TY - JOUR
AU - Apel, Klaus
AB - Abstract The flu mutant of Arabidopsis thaliana overaccumulates in the dark the immediate precursor of chlorophyllide, protochlorophyllide (Pchlide), a potent photosensitizer, that upon illumination generates singlet oxygen (1O2). Once 1O2 has been released in plastids of the flu mutant, mature plants stop growing, while seedlings die. Several suppressor mutations, dubbed singlet oxygen-linked death activator (soldat), were identified that specifically abrogate 1O2-mediated stress responses in young flu seedlings without grossly affecting 1O2-mediated stress responses of mature flu plants. One of the soldat mutations, soldat8, was shown to impair a gene encoding the SIGMA6 factor of the plastid RNA polymerase. Reintroduction of a wild-type copy of the SOLDAT8 gene into the soldat8/flu mutant restored the phenotype of the flu parental line. In contrast to flu, seedlings of soldat8/flu did not bleach when grown under non-permissive dark/light conditions, despite their continuous overaccumulation of the photosensitizer Pchlide in the dark. The activity of SIGMA6 is confined primarily to the very early stage of seedling development. Inactivation of SIGMA6 in soldat8 mutants disturbed plastid homeostasis, drastically reduced the non-photochemical quenching capacity and enhanced the light sensitivity of young soldat8 seedlings. Surprisingly, after being grown under very low light, soldat8 seedlings showed an enhanced resistance against a subsequent severe light stress that was significantly higher than in wild-type seedlings. In order to reach a similar enhanced stress resistance, wild-type seedlings had to be exposed to a brief higher light treatment that triggered an acclimatory response. Such a mild pre-stress treatment did not further enhance the stress resistance of soldat8 seedlings. Suppression of 1O2-mediated cell death in young flu/soldat8 seedlings seems to be due to a transiently enhanced acclimation at the beginning of seedling development caused by the initial disturbance of plastid homeostasis. Introduction Plants exposed to environmental stress show an increased production of reactive oxygen species (ROS) (Apel and Hirt 2004). ROS may react with various biomolecules such as lipids, proteins and nucleic acids, causing irreversible damage that can lead to tissue necrosis and ultimately may kill the plant (Rebeiz et al. 1988, Girotti 2001, Przybyla et al. 2008), but they may also act as signals that activate and control genetic stress response programs that confer an enhanced stress tolerance to an otherwise vulnerable plant (Karpinski et al. 1999, Bowler and Fluhr 2000, Przybyla et al. 2008). Because in plants under stress different ROS are generated simultaneously, it is difficult to determine the biological activity and mode of action for each of these ROS separately. For instance, abiotic stress conditions such as high light, high or low temperatures, drought, high or low salt or nutrient stress may limit the plant's ability to use light energy for photosynthesis (Barber and Anderson 1992, Niyogi 1999, Dat et al. 2001). Under such stress conditions, hyper-reduction of the photosynthetic electron transport chain favors the direct reduction of O2 by PSI to the superoxide radical and the subsequent production of hydrogen peroxide (H2O2) and the hydroxyl radical (OH·) (Asada 1999, Foyer and Noctor 2000). At the same time, excited triplet Chl in PSII interacts with O2 to generate singlet oxygen (1O2) by energy transfer (Macpherson et al. 1993, Ledford and Niyogi 2005). Recently the conditional flu mutant of Arabidopsis thaliana has been used to discern the biological activity and specificity of one of these ROS. The mutant releases 1O2 in plastids in a controlled and non-invasive manner (op den Camp et al. 2003). FLU is a nucleus-encoded protein that plays a key role during the negative feedback control of Chl biosynthesis (Meskauskiene et al. 2001). Inactivation of this protein in the flu mutant leads to the accumulation of free protochlorophyllide (Pchlide) in plastids of plants kept in the dark. Once these plants are shifted to the light, Pchlide acts as a photosensitizer and by energy transfer generates 1O2. Immediately after the release of 1O2, mature flu plants stop growing, while seedlings bleach and die (op den Camp et al. 2003). Growth inhibition and seedling lethality of flu do not result from physicochemical damage caused by 1O2 during oxidative stress, but are due to the activation of genetically determined stress response programs (Przybyla et al. 2008). During an extensive second-site mutant screen, a larger number of suppressor mutations have been identified that abrogate either one or both stress responses of flu. One of the mutated genes, EXECUTER1 (EX1), has been shown previously to be indispensable for 1O2-mediated stress responses of both seedlings and mature plants (Wagner et al. 2004). Here we have analyzed a member of another group of suppressor mutations, dubbed singlet oxygen-linked death activator (soldat), that block predominantly 1O2-mediated cell death responses of seedlings. In contrast to EXECUTER1, inactivation of the SOLDAT8 protein does not impair 1O2-mediated signaling, but instead enhances the light sensitivity, activates an acclimatory response, and in this way seems to suppress the subsequent 1O2-mediated cell death of seedlings. Results Characterization of the soldat8/flu double mutant Second-site mutations of flu were characterized that suppress the 1O2-mediated cell death response of seedlings, but not the growth inhibition of mature plants. Among the suppressor mutants only those were selected for this study that still accumulated amounts of free Pchlide in the dark similar to the parental flu mutant and also ceased growth, when mature plants were exposed to a dark/light regime. Each of these selected mutants was back-crossed at least once to the original flu mutant. Segregation analysis of the F2 generation of these crosses verified that in each case the phenotype of the second-site mutants was caused by a single recessive gene mutation. These mutant lines were dubbed soldat. A total of 19 soldat mutant lines were found, that comprise 17 different loci. In the present study, one of these mutants, soldat8/flu, was analyzed in greater detail. Etiolated seedlings of soldat8/flu and flu exposed to blue light emitted the strong red fluorescence of excited free Pchlide. This red fluorescence was not seen in etiolated wild-type seedlings, even though these plants also contained some Pchlide (Fig. 1A and data not shown). In the wild type, Pchlide together with NADPH and the NADPH-Pchlide oxidoreductase (POR) forms a ternary photoactive complex that uses light energy absorbed by Pchlide for the reduction of Pchlide to Chlide (Griffiths 1978). When seedlings of soldat8/flu initially grown under continuous light for 5 d were shifted to the dark for 15 h the Pchlide level at the end of the dark period exceeded that of wild-type seedlings 8- to 9-fold (Fig. 1A). Upon re-illumination of these seedlings, the levels of free Pchlide in soldat8/flu were sufficient to generate 1O2 that induced a drastic activation of nuclear genes previously shown to be rapidly up-regulated in response to 1O2 (op den Camp et al. 2003, Danon et al. 2005). Within the first 30 min of re-illumination of 4-day-old soldat8/flu seedlings, transcripts of Ethylene Responsive Factor5 and 6 (ERF5 and ERF6), and Bonsai1 Associated Protein (BAP1) reached levels that were approximately 100-, 40- and 35-fold higher, respectively, than in the wild type and comprised approximately 80% of the corresponding transcript levels in seedlings of the parental flu mutant treated in the same way (Fig. 1B). Fig. 1 View largeDownload slide The amounts of Pchlide (A) and 1O2-mediated changes in gene expression (B) in wild-type (wt), flu and soldat8/flu seedlings. (A) Seedlings grown for 5 d under continuous light and shifted to 15 h of darkness. By the end of the dark period, Pchlide levels were determined. (B) Seedlings grown for 5 d under continuous