TY - JOUR
AU - Pang, D.
AB - ABSTRACT Myostatin is expressed in skeletal muscle tissue where it functions to suppress myoblast proliferation and myofiber hypertrophy. Recently, myostatin was detected in the tendon, mammary gland, and adipose tissue of mice. We sought to determine whether myostatin is expressed in the liver, spleen, lung, and kidney of pigs. Real-time PCR and Western blots demonstrated that myostatin, follistatin, decorin, and activin receptor IIB (ActRIIB) mRNA and proteins were expressed in skeletal muscle, heart muscle, and adipose tissue, and also in liver, spleen, lung, kidney, and cultured fibroblasts. The relative abundance of myostatin was closely related to follistatin and decorin in porcine tissues. Immunohistochemical analysis further demonstrated the presence of myostatin, follistatin, and decorin in the skeletal muscle, adipose tissue, heart muscle, liver, spleen, lung, and kidney of pigs. These results suggest that myostatin could be associated with certain functions of the internal organs, such as energy metabolism or fibrosis. We conclude that myostatin is a factor broadly expressed in the internal organs and muscle tissues of pigs. INTRODUCTION Myostatin, also known as growth and differentiation factor-8 (GDF-8), is a member of the transforming growth factor-β (TGF-β) superfamily and was identified in 1997 (McPherron et al., 1997). The major role of myostatin is to suppress skeletal muscle growth and development. Genetic disruption of myostatin causes a dramatic increase in muscle mass in animals (McPherron and Lee, 1997; Welle et al., 2009; Boman et al., 2010) and humans (Schuelke et al., 2004). Manipulation of myostatin activity as a means to promote muscle growth and improve disease phenotypes in a variety of myopathies, including the muscular dystrophies and degenerative and metabolic diseases, has been raised (Liu et al., 2008; Nakatani et al., 2008; Qiao et al., 2008). Endogenous inhibitors of myostatin, including follistatin (Lee, 2004), decorin (Kishioka et al., 2008), and myostatin propeptide (Qiao et al., 2009), promote accretion of muscle mass and proliferation of myogenic cells. Furthermore, blocking myostatin function may be useful for slowing or preventing the development of type 2 diabetes (McPherron and Lee, 2002) and obesity (Choi et al., 2007). Many types of animal tissues and cells are reported to express myostatin, and its expression influences their functions to some extent. In addition to regulating skeletal muscle mass, myostatin regulates the structure and function of tendons (Mendias et al., 2008). Myostatin is expressed in the mouse mammary gland (Manickam et al., 2008). In addition to the tendons and mammary gland, myostatin is expressed in the porcine anterior pituitary gland (Taketa et al., 2008) and rat uterus (Ciarmela et al., 2009). Therefore, we hypothesized that myostatin expression has a broad tissue distribution in pigs. The overall aims of this study were to assess myostatin mRNA and protein expression and its localization in porcine skeletal muscle, adipose tissue, heart muscle, liver, spleen, lung, kidney, and fibroblasts. Tissue contents of myostatin mRNA and protein were compared with the relative abundances of follistatin and decorin, negative regulators of myostatin activity. MATERIALS AND METHODS Animals used in the study were cared for according to the guidelines of the Jilin Province Animal Embryo Engineering Key Laboratory Institutional Animal Care and Use Committee. Animals The animals used were healthy Large White pigs at the age of 6 mo. The porcine fetuses were 32 d of gestation and the heterozygous myostatin+/− pigs were 1.5 mo of age. The wild-type littermates of the heterozygous myostatin+/− pigs served as controls. Heterozygous myostatin+/− was generated by replacing a portion of the third exon of the myostatin gene with a neomycin cassette (McPherron et al., 1997). The heterozygous myostatin+/− pigs were established as described previously (Lai et al., 2002). The genotype of pigs was determined by PCR-based analysis of DNA samples obtained via umbilical cord biopsy (Mendias et al., 2008). Sampling of Porcine Tissues and Isolating and Culturing of Pig Fibroblasts Six healthy Large White pigs (embryo donors; >100 kg of BW), 3 heterozygous myostatin+/− pigs, and 3 wild-type littermates (14 ± 2 kg of BW) were euthanized and the tissues removed for experimental purposes. Specimens were immediately immersed in liquid N for RNA and protein extraction, or placed in 10% neutral formaldehyde fixative for immunohistochemistry. Porcine fetal fibroblasts were isolated from fetuses of 32 d of gestation, as described previously (Li et al., 2009). The fibroblasts were cultured at 39°C in Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA), supplemented with 10% fetal bovine serum (PAA, Pasching, Austria). RNA Isolation and Quantitative Real-Time RCR Total RNA was extracted from the frozen porcine tissues and fibroblast samples using the TRIzol