TY - JOUR
AU1 - Wu,, Lianzhi
AU2 - Cheng,, Biheng
AU3 - Liu,, Qian
AU4 - Jiang,, Ping
AU5 - Yang,, Jing
AB - Abstract Disruption of circadian rhythms is associated with aberrant trophoblast migration and invasion in recurrent spontaneous abortion (RSA). This study aims to explore the functional role and the mechanisms of cryptochrome 2 (CRY2), a fundamental component of the circadian clock, in regulating trophoblast migration and invasion. Human extravillous trophoblast cell line HTR-8/SVneo was used as a cell model. Cell migration and invasion were examined using wound healing assay and Transwell assay, respectively. The mRNA and protein levels were determined using quantitative real-time polymerase chain reaction and western blot, respectively. Luciferase reporter assay and chromatin immunoprecipitation assay were performed to explore the interaction between c-Myc to the brain and muscle ARNT-like protein 1 (BMAL1) promoter. CRY2 was highly expressed in human villous specimens of RSA. Furthermore, CRY2 overexpression impaired migration and invasion in HTR-8/SVneo cells, whereas CRY2 knockdown yielded the opposite results. Mechanistically, c-Myc bound to the BMAL1 promoter and induced BMAL1 transcription, both of which further activated matrix metalloproteinase 2/9 (MMP2/9) and facilitated migration and invasion in HTR-8/SVneo cells. CRY2 inhibited c-Myc-BMAL1 pathway and impaired migration and invasion of HTR-8/SVneo cells. Collectively, these findings demonstrate that CRY2 suppresses trophoblast migration and invasion via inhibiting c-Myc-BMAL1-MMP2/9 pathway. BMAL1, c-Myc, CRY2, recurrent spontaneous abortion, trophoblast Recurrent spontaneous abortion (RSA) is defined as three or more spontaneous abortions prior to 20 weeks gestation affecting about 2–4% of reproductive-age couples (1). The aetiology of RSA still remains incompletely understood. Trophoblast cells are the most important cells in early pregnancy and their proliferation, migration and invasion are essential to the establishment and maintenance of a successful pregnancy. Defects in trophoblast cell function lead to impaired uterine spiral artery rebuilding and are involved in pregnancy-related complications including RSA (2). In recent years, the role of circadian rhythms in fertility has received increasing attention (3). Female reproductive function is under strict circadian control at every level of the hypothalamic–pituitary–gonadal axis (4). The interruption of circadian rhythm caused by shift work or jet lag is related to reproductive dysfunction in women, including irregular menstrual cycles, an increased risk of pre-term birth and overall reduced fecundity (5–7). Cryptochrome 2 (CRY2) plays a critical role in regulating the clock gene network. This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. Convincing evidence has underscored the important roles of CRY2 in various diseases such as depression (8), colon cancer (9), kidney cancer (10) and breast cancer (11). However, the role of CRY2 in RSA has not been elaborated. Brain and muscle ARNT-like protein 1 (BMAL1) is one of the circadian clock genes and facilitates migration and invasion of trophoblasts through inducing SP1-DNMT1/DAB2IP pathway (3). In addition, c-Myc (also sometimes referred to as Myc) is a well-known oncogene and has been shown to promote trophoblast cell invasion (12). Recent data in osteosarcoma cells demonstrated that CRY2 can negatively regulate expression of c-Myc and clock genes including BMAL1 (13). In this study, we attempted to certify the role of CRY2 in regulating trophoblast cell function and to validate whether the underlying mechanisms were associated with its regulation of c-Myc and BMAL1. Materials and Methods Clinical specimens Villous specimens were collected from patients with unexplained RSA (n = 3), patients with missed abortion (n = 4) and women undergoing induced abortion with nonmedical causes (n = 4). All operations were performed between 9:00 and 11:00 a.m. The exclusion criteria were as follows: parental chromosomal, hormonal, autoimmune, anatomic and infectious causes, diabetes, hypertension and thyroid abnormalities. All participants provided written informed consent in accordance with the Declaration of Helsinki. This study was approved by the Research Ethics Committee of the Renmin Hospital of Wuhan University. Cell culture The immortalized human extravillous trophoblast cell line HTR-8/SVneo was purchased from American Type Culture Collection (ATCC, Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM)/F-12 medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% faetal bovine serum (FBS; Gibco) in a humidified air containing 5% CO2 at 37°C. Cell proliferation assay Cell proliferation was measured by the MTT assay. In brief, cells were harvested for 48 h after transfection and then plated into 96-well plates at a density of 1 × 104 cells per well. After 24 h of incubation, 20 μl MTT (5 mg/ml; Sigma-Aldrich, St. Louis, MO, USA) was added into each well for 4 h of incubation at 37°C. Then the supernatant was discarded carefully and 150 μl dimethyl sulfoxide (DMSO) (Sigma-Aldrich) per well was added to dissolve the formazan product for 10 min. The optical density at 490 nm was measured by a spectrophotometer (Multiskan MK3, Thermo, Waltham, MA, USA) to determine cellular viability. Migration assay Wound healing assay was performed to evaluate the cell migratory capacity of HTR-8/SVneo cells, as previously described (14). In brief, cells were cultured to reach 85–90% confluence. A wound of ∼1-mm width was made by manually scraping the monolayer in the middle of the each well with a 10-µl pipette tip. The migration distance was observed and photographed under an inverted microscope at the 0, 24 and 48 h after scratching. IPP7.0 software was used to calculate the cell-free area at each time point, which was compared with that at the 0 h to calculate the migration rate. Matrigel-based invasion assay A total of 100-µl cell suspension in serum-free medium (1 × 105 cells/ml) was seeded into the upper chamber of cell culture inserts (24-well, 8-μm pore size; BD Biosciences, San Jose, CA, USA) pre-coated with Matrigel (BD Biosciences) membrane. A total of 600 µl Roswell Park Memorial Institute (RPMI)-1640 medium containing 10% FBS was added to the lower chamber as chemo-attractant. After 24 h of incubation at 37°C, cells that had invaded across the membrane were stained with 0.1% crystal violet for 20 min at room temperature. The numbers of invasive cells were observed under a microscope (Nikon E100; Nikon Corp., Japan) and counted and averaged from five randomly selected fields. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was extracted from the above-treated cells and villous specimens using TRIzol reagent (Invitrogen; Thermo Fisher Scientific) and was reverse transcribed into cDNAs using the PrimeScript RT Master Mix Perfect Real-Time kit (TaKaRa, Dalian, China). qRT-PCR was then performed to amplify the cDNA template using SYBR Premix Dimmer Eraser kit (TaKaRa) by the ABI7900 system (Applied Biosystem, Foster City, CA, USA). The mRNA levels of candidate genes (CRY2, c-Myc, BMAL1, MMP2 and MMP9) were calculated by the 2−ΔΔCt method and normalized to the internal control β-actin. The specific primer sequences were introduced as previously published (3, 15). The primer sequences used of targeting genes were as listed in Table I. Table I. Primers used for qRT-PCR analysis Primer name . Sequence (5′–3′) . CRY2-F CTCCTCCAATGTGGGCATCAA CRY2-R CCACGAATCACAAACAGACGG c-Myc-F ACAGCTACGGAACTCTTGTGCGTA c-Myc-R GCCCAAAGTCCAATTTGAGGCAGT BMAL1-F TGCAAGGGAAGCTCACAGTC BMAL1-R GATTGGTGGCACCTCTTAATG MMP2-F GATACCCCTTTGACGGTAAGGA MMP2-R CCTTCTCCCAAGGTCCATAGC MMP9-F AGACCTGGGCAGATTCCAAAC MMP9-R CGGCAAGTCTTCCGAGTAGT β-Actin-F GGGAAATCGTGCGTGACATTAAG β-Actin-R TGTGTTGGCGTACAGGTCTTTG Primer name . Sequence (5′–3′) . CRY2-F CTCCTCCAATGTGGGCATCAA CRY2-R CCACGAATCACAAACAGACGG c-Myc-F ACAGCTACGGAACTCTTGTGCGTA c-Myc-R GCCCAAAGTCCAATTTGAGGCAGT BMAL1-F TGCAAGGGAAGCTCACAGTC BMAL1-R GATTGGTGGCACCTCTTAATG MMP2-F GATACCCCTTTGACGGTAAGGA MMP2-R CCTTCTCCCAAGGTCCATAGC MMP9-F AGACCTGGGCAGATTCCAAAC MMP9-R CGGCAAGTCTTCCGAGTAGT β-Actin-F GGGAAATCGTGCGTGACATTAAG β-Actin-R TGTGTTGGCGTACAGGTCTTTG Open in new tab Table I. Primers used for qRT-PCR analysis Primer name . Sequence (5′–3′) . CRY2-F CTCCTCCAATGTGGGCATCAA CRY2-R CCACGAATCACAAACAGACGG c-Myc-F ACAGCTACGGAACTCTTGTGCGTA c-Myc-R GCCCAAAGTCCAATTTGAGGCAGT BMAL1-F TGCAAGGGAAGCTCACAGTC BMAL1-R GATTGGTGGCACCTCTTAATG MMP2-F GATACCCCTTTGACGGTAAGGA MMP2-R CCTTCTCCCAAGGTCCATAGC MMP9-F AGACCTGGGCAGATTCCAAAC MMP9-R CGGCAAGTCTTCCGAGTAGT β-Actin-F GGGAAATCGTGCGTGACATTAAG β-Actin-R TGTGTTGGCGTACAGGTCTTTG Primer name . Sequence (5′–3′) . CRY2-F CTCCTCCAATGTGGGCATCAA CRY2-R CCACGAATCACAAACAGACGG c-Myc-F ACAGCTACGGAACTCTTGTGCGTA c-Myc-R GCCCAAAGTCCAATTTGAGGCAGT BMAL1-F TGCAAGGGAAGCTCACAGTC BMAL1-R GATTGGTGGCACCTCTTAATG MMP2-F GATACCCCTTTGACGGTAAGGA MMP2-R