light, shifted for 15 h to the dark and re-exposed for 30 min to light. Total RNAs were extracted and the expression levels of the three genes ERF5, ERF6 and BAP1 in flu (gray bars) and in soldat8/flu (white bars) were determined relative to those in the wild type. Fig. 1 View largeDownload slide The amounts of Pchlide (A) and 1O2-mediated changes in gene expression (B) in wild-type (wt), flu and soldat8/flu seedlings. (A) Seedlings grown for 5 d under continuous light and shifted to 15 h of darkness. By the end of the dark period, Pchlide levels were determined. (B) Seedlings grown for 5 d under continuous light, shifted for 15 h to the dark and re-exposed for 30 min to light. Total RNAs were extracted and the expression levels of the three genes ERF5, ERF6 and BAP1 in flu (gray bars) and in soldat8/flu (white bars) were determined relative to those in the wild type. Identification of the soldat8 gene by map-based cloning We genetically mapped SOLDAT8 in F2 plants from a cross between the homozygous soldat8/flu mutant in ecotype Landsberg erecta (Ler) and the flu mutant in ecotype Columbia (Col-0). The flu line of ecotype Col had been obtained by seven backcrosses of flu Ler with Col wild type. Homozygous soldat8/flu F2 seedlings were distinguished from the wild type on agar plates under non-permissive dark/light conditions by their lighter green color. The soldat8 phenotype co-segregated with cleaved amplified polymorphic sequence (CAPS) and simple sequence length polymorphism (SSLP) markers in 120 F2 individuals, placing SOLDAT8 on chromosome 2 (Fig. 2A). For the subsequent fine mapping, the size of the mapping population was increased to a total of 470 F2 homozygous soldat8/flu plants. SOLDAT8 was located on a genomic fragment of approximately 55 kb (Fig. 2A). This fragment was sequenced and shown to contain 13 open reading frames. In one of the genes (At2g36990) encoding the chloroplast sigma factor SIGMA6, a single point mutation changing a thymine to a cytosine in the seventh exon of the gene was detected (Fig. 2A). This base pair exchange leads to a stop codon in amino acid position 354 within the conserved sigma 70-like r2 domain (Fujiwara et al. 2000). Transcripts of the mutated gene reached approximately 20–30% of the wild-type level (Fig. 2D). Fig. 2 View largeDownload slide Identification and isolation of the SOLDAT8 gene by map-based cloning, sequencing and complementation. (A) Map-based cloning of the SOLDAT8 gene. The gene was localized on a 54.9 kb fragment of chromosome 2. This fragment contained 14 open reading frames (red boxes). After sequencing, the gene At2g36990 encoding SIGMA6 was shown to carry a mutation in one of its nine exons (blue boxes) that leads to a premature stop codon (arrowhead). (B) Complementation of the mutation by the SOLDAT8 wild-type gene. Seedlings of the soldat8/flu double mutant complemented with the genomic SOLDAT8 gene behaved like the parental flu line, when grown under non-permissive dark/light conditions. (C) Selection of soldat8 mutants in the wild-type background by PCR analysis. soldat8/flu was crossed with the wild type and, among the F2 seedlings, soldat8 homozygous mutants (2) were distinguished from SOLDAT8 wild-type plants (1) and their DNAs were analyzed by using forward and wild-type-specific reverse (wt) or soldat8-specific reverse soldat8 primers. In a similar PCR analysis, flu- and FLU-specific reverse primers were used to identify homozygous soldat8/FLU plants. (D) Transcript levels of SIGMA6 in 4- and 10-day-old light-grown seedlings of soldat8 and the wild type. Fig. 2 View largeDownload slide Identification and isolation of the SOLDAT8 gene by map-based cloning, sequencing and complementation. (A) Map-based cloning of the SOLDAT8 gene. The gene was localized on a 54.9 kb fragment of chromosome 2. This fragment contained 14 open reading frames (red boxes). After sequencing, the gene At2g36990 encoding SIGMA6 was shown to carry a mutation in one of its nine exons (blue boxes) that leads to a premature stop codon (arrowhead). (B) Complementation of the mutation by the SOLDAT8 wild-type gene. Seedlings of the soldat8/flu double mutant complemented with the genomic SOLDAT8 gene behaved like the parental flu line, when grown under non-permissive dark/light conditions. (C) Selection of soldat8 mutants in the wild-type background by PCR analysis. soldat8/flu was crossed with the wild type and, among the F2 seedlings, soldat8 homozygous mutants (2) were distinguished from SOLDAT8 wild-type plants (1) and their DNAs were analyzed by using forward and wild-type-specific reverse (wt) or soldat8-specific reverse soldat8 primers. In a similar PCR analysis, flu- and FLU-specific reverse primers were used to identify homozygous soldat8/FLU plants. (D) Transcript levels of SIGMA6 in 4- and 10-day-old light-grown seedlings of soldat8 and the wild type. The complementation of the soldat8 mutation The identification of soldat8 was confirmed by complementing the soldat8/flu double mutant. A genomic fragment of the wild-type SOLDAT8 gene was stably integrated into the genome of the homozygous soldat8/flu double mutant by using Agrobacterium tumefaciens for transformation. Seeds of independent T3 homozygous lines were collected and germinated under light/dark cycles. The flu phenotype could easily be scored by the bleaching of seedlings. Wild-type and soldat8/flu double mutants developed similarly except that the Chl content of the double mutant reached only about 60–70% of that of wild-type seedlings and the size of chloroplasts of young mutant seedlings was reduced (data not shown). Seedlings of the soldat8/flu double mutant that had been transformed with the genomic fragment containing the wild-type SOLDAT8 gene were bleached and phenotypically indistinguishable from seedlings of the parental flu line (Fig. 2B). Thus, suppression of the 1O2-mediated cell death response of flu seedlings was caused by the impairment of the SIGMA6 subunit of plastid-encoded RNA polymerase (PEP). The characterization of soldat8 in the wild-type background The physiological consequences of the soldat8 mutation and the assessment of its possible impact on 1O2-mediated stress responses were determined in soldat8 mutants lacking the flu mutation. The soldat8/flu double mutant was crossed with wild-type (Ler), and homozygous soldat8 mutants in a wild-type background were selected in two steps from the segregating F2 generation of this cross. First, seedlings with lighter green cotyledons were identified as putative homozygous soldat8 mutants. In a second step, a PCR analysis was used to confirm the presence of two mutated alleles of the SOLDAT8 locus (Fig. 2C). There are six different sigma factors in Arabidopsis that confer different promoter specificities to the PEP during chloroplast gene transcription in response to various developmental and environmental cues (Allison 2000). Amongst them, SIGMA6 has been reported to act as a major sigma factor in chloroplasts during early development of light-grown seedlings (Ishizaki et al. 2005, Loschelder et al. 2006), but it may also be active in mature plants (Loschelder et al. 2006). Two null mutants had been described previously that lacked detectable transcript levels of SIGMA6 and had an impaired chloroplast development in light-grown seedlings. Cotyledons of sig6-1 were initially pale green, but reached Chl levels similar to those in the wild type after 8 d of seedling development (Ishizaki et al. 2005), whereas cotyledons of sig6-2 turned yellowish and finally white (Loschelder et al. 2006). The following true leaves of both mutants developed similarly to those of the wild type. Transcript levels of most PEP-dependent genes were greatly reduced in 4-day-old seedlings of these mutants, whereas the accumulation of nuclear-encoded RNA polymerase (NEP)-dependent transcripts generally increased. As soldat8 showed far less severe phenotypic changes than sig6-1 and sig6-2, it was of interest to compare the impact of soldat8 on plastid gene expression with those reported earlier for the two other sigma6 