reagent method (Invitrogen) following the manufacturer's instructions. Total RNA was solubilized in RNase-free H2O, incubated in DNase I (Fermentas China, Shenzhen, China) to remove any DNA, and quantified by measuring optical density at 260 nm. The RNA purity was estimated by obtaining a 260/280 nm optical density ratio of 1.8 to 2.0, and RNA integrity was assessed by agarose gel electrophoresis for all samples. First-strand cDNA was synthesized in a volume of 10 μL using 1 μg of total RNA and reverse-transcription reagents (Bioer Technology, Hangzhou, China). The cDNA obtained was used as a template for real-time PCR expression analysis. At the same time, negative control reactions in the absence of reverse transcriptase were performed to exclude the possibility of genomic DNA contamination by real-time PCR in each RNA sample, and reactions were performed in triplicate. A sample without cDNA template was amplified in triplicate to verify that master mixture was free from contamination. Real-time PCR reactions were performed in an Mx3000P Real-time PCR System (Stratagene, La Jolla, CA) using SYBR Green detection (Bioer Technology). All real-time PCR procedures were run in triplicate to correct for variances in loading. Standard curves for both targets and the endogenous reference gene were created on the basis of the linearity of amplification to confirm the acceptable slope values (included between −3.55 and −3.20) and almost equal efficiencies. All PCR efficiencies were found to be adequate. The PCR cycling conditions used were as follows: 40 cycles at 94°C for 2 min, 94°C for 10 s, 60°C for 15 s, and 72°C for 30 s. The PCR primers were designed using Primer 5 software (Applied Biosystems, Foster City, CA). All of the primer sequences are listed in Table 1. When possible, primers were designed to span introns to minimize nonspecific fluorescence signals due to contaminating genomic DNA. Each primer pair yielded a single peak in the melting curve. Identities of the PCR products were confirmed by DNA sequencing. Relative gene expression was calculated using the comparative Ct method with the formula 2−ΔΔCt (Livak and Schmittgen, 2001). After measuring the stability of endogenous control genes using the 2−ΔCt test in the samples, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference to normalize quantification of an mRNA target, and all experiments were repeated using a second endogenous control gene (β-actin) to validate the results obtained with GAPDH (data shown in the figures refer to normalization with GAPDH only). Table 1. Genes, primer sequences, and amplicon sizes Gene1  Primer  Sequence (5′ to 3′)  GenBank accession number  Amplicon size, bp  Myostatin  Forward  GATTATCACGCTACGACGGA  AY448008  269    Reverse  CCTGGGTTCATGTCAAGTTTC      Follistatin  Forward  AGTGACAATGCCACCTACGC  M19529.1  118    Reverse  CCTCGGTGTCTTCTGAAATGG      Decorin  Forward  ATCACCAAAGTGCGAAAGGC  AF125537  144    Reverse  GTCAGCGATGCGGATGTAGG      ActRIIB  Forward  GCATCGCAAGCCTCCCTAT  NM_001005350.1  256    Reverse  CTGTAGCAGGTTCTCGTGCTTC      GAPDH  Forward  GCCATCACCATCTTCCAGG  AF017079  190    Reverse  TCACGCCCATCACAAACAT      Gene1  Primer  Sequence (5′ to 3′)  GenBank accession number  Amplicon size, bp  Myostatin  Forward  GATTATCACGCTACGACGGA  AY448008  269    Reverse  CCTGGGTTCATGTCAAGTTTC      Follistatin  Forward  AGTGACAATGCCACCTACGC  M19529.1  118    Reverse  CCTCGGTGTCTTCTGAAATGG      Decorin  Forward  ATCACCAAAGTGCGAAAGGC  AF125537  144    Reverse  GTCAGCGATGCGGATGTAGG      ActRIIB  Forward  GCATCGCAAGCCTCCCTAT  NM_001005350.1  256    Reverse  CTGTAGCAGGTTCTCGTGCTTC      GAPDH  Forward  GCCATCACCATCTTCCAGG  AF017079  190    Reverse  TCACGCCCATCACAAACAT      1 ActRIIB = activin receptor IIB; GAPDH = glyceraldehyde-3-phosphate dehydrogenase. View Large Table 1. Genes, primer sequences, and amplicon sizes Gene1  Primer  Sequence (5′ to 3′)  GenBank accession number  Amplicon size, bp  Myostatin  Forward  GATTATCACGCTACGACGGA  AY448008  269    Reverse  CCTGGGTTCATGTCAAGTTTC      Follistatin  Forward  AGTGACAATGCCACCTACGC  M19529.1  118    Reverse  CCTCGGTGTCTTCTGAAATGG      Decorin  Forward  ATCACCAAAGTGCGAAAGGC  AF125537  144    Reverse  GTCAGCGATGCGGATGTAGG      ActRIIB  Forward  GCATCGCAAGCCTCCCTAT  NM_001005350.1  256    Reverse  CTGTAGCAGGTTCTCGTGCTTC      GAPDH  Forward  GCCATCACCATCTTCCAGG  AF017079  190    Reverse  TCACGCCCATCACAAACAT      Gene1  Primer  Sequence (5′ to 3′)  GenBank accession number  Amplicon size, bp  Myostatin  Forward  GATTATCACGCTACGACGGA  AY448008  269    Reverse  CCTGGGTTCATGTCAAGTTTC      Follistatin  Forward  AGTGACAATGCCACCTACGC  M19529.1  118    Reverse  CCTCGGTGTCTTCTGAAATGG      Decorin  Forward  ATCACCAAAGTGCGAAAGGC  AF125537  144    Reverse  GTCAGCGATGCGGATGTAGG      ActRIIB  Forward  GCATCGCAAGCCTCCCTAT  NM_001005350.1  256    Reverse  CTGTAGCAGGTTCTCGTGCTTC      GAPDH  Forward  GCCATCACCATCTTCCAGG  AF017079  190    Reverse  TCACGCCCATCACAAACAT      1 ActRIIB = activin receptor