CCTTCTCCCAAGGTCCATAGC MMP9-F AGACCTGGGCAGATTCCAAAC MMP9-R CGGCAAGTCTTCCGAGTAGT β-Actin-F GGGAAATCGTGCGTGACATTAAG β-Actin-R TGTGTTGGCGTACAGGTCTTTG Open in new tab Western blot The cell lysates were extracted using the radioimmunoprecipitation assay lysis buffer (Beyotime, Shanghai, China) and quantified using the BCA Protein Assay Kit (Beyotime). Forty micrograms of protein was loaded per lane and separated with 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes. Subsequently, the membranes were incubated overnight at 4°C with primary antibodies against c-Myc, BMAL1, matrix metalloproteinase (MMP) 2 and MMP 9 (1:1000, Santa Cruz Biotechnology, Dallas, TX, USA), followed by incubation with the horseradish peroxidase-conjugated secondary antibodies (1:2000; Santa Cruz Biotechnology) at room temperature for 2 h. Blots were examined by an Enhanced Chemiluminescence Detection kit (Pierce Biotechnology, Rockford, IL, USA). The band intensity was analysed by Quantity One software. Plasmids, siRNAs and cell transfection The full-length fragments of CRY2, c-Myc and BMAL1 were cloned into the pcDNA 3.1 plasmid (Invitrogen) to overexpress CRY2, c-Myc and BMAL1. An empty pcDNA3.1 vector was used as the control. The siRNAs targeting CRY2 and c-Myc (namely si-CRY2 and si-c-Myc, respectively) and si-Ctrl were designed and synthesized (GenePharma, Shanghai, China) to knock down CRY2 and c-Myc. HTR-8/SVneo cells were transfected with these plasmids and siRNAs using Lipofectamine® 3000 (Invitrogen) according to the manufacturer’s instructions. Luciferase reporter assay C-Myc-mediated BMAL1 transcriptional activity was assessed using luciferase reporter assay. Briefly, BMAL1 promoter sequence was amplified by PCR using the human genomic DNA and cloned into pGL4.70 reporter vector (Promega, Madison, WI, USA), generating the BMAL1 reporter plasmid (pGL4.70-BMAL1). A full-length human c-Myc cDNA was amplified by PCR and cloned into pcDNA3.1 vector, generating c-Myc expression plasmid (pcDNA3.1-c-Myc). HTR-8/SVneo cells were transiently co-transfected with pGL4.70-BMAL1 and pcDNA3.1-c-Myc or empty pcDNA3.1 vector, or si-c-Myc, or si-Ctrl using Superfect Transfection Reagent (Qiagen, Hamburg, Germany). At 24 h post-transfection, lysates were prepared and the luciferase activity was measured using a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. Luciferase activity was normalized using the Renilla luciferase activity. Chromatin immunoprecipitation (ChIP) assay ChIP assay was performed to analyse the binding of c-Myc to the BMAL1 promoter using SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Danvers, MA, USA). Briefly, HTR-8/SVneo cells were cross-linked with 1% formaldehyde, harvested and then re-suspended in lysis buffer. Nuclei were pelleted and digested by micrococcal nuclease. Following sonication and centrifugation, sheared chromatin was incubated overnight at 4°C with anti-c-Myc (Santa Cruz Biotechnology) or normal serum IgG as a negative control. DNA was purified using the QIAquick PCR Purification Kit (Qiagen) and the BMAL1 promoter was amplified by qRT-PCR. Statistical analysis All statistical analyses were performed using GraphPad Prism 7.0. The data are presented as the mean ± standard deviation (SD). The unpaired Student’s t-test was used to analyse differences between two groups. One-way ANOVA was used to analyse differences among multiple groups. Experiments were performed in triplicate. Significance was set at P < 0.05. Results CRY2 was highly expressed in villous specimens from RSA patients We initially detected CRY2 expression in human villous specimens of RSA and observed a significantly higher CRY2 expression in villous specimens from RSA patients relative to both villous specimens of missed abortion and normal villous specimens (Fig. 1). Fig. 1 Open in new tabDownload slide CRY2 was highly expressed in villous specimens from RSA patients. CRY2 mRNA expression in villous specimens was examined by qRT-PCR. Normal villous (n = 4), missed abortion (n = 4), recurrent spontaneous abortion (RSA, n = 3). **P < 0.01 versus normal villous or missed abortion. Fig. 1 Open in new tabDownload slide CRY2 was highly expressed in villous specimens from RSA patients. CRY2 mRNA expression in villous specimens was examined by qRT-PCR. Normal villous (n = 4), missed abortion (n = 4), recurrent spontaneous abortion (RSA, n = 3). **P < 0.01 versus normal villous or missed abortion. CRY2 knockdown facilitated, whereas CRY2 overexpression