TY - JOUR
AU - Holmäng,, Agneta
AB - Abstract During pregnancy, systemic inflammatory responses induce cytokines that may stress the fetus and contribute to cardiovascular and neuroendocrine dysfunction in adulthood. We evaluated the effects of early and late prenatal exposure to IL-6 on mean systolic arterial pressure (MSAP) and hypothalamic-pituitary-adrenal (HPA) axis regulation in male and female rats at 5–24 wk of age. MSAP and ACTH and corticosterone levels were measured basally and in response to a novel environment, immobilization stress, and stimulation with corticotropin-releasing factor (CRF) and ACTH. In addition, mRNA expression and protein levels of glucocorticoid receptor, mineralocorticoid receptor, CRF receptor type 1, and CRF were estimated in brain areas thought to mediate central effects of corticosteroids on the HPA axis and on central neuroendocrine regulation of MSAP. Both early and late prenatal IL-6 exposure led to hypertension, which was evident in females at 5 wk of age. In adult rats, basal ACTH and corticosterone levels were elevated, the responses to stress and stimulation tests were of extended duration, and circadian rhythm during the light period was flattened and reversed. Mineralocorticoid receptor and glucocorticoid receptor mRNA expression was reduced in the hippocampus, the CRF level was increased in the hypothalamus, and CRF receptor type 1 mRNA expression was increased in the pituitary. These findings suggest that fetal stress induced by prenatal exposure to IL-6 leads to hypertension and dysregulation of HPA axis activity during adulthood. LIVING ORGANISMS ARE under constant pressure from pathogenic influences, starting in intrauterine life when a pregnant mother may be exposed to infection, inflammation, immunization, or mental insults eliciting profound neuroendocrine disturbances. Several diseases, including hypertension, coronary heart disease, stroke, obesity, and type 2 diabetes, may be influenced by perturbations of intrauterine growth and development (1). Such diseases may result, in part, from early programming, a process whereby stimuli or insults in early life have long-term effects on the individual’s structure, physiology, metabolism, and mental functions. The stress response is largely mediated by the hypothalamic-pituitary-adrenal (HPA) axis and the sympathoadrenomedullary (SA) axis. Activation of the HPA axis increases the secretion of corticotropin-releasing factor (CRF), which stimulates ACTH and leads to glucocorticoid release from the adrenal cortex. Activation of the SA axis, however, increases the release of epinephrine and norepinephrine from the adrenal medulla and stimulates the sympathetic norepinergic nerves, increasing norepinephrine secretion. These two axes form the key efferent links in the defeat (HPA axis) and defense (SA axis) reactions (2, 3). Chronic activation of either axis can lead to stress-related diseases such as hypertension, diabetes, and obesity (2, 3). Prenatal stress and increased exposure to glucocorticoids adversely affect the developing brain (4–6). The HPA axis is highly susceptible to programming during fetal and neonatal development (7) and appears to be very sensitive to glucocorticoid exposure (4, 5). The same is probably true of the central control of the SA axis. However, the phenotype of HPA function depends not only on the type of perinatal manipulation but also on its timing, duration, and intensity and on the sex of the fetus (8). Glucocorticoids act predominantly through two types of intracellular receptors: lower-affinity glucocorticoid receptors (GRs) and higher-affinity mineralocorticoid receptors (MRs), which bind cortisol in humans and corticosterone (CORT) in rats and mice. Even under basal resting conditions, the high-affinity MRs are occupied more than 80% by the endogenous hormone (9, 10). The GRs, however, are only significantly occupied after stress or during the circadian peak in cortisol secretion (8). Glucocorticoids regulate their own secretion by negative feedback through hypothalamic and pituitary