IIB; GAPDH = glyceraldehyde-3-phosphate dehydrogenase. View Large Protein Extraction and Western Blotting The tissue was ground in liquid N. The resultant powder was then lysed with lysis buffer containing RIPA (radio-immunoprecipitation assay) buffer (50 mM Tris-HCl, pH 7.4,150 mM NaCl,1% Triton X-100,1% sodium deoxycholate, 0.1% SDS, and sodium orthovanadate, sodium fluoride, EDTA, leupeptin, and other unlisted protease inhibitors; phenylmethanesulfonyl fluoride, 1 mmol/L; Beyotime, Shanghai, China) and protease inhibitor cocktail (10 µL/mL; Sigma, St. Louis, MO). Porcine fibroblast lysates were directly made in the same component lysis buffer. The tissue and cell extracts were clarified by centrifuging at 12,000 × g for 20 min at 4°C. The protein concentrations were determined using the BCA protein assay kit (Applygen Technologies Inc., Beijing, China), and an equal amount of protein was fractionated by 12% SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Amersham Biosciences, Piscataway, NJ), blocked with 5% (wt/vol) blocking buffer, and subjected to immunoblot analysis with primary antibodies. Monoclonal antibodies against GAPDH, myostatin, decorin, and activin receptor IIB (ActRIIB) were from Abcam (Cambridge, MA). Anti-follistatin monoclonal antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). Primary antibodies against Smad2 and phospho-Smad2 were purchased from Cell Signaling Technology (Beverly, MA). After washing, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (Santa Cruz Biotechnology) at room temperature. Membrane-bound immune complexes were detected by using a SuperECL Plus Kit (Applygen Technologies Inc., Beijing, China) according to the manufacturer's instructions. Bands were quantified densitometrically using Gel-Pro Analyzer software (Media Cybernetics, Silver Spring, MD). Analysis of Immunohistochemistry on Paraffin-Embedded Tissue Tissue sections were deparaffinized using xylene and rehydrated in sequential ethanol washes of (vol/vol) 100, 95, 90, and 80%. The tissue sections were then incubated at room temperature in 3% H2O2 in PBS for 10 min to inactivate endogenous peroxidase. After incubation, each slide was washed 3 times in PBS for 3 min. Antigen retrieval was obtained by heating in a microwave at 90°C for 10 min in citrate buffer (0.01 M, pH 6.0) and then cooled for 20 min at room temperature. Each slide was again washed 3 times in PBS for 5 min. The slides were blocked (30 min in a humid chamber at room temperature) with 5% (vol/vol PBS) goat serum to reduce nonspecific binding. Serum was removed from the slides, and the slides were then incubated with the primary antibodies (the primary antibodies are the same as the Western blotting monoclonal antibodies) at the appropriate dilution at 4°C overnight. After incubation, each slide was washed 3 times in PBS for 5 min. The slides were then incubated with anti-mouse HRP-polymer (Fuzhou Maixin Biotechnology, Fuzhou, China) for 10 min at room temperature, followed by 3 washes in PBS for 5 min each. A 3,3′-diaminobenzidine substrate (Fuzhou Maixin Biotechnology) was used for detection, and hematoxylin was used for counterstaining. The slides were then dehydrated and mounted in neutral balsam (Zhongshan Goldenbridge Biotechnology Co., Ltd., Beijing, China). Statistical Analysis All of the results are expressed as the mean ± SD (n = 6). The differences between means were considered significant if P < 0.05. The student's t-test was used to compare the differences in protein expression of myostatin, p-Smad2, Smad2, and decorin between the heterozygous myostatin+/− and wild-type pigs. All other data were analyzed by ANOVA followed by posthoc Tukey's multiple comparison test. RESULTS Expression of Myostatin and Its Regulators and Receptor mRNA in Skeletal Muscle, Heart Muscle, Adipose, Liver, Spleen, Lung, Kidney, and Fibroblasts To determine whether myostatin mRNA was expressed in various adult porcine tissues, we examined the expression of myostatin mRNA in porcine skeletal muscle (vastus medialis), liver, spleen, lung, kidney, heart muscle, and adipose of 6-mo-old pigs and cultured fibroblasts. Real-time PCR showed mRNA expression in all of the samples from the various porcine tissues and cultured fibroblasts (Figure 1A). Myostatin mRNA was significantly greater (P < 0.01) in skeletal muscle than in liver, spleen, lung, kidney, adipose, heart muscle, and cultured fibroblasts (Figure 1A). Figure 1. View largeDownload slide Myostatin, follistatin, decorin, and activin receptor IIB (ActRIIB) mRNA expression in different porcine tissues and fibroblasts. Data are presented as relative expression with respect to the skeletal muscle (vastus medialis) sampled at 6 mo of age, and fibroblasts used were obtained from fetuses of 32 d of gestation by means of real-time PCR using the 2−ΔΔCt comparative method. Glyceraldehyde-3-phosphate dehydrogenase was used as a control. Relative transcript abundance for myostatin (A), follistatin (B), decorin (C), and