mutants. Global plastid gene expression in soldat8 and wild-type seedlings was first analyzed by using a DNA macroarray, containing 94 of the genes encoded by the plastid genome of Arabidopsis. Total RNA was extracted from 4- and 10-day-old seedlings of soldat8 and the wild type. Radioactively labeled cDNA obtained by reverse transcription of this RNA was used as a hybridization probe. The cDNA of each plastid gene on the filter was present in three different concentrations and in each case had been spotted in duplicate. Hybridizations were repeated three times and carried out with cDNA probes derived from three independent experiments. Results of one of these hybridization experiments are shown in Fig. 3A. The intensities of hybridization signals representing the same gene were averaged. For most genes, no drastic differences in transcript levels between the wild type and soldat8 mutant could be observed. Transcripts of only two of the genes were up-regulated at least 2-fold in 4-day-old mutant seedlings, encoding the D3 subunit of the NADPH chloroplast dehydrogenase complex (NDHC; 2.75 ± 0.06) and the chloroplast ribosomal protein RPL20 (2.72 ± 0.05) (Fig. 3B), and only one gene, encoding the proline-accepting tRNA (2.59 ± 0.23), was up-regulated in 10-day-old seedlings (Fig. 3C). Fig. 3 View largeDownload slide A comparison of chloroplast DNA transcript levels in 4- and 10-day-old soldat8 and wild-type (wt) seedlings of Arabidopsis. (A) Autoradiograms of chloroplast DNA arrays hybridized with soldat8 and wild-type (wt) cDNA samples. RNA extracted from wild-type and soldat8 4- and 10-day-old seedlings was reverse transcribed into cDNA, using radioactively labeled dCTP. The labeled cDNA was hybridized with nylon filters containing probes corresponding to 94 plastid genes. (B, C) The chloroplast DNA macroarray shown in (A) was used to quantify the transcript levels of 94 plastid genes in seedlings of soldat8 relative to those of the wild type on day 4 (B) and day 10 (C) of seedling development. Intensities of duplicate spots representing the same gene were averaged and expressed as percentages of the total signal on the array after subtracting the background. Each value represents the mean value of three independent experiments. Fig. 3 View largeDownload slide A comparison of chloroplast DNA transcript levels in 4- and 10-day-old soldat8 and wild-type (wt) seedlings of Arabidopsis. (A) Autoradiograms of chloroplast DNA arrays hybridized with soldat8 and wild-type (wt) cDNA samples. RNA extracted from wild-type and soldat8 4- and 10-day-old seedlings was reverse transcribed into cDNA, using radioactively labeled dCTP. The labeled cDNA was hybridized with nylon filters containing probes corresponding to 94 plastid genes. (B, C) The chloroplast DNA macroarray shown in (A) was used to quantify the transcript levels of 94 plastid genes in seedlings of soldat8 relative to those of the wild type on day 4 (B) and day 10 (C) of seedling development. Intensities of duplicate spots representing the same gene were averaged and expressed as percentages of the total signal on the array after subtracting the background. Each value represents the mean value of three independent experiments. In order to exclude the possibility that a limit in sensitivity of the method used for quantification was the reason for the apparent lack of more drastic transcript changes in the soldat8 mutant, transcript levels of 23 selected plastid genes, most of which had previously been shown to be up- or down-regulated in sig6-1 and sig6-2 mutants (Ishizaki et al. 2005, Loschelder et al. 2006), were analyzed by quantitative real-time PCR (Fig. 4A, B). For the majority of these selected plastid genes, transcript levels in 4- and 10-day-old soldat8 mutant seedlings were identical or very similar to those in wild-type control seedlings of the same age (Fig. 4A). In 4-day-old soldat8 seedlings, only transcripts of the two PEP-dependent genes, psbA encoding the D1 protein of the PSII reaction center and rrn16 encoding the 16S rRNA, were slightly down-regulated in soldat8 relative to the wild type, in contrast to the drastic down-regulation of these genes in sig6-1 and sig6-2. Transcripts of other PEP-dependent genes that were strongly affected in sig6-1 and sig6-2 reached similar levels in soldat8 and in the wild type. Transcripts of eight genes transcribed by the NEP of the plastid reached at least a ≥2-fold level in 4-day-old soldat8 compared with the wild-type controls (Fig. 4B). A similar up-regulation of these NEP-dependent transcripts had been described earlier in sig6-1 and sig6-2 (Ishizaki et al. 2005, Loschelder et al. 2006), in PEP-deficient mutants (Legen et al. 2002) and in sigma2 (sig2) knock-out mutants (Nagashima et al. 2004). Four of these genes encode the β subunit of acetyl-CoA carboxylase (ACCD), a caseinolytic protease (CLPP) and two hypothetical proteins (YCF2.1 and YCF2.2), whereas the remaining four encode subunits of PEP (RPOA, RPOB, RPOC1 and RPOC2) (Hess and Börner 1999) (Fig. 4B). Up-regulation of these genes occurred transiently in 4-day-old seedlings; in 10-day-old seedlings relative transcript levels, except for those of CLPP, had been reduced again and reached the levels of the wild-type controls (Fig. 4A). Hence, the mutant seems to compensate for the loss of SIGMA6 activity by enhancing the concentration of the PEP core enzyme. Since each of the remaining sigma factors may interact with PEP, transcript levels of the corresponding genes SIG1, SIG2, SIG3, SIG4 and SIG5 were determined in 4- and 10-day-old soldat8 seedlings and compared with those of wild-type controls. Transcripts of all five genes reached similar relative levels that did not differ from those of the controls (Fig. 5). Fig. 4 View largeDownload slide A comparison of transcript levels of a selected subset of plastid genes analyzed in 4- (black bars) and 10-day-old (white bars) seedlings of soldat8 relative to the corresponding wild-type levels by real-time PCR. (A) Most of the gene transcripts reached similar levels in 4- and 10-day-old seedlings of the wild type and soldat8. (B) For a total of eight genes, transcripts reached at least a 2-fold higher level in soldat8 than in the wild type of 4-day-old but not of 10-day-old seedlings, except for CLPP with higher transcript levels also in 10-day-old soldat8 seedlings. Fig. 4 View largeDownload slide A comparison of transcript levels of a selected subset of plastid genes analyzed in 4- (black bars) and 10-day-old (white bars) seedlings of soldat8 relative to the corresponding wild-type levels by real-time PCR. (A) Most of the gene transcripts reached similar levels in 4- and 10-day-old seedlings of the wild type and soldat8. (B) For a total of eight genes, transcripts reached at least a 2-fold higher level in soldat8 than in the wild type of 4-day-old but not of 10-day-old seedlings, except for CLPP with higher transcript levels also in 10-day-old soldat8 seedlings. Fig. 5 View largeDownload slide Expression of SIGMA genes of Arabidopsis during early seedling development. Transcript levels of SIGMA 1, 2, 3, 4 and 5 in soldat8 were expressed relative to wild-type levels in 4- (black bars) and 10-day-old (white bars) seedlings. The values represent means and standard deviations of three independent experiments. Fig. 5 View largeDownload slide Expression of SIGMA genes of Arabidopsis during early seedling development. Transcript levels of SIGMA 1, 2, 3, 4 and 5 in soldat8 were expressed relative to wild-type levels in 4- (black bars) and 10-day-old (white bars) seedlings. The values represent means and standard deviations of three independent experiments. The lower rrn16 transcript level in soldat8 may reduce the capacity of plastids to translate plastid-specific mRNAs and would be expected to affect primarily the concentration of chloroplast proteins with a high turnover rate. Immunodetection of several plastid-encoded proteins, such as the β and δ subunits of ATP synthase, the large subunit of ribulose 1,5 bisphosphate carboxylase and the D2 protein of the PSII