GRs, which inhibit the synthesis or release of CRF and ACTH (11). In rats, the CRF receptor type 1 (CRF1) in the pituitary is essential for ACTH response to extero- as well as interoceptive stressors (9, 11, 12). The central MRs, mainly located in the hippocampus, help maintain basal activity of the HPA axis by controlling its inhibitory tone (12). Similarly, the SA axis can engage in a variety of response patterns via limbic-hypothalamic structures, depending on the physical or mental challenges involved (3). The response of the HPA axis to stress or inflammation is mediated by cytokines, produced peripherally and within the hypothalamus and pituitary, that stimulate CRF and ACTH secretion (13, 14) and antagonize their own proinflammatory actions by stimulating the HPA axis. Consequently, animals exposed prenatally to endotoxin, which induces massive production of proinflammatory cytokines, show attenuated responses to stress as adults and are generally insulin resistant and obese (15). In a study investigating the relevance of cytokines released during an inflammatory response, administration of TNF or IL-6 during pregnancy resulted in insulin resistance and enhanced CORT responses to stress in the adult offspring (16). Thus, immune cytokines may play a vital role in the programming of neuroendocrine functions during early ontogenesis. In this study, we assessed the effects of exposure to IL-6, early and late in pregnancy, on mean systolic arterial pressure (MSAP) and HPA axis regulation in male and female rats in response to a novel environment, restraint stress, and stimulation with CRF and ACTH. Materials and Methods Animals Nulliparous, timed-mated Wistar rats (B&K Universal, Sollentuna, Sweden) were maintained under controlled noise-free conditions (light from 0700 to 1700 h; temperature 21 ± 2 C; humidity, 55–65%) and fed standard rat pellets ad libitum. Standard principles of laboratory animal care were followed, and all procedures were approved by the animal ethics committee of the Göteborg University. Dams and litters After 1 wk of acclimatization, dams (n = 6/group) were randomly assigned to receive ip injections of human IL-6 (9 μg/kg; Roche Molecular Biochemicals Biochemica, Mannheim, Germany) (17) dissolved in PBS on d 8, 10, and 12 [early IL-6 exposure (EIL-6) group] or on d 16, 18, and 20 [late IL-6 exposure (LIL-6) group]. Controls received injections of vehicle alone on the same schedule. ACTH and CORT levels were measured in tail nick samples collected before (0 min), 30 min after, and 2, 4, and 24 h after injection on d 8 (early groups) or d 16 (late groups). Care was taken to keep the animals undisturbed and fed the night before the experiment. Maternal weight and food intake were measured daily until pups were born at approximately 21 d. At birth, pups were weighed and sexed, and body length was measured. Within 1 wk after delivery, pups were redistributed so that each experimental group consisted of four to five males and four to five females per lactating mother. Pups were separated from their mothers at 4 wk of age and housed four to a cage. Vaginal smears The estrous status of the pups was determined from vaginal smears taken daily between 8 and 11 wk of age. The estrous cycle (estrus, diestrus 1, diestrus 2, and proestrus) usually lasts about 4 d in rats. Cycles of 4 or 5 d with clear ovulation (a characteristic, rich amount of epithelial cells without leukocytes in the smears) were considered normal. All sampling and testing were performed at the beginning of diestrus 1, the day after estrus. Blood pressure measurements Systolic arterial pressure and heart rate (HR) were measured with a tail cuff monitor (RTBP Monitor, Harvard Apparatus, South Natick, MA) between 0800 and 1200 h at 5, 11, 16, and 24 wk of age. Rats were placed on a heating pad, and their tails were warmed with a heating lamp for 10 min to cause vasodilatation for an optimal signal. In each rat, MSAP was calculated from three consecutive recordings. Novel-environment stress test At 5 and 24 wk of age, rats underwent a