ActRIIB (D) is shown. Data are presented as mean ± SD (*P < 0.05; **P < 0.01). Figure 1. View largeDownload slide Myostatin, follistatin, decorin, and activin receptor IIB (ActRIIB) mRNA expression in different porcine tissues and fibroblasts. Data are presented as relative expression with respect to the skeletal muscle (vastus medialis) sampled at 6 mo of age, and fibroblasts used were obtained from fetuses of 32 d of gestation by means of real-time PCR using the 2−ΔΔCt comparative method. Glyceraldehyde-3-phosphate dehydrogenase was used as a control. Relative transcript abundance for myostatin (A), follistatin (B), decorin (C), and ActRIIB (D) is shown. Data are presented as mean ± SD (*P < 0.05; **P < 0.01). To explore why myostatin mRNA expression was greater in skeletal muscle than that of other tissues and whether this difference was associated with its regulators, we examined the mRNA abundance of follistatin and decorin in the collected tissues and cultured fibroblasts. The mRNA abundance of follistatin and decorin was greater (P < 0.01) in adipose and lung tissues than the other tissues (Figures 1B and 1C). In addition, we examined the mRNA abundance of ActRIIB, a myostatin receptor located in the cell membrane, and determined its expression was greater (P < 0.01) in spleen, lung, and kidney vs. skeletal muscle and was greater (P > 0.05) in heart muscle and liver vs. skeletal muscle, and in the internal organs than in the skeletal muscle (Figure 1D). Expression of Myostatin and Its Regulators and Receptor Proteins in Skeletal Muscle, Heart Muscle, Adipose, Liver, Spleen, Lung, Kidney, and Fibroblasts Protein expression of myostatin, follistatin, and decorin was examined in tissues of 6-mo-old pigs and cultured fibroblasts by Western blot analysis to compare with mRNA abundance. The GAPDH was used as an equal loading control (Figure 2I). Expression of myostatin protein was identified in all of the samples collected and in the cultured fibroblasts (Figure 2A). Myostatin protein content was greater (P < 0.01) in liver, spleen, lung, and adipose vs. skeletal muscle, greater (P < 0.05) in kidney and heart muscle vs. skeletal muscle, and in internal organs and adipose tissue than in skeletal muscle; furthermore, it was least (P < 0.01) in the cultured fibroblasts (Figure 2B). The myostatin protein expression of adipose tissue and lung was 8.6- and 8.9-fold greater (P < 0.01), respectively, than that of skeletal muscle. Figure 2. View largeDownload slide Myostatin, follistatin, decorin, and activin receptor IIB (ActRIIB) protein expression in different porcine tissues and fibroblasts. Tissue samples were collected from porcine skeletal muscle, heart muscle, adipose, liver, spleen, lung, and kidney at 6 mo of age, and fibroblasts were obtained from fetuses of 32 d of gestation. Densitometry analysis of protein expression for Western blots (myostatin, follistatin, decorin, and ActRIIB) was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. Representative Western blots of myostatin (A), follistatin (C), decorin (E), ActRIIB (G), and GAPDH (I) are shown. B, D, F, and H are the corresponding densitometry analyses. Data are presented as means ± SD (*P < 0.05; **P < 0.01). Figure 2. View largeDownload slide Myostatin, follistatin, decorin, and activin receptor IIB (ActRIIB) protein expression in different porcine tissues and fibroblasts. Tissue samples were collected from porcine skeletal muscle, heart muscle, adipose, liver, spleen, lung, and kidney at 6 mo of age, and fibroblasts were obtained from fetuses of 32 d of gestation. Densitometry analysis of protein expression for Western blots (myostatin, follistatin, decorin, and ActRIIB) was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression. Representative Western blots of myostatin (A), follistatin (C), decorin (E), ActRIIB (G), and GAPDH (I) are shown. B, D, F, and H are the corresponding densitometry analyses. Data are presented as means ± SD (*P < 0.05; **P < 0.01). All of the tissue samples and cultured fibroblasts expressed follistatin and decorin proteins (Figures 2C and 2E). Follistatin protein expression of lung and adipose tissues was 13.4- and 4.8-fold greater (P < 0.01), respectively, than that of skeletal muscle (Figure 2D). Decorin protein expression in adipose tissue and lung was 112.3- and 145.2-fold greater (P < 0.01), respectively, than in skeletal muscle (Figure 2F). The ActRIIB protein was also examined in the samples and cultured fibroblasts (Figure 2G). The ActRIIB protein expression in lung and adipose tissue were greater (P < 0.01) than in the skeletal muscle and other internal organs (Figure 2H). Activating of the Smad2 Signaling Pathway in Heterozygous Myostatin+/− Pigs To verify the function of myostatin in internal organs, we determined whether myostatin affects the intracellular signaling pathway in heterozygous myostatin+/− pigs. The phosphorylation of Smad2 was induced in the tissues of the heterozygous myostatin+/− pigs (Figure 