impaired migration and invasion in HTR-8/SVneo cells Next, we sought to assess the functional role of CRY2 in regulating cell behaviours of HTR-8/SVneo, which is widely used as a model for testing the invasion and migration of first-trimester extravillous trophoblasts. To address this, we knocked down CRY2 in HTR-8/SVneo cells, which was confirmed by qRT-PCR analysis (Fig. 2A). Data revealed that CRY2 knockdown had no obvious effect on cell proliferation (Fig. 2B). Intriguingly, wound healing assay results indicated that the migration ability of HTR-8/SVneo cells to close the wound was facilitated following CRY2 knockdown (Fig. 2C). Furthermore, Transwell invasion assay demonstrated that the number of invaded cells following CRY2 knockdown was significantly increased (Fig. 2D). Fig. 2 Open in new tabDownload slide CRY2 knockdown promoted migration and invasion in HTR-8/SVneo cells. (A) CRY2 mRNA levels in HTR-8/SVneo cells transfected with si-Ctrl and si-CRY2 were examined by qRT-PCR. (B) Cell proliferation after CRY2 knockdown was measured by the MTT assay. (C) Wound healing assay after CRY2 knockdown at the 0, 24, 48 h after scratching. (D) Transwell invasion assay after CRY2 knockdown. **P < 0.01 versus si-Ctrl. Data were expressed as mean ± SD (n = 3). Fig. 2 Open in new tabDownload slide CRY2 knockdown promoted migration and invasion in HTR-8/SVneo cells. (A) CRY2 mRNA levels in HTR-8/SVneo cells transfected with si-Ctrl and si-CRY2 were examined by qRT-PCR. (B) Cell proliferation after CRY2 knockdown was measured by the MTT assay. (C) Wound healing assay after CRY2 knockdown at the 0, 24, 48 h after scratching. (D) Transwell invasion assay after CRY2 knockdown. **P < 0.01 versus si-Ctrl. Data were expressed as mean ± SD (n = 3). We then overexpressed CRY2 in HTR-8/SVneo cells, and qRT-PCR analysis confirmed that CRY2 level in CRY2-overexpressing cells was markedly higher than that in cells transfected with the control vector (Fig. 3A). No significant changes were observed in cell proliferation when CRY2 was overexpressed (Fig. 3B). However, CRY2 overexpression notably impaired cell migration (Fig. 3C) and invasion (Fig. 3D) in HTR-8/SVneo cells. Thus, these data indicated that CRY2 impaired migration and invasion of trophoblasts. Fig. 3 Open in new tabDownload slide CRY2 overexpression impaired migration and invasion in HTR-8/SVneo cells. (A) CRY2 mRNA levels in HTR-8/SVneo cells transfected with CRY2 overexpressing vector (CRY2) and control vector (Ctrl) were examined by qRT-PCR. (B) Cell proliferation after CRY2 overexpression was measured by the MTT assay. (C) Wound healing assay after CRY2 overexpression at the 0, 24, 48 h after scratching. (D) Transwell invasion assay after CRY2 overexpression. **P < 0.01 versus Ctrl. Data were expressed as mean ± SD (n = 3). Fig. 3 Open in new tabDownload slide CRY2 overexpression impaired migration and invasion in HTR-8/SVneo cells. (A) CRY2 mRNA levels in HTR-8/SVneo cells transfected with CRY2 overexpressing vector (CRY2) and control vector (Ctrl) were examined by qRT-PCR. (B) Cell proliferation after CRY2 overexpression was measured by the MTT assay. (C) Wound healing assay after CRY2 overexpression at the 0, 24, 48 h after scratching. (D) Transwell invasion assay after CRY2 overexpression. **P < 0.01 versus Ctrl. Data were expressed as mean ± SD (n = 3). CRY2 inhibited expression of c-Myc and BMAL1 in HTR-8/SVneo cells Evidence indicates that CRY2 knockdown increases expression of c-Myc and BMAL1 in osteosarcoma cells (13). Myc downregulation mediated by miRNA-34a suppresses the invasiveness of trophoblasts (12). Furthermore, BMAL1 facilitates migration and invasion in HTR-8/SVneo cells (3). Therefore, we attempted to verify the regulation of c-Myc and BMAL1 expression by CRY2 in HTR-8/SVneo cells and to explore whether this regulation was involved in the CRY2-mediated modulation of cell behaviours. Data demonstrated that CRY2 overexpression notably decreased expression of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells, at both mRNA (Fig. 4A) and protein (Fig. 4B) levels. On the contrary, CRY2 knockdown led to a marked increase in both mRNA (Fig. 4C) and protein (Fig. 4D) levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells. MMP2 and MMP9 play an important role in regulating trophoblast migration and invasion. The expression tendency of these two MMPs was in accord with the changes in migration and invasion ability of HTR-8/SVneo cells following CRY2 