TY - JOUR
AU - Fu,, Zhengwei
AB - Abstract Dibutyl phthalate (DBP), a kind of typical environmental pollutant, is widely used as plasticizers, and its neurotoxicity and developmental toxicity have been found in recent years. However, whether oral DBP exposure will affect the homeostasis of gut microbiota and its adverse response in liver of mammalians remain unclear. In the present study, 10-week experimental cycles of vehicle or DBP (0.1 and 1 mg/kg) were given to 6-week-old C57BL/6J mice by oral gavage. Our results revealed that the body weight of mice was increased after exposure to both low and high doses of DBP. The serum levels of hepatic triglyceride and total cholesterol were significantly increased in response to both doses of DBP. In addition, some pivotal genes related to lipogenesis were also increased in liver at the mRNA level. Evaluation of gut microbiota by 16S rRNA sequencing technology showed that 0.1 mg/kg DBP exposure significantly affected gut microbiota at the phylum and genus levels. Moreover, DBP exposure decreased mucus secretion and caused inflammation in the gut, leading to the impairment of intestinal barrier function. Exposure to DBP inhibited the expression of peroxisome proliferator-activated receptor-γ and activated the expression of nuclear factor kappa B. In addition, DBP exposure increased the level of lipopolysaccharide in serum, and increased the expression of toll-like receptor 4 and the levels of inflammatory cytokines, such as interleukin (IL)-1β, IL-6, and tumor necrosis factor alpha, in the liver. These results indicated that exposure to DBP disturbed the homeostasis of gut microbiota, induced hepatic lipid metabolism disorder, and caused liver inflammation in mice via the related gut–liver axis signaling pathways. dibutyl phthalate, gut microbiota, lipid metabolism, inflammation, gut–liver axis Introduction Phthalate acid ester (PAE) is a kind of chemical products, which are widely used in the manufacturing and processing of plastic products as plasticizers [1]. Plasticizers are used in all kinds of daily consumer products, such as a range of toys, pesticides, and plastic packaging materials [2]. Thus, in the past few decades, the risk that human exposure to phthalates’ toxic components in environment has increased dramatically due to the increasing use of phthalates [2]. Furthermore, microplastics (MPs) usually contain PAEs, which mainly include dibutyl phthalate (DBP) [3]. Because phthalates are not chemically bonded to polyvinyl chloride, they can leach out and enter the environment [4]. Subsequently, phthalates or their degradation products can enter the food chain of wild animals through the aquatic environment and affect host metabolic pathways [5–7], which gives evidence that DBP is a kind of typical environmental pollutants that exist in the environment [8]. In the past 20 years, DBP was still widely used as the main plasticizer in China, but it has been listed as a priority environmental pollutant by United States Environmental Protection Agency in recent years [9]. Previous studies have indicated that DBP exposure is harmful to human health in many aspects, mainly in developmental, reproductive toxicity [10], and neurotoxicity [11]. A previous study showed that DBP exposure can also affect female sexual maturation and male sperm quality in mice [12]. Furthermore, DBP can also damage immune cell function in humans [13]. In 2005, based on a research in rats, a lowest adverse effect level of 2 mg/kg body weight/day DBP was observed [14]. Then, the European Food Safety Authority recommended that the tolerable daily intake of DBP was 0.01 mg/kg body weight/day for humans [15]. In another study, the daily intake of DBP for the general population was recommended to be 0.007–0.01 mg/kg/day [16]. In addition, a previous study had revealed that women during pregnancy were found to be exposed to over 200 times more DBP than other populations, because they are prone to taking oral medications with DBP-incorporated enteric coats [17]. The lowest dose of DBP used in mice was 1 mg/kg body weight in a previous study [16]. Thus, to explore the minimum dose response of DBP exposure in the liver, we determined that 0.1 mg/kg was the low dose and 1 mg/kg was the high dose. In this study, we therefore explored whether DBP affects lipid metabolism and causes inflammation via disturbing the homeostasis of gut microbiota related with gut–liver axis in mice. Materials and Methods Animals and treatments Male C57BL/6J mice (6 weeks old; n = 24) were purchased from the China National Laboratory Animal Resource Center (Shanghai, China). All animals were maintained with a cycle of 12/12-h light/dark and housed in standard mouse cages. The body weight of each mouse in all groups was recorded every week. After a week of accommodation, all mice were weighed and randomly divided into three groups. Two groups (n = 8, per group) were exposed to DBP (Aladdin, Shanghai, China) at the doses of 0.1 and 1 mg/kg for the toxicological experiments, respectively. DBP was dissolved in corn oil and given to mice of the control, DBP-0.1, and DBP-1 groups at 0, 0.1, and 1 mg/kg/day respectively by oral gavage at 6 p.m. per day for a total of 10 weeks. In addition, for the sequencing analysis experiment of gut microbiota, two groups were exposed with or without DBP at a concentration of 0.1 mg/kg/day (n = 5). During the whole experiment cycle, the water and basic diet were always available. At the end of 10-week exposure, all mice were fasted for 8 h with free access to water before being sacrificed. Tissues, such as liver, colon, and cecal contents, were also quickly removed from mice and quickly frozen with liquid nitrogen. Blood samples were also collected to obtain serum. All samples were stored at − 80°C for further study. The experimental procedures were approved by the Committee of the Ethics of Animal of Zhejiang University of Technology. Serum and liver lipid biochemical analysis Blood was centrifugated at 7000 g for 7 min at 4°C to collect the plasma. To measure the levels of blood lipid, indexes of biochemical analysis were determined using commercial kits, including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP), according to the manufacturer’s instructions. To measure the content of the hepatic lipid, a small part of liver was randomly selected and homogenized with nine volumes of phosphate buffered saline (PBS). Then, the supernatant was collected by centrifuging at 3500 g for 5 min at 4°C. The concentration of protein was determined with a commercial enhanced BCA protein kit (Thermo Scientific, Waltham, USA). After that, hepatic TC, TG, LDL-C, and HDL-C were determined with commercial kits (Jiancheng Bioengineering Technology Company, Nanjing, China) according to the manufacturer’s instructions. Histopathological analysis A portion of the liver and colon tissue was excised and fixed in 4% formalin solution. Then, three samples from each group were cut into 5-μm sections and prepared for hematoxylin and eosin (H&E) staining. In addition, three colon tissue samples were also subject to Alcian Blue/periodic acid Schiff (AB-PAS) staining. The histopathological analysis were performed, and images were captured with a light microscope. Oil Red O staining The lipid accumulation of liver was determined by Oil Red O staining. In brief, the liver tissue from three mice that were randomly selected in each group was excised and fixed in 4% formalin solution. Then, they were cut into 5-μm sections, washed with 0.1 M PBS, and fixed with 4% paraformaldehyde for 20 min. Subsequently, they were stained with 0.5% Oil Red O (Sigma-Aldrich, St Louis, USA) solution for 1 h at room temperature. Then, each section was washed with PBS. After that, every section was