3). Expression of myostatin and decorin was increased (P < 0.05) in liver and lung, and in spleen and kidney (P < 0.05) of the heterozygous myostatin+/− pigs (Figure 3). Figure 3. View largeDownload slide Phosphorylation of Smad2 in heterozygous myostatin+/− pigs. Equal amounts of protein from the liver, spleen, lung, and kidney of heterozygous myostatin+/− (HZ, heterozygous), and littermate control (WT, wild-type) pigs were used to evaluate the expression of phospho-Smad2, Smad2, myostatin, decorin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by Western blotting. The protein expressions of myostatin and decorin were increased in the detected tissues of heterozygous myostatin+/− pigs compared with controls. The phospho-Smad2 expressions were also increased in these tissues of heterozygous myostatin+/− pigs relative to controls. Figure 3. View largeDownload slide Phosphorylation of Smad2 in heterozygous myostatin+/− pigs. Equal amounts of protein from the liver, spleen, lung, and kidney of heterozygous myostatin+/− (HZ, heterozygous), and littermate control (WT, wild-type) pigs were used to evaluate the expression of phospho-Smad2, Smad2, myostatin, decorin, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) by Western blotting. The protein expressions of myostatin and decorin were increased in the detected tissues of heterozygous myostatin+/− pigs compared with controls. The phospho-Smad2 expressions were also increased in these tissues of heterozygous myostatin+/− pigs relative to controls. Expression Analysis of Myostatin in Skeletal Muscle, Heart Muscle, Adipose, Liver, Spleen, Lung, and Kidney by Immunohistochemistry To further ascertain the expression of myostatin, follistatin, and decorin in adult porcine tissues, we examined their presence using immunohistochemistry on paraffin-embedded tissue. Myostatin, follistatin, and decorin were all expressed in the collected samples (Figure 4). Figure 4. View largeDownload slide Immunodetection of myostatin, follistatin, and decorin. Immunohistochemical detection of myostatin (A), follistatin (B), and decorin (C) in porcine tissues of skeletal muscle (1), adipose (2), heart muscle (3), liver (4), spleen (5), lung (6), and kidney (7). Original magnification is 200×. Color version available in the online PDF. Figure 4. View largeDownload slide Immunodetection of myostatin, follistatin, and decorin. Immunohistochemical detection of myostatin (A), follistatin (B), and decorin (C) in porcine tissues of skeletal muscle (1), adipose (2), heart muscle (3), liver (4), spleen (5), lung (6), and kidney (7). Original magnification is 200×. Color version available in the online PDF. DISCUSSION Myostatin, a member of the TGF-β superfamily, functions specifically as a negative regulator of skeletal muscle growth (McPherron et al., 1997). Previous studies on myostatin expression focused mainly on skeletal muscles of different animals or animals during the pre- and postnatal period. However, little is known regarding whether myostatin is expressed in various porcine tissues. Herein, mRNA and protein expression of myostatin, ActRIIB, follistatin, and decorin were demonstrated in several types of porcine tissues, and the myostatin expression was certainly not limited to skeletal muscle, heart muscle, and adipose tissue. Myostatin is a widely expressed cellular factor in pigs. Myostatin may elicit its biological functions under the regulation of follistatin, decorin, and ActRIIB in different tissues. Ample data have supported the role of myostatin as a secreted factor in different types of tissues and cells, such as adipose (Guo et al., 2009), tendon (Mendias et al., 2008), and mammary gland (Manickam et al., 2008). We have shown that myostatin mRNA is expressed not only in skeletal muscle, adipose tissue, and heart muscle, but also in liver, spleen, lung, kidney, and cultured fibroblasts of pigs. Although it was expressed in several types of porcine tissues and cultured fibroblasts, myostatin mRNA expression varied among the different porcine tissues. In contrast to Ji et al. (1998), who reported the presence of myostatin mRNA in skeletal muscle, but not in adipose tissue, heart, lung, spleen, kidney, or liver, we found myostatin mRNA expression not only in skeletal muscle, but also in fibroblasts, adipose, heart, liver, spleen, lung, and kidney. The differences may reflect the different methods used in each study. We used real-time PCR, which is much more sensitive than the ribonuclease protection assay used in the other study. Although, both studies found that myostatin mRNA was expressed in skeletal muscle. The activity of myostatin in circulation, myogenic cells, and skeletal muscle is regulated by various proteins including myostatin propeptide (Hill et al., 2002), follistatin-related gene (Hill et al., 2002), follistatin (Lee, 2004), and decorin (Nishimura et al., 2007; Kishioka et al., 2008). It is feasible that follistatin and decorin can also regulate myostatin activity