overexpression and knockdown. Fig. 4 Open in new tabDownload slide Effect of CRY2 overexpression and knockdown on expression of c-Myc, BMAL1 and MMP2/9. (A) qRT-PCR analysis of mRNA levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with CRY2 overexpressing vector (CRY2) and control vector (Ctrl). (B) Western blot analysis of protein levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with CRY2 and Ctrl. (C) qRT-PCR analysis of mRNA levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with si-CRY2 and si-Ctrl. (D) Western blot analysis of protein levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with si-CRY2 and si-Ctrl. *P < 0.05, **P < 0.01 versus Ctrl. #P < 0.05, ##P < 0.01 versus si-Ctrl. Data were expressed as mean ± SD (n = 3). Fig. 4 Open in new tabDownload slide Effect of CRY2 overexpression and knockdown on expression of c-Myc, BMAL1 and MMP2/9. (A) qRT-PCR analysis of mRNA levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with CRY2 overexpressing vector (CRY2) and control vector (Ctrl). (B) Western blot analysis of protein levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with CRY2 and Ctrl. (C) qRT-PCR analysis of mRNA levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with si-CRY2 and si-Ctrl. (D) Western blot analysis of protein levels of c-Myc, BMAL1 and MMP2/9 in HTR-8/SVneo cells transfected with si-CRY2 and si-Ctrl. *P < 0.05, **P < 0.01 versus Ctrl. #P < 0.05, ##P < 0.01 versus si-Ctrl. Data were expressed as mean ± SD (n = 3). c-Myc bound to the BMAL1 promoter and induced BMAL1 transcription Next, we examined the regulation of BMAL1 expression by c-Myc and found that c-Myc overexpression caused an obvious increase in expression of c-Myc and BMAL1 in HTR-8/SVneo cells, at both mRNA (Fig. 5A) and protein (Fig. 5B) levels. In contrast, c-Myc knockdown significantly decreased both mRNA (Fig. 5C) and protein (Fig. 5D) levels of c-Myc and BMAL1 in HTR-8/SVneo cells. Fig. 5 Open in new tabDownload slide c-Myc bound directly to the BMAL1 promoter and induced BMAL1 transcription. (A) Effect of c-Myc overexpression on BMAL1 mRNA levels in HTR-8/SVneo cells. (B) Effect of c-Myc overexpression on BMAL1 protein levels in HTR-8/SVneo cells. (C) Effect of c-Myc knockdown on BMAL1 mRNA levels in HTR-8/SVneo cells. (D) Effect of c-Myc knockdown on BMAL1 protein levels in HTR-8/SVneo cells. (E) Luciferase activity in HTR-8/SVneo cells co-transfected with pGL4.70-BMAL1 and pcDNA3.1-c-Myc or empty pcDNA3.1 vector. (F) Luciferase activity in HTR-8/SVneo cells co-transfected with pGL4.70-BMAL1 and si-c-Myc or si-Ctrl. (G) CHIP analysis confirmed the binding of c-Myc to the BMAL1 promoter. **P < 0.01 versus Ctrl. #P < 0.05, ##P < 0.01 versus si-Ctrl. $$P < 0.01 versus IgG. Data were expressed as mean ± SD (n = 3). Fig. 5 Open in new tabDownload slide c-Myc bound directly to the BMAL1 promoter and induced BMAL1 transcription. (A) Effect of c-Myc overexpression on BMAL1 mRNA levels in HTR-8/SVneo cells. (B) Effect of c-Myc overexpression on BMAL1 protein levels in HTR-8/SVneo cells. (C) Effect of c-Myc knockdown on BMAL1 mRNA levels in HTR-8/SVneo cells. (D) Effect of c-Myc knockdown on BMAL1 protein levels in HTR-8/SVneo cells. (E) Luciferase activity in HTR-8/SVneo cells co-transfected with pGL4.70-BMAL1 and pcDNA3.1-c-Myc or empty pcDNA3.1 vector. (F) Luciferase activity in HTR-8/SVneo cells co-transfected with pGL4.70-BMAL1 and si-c-Myc or si-Ctrl. (G) CHIP analysis confirmed the binding of c-Myc to the BMAL1 promoter. **P < 0.01 versus Ctrl. #P < 0.05, ##P < 0.01 versus si-Ctrl. $$P < 0.01 versus IgG. Data were expressed as mean ± SD (n = 3). To explore the mechanism by which c-Myc induces BMAL1 expression, we used a bioinformatics approach to predict transcription factor-binding sites in the BMAL1 promoter region and found binding sites for c-Myc at −1166 to −1155 (agccccgccccc) upstream of the transcriptional start site in the BMAL1 promoter region. A dual-luciferase reporter gene assay revealed a notably increased luciferase signal in cells transfected with pcDNA3.1-c-Myc (Fig. 5E) and an obviously decreased luciferase signal in cells transfected with the si-c-Myc (Fig. 5F). To corroborate this result in HTR-8/SVneo cells, we performed ChIP-qRT-PCR assay, which showed enrichment of c-Myc at the BMAL1 promoter region (Fig. 5G), verifying the binding of c-Myc to the BMAL1 promoter. CRY2 impaired migration and invasion in HTR-8/SVneo cells via negatively regulating c-Myc and BMAL1 To