photographed by using a light microscope and the results were quantified by using Image pro plus 6.0 software (National Institutes of Health, Bethesda, USA). Measurement of inflammatory cytokines in liver and plasma The liver samples were homogenized with nine volumes of pre-cold normal saline and centrifuged at 5000 g for 15 min at 4°C to collect supernatant for further analysis. The concentration of protein in each sample was measured by using an enhanced BCA protein assay kit (Thermo Scientific) according to the manufacturer’s protocols. Then, the levels of interleukin (IL)-6, IL-1β, and tumor necrosis factor alpha (TNF-α) in liver supernatant were measured using commercial enzyme-linked immunosorbent assay (ELISA) kits (Jiancheng Bioengineering Technology Company) according to the manufacturer’s instructions. The levels of hepatic mevalonate, high-mobility group-coenzyme A (HMG-CoA), acetyl-CoA, malonyl-CoA, saturated fatty acid (sat-FA), and unsaturated fatty acid (unsat-FA) were also measured using the corresponding commercial ELISA kits. The absorbance values were measured at 450 nm by using a microplate spectrophotometer (TECAN Spectrafluor plus; Tecan Group Ltd, Männedorf, Switzerland). The levels of inflammatory cytokines were calculated according to standard curves. In addition, the level of plasma lipopolysaccharide (LPS) from the portal vein of each mouse was also measured with a commercial ELISA kit. DNA extraction, qPCR amplification, and 16S rRNA sequencing analysis The analysis of bacterial communities of mice treated with DBP was performed by 16S rRNA gene sequencing with an Illumina MiSeq platform (San Diego, USA). In brief, total genomic DNA (gDNA) was isolated from cecal contents with a commercial QIAamp DNA Stool Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocols. Then, the relative abundance of gut microbiota at the phylum level was detected by quantitative polymerase chain reaction (qPCR) using the phylum-specific primers (Table1). Next, five gDNA samples were randomly selected from the control and DBP-0.1 groups for 16S rRNA sequencing analysis. Then, the V4-V5 region of 16S rRNA gene was amplified with universal primers (515F forward primer: 5ʹ-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA-3ʹ; 806R reverse primer: 5ʹ-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3ʹ). Next, agarose gel electrophoresis was used to verify the quality of extracted DNA. After that, to obtain effective tags, high-quality clean reads were filtered from the established database. Sequences that have 97% sequence identity were viewed as the same operational taxonomic units. Table 1. Sequence of primers used in the real-time quantitative PCR Type . Full name . Sequence (5′→3′) . Pyhlum Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT R: AGCTGACGACAACCATGCAG Pyhlum Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA R: AGCTGACGACAACCATGCAC Pyhlum a-Proteobacteria F: ACTCCTACGGGAGGCAGCAG R: TCTACGRATTTCACCYCTAC Pyhlum Verrucomicrobia F: GAATTCTCGGTGTAGCA R: GGCATTGTAGTACGTGTGCA Universal Bacteria F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG Type . Full name . Sequence (5′→3′) . Pyhlum Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT R: AGCTGACGACAACCATGCAG Pyhlum Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA R: AGCTGACGACAACCATGCAC Pyhlum a-Proteobacteria F: ACTCCTACGGGAGGCAGCAG R: TCTACGRATTTCACCYCTAC Pyhlum Verrucomicrobia F: GAATTCTCGGTGTAGCA R: GGCATTGTAGTACGTGTGCA Universal Bacteria F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG F, forward; R, reverse. Open in new tab Table 1. Sequence of primers used in the real-time quantitative PCR Type . Full name . Sequence (5′→3′) . Pyhlum Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT R: AGCTGACGACAACCATGCAG Pyhlum Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA R: AGCTGACGACAACCATGCAC Pyhlum a-Proteobacteria F: ACTCCTACGGGAGGCAGCAG R: TCTACGRATTTCACCYCTAC Pyhlum Verrucomicrobia F: GAATTCTCGGTGTAGCA R: GGCATTGTAGTACGTGTGCA Universal Bacteria F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG Type . Full name . Sequence (5′→3′) . Pyhlum Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT R: AGCTGACGACAACCATGCAG Pyhlum Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA R: AGCTGACGACAACCATGCAC Pyhlum a-Proteobacteria F: ACTCCTACGGGAGGCAGCAG R: TCTACGRATTTCACCYCTAC Pyhlum Verrucomicrobia F: GAATTCTCGGTGTAGCA R: GGCATTGTAGTACGTGTGCA Universal Bacteria F: ACTCCTACGGGAGGCAGCAG R: ATTACCGCGGCTGCTGG F, forward; R, reverse. Open in new tab Gene expression analysis Quantitative real-time PCR analysis was performed with total RNAs isolated from colon tissues of mice using Trizol reagent (Invitrogen, Carlsbad, USA). Then, the cDNA was extracted using the SYBR ExScript PCR kit (Toyobo, Tokyo, Japan) following the standard instructions and a MasterCycler RealPlex4 system (Eppendorf, Wesseling-Berzdorf, Germany). The primers of target genes used in our study were listed in Table2. Expression levels of genes were normalized to that of GAPDH. Relative expression levels were calculated using the 2-ΔΔCT method. Table 2. Sequence of primers used for quantitative real-time PCR Gene . Accession No. . Sequence (5′→3′) . Primer size (bp) . Amplicon size (bp) . GAPDH NM_007393.5 F: ATGGGACGATGCTGGTACTGA 21 112 R: TGCTGACAACCTTGAGTGAAAT 21 SREBP-1C NM_011480.4 F: ACACTTCTGGAGACATCGCA 20 219 R: CGGATGAGGTTCCAAAGCAG 20 SREBP-2 NM_033218.1 F: GCTGTGAGGATGAAGGCAAG 20 176 R: GCTTGGACCGTGGATTTACC 20 Fasn NM_007988.3 F: AAGTTGCCCGAGTCAGAGAA 20 212 R: TTCCAGACCGCTTGGGTAAT 20 Scd NM_009127.4 F: GGCTTCCAGATCCTCCCTAC 20 107 R: ACCCTCGCATTCAGTGGTTA 20 Acc NC_000077.6 F: ATGTCTGGCTTGCACCTAGT 20 153 R: ATCGCATGCATTTCACTGCT 20 Hmgcr NM_008255.2 F: GCAGCAGGACATCTTGTCAG 20 234 R: CGCTTCAGTTCAGTGTCAGG 20 Hmgcs1 NM_145942.5 F: CTGGCACAGTACTCACCTCA 20 247 R: GCCACACAAGTTCTCGAGTC 20 PPAR-γ NM_011144.6 F: GCGCAGCTCGTACAGGTCAT 20 236 R: GTGGGGAGAGCCCGCATTAC 20 Gene . Accession No. . Sequence (5′→3′) . Primer size (bp) . Amplicon size (bp) . GAPDH NM_007393.5 F: ATGGGACGATGCTGGTACTGA 21 112 R: TGCTGACAACCTTGAGTGAAAT 21 SREBP-1C NM_011480.4 F: ACACTTCTGGAGACATCGCA 20 219 R: CGGATGAGGTTCCAAAGCAG 20 SREBP-2 NM_033218.1 F: GCTGTGAGGATGAAGGCAAG 20 176 R: GCTTGGACCGTGGATTTACC 20 Fasn NM_007988.3 F: AAGTTGCCCGAGTCAGAGAA 20 212 R: TTCCAGACCGCTTGGGTAAT 20 Scd NM_009127.4 F: GGCTTCCAGATCCTCCCTAC 20 107 R: ACCCTCGCATTCAGTGGTTA 20 Acc NC_000077.6 F: ATGTCTGGCTTGCACCTAGT 20 153 R: ATCGCATGCATTTCACTGCT 20 Hmgcr NM_008255.2 F: GCAGCAGGACATCTTGTCAG 20 234 R: CGCTTCAGTTCAGTGTCAGG 20 Hmgcs1 NM_145942.5 F: CTGGCACAGTACTCACCTCA 20 247 R: GCCACACAAGTTCTCGAGTC 20 PPAR-γ NM_011144.6 F: GCGCAGCTCGTACAGGTCAT 20 236 R: GTGGGGAGAGCCCGCATTAC 20 F, forward; R, reverse. Open in new tab Table 2. Sequence of primers used for quantitative real-time PCR Gene . Accession No. . Sequence (5′→3′) . Primer size (bp) . Amplicon size (bp) . GAPDH NM_007393.5 F: ATGGGACGATGCTGGTACTGA 21 112 R: TGCTGACAACCTTGAGTGAAAT 21 SREBP-1C NM_011480.4 F: ACACTTCTGGAGACATCGCA 20 219 R: CGGATGAGGTTCCAAAGCAG 20 SREBP-2 NM_033218.1 F: GCTGTGAGGATGAAGGCAAG 20 176 R: GCTTGGACCGTGGATTTACC 20 Fasn NM_007988.3 F: AAGTTGCCCGAGTCAGAGAA 20 212 R: TTCCAGACCGCTTGGGTAAT 20 Scd NM_009127.4 F: GGCTTCCAGATCCTCCCTAC 20 107 R: ACCCTCGCATTCAGTGGTTA 20 Acc NC_000077.6 F: ATGTCTGGCTTGCACCTAGT 20 153 R: ATCGCATGCATTTCACTGCT 20 Hmgcr NM_008255.2 F: GCAGCAGGACATCTTGTCAG 20 234 R: CGCTTCAGTTCAGTGTCAGG 20 Hmgcs1 NM_145942.5 F: CTGGCACAGTACTCACCTCA 20 247 R: GCCACACAAGTTCTCGAGTC 20 PPAR-γ NM_011144.6 F: GCGCAGCTCGTACAGGTCAT 20 236 R: GTGGGGAGAGCCCGCATTAC 20 Gene . Accession No. . Sequence (5′→3′) . Primer size (bp) . Amplicon size (bp) . GAPDH NM_007393.5 F: ATGGGACGATGCTGGTACTGA 21 112 R: TGCTGACAACCTTGAGTGAAAT 21 SREBP-1C NM_011480.4 F: ACACTTCTGGAGACATCGCA 20 219 R: CGGATGAGGTTCCAAAGCAG 20 SREBP-2 NM_033218.1 F: GCTGTGAGGATGAAGGCAAG 20 176 R: GCTTGGACCGTGGATTTACC 20 Fasn NM_007988.3 F: AAGTTGCCCGAGTCAGAGAA 20 212 R: TTCCAGACCGCTTGGGTAAT 20 Scd NM_009127.4 F: GGCTTCCAGATCCTCCCTAC 20 107 R: ACCCTCGCATTCAGTGGTTA 20 Acc NC_000077.6 F: ATGTCTGGCTTGCACCTAGT 20 153 R: ATCGCATGCATTTCACTGCT 20 Hmgcr NM_008255.2 F: GCAGCAGGACATCTTGTCAG 20 234 R: CGCTTCAGTTCAGTGTCAGG 20 Hmgcs1 NM_145942.5 F: CTGGCACAGTACTCACCTCA 20 247 R: GCCACACAAGTTCTCGAGTC 20 PPAR-γ NM_011144.6 F: GCGCAGCTCGTACAGGTCAT 20 236 R: GTGGGGAGAGCCCGCATTAC 20 F, forward; R, reverse. Open in new tab Western blot analysis Liver and colon tissue samples were homogenized in 300 μl of 1 × RIPA with enzyme inhibitors (protease inhibitors and phosphatase inhibitors) to obtain suspension and centrifuged to collect supernatants. Then, the concentration of protein was determined by using an enhanced BCA protein assay kit (Thermo Scientific). Radioimmunoprecipitation assay buffer (RIPA) lysis buffer containing loading buffer (5 ×) was used to dilute the proteins to 3 μg/μl, then 8 µl of each sample was subject to western blot analysis. Proteins with equal amount were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred onto the polyvinylidene difluoride (PVDF) membranes. The membranes were blocked for 1 h with 2% bovine serum albumin in blocking buffer, and then incubated with primary antibodies against nuclear factor kappa B (NF-κB) (1:1000; Abcam, Cambridge, UK), Occludin (1:2000; Proteintech Group, Wuhan, China), toll-like receptor 4 (TLR4) (1:1000; ABclonal, Wuhan, China), Claudin1 (1:600; Proteintech Group), sterol regulatory element-binding protein-1C (SREBP-1C) (1:500; Bioss, Beijing, China), peroxisome proliferator-activated receptor (PPAR)-α (ab24509, 1:1000; Abcam), PPAR-γ (ab178860, 1:1000; Abcam), and β-actin (1:1500; MBL, Nagoya, Japan). Next, Tris-buffered saline with Tween (TBST) washing buffer was used to wash the PVDF membranes, and the membranes were incubated with the corresponding HRP-conjugated secondary antibodies (1:5000; Cell Signaling Technology, Beverly, USA) at room temperature for 1.5 h. Then, these blots were washed four times with TBST and successively visualized with an enhanced chemiluminescence system (Santa Cruz Biotechnology, Santa Cruz, USA). The results of western blots were quantitated with the ImageJ software (National Institutes of Health, Bethesda, USA). Statistical analysis All data were expressed as the mean ± SEM. Statistical analysis was performed by Student’s t-test using Graphpad Prism 7.0 software. The statistical significance was defined as P < 0.05 in all assays. Results Effects of DBP exposure on growth phenotypes As shown in Fig. 1, exposure of DBP affected the growth phenotypes of mice substantially. Throughout the entire period, compared with that in the control group, the body weight of DBP-treated groups was elevated in a dose-dependent manner, and the mice exposed to 1 mg/kg DBP had a higher body weight than that of mice exposed to 0.1 mg/kg DBP (Fig. 1A). The liver weight and the relative liver to body weight were significantly increased by exposure of DBP at 1 mg/kg, whereas no significant change was found after exposure at 0.1 mg/kg (Fig. 1B,C). A similar trend was observed for the relative epididymal fat weight of mice (Fig. 1D). Figure 1. Open in new tabDownload slide DBP exposure affects the growth phenotypes (A) Body weight. (B) Liver weight. (C) Relative liver weight. (D) Relative epididymal fat weight. The values are presented as the mean ± SEM (n = 8). *P < 0.05, and **P < 0.01. Figure 1. Open in new tabDownload slide DBP exposure affects the growth phenotypes (A) Body weight. (B) Liver weight. (C) Relative liver weight. (D) Relative epididymal fat weight. The values are presented as the mean ± SEM (n = 8). *P < 0.05, and **P < 0.01. Effects of DBP exposure on plasma AST, ALT, ALP, and blood lipid levels Next, we examined the effect of DBP on the level of blood lipid. As shown in Fig. 2, the levels of AST and ALT in the DBP-administered groups were significantly elevated in a dose-dependent manner (Fig. 2A,B) and administration of 0.1 mg/kg DBP significantly increased the level of ALP in the plasma of mice compared with those in the control group (Fig. 2C). Interestingly, exposure to 1 mg/kg DBP increased the level of ALP, although no significance was observed, and the level was lower in the 0.1 mg/kg DBP-treated group than that in the control group (Fig. 2C). To further explore the effect of DBP on blood lipid level, we determined the levels of serum TC, TG, LDL-C, and HDL-C. The contents of TC, TG, LDL-C, and HDL-C in the plasma of DBP-treated groups were all increased in a dose-dependent manner compared with those in the control group (Fig. 2D–F), whereas the content of HDL-C in the plasma of DBP-treated groups was significantly reduced in a dose-dependent manner (Fig. 2G) compared with that in the plasma of the control group. Figure 2. Open in new tabDownload slide DBP exposure affects the plasma AST, ALT, ALP and blood lipid levels The plasma (A) AST, (B) ALT and (C) ALP levels, and (D) TC, (E) TG, (F) LDL-C, and (G) HDL-C levels were measured by using commercial assay kits. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Figure 2. Open in new tabDownload slide DBP exposure affects the plasma AST, ALT, ALP and blood lipid levels The plasma (A) AST, (B) ALT and (C) ALP levels, and (D) TC, (E) TG, (F) LDL-C, and (G) HDL-C levels were measured by using commercial assay kits. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Effects of DBP exposure on the lipid metabolism of liver To further explore the effects of DBP on lipid metabolism in the liver, H&E staining and Oil Red O staining were performed, and the levels of hepatic TC, TG, LDL-C, and HDL-C were determined. As shown in Fig. 3A, the intensity of Oil Red O staining was increased with the increase of the DBP dose; the number of lipid droplets in the liver fat cells was significantly increased, which was higher than that in controls (Fig. 3B). The images of H&E-stained sections showed that the histology of the liver from the control mice was typical, while hepatocytes in the mice of DBP-exposed groups exhibited extensive fatty changes, especially in the 1 mg/kg DBP-treated group, indicating lipid accumulation in the liver after exposure to DBP (Fig. 3C). In addition, exposure to DBP increased the levels of hepatic TC, TG, and LDL-C in a dose-dependent manner compared with those in control group (Fig. 3D–F). The level of HDL-C was reduced in the 0.1 mg/kg DBP-treated group; and exposure to 1 mg/kg reduced the level of HDL-C substantially compared with those in the control group (Fig. 3G). Furthermore, we also detected the relative mRNA expression levels of the Srebp-1c, Srebp-2, Fasn, Acc, Scd, Hmgcr, Hmgcs1, and Ppar-γ genes. DPB exposure increased the relative expression levels of Srebp-1c, Srebp-2, Fasn, Acc, Scd, Hmgcr, and Hmgcs1 genes with the increase of DBP dose, but the relative expression level of Ppar-γ was reduced compared with that in the control group (Fig. 3H). In addition, we also detected the protein expression levels of PPAR-α, PPAR-γ, and SREBP-1C by western blot analysis. Our results showed that exposure to DBP significantly decreased the protein expression levels of PPAR-α and PPAR-γ, and significantly increased the protein expression level of SREBP-1C compared with those in the control group (Fig. 3I,J). Figure 3. Open in new tabDownload slide DBP exposure affects the lipid metabolism of liver (A) Oil Red O staining. (B) Quantified result of Oil Red O staining by using Image pro plus 6.0 software. (C) H&E staining. The contents of (D) TC, (E) TG, (F) LDL-C, and (G) HDL-C in the liver were measured. (H) The relative expression levels of Srebp-1c, Srebp-2, Fasn, Acc, Scd, Hmgcs1, Hmgcr, and Ppar-γ genes in the liver were determined by RT-qPCR. (I) Western blot analysis of the expressions of PPAR-α, PPAR-γ and SREBP-1C proteins in the livers of control, DBP-0.1 and DBP-1 groups. (J) ImageJ analysis of the intensity of PPAR-α, PPAR-γ and SEEBP-1C proteins after normalization with β-actin. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Figure 3. Open in new tabDownload slide DBP exposure affects the lipid metabolism of liver (A) Oil Red O staining. (B) Quantified result of Oil Red O staining by using Image pro plus 6.0 software. (C) H&E staining. The contents of (D) TC, (E) TG, (F) LDL-C, and (G) HDL-C in the liver were measured. (H) The relative expression levels of Srebp-1c, Srebp-2, Fasn, Acc, Scd, Hmgcs1, Hmgcr, and Ppar-γ genes in the liver were determined by RT-qPCR. (I) Western blot analysis of the expressions of PPAR-α, PPAR-γ and SREBP-1C proteins in the livers of control, DBP-0.1 and DBP-1 groups. (J) ImageJ analysis of the intensity of PPAR-α, PPAR-γ and SEEBP-1C proteins after normalization with β-actin. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Effects of DBP exposure on the metabolic products of lipid metabolism pathway Next, to further analyze the effect on the metabolic products related to lipid metabolism pathway in the liver, the concentrations of mevalonate, HMG-CoA, acetyl-CoA, malonyl-CoA, sat-FA, and unsat-FA were detected using ELISA kits. The level of mevalonate was first measured, because it is an important metabolite from the cholesterol synthesis pathway. As shown in Fig. 4A, the level of mevalonate was increased in a dose-dependent manner when exposed to DBP, while no significant change was observed in the 0.1 mg/kg DBP-treated group compared with that in the control group. In addition, we also determined the level of HMG-CoA, another essential metabolic product involved in cholesterol synthesis pathway. Compared with the control group, the concentration of HMG-CoA was significantly increased in both the 0.1 and 1 mg/kg DBP-treated groups (Fig. 4B). As shown in Fig. 4C, the level of acetyl-CoA, as a kind of intermediary metabolism substance linking to the cholesterol and TG synthesis pathways, was significantly increased in a dose-dependent manner after exposure to 0.1 and 1 mg/kg DBP, compared with those in the control group. Then, we further explored the effect of DBP on some metabolic products involved in TG synthesis pathway, such as malonyl-CoA, sat-FA, and unsat-FA. Compared with those in the control group, the levels of malonyl-CoA, sat-FA, and unsat-FA were also significantly increased in 0.1 and 1 mg/kg DBP-treated groups (Fig. 4D–F). Figure 4. Open in new tabDownload slide DBP exposure affects the metabolic products of lipid metabolism pathway The levels of (A) mevalonate, (B) HMG-CoA, (C) acetyl-CoA, (D) malonyl-CoA, (E) sat-FA, and (F) unsat-FA in the liver were detected using ELISA kits. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Figure 4. Open in new tabDownload slide DBP exposure affects the metabolic products of lipid metabolism pathway The levels of (A) mevalonate, (B) HMG-CoA, (C) acetyl-CoA, (D) malonyl-CoA, (E) sat-FA, and (F) unsat-FA in the liver were detected using ELISA kits. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. DBP exposure alters the structure and composition of gut microbiota To examine the effects of DBP on the gut microbiota, we first analyzed the main constituents of the microbiota in the cecal contents at the phylum level using qPCR technology. As shown in Fig. 5A, the relative abundance of Firmicutes and α-proteobacteria was significantly increased in 0.1 and 1 mg/kg DBP-treated groups, while the relative abundance of Bacteroidetes and Verrucomicrobia was significantly decreased after exposure to DBP at the doses of 0.1 and 1 mg/kg. To further analyze the change of gut microbiota resulting from DBP exposure, we used 16S rRNA gene sequencing technology to analyze the structure and composition of gut microbiota. It was found that the characters of the gut microbiota were obviously altered by DBP exposure. At the phylum level, we pay more attention to the relative abundance of Firmicutes, Bacteroidetes, Proteobacteria, and Verrucomicrobia. The relative abundance of Bacteroidetes and Verrucomicrobia was reduced, and the relative abundance of Firmicutes and Proteobacteria was increased after exposure to 0.1 mg/kg DBP when compared with that in the control group (Fig. 5B). In addition, the composition of the gut microbiota was further analyzed at the genus level after exposure to DBP, which revealed more detailed changes (Fig. 5C). At the genus level, nine types of bacteria were significantly changed. The relative abundance of Prevotella, Desulfovibrio, Sutterella, and Bacteroides was significantly increased, whereas the relative abundance of Oscillospira, Parabacteroides, Akkermansia, Odoribacter, and Helicobacter was decreased in the 0.1 mg/kg DBP-treated group compared with those in the control group (Fig. 5C). Furthermore, the Shannon and Simpson indexes of alpha diversity also suggested that the diversity of the gut microbiota was substantially decreased by exposure to 0.1 mg/kg DBP (Fig. 5D,E). Based on the principal component analysis (PCA) of beta diversity, the gut microbiota in the 0.1 mg/kg DBP-treated group also differed from that in the control group (Fig. 5F). In addition, we further analyzed the differences in Kyoto Encyclopedia of Genes and Genomes (KEGG) metabolic pathways. As shown in Fig. 5G, the functional genes related to the lipid metabolism pathway were obviously influenced by 0.1 mg/kg DBP. Results showed that there exist close links between changes of functional genes related to the lipid metabolism pathway and DBP exposure (Fig. 5G). In addition, we also analyzed the interaction of gut microbiota by Spearson correlation coefficient. Among the 10 bacterial genera found in two groups, Parabacteroides, Odoribacter, Ruminococcus, and Akkermansia were significantly different (Fig. 5H). Figure 5. Open in new tabDownload slide DBP exposure alters the structure and composition of microbiota in the gut (A) Relative abundance of the microbiota at the phylum level in the cecal contents after exposure to 0.1 and 1 mg/kg DBP for 10 weeks. (B) Gut microbiome composition profiles at the phylum level in the control group and DBP-0.1 group, respectively. (C) Changes in the gut microbiota composition at the genus level after 0.1 mg/kg DBP exposure (each color represents one bacterial genus). (D) Shannon index of the diversity of gut microbiota after DBP exposure. (E) Simpson index of the diversity of gut microbiota after DBP exposure. (F) Gut microbiota patterns in control group and DBP-treated group differentiated by principal component analysis (PCA). (G) The predicted difference in the KEGG metabolic pathways of the cecal microbiota from the control and 0.1 mg/kg DBP-treated groups. (H) The analysis in interaction of gut microbiota by Spearson correlation coefficient. n = 5. Data represent mean with 95% CI. Figure 5. Open in new tabDownload slide DBP exposure alters the structure and composition of microbiota in the gut (A) Relative abundance of the microbiota at the phylum level in the cecal contents after exposure to 0.1 and 1 mg/kg DBP for 10 weeks. (B) Gut microbiome composition profiles at the phylum level in the control group and DBP-0.1 group, respectively. (C) Changes in the gut microbiota composition at the genus level after 0.1 mg/kg DBP exposure (each color represents one bacterial genus). (D) Shannon index of the diversity of gut microbiota after DBP exposure. (E) Simpson index of the diversity of gut microbiota after DBP exposure. (F) Gut microbiota patterns in control group and DBP-treated group