reaction center, as well as major nuclear-encoded plastid proteins [light-harvesting complex II (LHCII), FLU protein, γ-subunit of ATP synthase, psbS subunit of PSII] revealed no obvious differences between soldat8 and wild-type seedlings grown in the light for either 4 or 10 d (Fig. 6). However, the concentration of the D1 protein of PSII was strongly reduced in 4-day-old soldat8 seedlings relative to the wild type, whereas in 10-day-old wild-type and soldat8 seedlings this protein reached similar levels that were significantly higher than in 4-day-old wild-type seedlings (Fig. 6). Among the proteins synthesized within chloroplasts, the D1 protein probably has the highest turnover rate. It forms part of the PSII core complex and plays a crucial role for photosynthetic electron transport and photoprotection of PSII (Andersson and Aro 2001). The deficiency of the D1 protein in 4-day-old seedlings of soldat8 would be expected to impact the activity of PSII and to enhance the sensitivity of seedlings to light stress. The functional state of PSII in intact wild-type and soldat8 mutant seedlings was assessed by measuring kinetics of Chl fluorescence induction with an imaging fluorometer in 3- to 7-day-old seedlings grown on agar plates under continuous light (Fig. 7A, B). The maximum quantum efficiency of PSII photochemistry, measured as the ratio of variable to maximum fluorescence (Fv/Fm), was reduced from 0.86 ± 0.009 in the wild type to 0.54 ± 0.004 in 3-day-old soldat8 mutant seedlings (Fig. 7A). This value in mutants rapidly increased during the following days, and in 5-day-old seedlings had reached a similar value to that in wild-type controls (Fig. 7A). Also the non-photochemical quenching (NPQ) was strongly impaired in 3-and 4-day-old seedlings of soldat8, but reached wild-type levels in older seedlings (Fig. 7B). Fig. 6 View largeDownload slide The effect of the soldat8 mutation on the levels of various plastid proteins in 4- and 10-day-old seedlings of the wild type and soldat8. Except for the D1 protein, which was hardly detectable in 4-day-old soldat8 seedlings, all other proteins reached similar levels in 4- and 10-day-old wild-type and soldat8 seedlings. Wild-type and soldat8 seedlings were grown under continuous light. The blots were incubated with specific antibodies and the immunoreactive bands were detected with horseradish peroxidase or alkaline phosphatase. Fig. 6 View largeDownload slide The effect of the soldat8 mutation on the levels of various plastid proteins in 4- and 10-day-old seedlings of the wild type and soldat8. Except for the D1 protein, which was hardly detectable in 4-day-old soldat8 seedlings, all other proteins reached similar levels in 4- and 10-day-old wild-type and soldat8 seedlings. Wild-type and soldat8 seedlings were grown under continuous light. The blots were incubated with specific antibodies and the immunoreactive bands were detected with horseradish peroxidase or alkaline phosphatase. Fig. 7 View largeDownload slide In vivo measurements of the maximum quantum efficiency of PSII and non-photochemical quenching (NPQ) in wild-type and soldat8 seedlings. (A) Changes of the maximum quantum efficiency of PSII, Fv/Fm, during seedling development of the wild type (gray bars) and soldat8 (white bars). (B) Changes of the NPQ during seedling development of the wild type (gray bars) and soldat8 (white bars). Fig. 7 View largeDownload slide In vivo measurements of the maximum quantum efficiency of PSII and non-photochemical quenching (NPQ) in wild-type and soldat8 seedlings. (A) Changes of the maximum quantum efficiency of PSII, Fv/Fm, during seedling development of the wild type (gray bars) and soldat8 (white bars). (B) Changes of the NPQ during seedling development of the wild type (gray bars) and soldat8 (white bars). Constitutive acclimation to light stress of soldat8 mutant seedlings Inhibition of PSII activity and the reduced NPQ capacity should enhance the susceptibility of soldat8 to light stress at the beginning of seedling development, even when grown under very low light. Minor stress is known to trigger an acclimatory response (Prasad et al. 1994, Chang et al., 2004, Ledford et al. 2007) that may enhance the resistance of soldat8 seedlings to a subsequent more severe stress. This prediction was tested experimentally by growing soldat8 and wild-type seedlings for 6 d at 20°C first under continuous very low light conditions (10 μmol m–2 s–1) to minimize the impact of light stress on the development of wild-type seedlings (Fig. 8A). Afterwards the light was switched off and over the next 4 h the temperature of the growth chamber was lowered to 4°C, before seedlings were re-exposed to a continuous light of higher intensity (250 μmol m–2s–1) and kept at 4°C for the next 72 h (Fig. 8A). Responses of seedlings were registered by measuring changes in the maximum quantum efficiency of PSII that may be due to stress-induced photoinhibition. The Fv/Fm values, ranging from > 0.8 for non-stressed plants down to 0 for fully bleached seedlings, were subdivided into seven groups (Fig. 8C, D). At the beginning of the combined low temperature/high light stress program, all mutant and wild-type seedlings were found in groups with Fv/Fm values between 0.65 and > 0.85, with soldat8 mutant seedlings having lower Fv/Fm values than the wild type. After 24 h of stress, Fv/Fm values of both the mutant and wild type were reduced, indicating that all seedlings suffered from light stress. Wild-type seedlings appeared to be more affected by light stress and the majority of them (80%) were found in the group covering Fv/Fm values between 0.35 and 0.45, whereas most of the soldat8 seedlings (65%) showed higher Fv/Fm values (Fig. 8C, D). Seedlings of soldat8 did not change their maximum quantum yield of PSII during the following 48 h and apparently were able to tolerate the continuous stress, whereas wild-type seedlings under the same conditions were severely affected and roughly 40% of them finally bleached and died. If this difference between the responses of wild-type and soldat8 seedlings to the combined low temperature/high light stress was due to a lack of stress acclimation in wild-type seedlings, an additional higher light pre-stress preceding the following more severe high light/low temperature treatment would be expected to enhance significantly the stress resistance of these seedlings. This prediction was tested with seedlings subjected to the same light program as used in the previous experiment, except that on the fifth day the low light treatment was interrupted by a brief 6 h high light treatment of 250 μmol m–2 s–1 at room temperature (Fig. 8B). At the beginning of the seventh day, plants were shifted to the dark for 4 h and at the same time the temperature was lowered from 20°C down to 4°C. Afterwards seedlings were re-exposed to a 25-fold higher light intensity than before the dark period, and for the next 72 h stress responses of plants were monitored by measuring Fv/Fm values and the percentage of bleached seedlings. After 72 h of combined high light/low temperature treatment, none of the pre-stressed wild-type seedlings was bleached anymore and their Fv/Fm values were significantly higher than in non-pre-stressed wild-type seedlings (compare Fig. 8C and D). The brief high light pre-treatment of wild-type seedlings was clearly effective in improving the seedlings’ ability to withstand the following more severe combined high light/low temperature stress. In soldat8 mutants exposed to the same pre-stress light treatment, the Fv/Fm values were slightly higher than in non-pre-stressed mutant seedlings at the end of the low light period (Fig. 8C, D), but both plant groups were equally well protected during the 72 h of high light/low temperature stress, suggesting that soldat8 plants without the pre-stress treatment were already acclimated. Fig. 8 View largeDownload slide The effect of a combined high light/low temperature stress on seedlings of the wild type and soldat8. (A, B) Seedlings were exposed to two different light/temperature regimes. During