in adipose tissue, liver, spleen, lung, and kidney. In the present study, myostatin, follistatin, and decorin mRNA and proteins were detected and present in a similar expression pattern in adipose tissue, liver, spleen, lung, kidney, and cultured fibroblasts. For example, these 3 factors were detected at greater amounts in the lung and adipose tissue than in skeletal muscle. In fact, several studies have reported that follistatin and decorin can bind to the extracellular matrix (ECM) of mammalian cells (Nishimura et al., 2007; Benabdallah et al., 2008) and interact with various factors in the ECM. For example, decorin not only directly suppressed myostatin activity (Miura et al., 2006) but also upregulated the expression of follistatin (Zhu et al., 2007), which indirectly inhibited myostatin. In addition, there was a similar pattern in the spatiotemporal expression of decorin and myostatin mRNA during development of rat skeletal muscle (Nishimura et al., 2007). Based on this evidence, we hypothesized that the mRNA and protein of the 3 factors have similar expression patterns in adipose tissue, liver, spleen, lung, and kidney, in addition to skeletal muscle, which was confirmed in this study. Although there were differences in the mRNA patterns, the ActRIIB protein pattern was similar to that of myostatin, follistatin, and decorin in the porcine tissues examined. These results indicate that myostatin protein expression correlated with follistatin, decorin, and ActRIIB, and that myostatin may play an important role during the development of various porcine tissues via the ActRIIB pathway. Although the major role of myostatin is to suppress myoblast proliferation and myofiber hypertrophy, its function may not be confined to muscle tissues; it could be transported to all organs and tissues via the bloodstream. Myostatin is an autocrine factor in vivo (Rios et al., 2004). We hypothesized that myostatin would be expressed and exert its function in nonmuscular tissues. In our study, myostatin was detected in nonmuscular tissues such as adipose, liver, spleen, lung, and kidney. One possibility is that the ECM surrounding the cells serves as a reservoir for myostatin and modulates its activation status and turnover. The phenomenon is similar to other factors such as TGF-β, IGF, fibroblast growth factor, and hepatocyte growth factor. These factors in the ECM, in turn, control cell proliferation, differentiation, synthesis, and remodeling of the ECM (Taipale and Keski-Oja, 1997). A second possibility is that myostatin elicits certain functions by which myostatin regulates the nonmuscular tissue metabolism because the Smad2 signaling pathway was activated in these nonmuscular tissues in heterozygous myostatin+/− pigs. From these analyses, we propose that myostatin could regulate cell metabolism in the nonmuscular tissues such as liver, spleen, lung, and kidney; however, we must further verify the function of myostatin. Signaling of TGF-β is perhaps the most potent mediator of fibrogenesis in multiple organs and tissues including liver, lung, kidney, and heart (Li et al., 2008). In the present study, another member of the TGF-β superfamily, myostatin, was detected in the liver, lung, kidney, and spleen of pigs, and the phosphorylation of Smad2 was induced in these nonmuscular tissues. A previous study showed that excessive or sustained production of TGF-β1 is a key molecular mediator of tissue fibrosis (Border and Noble, 1994). Myostatin and TGF-β1 are both members of the TGF-β superfamily and probably have similar roles in tissue fibrogenesis. Because Smad2 activity was detected in nonmuscular tissues, further study is needed to determine whether this is related to myostatin. We also detected follistatin and decorin proteins in the porcine tissues examined, including liver, lung, kidney, and spleen. These 2 factors are closely related to fibrogenesis. Follistatin attenuates early liver fibrosis in rats (Patella et al., 2006), and decorin binds TGF-β1, then modulates the activity of this mediator (Yamaguchi et al., 1990). One question is why myostatin protein was detected at decreased quantities in skeletal muscle compared with other tissues, such as lung and adipose tissue. In our study, the mRNA expression of myostatin was greater in skeletal muscle than in other tissues. These results suggest that myostatin protein is promptly transported into the extracellular fluid and bloodstream after translation in skeletal muscle cells because myostatin in the bloodstream is produced primarily by skeletal muscle (Sumner et al., 2009). Follistatin and decorin protein were also detected in other tissues in addition to skeletal muscle. Taken together with the evidence that follistatin can associate with the proteoglycans on the surface of cells (Phillips and de Kretser, 1998) and that myostatin and immobilized decorin in the collagen matrix also can sequester myostatin into the ECM (Kishioka et al., 2008), it is likely that follistatin and