differentiated by principal component analysis (PCA). (G) The predicted difference in the KEGG metabolic pathways of the cecal microbiota from the control and 0.1 mg/kg DBP-treated groups. (H) The analysis in interaction of gut microbiota by Spearson correlation coefficient. n = 5. Data represent mean with 95% CI. DBP exposure affects the intestinal barrier function and causes inflammation of the colon tissue To further explore the influence of DBP exposure on the gut, H&E- and AB-PAS-stained tissue sections were analyzed. As shown in Fig. 6A, AB-PAS staining of the gut demonstrated that the volume of mucus in the guts of mice was significantly decreased after exposure to 0.1 mg/kg DBP. In addition, H&E staining showed that there was a significant change in the guts of mice exposed to 0.1 and 1 mg/kg DBP (Fig. 6B). To further explore the effects of DBP on the intestinal barrier, the mRNA expression levels of tight junction proteins such as Occludin and Claudin1 were determined (Fig. 6C,D). Our results showed that compared with those in the control group, mRNA expressions of Occludin and Claudin1 were decreased in the DBP-administered groups in a dose-dependent manner (Fig. 6C,D). Similarly, the protein expression levels of Occludin and Claudin1 were also significantly decreased in the DBP-administered groups in a dose-dependent manner (Fig. 6E,F). We also detected the mRNA expressions of inflammatory cytokines, including IL-6 and IL-1β, in colon tissues of the DBP-administered groups. The relative mRNA expressions of IL-6 and IL-1β were significantly increased compared with those in the control group (Fig. 6G,H). Figure 6. Open in new tabDownload slide DBP exposure affects the intestinal barrier function and causes the inflammation of the colon tissue (A) AB-PAS staining of colon. (B) H&E staining of colon. The relative mRNA expressions of (C) Occludin and (D) Claudin1. (E) Western blot analysis of the expression of Occludin protein in the liver of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of Occludin protein after normalization with β-actin. (F) Western blot analysis of the expression of Claudin1 protein in the livers of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of Claudin1 protein after normalization with β-actin. The relative mRNA expressions of (G) IL-6 and (H) IL-1β. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Figure 6. Open in new tabDownload slide DBP exposure affects the intestinal barrier function and causes the inflammation of the colon tissue (A) AB-PAS staining of colon. (B) H&E staining of colon. The relative mRNA expressions of (C) Occludin and (D) Claudin1. (E) Western blot analysis of the expression of Occludin protein in the liver of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of Occludin protein after normalization with β-actin. (F) Western blot analysis of the expression of Claudin1 protein in the livers of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of Claudin1 protein after normalization with β-actin. The relative mRNA expressions of (G) IL-6 and (H) IL-1β. The values are presented as the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. DBP exposure affects proinflammatory cytokine levels in the liver Levels of inflammatory factors were detected by ELISA. As shown in Fig. 7, the mRNA expression of IL-1β was significantly increased in the 0.1 mg/kg DBP-treated group (Fig. 7A); and exposure to 1 mg/kg DBP also increased the mRNA expression of IL-1β, but with no significance compared with that in the control group (Fig. 7A). However, the mRNA levels of TNF-α and IL-6 were increased in a dose-dependent manner in DBP-administered groups compared with those in the control group (Fig. 7B,C). Similarly, the level of IL-1β in the 1 mg/kg DBP-treated group was significantly higher than that in the control group (Fig. 7D), and a similar trend was observed in the 0.1 mg/kg DBP-treated group; however, the difference was not significant (Fig. 7D). In addition, compared with those in the control group, the TNF-α and IL-6 levels were increased in the DBP-administered groups in a dose-dependent manner (Fig. 7E,F). Moreover, we also detected the level of LPS in the plasma. Compared with that in the control group, the level of LPS in plasma was significantly increased in the 1 mg/kg DBP-treated group, whereas no significant change was observed in the group that received 0.1 mg/kg of DBP (Fig. 7G). In addition, the protein expressions of TLR4 and NF-κB were increased in a dose-dependent manner after exposure to DBP compared with those in the control group (Fig. 7H,I). Together, these results suggested that DBP possibly activates the LPS-TLR4-NF-κB pathway and leads to increased levels of inflammatory factors in the liver. Figure 7. Open in new tabDownload slide DBP exposure causes inflammation in the liver The relative mRNA expressions of (A) IL-1β, (B) TNF-α and (C) IL-6. The levels of (D) IL-1β, (E) TNF-α, and (F) IL-6 were detected in the liver by ELISA. (G) The level of LPS in the plasma was detected by ELISA. (H) Western blot analysis of the expression of TLR4 protein in the liver of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of TLR4 protein after normalization with β-actin. (I) Western blot analysis of the expression of NF-κB protein in the liver of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of NF-κB protein after normalization with β-actin. The values are presented the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Figure 7. Open in new tabDownload slide DBP exposure causes inflammation in the liver The relative mRNA expressions of (A) IL-1β, (B) TNF-α and (C) IL-6. The levels of (D) IL-1β, (E) TNF-α, and (F) IL-6 were detected in the liver by ELISA. (G) The level of LPS in the plasma was detected by ELISA. (H) Western blot analysis of the expression of TLR4 protein in the liver of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of TLR4 protein after normalization with β-actin. (I) Western blot analysis of the expression of NF-κB protein in the liver of control, DBP-0.1 and DBP-1 groups; ImageJ analysis of the intensity of NF-κB protein after normalization with β-actin. The values are presented the mean ± SEM (n = 8). *P < 0.05, **P < 0.01, and ***P < 0.001. Discussion In recent years, many studies have shown that pollutants, such as PCBs [18] and other ambient air pollutants [19], can cause disorders in lipid metabolism. Phthalates, mainly DBP, diethyl phthalate, and di(2-ethylhexyl) phthalate (DEHP), are a series of typical environmental pollutants, among which DBP is the most widely used plasticizers [20]. Previous studies have confirmed that phthalates can affect lipid metabolism and increase lipid accumulation in different organisms [21,22], which has attracted the attention of researchers. A previous study revealed that the effect of DEHP on lipid metabolism in rats was mediated via the JAK3/STAT5a pathway [18]. However, to our knowledge, the link between phthalates and gut microbiota has never been reported. Furthermore, increasing evidence has confirmed that gut microbiota plays an indispensable role in lipid metabolism and inflammation of the liver, which includes endogenous LPS invasion and activation of inflammatory responses, causing the disorder of lipid metabolism and inflammation in the liver [23]. Therefore, in this study, we focused on the relationships among DBP, gut microbiota, inflammation, and lipid metabolism. Our results revealed that DBP exposure caused the disorder of lipid metabolism, affected the structure and composition of gut microbiota, and mainly activated the LPS-TLR4-NF-κB pathways to cause inflammation in the liver. We found that the structure and composition of gut microbiota were significantly affected after DBP exposure. Previous studies have