clarify whether CRY2 impaired migration and invasion in HTR-8/SVneo cells via negatively regulating c-Myc and BMAL1, we performed rescue experiments. Contrary to CRY2 overexpression, c-Myc overexpression obviously increased mRNA (Fig. 6A) and protein (Fig. 6B) levels of BMAL1 and MMP2/9, and facilitated cell migration (Fig. 6C) and invasion (Fig. 6D) in HTR-8/SVneo cells. Importantly, c-Myc overexpression partially rescued the CRY2 overexpression-mediated decrease in mRNA (Fig. 6A) and protein (Fig. 6B) levels of BMAL1 and MMP2/9 and impairment of cell migration (Fig. 6C) and invasion (Fig. 6D) in HTR-8/SVneo cells. Similarly, BMAL1 overexpression effectively abrogated the CRY2 overexpression-mediated decrease in mRNA (Fig. 7A) and protein (Fig. 7B) levels of BMAL1 and MMP2/9 and impairment of cell migration (Fig. 7C) and invasion (Fig. 7D) in HTR-8/SVneo cells. Fig. 6 Open in new tabDownload slide CRY2 impaired migration and invasion in HTR-8/SVneo cells via negatively regulating c-Myc. HTR-8/SVneo cells were transfected with CRY2 overexpressing vector (CRY2), c-Myc overexpressing vector (c-Myc), both alone and in combination. The mRNA (A) and protein (B) levels of BMAL1 and MMP2/9 in HTR-8/SVneo cells were examined by qRT-PCR and western blot, respectively. (C) Wound healing assay at the 0, 24, 48 h after scratching. (D) Transwell invasion assay. *P < 0.05, **P < 0.01 versus Ctrl. $P < 0.05, $$P < 0.01 versus CRY2. Data were expressed as mean ± SD (n = 3). Fig. 6 Open in new tabDownload slide CRY2 impaired migration and invasion in HTR-8/SVneo cells via negatively regulating c-Myc. HTR-8/SVneo cells were transfected with CRY2 overexpressing vector (CRY2), c-Myc overexpressing vector (c-Myc), both alone and in combination. The mRNA (A) and protein (B) levels of BMAL1 and MMP2/9 in HTR-8/SVneo cells were examined by qRT-PCR and western blot, respectively. (C) Wound healing assay at the 0, 24, 48 h after scratching. (D) Transwell invasion assay. *P < 0.05, **P < 0.01 versus Ctrl. $P < 0.05, $$P < 0.01 versus CRY2. Data were expressed as mean ± SD (n = 3). Fig. 7 Open in new tabDownload slide CRY2 impaired migration and invasion in HTR-8/SVneo cells via negatively regulating BMAL1. HTR-8/SVneo cells were transfected with CRY2 overexpressing vector (CRY2), BMAL1 overexpressing vector (BMAL1), both alone and in combination. The mRNA (A) and protein (B) levels of BMAL1 and MMP2/9 in HTR-8/SVneo cells were examined by qRT-PCR and western blot, respectively. (C) Wound healing assay at the 0, 24, 48 h after scratching. (D) Transwell invasion assay. *P < 0.05, **P < 0.01 versus Ctrl. $P < 0.05, $$P < 0.01 versus BMAL1. Data were expressed as mean ± SD (n = 3). Fig. 7 Open in new tabDownload slide CRY2 impaired migration and invasion in HTR-8/SVneo cells via negatively regulating BMAL1. HTR-8/SVneo cells were transfected with CRY2 overexpressing vector (CRY2), BMAL1 overexpressing vector (BMAL1), both alone and in combination. The mRNA (A) and protein (B) levels of BMAL1 and MMP2/9 in HTR-8/SVneo cells were examined by qRT-PCR and western blot, respectively. (C) Wound healing assay at the 0, 24, 48 h after scratching. (D) Transwell invasion assay. *P < 0.05, **P < 0.01 versus Ctrl. $P < 0.05, $$P < 0.01 versus BMAL1. Data were expressed as mean ± SD (n = 3). Discussion Trophoblast cells play an important role in the establishment of early pregnancy. Only when the trophoblasts invade into the uterus decidua can a successful pregnancy be established (16). Inadequate migration and invasion of trophoblast cells result in impaired uterine spiral artery rebuilding and are implicated in RSA (2). Trophoblasts invasion is mediated by various signalling pathways. Recent studies have highlighted the role of circadian rhythms in female reproductive physiology such as ovulation, implantation and the maintenance of pregnancy (17). As reported, deregulation of circadian rhythms is associated with impaired trophoblast migration and invasion in RSA (3). CRY2 is a core component of the circadian clock that is essential for maintenance of circadian rhythms. CRY2 plays a critical role in DNA damage checkpoint control and regulating important cell cycle progression genes (18). In addition to depression (8), CRY2 has a complex function in development of several cancers, such as colon cancer (9), kidney cancer (10) and breast cancer (11). In our study, we observed increased abundance of CRY2 in the villous specimens from RSA patients compared with that