decorin could contribute to the tissue deposition of myostatin protein. These results suggest that the proteins of myostatin, follistatin, and decorin came not only from the various tissues themselves, but also from other tissues, such as skeletal muscle, lung, adipose, and liver. In summary, we demonstrated that the mRNA and proteins of myostatin, follistatin, decorin, and ActRIIB are expressed in the examined porcine tissues and cultured fibroblasts. These factors were closely interrelated, interact with one other, and have a similar protein expression pattern. Although we speculated that some of the myostatin protein in liver, spleen, lung, kidney, and heart probably came from skeletal muscle, future studies will attempt to address this issue. Myostatin also may play important roles in regulating the energy metabolism and fibrosis of various tissues in pigs. LITERATURE CITED Benabdallah B. F. Bouchentouf M. Rousseau J. Bigey P. Michaud A. Chapdelaine P. Scherman D. Tremblay J. P. 2008. Inhibiting myostatin with follistatin improves the success of myoblast transplantation in dystrophic mice. Cell Transplant.  17: 337– 350. [PubMed] Google Scholar CrossRef Search ADS PubMed  Boman I. A. Klemetsdal G. Nafstad O. Blichfeldt T. Vage D. I. 2010. Impact of two myostatin (MSTN) mutations on weight gain and lamb carcass classification in Norwegian White Sheep (Ovis aries). Genet. Sel. Evol.  42: 4. [PubMed] Google Scholar CrossRef Search ADS PubMed  Border W. Noble N. 1994. Transforming growth factor beta in tissue fibrosis. N. Engl. J. Med.  331: 1286– 1292. [PubMed] Google Scholar CrossRef Search ADS PubMed  Choi C. S. Distefano A. Kim S. N. Kulkarni A. Hwang Y. J. Cline G. Shulman G. 2007. Myostatin knockout mice are protected from high-fat diet induced obesity and insulin resistance. Diabetes  56: A84– A85. Ciarmela P. Wiater E. Smith S. M. Vale W. 2009. Presence, actions, and regulation of myostatin in rat uterus and myometrial cells. Endocrinology  150: 906– 914. [PubMed] Google Scholar CrossRef Search ADS PubMed  Guo T. Jou W. Chanturiya T. Portas J. Gavrilova O. McPherron A. C. 2009. Myostatin inhibition in muscle, but not adipose tissue, decreases fat mass and improves insulin sensitivity. PLoS ONE  4: e4937. [PubMed] Google Scholar CrossRef Search ADS PubMed  Hill J. J. Davies M. V. Pearson A. A. Wang J. H. Hewick R. M. Wolfman N. M. Qiu Y. C. 2002. The myostatin propeptide and the follistatin-related gene are inhibitory binding proteins of myostatin in normal serum. J. Biol. Chem.  277: 40735– 40741. [PubMed] Google Scholar CrossRef Search ADS PubMed  Ji S. Losinski R. L. Cornelius S. G. Frank G. R. Willis G. M. Gerrard D. E. Depreux F. F. Spurlock M. E. 1998. Myostatin expression in porcine tissues: Tissue specificity and developmental and postnatal regulation. Am. J. Physiol.  275: R1265– R1273. [PubMed] Google Scholar CrossRef Search ADS PubMed  Kishioka Y. Thomas M. Wakamatsu J. I. Hattori A. Sharma M. Kambadur R. Nishimura T. 2008. Decorin enhances the proliferation and differentiation of myogenic cells through suppressing myostatin activity. J. Cell. Physiol.  215: 856– 867. [PubMed] Google Scholar CrossRef Search ADS PubMed  Lai L. Kolber-Simonds D. Park K. W. Cheong H. T. Greenstein J. L. Im G. S. Samuel M. Bonk A. Rieke A. Day B. N. Murphy C. N. Carter D. B. Hawley R. J. Prather R. S. 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science  295: 1089– 1092. [PubMed] Google Scholar CrossRef Search ADS PubMed  Lee S. J. 2004. Regulation of muscle mass by myostatin. Annu. Rev. Cell Dev. Biol.  20: 61– 86. [PubMed] Google Scholar CrossRef Search ADS PubMed  Li L. Pang D. Chen L. Wang T. Nie D. Yan S. Ouyang H. 2009. Establishment of a transgenic pig fetal fibroblast reporter cell line for monitoring Cre recombinase activity. DNA Cell Biol.  28: 303– 308. [PubMed] Google Scholar CrossRef Search ADS PubMed  Li Z. B. Kollias H. D. Wagner K. R. 2008. Myostatin directly regulates skeletal muscle fibrosis. J. Biol. Chem.  283: 19371– 19378. [PubMed] Google Scholar CrossRef Search ADS PubMed  Liu C. M. Yang Z. Liu C. W. Wang R. Tien P. Dale R. Sun L. Q. 2008. Myostatin antisense RNA-mediated muscle growth in normal and cancer cachexia mice. Gene Ther.  15: 155– 160. [PubMed] Google Scholar CrossRef Search ADS PubMed  Livak K. J. Schmittgen T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2-(delta) (delta)CT method. Methods  25: 402– 408. [PubMed] Google Scholar CrossRef Search ADS PubMed  Manickam R. Pena R. N. Whitelaw C. B. a. 2008. Mammary gland differentiation inversely correlates with GDF-8 expression. Mol. Reprod. Dev.  75: 1783– 1788. [PubMed] Google Scholar CrossRef Search ADS PubMed  McPherron A. C. Lawler A. M. Lee S. J. 1997. Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature  387: 83– 90. [PubMed] Google Scholar CrossRef Search ADS PubMed  McPherron A. C. Lee S. J. 1997. Double muscling in cattle due to mutations in the myostatin gene. Proc. Natl. Acad. Sci. USA  94: 12457– 12461. [PubMed] Google Scholar CrossRef Search ADS   McPherron A. C. Lee S. J. 2002. Suppression of body fat accumulation in myostatin-deficient mice. J. Clin. Invest.  