revealed that the gut microbiota plays a key role in regulating host lipid metabolism [24,25]. Some of the properties associated with gut microbiota were found to regulate host lipid metabolism [26]. Furthermore, increasing evidence has confirmed that gut microbiota can be affected by some kinds of environmental pollutants [22,27]. Therefore, whether DBP can induce gut microbiota dysbiosis in mice or other model animals is worth being studied. In our study, we observed that the composition and structure of gut microbiota in the cecal contents changed at the phylum and genus levels when the mice were exposed to DBP. DBP treatment increased the relative abundance of Firmicutes and decreased the relative abundance of Bacteroidetes at the phylum level. According to an early research, the effects of Bacteroidetes and Firmicutes are closely correlated with the development of lipid metabolism [28]. It has also been shown that an increased Firmicutes and Bacteroidetes ratio was related to lipid accumulation in high fat diet-fed rats [29], which is consistent with our results. Some key gut microbiota at the genus level also changed significantly. For example, the close association of Oscillospira with lipid accumulation was confirmed by a previous study, which showed that the decrease in the relative abundance of Oscillospira was related to increased lipid accumulation [27]. Chen et al. [29] showed that there was a strong correlation between bile acid and Prevotella, which mediates lipid levels via altering bile acid metabolism, thereby impacting subsequent metabolism to cause the changes in blood lipid levels [30]. Akkermansia, a genus of bacteria whose abundance is inversely correlated with obesity [31], was also reported to modulate lipid metabolism disorder [23]. Similar changes in these genera were observed in our experiments. In addition, the structure of gut microbiota was altered by DBP exposure as indicated by the Shannon and Simpson indexes of alpha diversity and the PCA of beta diversity. Furthermore, the results of the KEGG metabolic pathway analysis also suggested that DBP exposure affects the lipid metabolism pathway. Overall, our study indicated that DBP exposure affects the structure and composition of gut microbiota related to lipid metabolism. The liver, one of the largest metabolic organs, plays a crucial role in the modulation of lipid metabolism [32]. As is known, production and storage of lipid in the organisms are mainly regulated by liver lipogenesis and catabolism. SREBPs are a kind of crucial activators for the synthesis of fatty acids and cholesterol, combined with a lipid synthesis promoter [33]. SREBP-1C is one of the most important isoforms of SREBP1, which is primarily responsible for the expressions of downstream genes, such as Fasn and Acc, which are key genes of lipid synthesis in liver [34]. SREBP-2 also plays a role in cholesterol biosynthesis [35]. A previous study showed that exposure to MPs, a kind of typic environmental pollutants, obviously affected the host lipid metabolism by upregulating the key genes involved in lipid biosynthesis pathway, mainly including Srebp-1c and Fasn [36]. In addition, a previous study reported that exposure to bisphenol A, a plastic component widely used in manufacturing, significantly increased the expressions of lipogenic key genes, such as Srebp-1c, leading to the accumulation of hepatic lipid [37]. Consistent with these studies on environmental pollutants, our study revealed that DBP exposure significantly increased the relative mRNA expressions of Srebp-1c and Srebp-2, which contribute to an increase in the expression levels of downstream genes, such as Fasn, Scd, Acc, Hmgcr, and Hmgcs1, and are related to fatty acid and cholesterol biosynthesis. In addition, because of the increased expressions of these genes, the metabolic products in the lipid metabolism pathway, such as mevalonate, HMG-CoA, acetyl-CoA, malonyl-CoA, sat-FA, and unsat-FA, were also increased, which accounted for the increased levels of TC and TG in the liver. Our results also accounted for the accumulation of lipids in the liver of mice after DBP exposure. Taken together, we found that DBP affected lipid metabolism by disturbing the expressions of key genes involved in lipid metabolism. In this sutdy, we found that levels of inflammatory factors were obviously increased after exposure to DBP. To explore the associated mechanisms of inflammation in the liver, we assessed key genes related to inflammation, such as those in the PPAR family [38]. PPARs, a nuclear receptor superfamily, contain PPAR-α, PPAR-β/δ, and PPAR-γ [39]. Much evidence has demonstrated that activation of PPAR-γ can protect LPS-induced inflammation by mainly suppressing the NF-κB signaling pathway [40]. In addition, a previous study reported that decreased gene expression of Ppar-γ is associated with downregulated expressions of other genes involved in lipid homeostasis, such as Fasn, Srebp, and Fabp-4 [41]. In another research, it was also reported that PPAR-γ is involved in lipid metabolism of adipocytes, and homeostasis of lipid metabolism is necessary for anti-inflammatory response, of which decreased expression is helpful for the repair of lipid metabolic reprogramming [42]. However, we found that DBP exposure significantly inhibited the relative mRNA expression of Ppar-γ, which activated the NF-κB signaling pathway. A recent study reported that the PPAR-γ-NF-κB signaling pathway is a major signaling pathway, and its activation leads to the increased expressions of proinflammatory cytokines, such as TNF-α, IL-1β, and IL-6 [43]. Interestingly, a previous study also reported that exposure to MPs significantly induced the disorder of lipid metabolism but decreased the expression of Ppar-γ in liver [27]. So, we reasonably speculated that DBP exposure may decrease the gene and protein expressions of PPAR-γ through an unknown indirect pathway, while gut microbiota may account for the interesting phenomenon. According to a previous study, the gene expression of Ppar-γ has a close interaction with alterations or dysbiosis of gut microbiota [44]. In addition, increasing evidence suggested a close link between lipid metabolism and inflammation. A previous study showed that accumulation of free cholesterol in liver led to serious hepatic inflammation and fibrosis; importantly, maintaining cholesterol homeostasis is important for protecting against production of inflammatory cytokines and accumulation of lipid in liver [45]. Furthermore, it was reported that high cholesterol diet increases oxidative stress and the expression of inflammatory cytokines in the liver [46]. Consistent with previous studies, our study indicated that DBP exposure possibly activates the PPAR-γ-NF-κB signaling pathway and induces increased expressions of proinflammatory cytokines in the liver, such as TNF-α, IL-1β, and IL-6, and accumulation of hepatic cholesterol further aggravates the inflammatory response in the liver. In addition, we also found that the intestinal barrier function was impaired by DBP exposure, which led to increased level of LPS. Moreover, DBP exposure caused the inflammation of the colon, leading to the leakiness of gut microflora. A previous study showed that the liver is the primary site of clearance of microbial products such as LPS, and it could be quickly absorbed into the liver through the portal system [47,48]. A previous study suggested that NF-κB binds with IκB, an NF-κB inhibitor, and is inactivated in the cytoplasm [49]. Once stimulated by LPS, NF-κB enters the nucleus from the cytoplasm and induces proinflammatory cytokines transcription [48,50]. In addition, our previous research also showed that LPS treatment induced the expressions of IL-6, TNF-α, and IL-1β in RAW264.7 