novel-environment stress test (18), and the CORT and ACTH responses were assessed. All tests started between 0700 and 0900 h, and care was taken to keep the rats undisturbed and fed the night before. Rats were removed individually from their home cages and placed in the novel environment (new cage and loud background noise). Blood samples (80 μl) were obtained immediately before and after 15, 30, 60, 90, and 120 min in the novel environment to measure CORT and ACTH levels. Immobilization stress test At 16 wk of age, undisturbed, nonfasting rats were subjected to a immobilization stress test, starting between 0700 and 0900 h. Immediately before the test, MSAP was measured as described above, and the test animal was transferred to a cage and placed in a small plastic cylinder, which limited head, leg, and body movements, for 2 h; the length and diameter of the cylinder were based on body size, with smaller-diameter cylinders being used in females than males (70 vs. 80 mm). MSAP and HR were measured at 30, 60, and 120 min. The rat was returned to its home cage, and the measurements were repeated at 210 min. ACTH and CORT during light period and in response to stimulation with CRF and ACTH At 20 wk of age, catheterized rats were stimulated with CRF and ACTH. Three days before experiments, rats were chosen at random, intubated, and ventilated with a mixture of air (0.5 liters/min), oxygen (1.5 liters/min), and isoflurane (2.5 liters/min; Abbott Laboratories, Abbott Park, IL). One end of the catheter was inserted into the right jugular vein for blood sampling and CRF and ACTH administration. The opposite end of the catheter was guided sc to the rat’s neck and secured with stitches. The catheters were filled with heparinized saline (500 U/ml) and flushed daily. In the first experiment, blood samples were obtained by catheter at 0800, 1300, and 1700 h for measurement of basal ACTH and CORT levels. In the second experiment, a baseline sample was collected at 0800 h, CRF (2 μg/kg iv; Sigma-Aldrich, St. Louis, MO) was administered, and samples were collected at 15, 30, 60, 90, and 120 min for determination of CORT and ACTH levels. The third experiment was identical with the second, except that ACTH (0.5 μg/kg; Bachem, San Carlos, CA) was administered instead of CRF. In all experiments, 0.1 ml saline was infused immediately after each withdrawal of blood. Between experiments, rats were allowed to recover for 48 h. Analytical methods Blood samples for CORT analysis were collected into heparinized microtubes and immediately centrifuged at 4 C. Blood for ACTH measurements was collected into cooled microtubes containing EDTA, kept on ice for 15 min, and centrifuged. ACTH levels were determined with a commercial radioimmunometric assay (Diagnostic Systems Laboratories, Inc, Webster, TX) and CORT levels with a 125I RIA kit (ICN Biochemicals, Irvine, CA). Testosterone was measured with a solid-phase RIA (Coat-A-Count Total Testosterone; Diagnostic Products Corp., Los Angeles, CA), and 17-β-estradiol was assayed with commercially available RIA (3rd Generation Estradiol RIA; Diagnostic Systems Laboratories, Inc.) at the age of 19 wk. Tissue harvesting and isolation of total RNA The rats were killed by decapitation. The brains were immediately removed and dissected into specimen hippocampus, hypothalamus, and pituitary; snap-frozen in liquid nitrogen; and stored at −80 C. Total RNA was extracted using RNeasy Mini kits and DNase I treatment, according to the manufacturer’s protocol (Qiagen, Hilden, Germany). The RNA concentration was determined spectrophotometrically at 260 nm. cDNA synthesis and real-time PCR First-strand cDNA was synthesized from 1 μg total RNA with TaqMan RT reagents (Applied Biosystems, Foster City, CA). Specific primers for each gene (Table 1) were designed with PrimerExpress 1.5 software (Applied Biosystems). To avoid amplification of genomic DNA, the probes were positioned to span exon junctions. All primers were synthesized by Applied Biosystems. Real-time PCR analysis was performed with the ABI Prism 7700 Sequence Detection