of women undergoing induced abortion. Furthermore, CRY2 overexpression impaired migration and invasion in HTR-8/SVneo cells, whereas CRY2 knockdown yielded the opposite results. These findings provided evidence implicating the essential role of CRY2 in RSA. The circadian clock gene BMAL1 is crucial for fertility (19, 20) and shares a potentially close association with miscarriage (21). Recent evidence on RSA has confirmed that BMAL1 is lowly expressed in human villous specimens of RSA and facilitates cell migration and invasion through inducing SP1-DNMT1/DAB2IP-MMP2/9 pathway in HTR-8/SVneo cells (3). Consistent with this, our results showed that BMAL1 overexpression induced MMP2/9 expression and promoted cell migration and invasion in HTR-8/SVneo cells. More importantly, the CRY2 overexpression-mediated inhibition of BMAL1 and MMP2/9 expression, cell migration and cell invasion could be apparently rescued by BMAL1 overexpression. Together, these data indicated that CRY2 impaired trophoblast migration and invasion via suppressing BMAL1-MMP2/9 pathway. It has been reported that c-Myc promotes trophoblast cell invasion (12). Recent data in osteosarcoma cells demonstrated that CRY2 negatively regulates c-Myc expression (13). In addition, CRY2 promotes c-Myc ubiquitination and degradation in conjunction with FBXL3 (22). In line with this, we observed a significant decrease in c-Myc expression following CRY2 overexpression and an increase following CRY2 knockdown. Furthermore, using bioinformatics analysis, luciferase reporter assay and ChIP assay, we confirmed the binding of c-Myc to the BMAL1 promoter. Our further experiments verified the positive regulation of BMAL1 expression by c-Myc. These data indicated that CRY2 acted as a negative regulator of c-Myc that induced BMAL1 transcription. Of note, we also found that c-Myc overexpression effectively abrogated the CRY2 overexpression-mediated inhibition of BMAL1 and MMP2/9 expression, cell migration and cell invasion, which further suggested that CRY2 impaired trophoblast migration and invasion via suppressing c-Myc-BMAL1-MMP2/9 pathway. Conclusion In summary, c-Myc binds to the BMAL1 promoter and induces BMAL1 transcription, both of which further activates MMP2/9 expression and then facilitates migration and invasion in HTR-8/SVneo cells. CRY2 functions as a negative upstream regulator of c-Myc-BMAL1-MMP2/9 pathway, and thereby impairs migration and invasion in HTR-8/SVneo cells. These data demonstrate that upregulated CRY2 may play a role in the pathogenesis and progression of RSA. Conflict of interest None declared. References 1 Kaur R. , Gupta K. ( 2016 ) Endocrine dysfunction and recurrent spontaneous abortion: an overview . Int. J. Appl. Basic Med. Res. 6 , 79 – 83 Google Scholar Crossref Search ADS PubMed WorldCat 2 Zong S. , Li C. , Luo C. , Zhao X. , Liu C. , Wang K. , Jia W. , Bai M. , Yin M. , Bao S. , Guo J. , Kang J. , Duan T. , Zhou Q. ( 2016 ) Dysregulated expression of IDO may cause unexplained recurrent spontaneous abortion through suppression of trophoblast cell proliferation and migration . Sci. Rep . 6 , 19916 Google Scholar Crossref Search ADS PubMed WorldCat 3 Li S. , Zhai J. , Liu J. , Hong Y. , Zhao W. , Zhao A. , Sun K. , Du Y. , Chen Z.J. ( 2017 ) BMAL1 facilitates trophoblast migration and invasion via SP1-DNMT1/DAB2IP pathway in recurrent spontaneous abortion . Oncotarget 8 , 89451 – 89464 Google Scholar PubMed OpenURL Placeholder Text WorldCat 4 Miller B.H. , Takahashi J.S. ( 2013 ) Central circadian control of female reproductive function . Front. Endocrinol. 4 , 195 OpenURL Placeholder Text WorldCat 5 Lawson C.C. , Whelan E.A. , Lividoti Hibert E.N. , Spiegelman D. , Schernhammer E.S. , Rich-Edwards J.W. ( 2011 ) Rotating shift work and menstrual cycle characteristics . Epidemiology 22 , 305 – 312 Google Scholar Crossref Search ADS PubMed WorldCat 6 Amaral F.G. , Castrucci A.M. , Cipolla-Neto J. , Poletini M.O. , Mendez N. , Richter H.G. , Sellix M.T. ( 2014 ) Environmental control of biological rhythms: effects on development, fertility and metabolism . J. Neuroendocrinol. 26 , 603 – 612 Google Scholar Crossref Search ADS PubMed WorldCat 7 Li R. , Cheng S. , Wang Z. ( 2015 ) Circadian clock gene plays a key role on ovarian cycle and spontaneous abortion . Cell. Physiol. Biochem. 