cell line [51]. In this study, we demonstrated that increased level of LPS activated the protein expression of TLR4, which could further activate the expression of NF-κB [23,52]. All these findings account for the incidence of inflammation via the LPS-TLR4-NF-κB signaling pathways in the liver [54]. In conclusion, our results showed that DBP exposure could induce the dysbiosis of gut microbiota and disturb the hepatic lipid metabolism, contributing to the accumulation of lipid. In addition, DBP exposure causes inflammation of the liver with the activation of the major signaling pathway of LPS-TLR4-NF-κB. Further research is needed in the transport mechanism of DBP in vivo. Thus, our study provides scientific evidence between environmental pollutants and human health. Funding This work was supported by the grants from the National Natural Science Foundation of China (No. 31701028), the National Key Research and Development Program of China (No. 2017YFD0200503), and the Program for Changjiang Scholars and Innovative Research Team in University (No. IRT_17R97). References 1. Net S , Rabodonirina S, Sghaier RB, Dumoulin D, Chbib C, Tlili I, Ouddane B. Distribution of phthalates, pesticides and drug residues in the dissolved, particulate and sedimentary phases from transboundary rivers (France-Belgium) . Sci Total Environ 2015 , 521-522 : 152 – 159 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Tu Z , Mu X, Chen X, Geng Y, Zhang Y, Li Q, Gao R, et al. . Dibutyl phthalate exposure disrupts the progression of meiotic prophase I by interfering with homologous recombination in fetal mouse oocytes . Environ Pollut 2019 , 252 : 388 – 398 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Fries E , Dekiff JH, Willmeyer J, Nuelle MT, Ebert M, Remy D. Identification of polymer types and additives in marine microplastic particles using pyrolysis-GC/MS and scanning electron microscopy . Environ Sci Process Impacts 2013 , 15 : 1949 – 1956 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Gao DW , Wen ZD. Phthalate esters in the environment: A critical review of their occurrence, biodegradation, and removal during wastewater treatment processes . Sci Total Environ 2016 , 541 : 986 – 1001 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Farzanehfar V , Naderi N, Kobarfard F, Faizi M. Determination of dibutyl phthalate neurobehavioral toxicity in mice . Food Chem Toxicol 2016 , 94 : 221 – 226 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Lee W , Cho JH, Lee Y, Lee S, Kim DH, Ha S, Kondo Y, et al. . Dibutyl phthalate impairs neural progenitor cell proliferation and hippocampal neurogenesis . Food Chem Toxicol 2019 , 129 : 239 – 248 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Yan B , Guo J, Liu X, Li J, Yang X, Ma P, Wu Y. Oxidative stress mediates dibutyl phthalateinduced anxiety-like behavior in Kunming mice . Environ Toxicol Pharmacol 2016 , 45 : 45 – 51 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Gu S , Zheng H, Xu Q, Sun C, Shi M, Wang Z, Li F. Comparative toxicity of the plasticizer dibutyl phthalate to two freshwater algae . Aquat Toxicol 2017 , 191 : 122 – 130 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Xu W , You Y, Wang Z, Chen W, Zeng J, Zhao X, Su Y. Dibutyl phthalate alters the metabolic pathways of microbes in black soils . Sci Rep 2018 , 8 : 2605. Google Scholar OpenURL Placeholder Text WorldCat 10. Swan SH . Environmental phthalate exposure in relation to reproductive outcomes and other health endpoints in humans . Environ Res 2008 , 108 : 177 – 184 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Wojtowicz AK , Szychowski KA, Wnuk A, Kajta M. Dibutyl phthalate (DBP)-induced apoptosis and neurotoxicity are mediated via the aryl hydrocarbon receptor (AhR) but not by estrogen receptor alpha (ERalpha), estrogen receptor beta (ERbeta), or peroxisome proliferator-activated receptor gamma (PPARgamma) in mouse cortical neurons . Neurotox Res 2017 , 31 : 77 – 89 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Dobrzynska MM , Tyrkiel EJ, Pachocki KA. Developmental toxicity in mice following paternal exposure to di-n-butyl-phthalate (DBP) . Biomed Environ Sci 2011 , 24 : 569 – 578 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 13. Maestre-Batlle D , OM P, RD H, Randhawa A, Carlsten C, AK B. Dibutyl phthalate modulates phenotype of granulocytes in human blood in response to inflammatory stimuli . Toxicol Lett 2018 , 296 : 23 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Xie X , Deng T, Duan J, Ding S, Yuan J, Chen M. Comparing the effects of diethylhexyl phthalate and dibutyl phthalate exposure on hypertension in mice . Ecotoxicol Environ Saf 2019 , 174 : 75 – 82 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Duan J , Kang J, Deng T, Yang X, Chen M. Exposure to DBP and high iodine aggravates autoimmune thyroid disease through increasing the levels of IL-17 and thyroid-binding globulin in wistar rats . Toxicol Sci 2018 , 163 : 196 – 205 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Sen N , Liu X, Craig ZR. Short term exposure to di-n-butyl phthalate (DBP) disrupts ovarian function in young CD-1 mice . Reprod Toxicol 2015 , 53 : 15 – 22 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Hernandez-Diaz S , Su YC, Mitchell AA, Kelley KE, Calafat AM, Hauser R. Medications as a potential source of exposure to phthalates among women of childbearing age . Reprod Toxicol 2013 , 37 : 1 – 5 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Guo Y , Wu Q, Kannan K. Phthalate metabolites in urine from China, and implications for human exposures . Environ Int 2011 , 37 : 893 – 898 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Mao S , Chen G, Liu F, Li N, Wang C, Liu Y, Liu S, et al. . Long-term effects of ambient air pollutants to blood lipids and dyslipidemias in a Chinese rural population . Environ Pollut 2020 , 256 : 113403. Google Scholar OpenURL Placeholder Text WorldCat 20. Heudorf U , Mersch-Sundermann V, Angerer J. Phthalates: toxicology and exposure . Int J Hyg Environ Health 2007 , 210 : 623 – 634 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Pradhan A , Olsson PE, Jass J. Di(2-ethylhexyl) phthalate and diethyl phthalate disrupt lipid metabolism, reduce fecundity and shortens lifespan of Caenorhabditis elegans . Chemosphere 2018 , 190 : 375 – 382 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Seyoum A , Pradhan A. Effect of phthalates on development, reproduction, fat metabolism and lifespan in Daphnia magna . Sci Total Environ 2019 , 654 : 969 – 977 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Wu J , Shao H, Zhang J, Ying Y, Cheng Y, Zhao D, Dou X, et al. . Mussel polysaccharide alpha-D-glucan (MP-A) protects against non-alcoholic fatty liver disease via maintaining the homeostasis of gut microbiota and regulating related gut-liver axis signaling pathways . Int J Biol Macromol 2019 , 130 : 68 – 78 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Chi Y , Wang H, Lin Y, Lu Y, Huang Q, Ye G, Dong S. Gut microbiota characterization and lipid metabolism disorder found in PCB77-treated female mice . Toxicology 2019 , 420 : 11 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Li TT , Tong AJ, Liu YY, Huang ZR, Wan XZ, Pan YY, Jia RB, et al. . Polyunsaturated fatty acids from microalgae Spirulina platensis modulates lipid metabolism disorders and gut microbiota in high-fat diet rats . Food Chem Toxicol 2019 , 131 : 110558. Google Scholar OpenURL Placeholder Text WorldCat 26. Norris GH , Milard M, Michalski MC, Blesso CN. Protective properties of milk sphingomyelin against dysfunctional lipid metabolism, gut dysbiosis, and inflammation . J Nutr Biochem 2019 , 73 : 108224. Google Scholar OpenURL Placeholder Text WorldCat 27. Lu L , Wan Z, Luo T, Fu Z, Jin Y. Polystyrene