System and MGB-labeled probes (Applied Biosystems). The reactions were analyzed in duplicate, and the data were normalized to an endogenous control (β-actin). The relative mRNA expression levels were calculated with the standard curve method (as described in User Bulletin 2, Applied Biosystems) and adjusted for the expression of the endogenous control. TABLE 1 Primers used for real time-PCR Gene Accession no. Forward primer (5′–3′) Reverse primer (5′–3′) GR NM 012576 CTTTGGAGTCCATTGGCAAATAT CGCACGCCGACTTGTTTA MR NM 013131 GATGGGTATCCCGTCCTAGAGTAC AGGTCTTGAGGATCCAGTAGAAACAC CRF NM 031019 CAGCCGTTGAATTTCTTGCAA TCACCCATGCGGATCAGAAT CRF1 NM 022714 TTGTGTCCGTTTTCTACTGCTTCT ACGGTGCCACCGCTTTC β-Actin NM 031144 CCCTGGCTCCTAGCACCAT TAGAGCCACCAATCCACACAGA Gene Accession no. Forward primer (5′–3′) Reverse primer (5′–3′) GR NM 012576 CTTTGGAGTCCATTGGCAAATAT CGCACGCCGACTTGTTTA MR NM 013131 GATGGGTATCCCGTCCTAGAGTAC AGGTCTTGAGGATCCAGTAGAAACAC CRF NM 031019 CAGCCGTTGAATTTCTTGCAA TCACCCATGCGGATCAGAAT CRF1 NM 022714 TTGTGTCCGTTTTCTACTGCTTCT ACGGTGCCACCGCTTTC β-Actin NM 031144 CCCTGGCTCCTAGCACCAT TAGAGCCACCAATCCACACAGA Open in new tab TABLE 1 Primers used for real time-PCR Gene Accession no. Forward primer (5′–3′) Reverse primer (5′–3′) GR NM 012576 CTTTGGAGTCCATTGGCAAATAT CGCACGCCGACTTGTTTA MR NM 013131 GATGGGTATCCCGTCCTAGAGTAC AGGTCTTGAGGATCCAGTAGAAACAC CRF NM 031019 CAGCCGTTGAATTTCTTGCAA TCACCCATGCGGATCAGAAT CRF1 NM 022714 TTGTGTCCGTTTTCTACTGCTTCT ACGGTGCCACCGCTTTC β-Actin NM 031144 CCCTGGCTCCTAGCACCAT TAGAGCCACCAATCCACACAGA Gene Accession no. Forward primer (5′–3′) Reverse primer (5′–3′) GR NM 012576 CTTTGGAGTCCATTGGCAAATAT CGCACGCCGACTTGTTTA MR NM 013131 GATGGGTATCCCGTCCTAGAGTAC AGGTCTTGAGGATCCAGTAGAAACAC CRF NM 031019 CAGCCGTTGAATTTCTTGCAA TCACCCATGCGGATCAGAAT CRF1 NM 022714 TTGTGTCCGTTTTCTACTGCTTCT ACGGTGCCACCGCTTTC β-Actin NM 031144 CCCTGGCTCCTAGCACCAT TAGAGCCACCAATCCACACAGA Open in new tab Western blot Total protein extracts from frozen hippocampus, hypothalamus, and pituitary were prepared as described (15). The primary polyclonal antibodies were rabbit anti-GR (1:1000), anti-MR (1:1000), anti-CRF1 (1:100), anti-CRF (1:100), and anti-β-actin (1:2000) (Santa Cruz Biotechnology, Santa Cruz, CA), diluted in Tris-buffered saline (pH 7.6) containing 0.1% Tween 20 (19). The secondary antibody was a horseradish peroxidase-conjugated anti-IgG [Amersham Pharmacia Biotech (Amersham), Amersham, Buckinghamshire, UK] diluted 1:2000 in Tris-buffered saline (pH 7.6) containing 0.1% Tween 20. All incubations were carried out at room temperature. After a final series of washes, immunodetection was performed with an enhanced chemiluminescence system (ECL, Amersham) according to manufacturer’s specifications. Chemiluminescence was captured on photographic film (Amersham), and the OD of each band was quantified with ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Each Western blot was exposed for 15, 30, and 60 sec to ensure the linearity of the film. The OD of each unknown was compared with the OD of the internal standard of each gel (Amersham). Protein levels were expressed as a ratio of the β-actin level. Statistical analysis Values are expressed as mean ± sem. The Mann-Whitney nonparametric U test was used to compare groups of dams and offspring. Hemodynamic and stress hormone data were analyzed by repeated-measures ANOVA considering prenatal condition (IL-6 or control), gender, and time of IL-6 exposure (early or late). Gene expression data were compared by one-way ANOVA followed by Tukey′s test. Two-tailed, unpaired t tests were used for all other analyses; significance was set at P < 0.05. All analyses were performed with StatView 5.0 (SAS Institute, Cary, NC). Results Dams and litters Throughout pregnancy, the body weight (BW) of the dams increased, and there were no significant differences between groups (Table 2). Nor were there significant differences in ACTH and CORT levels before and after the first injection of IL-6 or vehicle, except at 4 h, when the levels were higher in the IL-6-exposed dams (Table 3). The number of progeny