37 , 911 – 920 Google Scholar Crossref Search ADS PubMed WorldCat 8 Lavebratt C. , Sjöholm L.K. , Soronen P. , Paunio T. , Vawter M.P. , Bunney W.E. , Adolfsson R. , Forsell Y. , Wu J.C. , Kelsoe J.R. , Partonen T. , Schalling M. ( 2010 ) CRY2 is associated with depression . PLoS One 5 , e9407 Google Scholar Crossref Search ADS PubMed WorldCat 9 Hasakova K. , Vician M. , Reis R. , Zeman M. , Herichova I. ( 2018 ) The expression of clock genes cry1 and cry2 in human colorectal cancer and tumor adjacent tissues correlates differently dependent on tumor location . Neoplasma 65 , 986 – 992 Google Scholar Crossref Search ADS PubMed WorldCat 10 Tetti M. , Castellano I. , Veneziano F. , Magnino C. , Veglio F. , Mulatero P. , Monticone S. ( 2018 ) Role of cryptochrome-1 and cryptochrome-2 in aldosterone-producing adenomas and adrenocortical cells . Int. J. Mol. Sci . 19 , 1675 Google Scholar Crossref Search ADS WorldCat 11 Liu L. , Shen H. , Wang Y. ( 2017 ) CRY2 is suppressed by FOXM1 mediated promoter hypermethylation in breast cancer . Biochem. Biophys. Res. Commun . 490 , 44 – 50 Google Scholar Crossref Search ADS PubMed WorldCat 12 Sun M. , Chen H. , Liu J. , Tong C. , Meng T. ( 2015 ) MicroRNA-34a inhibits human trophoblast cell invasion by targeting MYC . BMC Cell Biol. 16 , 21 Google Scholar Crossref Search ADS PubMed WorldCat 13 Yu Y. , Li Y. , Zhou L. , Yang G. , Wang M. , Hong Y. ( 2018 ) Cryptochrome 2 (CRY2) suppresses proliferation and migration and regulates clock gene network in osteosarcoma cells . Med. Sci. Monit. 24 , 3856 – 3862 Google Scholar Crossref Search ADS PubMed WorldCat 14 Miao H. , Wang N. , Shi L.X. , Wang Z. , Song W.B. ( 2019 ) Overexpression of mircoRNA-137 inhibits cervical cancer cell invasion, migration and epithelial-mesenchymal transition by suppressing the TGF-beta/smad pathway via binding to GREM1 . Cancer Cell Int. 19 , 147 Google Scholar Crossref Search ADS PubMed WorldCat 15 Shang Y. , Brown M. ( 2002 ) Molecular determinants for the tissue specificity of SERMs . Science 295 , 2465 – 2468 Google Scholar Crossref Search ADS PubMed WorldCat 16 Moser G. , Weiss G. , Sundl M. , Gauster M. , Siwetz M. , Lang-Olip I. , Huppertz B. ( 2017 ) Extravillous trophoblasts invade more than uterine arteries: evidence for the invasion of uterine veins . Histochem. Cell Biol. 147 , 353 – 366 Google Scholar Crossref Search ADS PubMed WorldCat 17 Kennaway D.J. , Boden M.J. , Varcoe T.J. ( 2012 ) Circadian rhythms and fertility . Mol. Cell. Endocrinol . 349 , 56 – 61 Google Scholar Crossref Search ADS PubMed WorldCat 18 Lee J.H. , Gaddameedhi S. , Ozturk N. , Ye R. , Sancar A. ( 2013 ) DNA damage-specific control of cell death by cryptochrome in p53-mutant ras-transformed cells . Cancer Res . 73 , 785 – 791 Google Scholar Crossref Search ADS PubMed WorldCat 19 Liu Y. , Johnson B.P. , Shen A.L. , Wallisser J.A. , Krentz K.J. , Moran S.M. , Sullivan R. , Glover E. , Parlow A.F. , Drinkwater N.R. , Schuler L.A. , Bradfield C.A. ( 2014 ) Loss of BMAL1 in ovarian steroidogenic cells results in implantation failure in female mice . Proc. Natl. Acad. Sci. USA 111 , 14295 – 14300 Google Scholar Crossref Search ADS WorldCat 20 Tonsfeldt K.J. , Schoeller E.L. , Brusman L.E. , Cui L.J. , Lee J. , Mellon P.L. ( 2019 ) The contribution of the circadian gene Bmal1 to female fertility and the generation of the preovulatory luteinizing hormone surge . J. Endocr. Soc . 3 , 716 – 733 Google Scholar Crossref Search ADS PubMed WorldCat 21 Kovanen L. , Saarikoski S.T. , Aromaa A. , Lonnqvist J. , Partonen T. ( 2010 ) ARNTL (BMAL1) and NPAS2 gene variants contribute to fertility and seasonality . PLoS One 5 , e10007 Google Scholar Crossref Search ADS PubMed WorldCat 22 Huber A.L. , Papp S.J. , Chan A.B. , Henriksson E. , Jordan S.D. , Kriebs A. , Nguyen M. , Wallace M. , Li Z. , Metallo C.M. , Lamia K.A. ( 2016 ) CRY2 and FBXL3 cooperatively degrade c-MYC . Mol. Cell 64 , 774 – 789 Google Scholar Crossref Search ADS PubMed WorldCat Abbreviations: Abbreviations: BMAL1 brain and muscle ARNT-like protein 1 ChIP , chromatin immunoprecipitation CRY2 cryptochrome 2 FBS faetal bovine serum MMP2/9 matrix metalloproteinase 2/9 qRT-PCR , quantitative real-time PCR RSA recurrent spontaneous abortion © The Author(s) 2019. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - CRY2 suppresses trophoblast migration and invasion in recurrent spontaneous abortion
JF - The Journal of Biochemistry
DO - 10.1093/jb/mvz076
DA - 2020-01-01
UR - https://www.deepdyve.com/lp/oxford-university-press/cry2-suppresses-trophoblast-migration-and-invasion-in-recurrent-ex0Y632zNW
SP - 79
VL - 167
IS - 1
DP - DeepDyve
ER -