microplastics induce gut microbiota dysbiosis and hepatic lipid metabolism disorder in mice . Sci Total Environ 2018 , 631-632 : 449 – 458 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Chen YH , Chiu CC, Hung SW, Huang WC, Lee YP, Liu JY, Huang YT, et al. . Gnotobiotic mice inoculated with Firmicutes, but not Bacteroidetes, deteriorate nonalcoholic fatty liver disease severity by modulating hepatic lipid metabolism . Nutr Res 2019 , 69 : 20 – 29 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Chen Q , Liu M, Zhang P, Fan S, Huang J, Yu S, Zhang C, et al. . Fucoidan and galactooligosaccharides ameliorate high-fat diet-induced dyslipidemia in rats by modulating the gut microbiota and bile acid metabolism . Nutrition 2019 , 65 : 50 – 59 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Fu J , Bonder MJ, Cenit MC, Tigchelaar EF, Maatman A, Dekens JA, Brandsma E, et al. . The gut microbiome contributes to a substantial proportion of the variation in blood lipids . Circ Res 2015 , 117 : 817 – 824 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Belzer C , de Vos WM. Microbes inside—from diversity to function: the case of Akkermansia . ISME J 2012 , 6 : 1449 – 1458 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Nguyen P , Leray V, Diez M, Serisier S, Le Bloc’h J, Siliart B, Dumon H. Liver lipid metabolism . J Anim Physiol Anim Nutr (Berl) 2008 , 92 : 272 – 283 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Krycer JR , Sharpe LJ, Luu W, Brown AJ. The Akt-SREBP nexus: cell signaling meets lipid metabolism . Trends Endocrinol Metab 2010 , 21 : 268 – 276 . Google Scholar Crossref Search ADS PubMed WorldCat 34. Zhang R , Pan Z, Wang X, Shen M, Zhou J, Fu Z, Jin Y. Short-term propamocarb exposure induces hepatic metabolism disorder associated with gut microbiota dysbiosis in adult male zebrafish . Acta Biochim Biophys Sin 2019 , 51 : 88 – 96 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Ren X , Dai P, Perveen A, Tang Q, Zhao L, Jia X, Li Y, et al. . Effects of chronic glyphosate exposure to pregnant mice on hepatic lipid metabolism in offspring . Environ Pollut 2019 , 254 : 112906. Google Scholar OpenURL Placeholder Text WorldCat 36. Backhed F , Ding H, Wang T, Hooper LV, Koh GY, Nagy A, Semenkovich CF, et al. . The gut microbiota as an environmental factor that regulates fat storage . Proc Natl Acad Sci U S A 2004 , 101 : 15718 – 15723 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Shimpi PC , More VR, Paranjpe M, Donepudi AC, Goodrich JM, Dolinoy DC, Rubin B, et al. . Hepatic lipid accumulation and Nrf2 expression following perinatal and peripubertal exposure to bisphenol A in a mouse model of nonalcoholic liver disease . Environ Health Perspect 2017 , 125 : 087005. Google Scholar OpenURL Placeholder Text WorldCat 38. Silva-Veiga FM , Rachid TL, de Oliveira L, Graus-Nunes F, Mandarim-de-Lacerda CA, Souza-Mello V. GW0742 (PPAR-beta agonist) attenuates hepatic endoplasmic reticulum stress by improving hepatic energy metabolism in high-fat diet fed mice . Mol Cell Endocrinol 2018 , 474 : 227 – 237 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Straus DS , Glass CK. Anti-inflammatory actions of PPAR ligands: new insights on cellular and molecular mechanisms . Trends Immunol 2007 , 28 : 551 – 558 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Hu X , Qin H, Li Y, Li J, Fu L, Li M, Jiang C, et al. . Biochanin A protect against lipopolysaccharide-induced acute lung injury in mice by regulating TLR4/NF-kappaB and PPAR-gamma pathway . Microb Pathog 2020 , 138 : 103846. Google Scholar OpenURL Placeholder Text WorldCat 41. Jia D , Li Z, Gao Y, Feng Y, Li W. A novel triazine ring compound (MD568) exerts in vivo and in vitro effects on lipid metabolism . Biomed Pharmacother 2018 , 103 : 790 – 799 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Kang S , Nakanishi Y, Kioi Y, Okuzaki D, Kimura T, Takamatsu H, Koyama S, et al. . Semaphorin 6D reverse signaling controls macrophage lipid metabolism and anti-inflammatory polarization . Nat Immunol 2018 , 19 : 561 – 570 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Hu X , Liu S, Zhu J, Ni H. Dachengqi decoction alleviates acute lung injury and inhibits inflammatory cytokines production through TLR4/NF-kappaB signaling pathway in vivo and in vitro . J Cell Biochem 2019 , 120 : 8956 – 8964 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Tomas J , Mulet C, Saffarian A, Cavin JB, Ducroc R, Regnault B, Kun Tan C, et al. . High-fat diet modifies the PPAR-gamma pathway leading to disruption of microbial and physiological ecosystem in murine small intestine . Proc Natl Acad Sci U S A 2016 , 113 : E5934 - E5943 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Liu H , Pathak P, Boehme S, Chiang JY. Cholesterol 7alpha-hydroxylase protects the liver from inflammation and fibrosis by maintaining cholesterol homeostasis . J Lipid Res 2016 , 57 : 1831 – 1844 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Wouters K , van Gorp PJ, Bieghs V, Gijbels MJ, Duimel H, Lutjohann D, Kerksiek A, et al. . Dietary cholesterol, rather than liver steatosis, leads to hepatic inflammation in hyperlipidemic mouse models of nonalcoholic steatohepatitis . Hepatology 2008 , 48 : 474 – 486 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Rao R . Endotoxemia and gut barrier dysfunction in alcoholic liver disease . Hepatology 2009 , 50 : 638 – 644 . Google Scholar Crossref Search ADS PubMed WorldCat 48. Luedde T , Schwabe RF. NF-kappaB in the liver—linking injury, fibrosis and hepatocellular carcinoma . Nat Rev Gastroenterol Hepatol 2011 , 8 : 108 – 118 . Google Scholar Crossref Search ADS PubMed WorldCat 49. Liu J , Chang G, Huang J, Wang Y, Ma N, Roy AC, Shen X. Sodium butyrate inhibits the inflammation of lipopolysaccharide-induced acute lung injury in mice by regulating the toll-like receptor 4/nuclear factor kappa B signaling pathway . J Agric Food Chem 2019 , 67 : 1674 – 1682 . Google Scholar Crossref Search ADS PubMed WorldCat 50. Li Z , Xiao X, Yang M. Asiatic acid inhibits lipopolysaccharide-induced acute lung injury in mice . Inflammation 2016 , 39 : 1642 – 1648 . Google Scholar Crossref Search ADS PubMed WorldCat 51. Miao W , Fu Z, Jin Y. 3-Methylcholanthrene alters the hepatic immune response in mice . Acta Biochim Biophys Sin 2020 , 52 : 570 – 572 . Google Scholar Crossref Search ADS PubMed WorldCat 52. Li HD , Chen X, Yang Y, Huang HM, Zhang L, Zhang X, Zhang L, et al. . Wogonin attenuates inflammation by activating PPAR-gamma in alcoholic liver disease . Int Immunopharmacol 2017 , 50 : 95 – 106 . Google Scholar Crossref Search ADS PubMed WorldCat 53. Shi L , Fang B, Yong Y, Li X, Gong D, Li J, Yu T, et al. . Chitosan oligosaccharide-mediated attenuation of LPS-induced inflammation in IPEC-J2 cells is related to the TLR4/NF-kappaB signaling pathway . Carbohydr Polym 2019 , 219 : 269 – 279 . Google Scholar Crossref Search ADS PubMed WorldCat 54. Zhang FX , Xu RS. Juglanin ameliorates LPS-induced neuroinflammation in animal models of Parkinson’s disease and cell culture via inactivating TLR4/NF-kappaB pathway . Biomed Pharmacother 2018 , 97 : 1011 – 1019 . Google Scholar Crossref Search ADS PubMed WorldCat © Crown copyright 2020. This article contains public sector information licensed under the Open Government Licence v3.0 (http://www.nationalarchives.gov.uk/doc/open-government-licence/version/3/).
TI - Exposure to dibutyl phthalate impairs lipid metabolism and causes inflammation via disturbing microbiota-related gut–liver axis
JO - Acta Biochimica et Biophysica Sinica
DO - 10.1093/abbs/gmaa128
DA - 2020-12-29
UR - https://www.deepdyve.com/lp/oxford-university-press/exposure-to-dibutyl-phthalate-impairs-lipid-metabolism-and-causes-eeHROJ5yTP
SP - 1382
EP - 1393
VL - 52
IS - 12
DP - DeepDyve
ER -