per dam and the sex ratios of the litters were not significantly different in controls and the EIL-6 and LIL-6 groups. However, EIL-6 dams had significantly heavier pups (Table 2). The early and late control groups of offspring did not differ in any of the tests performed and were therefore pooled as one control group for each sex. TABLE 2 Maternal weight gain (d 7–22), gestational length, litter size, proportion of females, and birth weight of offspring Treatment Maternal weight gain (g) (n = 6/group) Gestation length (d) Litter size (n) Proportion of females Birth weight (g) Males (n = 10) Females (n = 10) EIL-6 102 ± 5 22.7 ± 0.3 8.5 ± 1.0 0.5 ± 0.1 6.5 ± 0.1a 6.3 ± 0.1a LIL-6 97 ± 8 22.2 ± 0.2 9.7 ± 1.3 0.6 ± 0.1 6.2 ± 0.1 6.0 ± 0.1 EContr 98 ± 13 22.3 ± 0.3 9.5 ± 0.9 0.6 ± 0.2 6.1 ± 0.1 6.1 ± 0.1 LContr 91 ± 8 23.1 ± 0.5 7.3 ± 0.8 0.5 ± 0.4 6.2 ± 0.1 6.2 ± 0.1 Treatment Maternal weight gain (g) (n = 6/group) Gestation length (d) Litter size (n) Proportion of females Birth weight (g) Males (n = 10) Females (n = 10) EIL-6 102 ± 5 22.7 ± 0.3 8.5 ± 1.0 0.5 ± 0.1 6.5 ± 0.1a 6.3 ± 0.1a LIL-6 97 ± 8 22.2 ± 0.2 9.7 ± 1.3 0.6 ± 0.1 6.2 ± 0.1 6.0 ± 0.1 EContr 98 ± 13 22.3 ± 0.3 9.5 ± 0.9 0.6 ± 0.2 6.1 ± 0.1 6.1 ± 0.1 LContr 91 ± 8 23.1 ± 0.5 7.3 ± 0.8 0.5 ± 0.4 6.2 ± 0.1 6.2 ± 0.1 Values are mean ± sem. EContr, Early control group; LContr, late control group. a P < 0.05 (unpaired t test). Open in new tab TABLE 2 Maternal weight gain (d 7–22), gestational length, litter size, proportion of females, and birth weight of offspring Treatment Maternal weight gain (g) (n = 6/group) Gestation length (d) Litter size (n) Proportion of females Birth weight (g) Males (n = 10) Females (n = 10) EIL-6 102 ± 5 22.7 ± 0.3 8.5 ± 1.0 0.5 ± 0.1 6.5 ± 0.1a 6.3 ± 0.1a LIL-6 97 ± 8 22.2 ± 0.2 9.7 ± 1.3 0.6 ± 0.1 6.2 ± 0.1 6.0 ± 0.1 EContr 98 ± 13 22.3 ± 0.3 9.5 ± 0.9 0.6 ± 0.2 6.1 ± 0.1 6.1 ± 0.1 LContr 91 ± 8 23.1 ± 0.5 7.3 ± 0.8 0.5 ± 0.4 6.2 ± 0.1 6.2 ± 0.1 Treatment Maternal weight gain (g) (n = 6/group) Gestation length (d) Litter size (n) Proportion of females Birth weight (g) Males (n = 10) Females (n = 10) EIL-6 102 ± 5 22.7 ± 0.3 8.5 ± 1.0 0.5 ± 0.1 6.5 ± 0.1a 6.3 ± 0.1a LIL-6 97 ± 8 22.2 ± 0.2 9.7 ± 1.3 0.6 ± 0.1 6.2 ± 0.1 6.0 ± 0.1 EContr 98 ± 13 22.3 ± 0.3 9.5 ± 0.9 0.6 ± 0.2 6.1 ± 0.1 6.1 ± 0.1 LContr 91 ± 8 23.1 ± 0.5 7.3 ± 0.8 0.5 ± 0.4 6.2 ± 0.1 6.2 ± 0.1 Values are mean ± sem. EContr, Early control group; LContr, late control group. a P < 0.05 (unpaired t test). Open in new tab TABLE 3 ACTH (pg/ml) and CORT (ng/ml) levels in IL-6-treated and control dams before and after the first injection Control (n = 12) IL-6 (n = 12) Before (0 min)     ACTH 277 ± 32 365 ± 43     CORT 361 ± 69 396 ± 45 30 min     ACTH 314 ± 48 387 ± 58     CORT 482 ± 33 495 ± 56 2 h     ACTH 306 ± 36 332 ± 90     CORT 476 ± 32 488 ± 31 4 h     ACTH 282 ± 34 450 ± 62a     CORT 407 ± 31 543 ± 30a 24 h     ACTH 226 ± 51 306 ± 48     CORT 396 ± 72 349 ± 61 Control (n = 12) IL-6 (n = 12) Before (0 min)     ACTH 277 ± 32 365 ± 43     CORT 361 ± 69 396 ± 45 30 min     ACTH 314 ± 48 387 ± 58     CORT 482 ± 33 495 ± 56 2 h     ACTH 306 ± 36 332 ± 90     CORT 476 ± 32 488 ± 31 4 h     ACTH 282 ± 34 450 ± 62a     CORT 407 ± 31 543 ± 30a 24 h     ACTH 226 ± 51 306 ± 48     CORT 396 ± 72 349 ± 61 Values are mean ± sem. a P < 0.05 vs. control (unpaired t test). Open in new tab TABLE 3 ACTH (pg/ml) and CORT (ng/ml) levels in IL-6-treated and control dams before and after the first injection Control (n = 12) IL-6 (n = 12) Before (0 min)     ACTH 277 ± 32 365 ± 43     CORT 361 ± 69 396 ± 45 30 min     ACTH 314 ± 48 387 ± 58     CORT 482 ± 33 495 ± 56 2 h     ACTH 306 ± 36 332 ± 90     CORT 476 ± 32 488 ± 31 4 h     ACTH 282 ± 34 450 ± 62a     CORT 407 ± 31 543 ± 30a 24 h     ACTH 226 ± 51 306 ± 48     CORT 396 ± 72 349 ± 61 Control (n = 12) IL-6 (n = 12) Before (0 min)     ACTH 277 ± 32 365 ± 43     CORT 361 ± 69 396 ± 45 30 min     ACTH 314 ± 48 387 ± 58     CORT 482 ± 33 495 ± 56 2 h     ACTH 306 ± 36 332 ± 90     CORT 476 ± 32 488 ± 31 4 h     ACTH 282 ± 34 450 ± 62a     