the first 6 d, seedlings were grown at room temperature under low light (10 μmol m–2 s–1) without (A) or with (B) a brief 6 h acclimatory high light treatment (250 μmol m–2 s–1) on day 5. On day 7, seedlings were shifted to the dark for 4 h and the temperature was lowered to +4°C. Afterwards seedlings were exposed to high light (250 μmol m–2 s–1) and low temperature. (C, D) In seedlings without (C) and with (D) a pre-stress photoinhibition, a decline of the maximum quantum efficiency of PSII in wild-type (black bars) and soldat8 (white bars) seedlings was measured. Fv/Fm values ranging from >0.8 (non-stressed seedlings) to 0 (bleached seedlings) were subdivided into seven classes (7 = ≥0.85, 6 = 0.75–0.85, 5 = 0.65–0.75, 4 = 0.55–0.65, 3 = 0.45–0.55, 2 = 0.35–0.45, 1 = 0). Values in (C, D) were taken from approximately 30 plants for each sample. Fig. 8 View largeDownload slide The effect of a combined high light/low temperature stress on seedlings of the wild type and soldat8. (A, B) Seedlings were exposed to two different light/temperature regimes. During the first 6 d, seedlings were grown at room temperature under low light (10 μmol m–2 s–1) without (A) or with (B) a brief 6 h acclimatory high light treatment (250 μmol m–2 s–1) on day 5. On day 7, seedlings were shifted to the dark for 4 h and the temperature was lowered to +4°C. Afterwards seedlings were exposed to high light (250 μmol m–2 s–1) and low temperature. (C, D) In seedlings without (C) and with (D) a pre-stress photoinhibition, a decline of the maximum quantum efficiency of PSII in wild-type (black bars) and soldat8 (white bars) seedlings was measured. Fv/Fm values ranging from >0.8 (non-stressed seedlings) to 0 (bleached seedlings) were subdivided into seven classes (7 = ≥0.85, 6 = 0.75–0.85, 5 = 0.65–0.75, 4 = 0.55–0.65, 3 = 0.45–0.55, 2 = 0.35–0.45, 1 = 0). Values in (C, D) were taken from approximately 30 plants for each sample. Discussion In the present work, the flu mutant of Arabidopsis has been used to study the biological activity of 1O2. We have exploited the ability of the flu mutant to accumulate free Pchlide in the dark that upon illumination acts as a photosensitizer and generates 1O2 by transferring light energy to ground-state, triplet molecular oxygen, thereby elevating it to the excited singlet state (Gollnick 1968). Previously, two stress responses of the flu mutant had been described, seedling lethality and growth inhibition of mature plants, which were triggered by the release of 1O2 within the plastid compartment (op den Camp et al. 2003). Under the experimental conditions used, these stress responses were not caused by the cytotoxicity of 1O2. This conclusion was based on the identification and characterization of the executer1 mutation that in flu abrogates both stress responses (Wagner et al. 2004). Here we have analyzed another group of second-site mutants of flu that suppress 1O2-mediated death of seedlings, but not the growth inhibition of mature plants. Nineteen soldat mutants were identified during an extensive second-site mutant screen, most of which were non-allelic and represented different genes, very much in contrast to the 15 executer/flu mutants isolated during the same screen, that had been shown previously to represent only a single gene, EXECUTER1 (Wagner et al. 2004). One of the soldat mutants, soldat8, encodes SIGMA6. Sigma factors are nuclear-encoded proteins that regulate promoter selectivity of PEP in chloroplasts of higher plants in response to different developmental and environmental cues (Allison 2000). In Arabidopsis, six different members of this protein family have been described (Isono et al. 1997, Tanaka et al. 1997, Fujiwara et al. 2000, Hakimi et al. 2000). Among these, SIGMA6 has been shown to act primarily during early seedling development (Ishizaki et al. 2005, Loschelder et al. 2006). Young seedlings of soldat8 showed a cotyledon-specific phenotype caused by slightly reduced amounts of Chl and a delay in chloroplast development. With increasing age, seedlings of soldat8 rapidly restored normal development and after 10 d were no longer distinguishable from the wild type. These observations support the proposed specific role of SIGMA6 during early seedling development and explain why suppression of 1O2-mediated stress responses by soldat8 was mainly affecting the seedling stage. There are at least two ways in which impairment of SIGMA6 in soldat8 could suppress 1O2-mediated stress responses of the flu mutant. Inactivation of SIGMA6 in the two null mutants sig6-1 and sig6-2 leads to a general severe disturbance of plastid development in light-grown seedlings (Ishizaki et al. 2005, Loschelder et al. 2006) due to the suppression of plastid genes essential for the assembly of photosynthetic membranes and Chl accumulation. Seedlings of sig6-1 and sig6-2 resemble other xantha- and albino-like mutants of Arabidopsis with a block of chloroplast development confined to cotyledons (Albrecht et al. 2006). Such a severe distortion of plastid development in young seedlings is likely to interfere with the overaccumulation of Pchlide in flu seedlings transferred from continuous light to the dark and 1O2 production during re-illumination of such seedlings. However, in contrast to sig6-1 and sig6-2, plastid development in young soldat8 seedlings is far less disturbed. Four-day-old soldat8 seedlings contained similar amounts to the wild type of major plastid proteins that form part of or are associated with photosynthetic membranes or accumulate within the stroma. Furthermore, after transfer to the dark, 4-day-old seedlings of soldat8/flu, similar to the parental flu line, overaccumulate excess amounts of free Pchlide and upon reillumination rapidly up-regulate 1O2-responsive stress-related nuclear genes. Collectively, these results indicate that suppression of 1O2-mediated stress responses in soldat8/flu seems not to be caused by a block in 1O2 production and/or 1O2-mediated control of nuclear genes involved in triggering 1O2-dependent visible stress responses of flu seedlings. Among the photosynthesis-related proteins whose concentrations were compared in seedlings of soldat8 and the wild type, the D1 protein was strongly affected. Its concentration was drastically reduced in 4-day-old mutant seedlings, whereas other proteins reached similar levels to those in the wild type. D1 is one of the core proteins of the reaction center of PSII that plays a key role in the photoinhibition–repair cycle of PSII (Andersson and Aro 2001). Photoinhibition has been associated with the release of ROS that have been suggested to inactivate PSII by direct interaction with the D1 protein (Sharma et al. 1997, Trebst 2003) or by inhibition of the repair of photodamaged PSII (Nishiyama et al. 2006). 1O2 is the main ROS that is continuously produced by PSII even under low light conditions (Keren et al. 1995, Jansen et al. 1999). The reduced amounts of the D1 protein in young soldat8 seedlings may be due to an increased degradation or a diminished synthesis of the protein, or a combination of both. In either case it would lead to an enhanced production of ROS by PSII that could cause photooxidative stress even at light intensities that have no apparent negative impact on wild-type seedlings. A possible impairment of PSII activity in young mutant seedlings grown under low light conditions was assessed by monitoring the Chl fluorescence changes in wild-type and mutant seedlings. The maximum quantum efficiency of PSII (Fv/Fm) of 3-day-old mutant seedlings was 30% lower than in the wild type. This reduced Fv/Fm value of young soldat8 seedlings indicates a partial inhibition of photosynthesis that correlates with the decreased amounts of the D1 protein. Chl fluorescence induction kinetics revealed higher levels of fluorescence in the mutant than in the wild type, indicating a reduced capacity of soldat8 to use light energy for photochemistry (data not shown). The mutant showed the same maximum fluorescence after a saturating light pulse as the wild type, but the basal level of fluorescence (Fo) was higher, resulting in lower Fv/Fm values. An increase in Fo has been interpreted as a reduction of the rate constant of energy trapping by PSII centers (Havaux 1993), which may be due to either physical dissociation of LHCs from the PSII core or a damaged PSII core. The dissociation of antenna from the core complex has been observed during heat stress, leading to an impairment of PSII and a higher Fo value (Armond et al. 1980). The reduced levels of D1 in young seedlings of soldat8, however, suggest that a lower activity of PSII core rather than a disturbed interaction between core and antenna of PSII might be the cause of the higher Fo values of the mutant. Collectively, these data suggest that light per se is a constant stress factor for soldat8 during early seedling development. Excess light may evoke an acclimatory response that enhances the plant's ability to anticipate and resist a more severe subsequent stress. For instance, acclimation to low levels of 1O2, medium intensity light, lower or higher temperatures and wounding have been shown to enhance the stress tolerance of the plants markedly (Vierling 1991, Prasad et al. 1994, Karpinski et al. 1999, Iida et al. 2000, Orozco-Cardenas et al. 2001, Chang et al. 2004, Ledford et al. 2007). This acclimation may not only provide protection against the same stress that initially was perceived by the plant but may also include cross-tolerance to other stresses (Wu et al. 1995, Bowler and Fluhr 2000, Funatsuki et al. 2003, Mateo et al. 2004, Ishikawa et al. 2005). The sublethal 6 h light stress during the initial growth at room temperature rendered wild-type seedlings more resistant to the subsequent, normally lethal combination of low temperature and high light stress. In soldat8 seedlings, however, this pre-stress treatment failed to improve the seedlings’ stress tolerance further. Seedlings of soldat8 without such a pre-stress treatment were already acclimated and reached a tolerance to the more severe stress similar to that of wild-type seedlings after they had been exposed to the sublethal pre-stress. This constitutive acclimation of soldat8 seedlings to light stress seems to mitigate the 1O2-mediated death response in the soldat8/flu double mutant. Materials and Methods Plant material All experiments were performed with A. thaliana ecotypes Ler and Col-0. Seeds were surface-sterilized and plated on Murashige and Skoog medium with 0.8% agar, supplemented with sucrose (5 g l–1). Light was provided by white light tubes (Philips Master TDL 36W, Philips Electronics NV, Eindhoven, The Netherlands and Sylvania Gro Lux F36W, SLI Lichtsysteme GmbH, Erlangen, Germany). Isolation of the soldat8 mutant To identify soldat8 mutants without the flu mutation, soldat8/flu double mutants were crossed with wild-type plants (Ler). Among the F2 progeny, putative homozygous soldat8 mutants were pre-selected based on the slightly pale green color of their cotyledons. Gene-specific primers for the soldat8 mutation (GCGAATCTGCATCCGGATTA) or for the wild type (GCGAATCTGCATCCGGATTG) in combination with a wild-type reverse primer (GATGATGCGCTTCAGCTCT) were used to confirm this identification by PCR analysis. In a second step, the same samples were tested for the presence of the wild-type FLU genes using gene-specific primers for the flu mutation (CCAAGGGAAGTATAGGGAAGT) or for the FLU wild-type gene (CCAAGGGAAGTATAGGGAAGC) and a wild-type reverse primer (GGCAATTGGCACTTAAGATGGC). Identification and complementation of the soldat8 mutation The SOLDAT8 locus was mapped on chromosome 2 using CAPS or SSLP markers listed in The Arabidopsis Information Resource database (TAIR, www.Arabidopsis.org). Additional markers used for the mapping were designed based on the collection of predicted Arabidopsis single nucleotide polymorphisms (SNPs) and small insertions/deletions (INDELs) in the publicly available Col-0 and Ler sequences generated by Monsanto (http://www.Arabidopsis.org/Cereon). The 54.9 kb genomic fragment flanked by the two closest markers which could be mapped was sequenced. Overlapping primers covering the whole fragment were designed and PCR was performed on genomic DNA from the soldat8/flu double mutant and flu, which served as a control. The amplified products were purified and approximately 100 ng of DNA per sample was sequenced by Microsynth (Balgach, Switzerland). Sequences were compared with those of the sequenced Arabidopsis genome, using the SeqViewer tool from TAIR. Specific primers flanking the SOLDAT8 genomic sequence, including the promoter regions, were used for amplification. The correct amplification was confirmed by sequencing the fragments. The genomic PCR product was cloned in the pCambia 3300 plasmid, and selected clones were transferred by electroporation to A. tumefaciens C58C1 cells. Homozygous soldat8/flu double mutant plants grown under continuous light on soil were transformed as described (Clough and Bent 1998). Primary transformants were selected on Basta-containing medium (25 μg Basta ml–1). Vernalized T2 seeds were sown on MS-Basta medium and the percentage of Basta-resistant seedlings per transgenic line was calculated. Lines with a 3 : 1 ratio of segregating Basta-resistant seedlings, corresponding to one copy of the inserted transgene, were selected. Chloroplast gene macroarrays A total of 94 plastid genes of Arabidopsis encoding photosynthetic proteins, rRNAs and tRNAs were amplified by PCR using gene-specific primer pairs. Genomic DNA of the wild type (Col) was used as a template. The genes were amplified using a standard PCR protocol with the following conditions: 30 cycles including 20 s denaturation at 94°C, 1 min annealing at 60°C and 1 min elongation at 72°C. The purified PCR products were diluted into three different concentrations (30, 7.5 and 1.87 g μl–1, respectively). The 94 probes were spotted onto the 11.9 cm×7.8 cm positively charged nylon membrane (Hybond™-N+ Amersham Pharmacia Biotech, Freiburg, Germany) by using a 96-pin tool [0.4 mm pins with a BioGrid spotting Device-Roboter (BioRobotics, UK)]. Each probe was spotted 20 times in order to obtain final DNA quantities of 1.25, 5 or 20 ng per sample on the different spots. Three different concentrations of one gene were spotted in duplicate onto the filters. The spotted membranes were denaturated in 1.5 M NaCl, 0.5 M NaOH and afterwards neutralized in 0.5 M Tris–HCl pH 7.2, 1 M NaCl. The filters were subsequently cross-linked using 120 mJ of UV light (302 nm) (Stratalinker UV crosslinker 1800; Stratagene, La Jolla, CA, USA) and dried. Before hybridization, the filters were incubated at 65°C for 1 h in 10 ml of 0.25 M Na2HPO4 pH 7.2, 7% SDS. Total RNA from the wild type and soldat8 grown for either 4 or 10 d under continuous light was used to synthesize [α-32P]dCTP-labeled DNAs with hexanucleotides (Roche, Mannheim, Germany) using the SuperScript T11 III RNase H– Reverse Transcriptase (Invitrogen, Karlsruhe, Germany). After hybridization, the washed filters were exp-osed to phosphor image plates for at least 3 d. The radioactive images were scanned with a FLA-3000 phosphoimager (Fuji, Tokyo, Japan) and the obtained signals were imported to the AIDA Image Analyzer (3.25) software for background correction and normalization. The background noise was corrected after alignment and integration of the spots. For background subtraction, the mean value of three selected background dots within a subgrid containing six spots of a gene probe was calculated. Their intensity values were averaged and then used as a background value to all spots of the subgrid. Afterwards, all spots in a filter were used to calculate the normalization constant. The intensity value of the spots corresponding to a particular gene was compared between the wild type and the mutant using the software AIDA Array Compare 3.25 (raytest Isotopenmeßgeräte GmbH, Straubenhardt, Germany). RNA isolation and real-time PCR analysis Seedlings were frozen in liquid nitrogen and ground to a fine powder with a mortar and a pestle. A 50–100 mg aliquot of powder was transferred to