109: 595– 601. [PubMed] Google Scholar CrossRef Search ADS PubMed  Mendias C. L. Bakhurin K. I. Faulkner J. A. 2008. Tendons of myostatin-deficient mice are small, brittle, and hypocellular. Proc. Natl. Acad. Sci. USA  105: 388– 393. [PubMed] Google Scholar CrossRef Search ADS   Miura T. Kishioka Y. Wakamatsu J.-i. Hattori A. Hennebry A. Berry C. J. Sharma M. Kambadur R. Nishimura T. 2006. Decorin binds myostatin and modulates its activity to muscle cells. Biochem. Biophys. Res. Commun.  340: 675– 680. [PubMed] Google Scholar CrossRef Search ADS PubMed  Nakatani M. Takehara Y. Sugino H. Matsumoto M. Hashimoto O. Hasegawa Y. Murakami T. Uezumi A. Takeda S. I. Noji S. Sunada Y. Tsuchida K. 2008. Transgenic expression of a myostatin inhibitor derived from follistatin increases skeletal muscle mass and ameliorates dystrophic pathology in mdx mice. FASEB J.  22: 477– 487. [PubMed] Google Scholar CrossRef Search ADS PubMed  Nishimura T. Oyama K. Kishioka Y. Wakamatsu J. Hattori A. 2007. Spatiotemporal expression of decorin and myostatin during rat skeletal muscle development. Biochem. Biophys. Res. Commun.  361: 896– 902. [PubMed] Google Scholar CrossRef Search ADS PubMed  Patella S. Phillips D. J. Tchongue J. de Kretser D. M. Sievert W. 2006. Follistatin attenuates early liver fibrosis: Effects on hepatic stellate cell activation and hepatocyte apoptosis. Am. J. Physiol. Gastrointest. Liver Physiol.  290: G137– G144. [PubMed] Google Scholar CrossRef Search ADS PubMed  Phillips D. J. de Kretser D. M. 1998. Follistatin: A multifunctional regulatory protein. Front. Neuroendocrinol.  19: 287– 322. [PubMed] Google Scholar CrossRef Search ADS PubMed  Qiao C. Li J. Jiang J. Zhu X. Wang B. Li J. Xiao X. 2008. Myostatin propeptide gene delivery by adeno-associated virus serotype 8 vectors enhances muscle growth and ameliorates dystrophic phenotypes in mdx mice. Hum. Gene Ther.  19: 241– 254. [PubMed] Google Scholar CrossRef Search ADS PubMed  Qiao C. Li J. Zheng H. Bogan J. Li J. B. Yuan Z. H. Zhang C. Bogan D. Kornegay J. Xiao X. 2009. Hydrodynamic limb vein injection of adeno-associated virus serotype 8 vector carrying canine myostatin propeptide gene into normal dogs enhances muscle growth. Hum. Gene Ther.  20: 1– 10. [PubMed] Google Scholar CrossRef Search ADS PubMed  Ríos R. Fernandez-Nocelos S. Carneiro I. Arce V. Devesa J. 2004. Differential response to exogenous and endogenous myostatin in myoblasts suggests that myostatin acts as an autocrine factor in vivo. Endocrinology  145: 2795– 2803. [PubMed] Google Scholar CrossRef Search ADS PubMed  Schuelke M. Wagner K. R. Stolz L. E. Hubner C. Riebel T. Komen W. Braun T. Tobin J. F. Lee S. J. 2004. Myostatin mutation associated with gross muscle hypertrophy in a child. N. Engl. J. Med.  350: 2682– 2688. [PubMed] Google Scholar CrossRef Search ADS PubMed  Sumner C. J. Wee C. D. Warsing L. C. Choe D. W. Ng A. S. Lutz C. Wagner K. R. 2009. Inhibition of myostatin does not ameliorate disease features of severe spinal muscular atrophy mice. Hum. Mol. Genet.  18: 3145– 3152. [PubMed] Google Scholar CrossRef Search ADS PubMed  Taipale J. Keski-Oja J. 1997. Growth factors in the extracellular matrix. FASEB J.  11: 51– 59. [PubMed] Google Scholar CrossRef Search ADS PubMed  Taketa Y. Nagai Y. Ogasawara H. Hayashi S. Miyake M. Tanaka S. Watanabe K. Ohwada S. Aso H. Yamaguchi T. 2008. Differential expression of myostatin and its receptor in the porcine anterior pituitary gland. Anim. Sci. J.  79: 382– 390. Google Scholar CrossRef Search ADS   Welle S. Burgess K. Thornton C. A. Tawil R. 2009. Relation between extent of myostatin depletion and muscle growth in mature mice. Am. J. Physiol. Endocrinol. Metab.  297: E935– E940. [PubMed] Google Scholar CrossRef Search ADS PubMed  Yamaguchi Y. Mann D. M. Ruoslahti E. 1990. Negative regulation of transforming growth factor-[beta] by the proteoglycan decorin. Nature  346: 281– 284. [PubMed] Google Scholar CrossRef Search ADS PubMed  Zhu J. Li Y. Shen W. Qiao C. Ambrosio F. Lavasani M. Nozaki M. Branca M. F. Huard J. 2007. Relationships between transforming growth factor-β1, myostatin, and decorin: Implications for skeletal muscle fibrosis. J. Biol. Chem.  282: 25852– 25863. [PubMed] Google Scholar CrossRef Search ADS PubMed  Footnotes 1 This work was financially supported by the National Natural Science Foundation of China (30771582 and 130871841; Beijing) and by the National S & T Major Project of China (2008ZX08006-003; Beijing). American Society of Animal Science
TI - Analysis of myostatin and its related factors in various porcine tissues
JF - Journal of Animal Science
DO - 10.2527/jas.2010-3827
DA - 2011-10-01
UR - https://www.deepdyve.com/lp/oxford-university-press/analysis-of-myostatin-and-its-related-factors-in-various-porcine-cQKzg0f0z4
SP - 3099
EP - 3106
VL - 89
IS - 10
DP - DeepDyve
ER -