a 2 ml Eppendorf tube, and 1 ml of TRIZOL® Reagent (Invitrogen AG, Basel, Switzerland) was added. The tubes were centrifuged at 11,400 r.p.m. for 15 min at 4°C (Eppendorf 5402) and the supernatants were transferred to a new tube. Chloroform was added (300 μl) and vortex was applied for 15 s. The samples were centrifuged again at 11,400 r.p.m. for 15 min at 4°C and the aqueous phase was transferred to a new tube. After the addition of 750 μl of isopropanol, the samples were incubated for 10 min at room temperature and centrifuged at 11,400 r.p.m. for 10 min at 4°C. After washing the pellet with 1 ml of 75% ethanol, the samples were centrifuged at 9,000 rpm for 5 min at 4°C. The pellet was air-dried and dissolved in 150 μl of RNase-free water. The RNA concentration was calculated according to Sambrook et al. (1989). To assess the quality of RNA, an aliquot containing 2 μg was loaded on a 2% agarose gel. The RNA was stored at –80°C. Real-time PCR was done as described previously by Danon et al. (2005). In vivo measurement of photosynthetic activity Chl a fluorescence measurements were used as a non-invasive technique to monitor photosynthetic processes in plants. The FluorCam System (Photon Systems Instruments, Brno, Czech Republic) is equipped with a sample chamber containing a CCD video camera and an irradiation system. The standard quenching analysis protocol provided by FluorCam calculates the maximum quantum efficiency of PSII and non-photochemical and photochemical quenching. For the quenching analysis of modulated fluorescence by the saturation pulse method, seedlings were first dark-adapted for 15 min. After applying a weak measuring beam for 2 s to obtain the minimum level of fluorescence (Fo), a first saturating pulse (0.8 s at 2,000 μmol m–2 s–1) raised the fluorescence to its maximum level (Fm). After 1 min dark relaxation, constant actinic light (350 μmol m–2 s–1 at 50% of intensity) was switched on and saturating pulses were applied during 1 min at intervals of 10 s. The minimum fluorescence value (Fo′) was calculated after switching off the actinic light. Other methods Chemical mutagenesis of seeds from flu mutant plants with ethylmethanesulfonate (EMS) was performed as described previously (Wagner et al. 2004). For visualization of Pchlide accumulation, etiolated seedlings from the wild type, flu and soldat8/flu were illuminated with blue light and examined under a Leica MZ12 fluorescence microscope with a Leica FM blue 10446146 filter (Leica Microsystems AG, Wetzlar, Germany). The bright red fluorescence emitted by the mutant is caused by the excitation of free Pchlide. Pchlide determination by HPLC and separation and immunodetection of proteins were done as decribed in Goslings et al. (2004). Funding The Swiss Federal Institute of Technology (K.A.); the Swiss National Science Foundation (K.A.); the Deutsche Forschungsgemeinschaft SFB TR1 (J.M.). Acknowledgments We are indebted to Dr. Dieter Rubli for art work, to André Imboden for taking care of plants, and to members of our group for many helpful discussions during the completion of this work. References Albrecht V,  Ingenfeld A,  Apel K.  Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: the impact of chloroplast elongation factor G on chloroplast development and and plant vitality.,  Plant Mol. Biol ,  2006, vol.  60 (pg.  507- 518) Google Scholar CrossRef Search ADS PubMed  Allison LA.  The role of sigma factors in plastid transcription.,  Biochimie ,  2000, vol.  82 (pg.  537- 548) Google Scholar CrossRef Search ADS PubMed  Andersson B,  Aro E.-M.  Aro E.-M,  Andersson B.  Photodamage and D1 protein turnover in photosystem II. In,  Regulation of Photosynthesis. ,  2001 Dordrecht, The Netherlands Kluwer Academic Publishers(pg.  377- 393) Apel K,  Hirt H.  Reactive oxygen species: metabolism, oxidative stress, and signal transduction.,  Annu. Rev. Plant Biol. ,  2004, vol.  55 (pg.  373- 399) Google Scholar CrossRef Search ADS PubMed  Armond PA,  Bjorkman O,  Staehelin LA.  Dissociation of supramolecular complexes in chloroplast membranes. A manifestation of heat damage to the photosynthetic apparatus.,  Biochim. Biophys. Acta ,  1980, vol.  601 (pg.  433- 443) Google Scholar CrossRef Search ADS PubMed  Asada K.  The water–water cycle in chloroplasts: scavenging of active oxygens and dissipation of excess photons.,  Annu. Rev. Plant Physiol. Plant Mol. Biol. ,  1999, vol.  50 (pg.  601- 639) Google Scholar CrossRef Search ADS PubMed  Barber J,  Andersson B.  Too much of a good thing: light can be bad for photosynthesis.,  Trends Biochem. Sci. ,  1992, vol.  17 (pg.  61- 66) Google Scholar CrossRef Search ADS PubMed  Bowler C,  Fluhr R.  The role of calcium and activated oxygens as signals for controlling cross-tolerance.,  Trends Plant Sci. ,  2000, vol.  5 (pg.  241- 246) Google Scholar CrossRef Search ADS PubMed  Chang CC,  Ball L,  Fryer MJ,  Baker NR,  Karpinski S,  Mullineaux PM.  Induction of ASCORBATE PEROXIDASE 2 expression in wounded Arabidopsis leaves does not involve known wound-signalling pathways but is associated with changes in photosynthesis.,  Plant J. ,  2004, vol.  38 (pg.  499- 511) Google Scholar CrossRef Search ADS PubMed  Clough SJ,  Bent AF.  Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana.,  Plant J. ,  1998, vol.  16 (pg.  735- 743) Google Scholar CrossRef Search ADS PubMed  Danon A,  Miersch O,  Felix G,  Camp RG,  Apel K.  Concurrent activation of cell death-regulating signaling pathways by singlet oxygen in Arabidopsis thaliana.,  Plant J. ,  2005, vol.  41 (pg.  68- 80) Google Scholar CrossRef Search ADS PubMed  Dat JF,  Inze D,  Van Breusegem F.  Catalase-deficient tobacco plants: tools for in planta studies on the role of hydrogen peroxide.,  Redox Rep. ,  2001, vol.  6 (pg.  37- 42) Google Scholar CrossRef Search ADS PubMed  Foyer CH,  Noctor G.  Oxygen processing in photosynthesis: regulation and signalling.,  New Phytol. ,  2000, vol.  146 (pg.  359- 388) Google Scholar CrossRef Search ADS   Fujiwara M,  Nagashima A,  Kanamaru K,  Tanaka K,  Takahashi H.  Three new nuclear genes, sigD, sigE and sigF, encoding putative plastid RNA polymerase [sigma] factors in Arabidopsis thaliana.,  FEBS Lett. ,  2000, vol.  481 (pg.  47- 52) Google Scholar CrossRef Search ADS PubMed  Funatsuki H,  Kurosaki H,  Murakami T,  Matsuba S,  Kawaguchi K,  Yumoto S, et al.  Deficiency of a cytosolic ascorbate peroxidase associated with chilling tolerance in soybean.,  Theor. Appl. Genet. ,  2003, vol.  106 (pg.  494- 502) Google Scholar PubMed  Girotti AW.  Photosensitized oxidation of membrane lipids: reaction pathways, cytotoxic effects, and cytoprotective mecha-nisms.,  J. Photochem. Photobiol. B ,  2001, vol.  63 (pg.  103- 113) Google Scholar CrossRef Search ADS PubMed  Gollnick K.  Type II photooxygenation reactions in solution.,  Adv. Photochem. ,  1968, vol.  6 (pg.  1- 122) Goslings D,  Meskauskiene R,  Kim C,  Lee KP,  Nater M,  Apel K.  Concurrent interactions of heme and FLU with Glu tRNA reductase (HEMA1), the target of metabolic feedback inhibition of tetrapyrrole biosynthesis, in dark- and light-grown Arabidopsis plants.,  Plant J. ,  2004, vol.  40 (pg.  957- 967) Google Scholar CrossRef Search ADS PubMed  Griffiths WT.  Reconstitution of chlorophyllide formation by isolated etioplast membranes.,  Biochem. J. ,  1978, vol.  174 (pg.  681- 692) Google Scholar CrossRef Search ADS PubMed  Hakimi MA,  Privat I,  Valay JG,  Lerbs-Mache S.  Evolutionary conservation of C-terminal domains of primary sigma(70)-type transcription factors between plants and bacteria.,  J. Biol. Chem. ,  2000, vol.  275 (pg.  9215- 9221) Google Scholar CrossRef Search ADS PubMed  Havaux M.  Characterisation of thermal damage to the photosynthetic electron transport system in potato leaves.,  Plant Sci. ,  1993, vol.  94 (pg.  19- 33) Google Scholar CrossRef Search ADS   Hess WR,  Börner T.  Organellar RNA polymerases of higher plants.,  Int. Rev. Cytol. ,  1999, vol.  190 (pg.  1- 59) Google Scholar PubMed  Iida A,  Kazuoka T,  Torikai S,  Kikuchi H,  Oeda K.  A zinc finger protein RHL41 mediates the light acclimatization response in Arabidopsis.,  Plant J. ,  2000, vol.  24 (pg.  191- 203) Google Scholar CrossRef Search ADS PubMed  Ishikawa T,  Morimoto Y,  Madhusudhan R,  Sawa Y,  Shibata H,  Yabuta Y, et al.  Acclimation to diverse environmental stresses caused by a suppression of cytosolic ascorbate peroxidase in tobacco BY-2 cells.,  Plant Cell Physiol. ,  2005, vol.  46 (pg.  1264- 1271) Google Scholar CrossRef Search ADS PubMed  Ishizaki Y,  Tsunoyama Y,  Hatano K,  Ando K,  Kato K,  Shinmyo A, et al.  A nuclear-encoded sigma factor, Arabidopsis SIG6, recognizes sigma-70 type chloroplast promoters and regulates early chloroplast development in cotyledons.,  Plant J. ,  2005, vol.  42 (pg.  133- 144) Google Scholar CrossRef Search ADS PubMed  Isono K,  Shimizu M,  Yoshimoto K,  Niwa Y,  Satoh K,  Yokota A, et al.  Leaf-specifically expressed genes for polypeptides destined for chloroplasts with domains of sigma70 factors of bacterial RNA polymerases in Arabidopsis thaliana.,  Proc. Natl Acad. Sci. USA ,  1997, vol.  94 (pg.  14948- 14953) Google Scholar CrossRef Search ADS   Jansen MA,  Mattoo AK,  Edelman M.  D1–D2 protein degradation in the chloroplast. Complex light saturation kinetics.,  Eur. J. Biochem. ,  1999, vol.  260 (pg.  527- 532) Google Scholar CrossRef Search ADS PubMed  Karpinski S,  Reynolds H,  Karpinska B,  Wingsle G,  Creissen G,  Mullineaux PM.  Systemic signalling and acclimation in response to excess excitation energy in Arabidopsis.,  Science ,  1999, vol.  284 (pg.  654- 657) Google Scholar CrossRef Search ADS PubMed  Keren N,  Gong H,  Ohad I.  Oscillations of reaction center II-D1 protein degradation in vivo induced by repetitive light flashes. Correlation between the level of RCII-QB- and protein degradation in low light.,  J. Biol. Chem. ,  1995, vol.  270 (pg.  806- 814) Google Scholar CrossRef Search ADS PubMed  Ledford HK,  Chin BL,  Niyogi KK.  Acclimation to singlet oxygen stress in Chlamydomonas reinhardtii.,  Eukaryot. Cell ,  2007, vol.  6 (pg.  919- 930) Google Scholar CrossRef Search ADS PubMed  Ledford HK,  Niyogi KK.  Singlet oxygen and photo-oxidative stress management in plants and algae.,  Plant Cell Environ. ,  2005, vol.  28 (pg.  1037- 1045) Google Scholar CrossRef Search ADS   Legen J,  Kemp S,  Krause K,  Profanter B,  Herrmann RG,  Maier RM.  Comparative analysis of plastid transcription profiles of entire plastid chromosomes from tobacco attributed to wild-type and PEP-deficient transcription machineries.,  Plant J. ,  2002, vol.  31 (pg.  171- 188) Google Scholar CrossRef Search ADS PubMed  Loschelder H,  Schweer J,  Link B,  Link G.  Dual temporal role of plastid sigma factor 6 in Arabidopsis development.,  Plant Physiol. ,  2006, vol.  142 (pg.  642- 650) Google Scholar CrossRef Search ADS PubMed  Macpherson A,  Telfer A,  Barber A,  Truscot T.  Direct detection of singlet oxygen from isolated photosystem II reaction centers.,  Biochim. Biophys. Acta ,  1993, vol.  1143 (pg.  301- 309) Google Scholar CrossRef Search ADS   Mateo A,  Muhlenbock P,  Rusterucci C,  Chang C.C.-C,  Miszalski Z,  Karpinska B, et al.  LESION SIMULATING DISEASE 1 is required for acclimation to conditions that promote excess excitation energy.,  Plant Physiol. ,  2004, vol.  136 (pg.  2818- 2830) Google Scholar CrossRef Search ADS PubMed  Meskauskiene R,  Nater M,  Goslings D,  Kessler F,  op den Camp R,  Apel K.  FLU: a negative regulator of chlorophyll biosynthesis in Arabidopsis thaliana.,  Proc. Natl Acad. Sci. USA ,  2001, vol.  98 (pg.  12826- 12831) Google Scholar CrossRef Search ADS   Nagashima A,  Hanaoka M,  Motohashi R,  Seki M,  Shinozaki K,  Kanamaru K, et al.  DNA microarray analysis of plastid gene expression in an Arabidopsis mutant deficient in a plastid transcription factor sigma, SIG2.,  Biosci. Biotechnol. Biochem. ,  2004, vol.  68 (pg.  694- 704) Google Scholar CrossRef Search ADS PubMed  Nishiyama Y,  Allakhverdiev SI,  Murata N.  A new paradigm for the action of reactive oxygen species in the photoinhibition of photosystem II.,  Biochim. Biophys. Acta ,  2006, vol.  1757 (pg.  742- 749) Google Scholar CrossRef Search ADS PubMed  Niyogi KK.  Photoprotection revisited: genetic and molecular approaches.,  Annu. Rev. Plant Physiol. Plant Mol. Biol. ,  1999, vol.  50 (pg.  333- 359) Google Scholar CrossRef Search ADS PubMed  op den Camp RG,  Przybyla D,  Ochsenbein C,  Laloi C,  Kim C,  Danon A, et al.  Rapid induction of distinct stress responses after the release of singlet oxygen in Arabidopsis.,  Plant Cell ,  2003, vol.  15 (pg.  2320- 2332) Google Scholar CrossRef Search ADS PubMed  Orozco-Cardenas ML,  Narvaez-Vasquez J,  Ryan CA.  Hydrogen peroxide acts as a second messenger for the induction of defense genes in tomato plants in response to wounding, systemin, and methyl jasmonate.,  Plant Cell ,  2001, vol.  13 (pg.  179- 191) Google Scholar CrossRef Search ADS PubMed  Prasad TK,  Anderson MD,  Martin BA,  Stewart CR.  Evidence for chilling-induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide.,  Plant Cell ,  1994, vol.  6 (pg.  65- 74) Google Scholar CrossRef Search ADS PubMed  Przybyla D,  Göbel C,  Imboden A,  Hamberg M,  Feussner I,  Apel K.  Enzymatic, but not non-enzymatic 1O2-mediated peroxidation of polyunsaturated fatty acids forms part of the EXECUTER1-dependent stress response program in the flu mutant of Arabidopsis thaliana.,  Plant J. ,  2008, vol.  54 (pg.  236- 248) Google Scholar CrossRef Search ADS PubMed  Rebeiz CA,  Montazer-Zouhoor A,  Mayasich ZM,  Tripathy BC,  Wu SM,  Rebeiz CC.  Photodynamic herbicides: recent development and molecular basis of selectivity.,  CRC Crit. Rev. Plant Sci. ,  1988, vol.  6 (pg.  385- 406) Google Scholar CrossRef Search ADS   Sambrook J,  Fritsch EF,  Maniatis T.  Molecular Cloning:,  A Laboratory Manual,. ,  1989 2nd Cold Spring Harbor, NY Cold Spring Harbor Laboratory Press Sharma J,  Panico M,  Barber J,  Morris HR.  Characterization of the low molecular weight photosystem II reaction center subunits and their light-induced modifications by mass spectrometry.,  J. Biol. Chem. ,  1997, vol.  272 (pg.  3935- 3943) Google Scholar CrossRef Search ADS PubMed  Tanaka K,  Tozawa Y,  Mochizuki N,  Shinozaki K,  Nagatani A,  Wakasa K, et al.  Characterization of three cDNA species encoding plastid RNA polymerase sigma factors in Arabidopsis thaliana: evidence for the sigma factor heterogeneity in higher plant plastids.,  FEBS Lett. ,  1997, vol.  413 (pg.  309- 313) Google Scholar CrossRef Search ADS PubMed  Trebst A.  Function of β-carotene and tocopherol in photosystem II.,  Z. Naturforsch. ,  2003, vol.  58c (pg.  609- 620) Vierling E.  The roles of heat shock proteins in plants.,  Annu. Rev. Plant Physiol. Plant Mol. Biol. ,  1991, vol.  42 (pg.  579- 620) Google Scholar CrossRef Search ADS   Wagner D,  Przybyla D,  Op den Camp R,  Kim C,  Landgraf F,  Lee KP, et al.  The genetic basis of singlet oxygen-induced stress responses of Arabidopsis thaliana.,  Science ,  2004, vol.  306 (pg.  1183- 1185) Google Scholar CrossRef Search ADS PubMed  Wu G,  Shortt BJ,  Lawrence EB,  Levine EB,  Fitzsimmons KC,  Shah DM.  Disease resistance conferred by expression of a gene encoding H2O2-generating glucose oxidase in transgenic potato plants.,  Plant Cell ,  1995, vol.  7 (pg.  1357- 1368) Google Scholar PubMed  Abbreviations: Abbreviations: CAPS cleaved amplified polymorphic sequence LHC light-harvesting complex NEP nuclear-encoded RNA polymerase NPQ non-photochemical quenching Pchlide protochlorophyllide PEP plastid-encoded RNA polymerase ROS reactive oxygen species SSLP simple sequence length polymorphism. © The Author 2009. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org
TI - Characterization of soldat8, a Suppressor of Singlet Oxygen-Induced Cell Death in Arabidopsis Seedlings
JO - Plant and Cell Physiology
DO - 10.1093/pcp/pcp036
DA - 2009-03-08
UR - https://www.deepdyve.com/lp/oxford-university-press/characterization-of-soldat8-a-suppressor-of-singlet-oxygen-induced-e30r6owFGK
SP - 707
EP - 718
VL - 50
IS - 4
DP - DeepDyve
ER -