CORT 407 ± 31 543 ± 30a 24 h     ACTH 226 ± 51 306 ± 48     CORT 396 ± 72 349 ± 61 Values are mean ± sem. a P < 0.05 vs. control (unpaired t test). Open in new tab BW development The BW of the offspring increased continuously during the experimental period. Male EIL-6 rats remained heavier than controls through 24 wk (515 ± 15 vs. 484 ± 12 g; P < 0.01). Although female EIL-6 rats were heavier than controls at birth, the difference was not sustained (data not shown); and at 24 wk, they weighed significantly less than controls (253 ± 3 vs. 265 ± 3 g; P < 0.05). Sex steroid levels There were no significant changes between controls and IL-6-exposed animals in the male and female groups, in plasma testosterone or 17β-estradiol levels measured at 19 wk of age (data not shown). Prenatal exposure to IL-6 causes hypertension in adult rats The effects of prenatal IL-6 exposure on MSAP and HR are shown in Fig. 1. At 5 wk of age, MSAP was significantly higher in female IL-6 rats than controls, but there were no differences in HR between groups. At 11 and 16 wk, MSAP was significantly increased in IL-6 males and IL-6 females. HR was increased in LIL-6 males and females at wk 11 and in LIL-6 males and EIL-6 females at wk 16. At 24 wk, MSAP was higher in all IL-6-exposed groups than in controls and was higher than at 16 wk, except in EIL-6 females. HR at 24 wk was higher in LIL-6 males and EIL-6 females than in controls. Fig. 1 Open in new tabDownload slide MSAP and HR at 5, 11, 16, and 24 wk of age in male (A and B) and female (C and D) rats (n = 12). MSAP was significantly increased by 5 wk in IL-6 females and by 11 wk in IL-6 males and continued to increase with age. At wk 24, MSAP was highest in LIL-6 males and females. HR was increased in LIL-6 males and females at wk 11 and continued to be high in LIL-6 males at wk 16 and 24, and in EIL-6 females at wk 16 and 24. Values are mean ± sem. *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. ††, P < 0.01 EIL-6 vs. LIL-6 rats (one-way ANOVA). Fig. 1 Open in new tabDownload slide MSAP and HR at 5, 11, 16, and 24 wk of age in male (A and B) and female (C and D) rats (n = 12). MSAP was significantly increased by 5 wk in IL-6 females and by 11 wk in IL-6 males and continued to increase with age. At wk 24, MSAP was highest in LIL-6 males and females. HR was increased in LIL-6 males and females at wk 11 and continued to be high in LIL-6 males at wk 16 and 24, and in EIL-6 females at wk 16 and 24. Values are mean ± sem. *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. ††, P < 0.01 EIL-6 vs. LIL-6 rats (one-way ANOVA). ANOVA showed an association with gender and MSAP in IL-6-treated rats, with higher MSAP in IL-6 females. Increased MSAP and HR responses to immobilization stress The responses to immobilization stress at 16 wk are shown in Fig. 2. At baseline, MSAP was higher in IL-6 males and IL-6 females than in controls. After 30 min of immobilization, MSAP had increased in all rats, reaching maximum levels at 30 min in male controls and at 30–60 min in female controls. MSAP was significantly higher in IL-6-exposed females at 30 min and in all IL-6-exposed rats at 60 and 120 min, compared with controls. The baseline HR was higher in IL-6-exposed rats than in controls. After 60 min of immobilization in male controls and after 30 min in female controls, HR was markedly higher than the baseline values. None of the IL-6-exposed rats had an increase in HR during immobilization, except for EIL-6 females at 60 min. At 210 min, MSAP and HR in all groups had returned more or less to the baseline values, which were higher in the IL-6-exposed rats than in controls. Fig. 2 Open in new tabDownload slide MSAP and HR in response to immobilization stress in 16-wk-old male (A and B) and female (C and D) rats. Pre- and recovery MSAP and HR levels were higher in IL-6-exposed rats, and the MSAP immobilization stress responses were higher at 60 and 120 min. HR was higher in females and lower in males than in controls. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. †, P < 0.05; †††, P < 0.001, EIL-6 vs. LIL-6 (repeated-measures ANOVA). Fig. 2 Open in new tabDownload slide MSAP and HR in response to immobilization stress in 16-wk-old male (A and B) and female (C and D) rats. Pre- and recovery MSAP and HR levels were higher in IL-6-exposed rats, and the MSAP immobilization stress responses were higher at 60 and 120 min. HR was higher in females and lower in males than in controls. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. †, P < 0.05; †††, P < 0.001, EIL-6 vs. LIL-6 (repeated-measures ANOVA). ANOVA showed no gender differences in MSAP or HR during immobilization stress in controls. In IL-6 rats, however, immobilization resulted in gender- and time-specific increased maximal MSAP response (also in HR) and a delayed recovery. Alternations in diurnal ACTH and CORT levels Baseline ACTH and CORT levels during the light period are shown in Fig. 3. In the morning, ACTH and CORT levels were higher in LIL-6 males, whereas ACTH values were higher in EIL-6 females, and CORT values were higher in IL-6 females, compared with controls. In the afternoon, EIL-6 males had higher ACTH levels and LIL-6 males had higher CORT levels, whereas ACTH and CORT were higher in EIL-6 females than in controls. In the evening, CORT levels were higher in the EIL-6 males and lower in LIL-6 females than in controls. Fig. 3 Open in new tabDownload slide Basal plasma ACTH (pg/ml) and CORT (ng/ml) concentrations in male (A and B) and female (C and D) rats. ACTH and CORT levels increased during the day in controls but showed a flattened or reversed pattern in IL-6-treated rats. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01 vs. controls. †, P < 0.05, EIL-6 vs. LIL-6 (repeated-measures ANOVA). Fig. 3 Open in new tabDownload slide Basal plasma ACTH (pg/ml) and CORT (ng/ml) concentrations in male (A and B) and female (C and D) rats. ACTH and CORT levels increased during the day in controls but showed a flattened or reversed pattern in IL-6-treated rats. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01 vs. controls. †, P < 0.05, EIL-6 vs. LIL-6 (repeated-measures ANOVA). ANOVA showed an association with gender and diurnal CORT levels in controls (1300 and 1700 h) and IL-6-treated rats (0800, 1300, and 1700 h), with higher CORT levels in females. Increased basal levels of ACTH and CORT and prolonged responses to novel environment stress The responses to the novel environment stress test at 5 wk are shown in Fig. 4. In controls, ACTH and CORT values were maximal at 15 and 30 min in all control groups at both 5 and 24 wk. At 5 wk, basal ACTH levels were higher in EIL-6 males than in controls. LIL-6 males had lower ACTH values than controls at 15 min and 60 min. Basal plasma CORT levels were higher than controls in EIL-6, but not in LIL-6, males at 5 wk of age. During the test, CORT levels were higher in EIL-6 rats at 15 and 90 min than in controls. EIL-6 female rats had higher baseline ACTH levels than controls at 5 wk, but had a lower ACTH response at 30 min, which was sustained through 90 min. LIL-6 females had lower ACTH levels than controls throughout the novel environment test except at 60 min. There were no significant differences in CORT levels among female rats. Fig. 4 Open in new tabDownload slide ACTH (pg/ml) and CORT (ng/ml) levels in 5-wk-old male (A and B) and female (C and D) rats before and in response to a novel environment stress test. Basal ACTH was increased in EIL-6 males and females. The basal CORT level was increased in EIL-6 males, which had high CORT responses at 15 and 90 min. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. †, P < 0.05; ††, P < 0.01, EIL-6 vs. LIL-6 (repeated-measures ANOVA). Fig. 4 Open in new tabDownload slide ACTH (pg/ml) and CORT (ng/ml) levels in 5-wk-old male (A and B) and female (C and D) rats before and in response to a novel environment stress test. Basal ACTH was increased in EIL-6 males and females. The basal CORT level was increased in EIL-6 males, which had high CORT responses at 15 and 90 min. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. †, P < 0.05; ††, P < 0.01, EIL-6 vs. LIL-6 (repeated-measures ANOVA). The responses at 24 wk are shown in Fig. 5. LIL-6 males had higher ACTH values than controls before the novel environment test and at 30–120 min; in EIL-6 males, ACTH levels were higher than control at 60–120 min. The CORT values in EIL-6 males were higher at baseline and at 60–120 min and LIL-6 males at 90–120 min. Compared with controls, LIL-6 females had higher ACTH levels before the test and at 60–120 min, whereas EIL-6 females had higher values at 90 and 120 min. The CORT level at 24 wk was higher before and throughout the test in LIL-6 females than in controls, but there were no differences between controls and EIL-6 females except for the higher value in the EIL-6 group at 120 min. Fig. 5 Open in new tabDownload slide Plasma ACTH (pg/ml) and CORT (ng/ml) levels and the response to novel environment stress test in 24-wk-old male (A and B) and female (C and D) rats. Basal ACTH was increased in LIL-6 males and females, and all IL-6-exposed rats had increased stress responses at 60 and 90 min. Basal CORT were increased in EIL-6 males and LIL-6 females. LIL-6 females had also an increased stress response, compared with controls. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls; †, P < 0.05; ††, P < 0.0, EIL-6 vs. LIL-6 (repeated-measures ANOVA). Fig. 5 Open in new tabDownload slide Plasma ACTH (pg/ml) and CORT (ng/ml) levels and the response to novel environment stress test in 24-wk-old male (A and B) and female (C and D) rats. Basal ACTH was increased in LIL-6 males and females, and all IL-6-exposed rats had increased stress responses at 60 and 90 min. Basal CORT were increased in EIL-6 males and LIL-6 females. LIL-6 females had also an increased stress response, compared with controls. Values are mean ± sem (n = 12). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls; †, P < 0.05; ††, P < 0.0, EIL-6 vs. LIL-6 (repeated-measures ANOVA). ANOVA showed an association with female gender and increased basal levels of CORT (P < 0.001). Prolonged duration of ACTH and CORT responses to CRF and ACTH stimulation The responses to CRF stimulation in 20-wk-old rats are shown in Fig. 6. Prestress ACTH and CORT levels were higher in IL-6-exposed rats than in controls, except in EIL-6 males, whose CORT levels were not different from the control values. In controls, ACTH and CORT levels were maximal between 15 and 30 min and returned toward the prestress levels at 120 min. Fig. 6 Open in new tabDownload slide Plasma ACTH (pg/ml) and CORT (ng/ml) levels in 20-wk-old male (A and B) and female (C and D) rats before and after iv injection of CRF (2 μg/kg), symbolized with arrow. CRF stimulation increased the high prestress ACTH values in all IL-6-exposed rats and CORT values in LIL-6 males and female rats, however with lower net ACTH and CORT responses than controls. Values are mean ± sem (n = 8). *, P < 0.05; **, P < 0.01 vs. controls. †, P < 0.05; †††, P < 0.001, EIL-6 vs. LIL-6 (repeated-measures ANOVA). Fig. 6 Open in new tabDownload slide Plasma ACTH (pg/ml) and CORT (ng/ml) levels in 20-wk-old male (A and B) and female (C and D) rats before and after iv injection of CRF (2 μg/kg), symbolized with arrow. CRF stimulation increased the high prestress ACTH values in all IL-6-exposed rats and CORT values in LIL-6 males and female rats, however with lower net ACTH and CORT responses than controls. Values are mean ± sem (n = 8). *, P < 0.05; **, P < 0.01 vs. controls. †, P < 0.05; †††, P < 0.001, EIL-6 vs. LIL-6 (repeated-measures ANOVA). At 90 min after stimulation with CRF, EIL-6 males had higher ACTH levels and LIL-6 males had higher CORT levels than controls. At 120 min, both ACTH and CORT levels were higher in IL-6 males than controls. IL-6 females had a prolonged stress response, with higher ACTH levels at 60 and 90 min (LIL-6) and higher ACTH and CORT levels at 120 min. ANOVA showed that female gender was associated with increased basal CORT levels and increased maximal ACTH response. In addition, IL-6-exposed female rats also showed increased maximal CORT response (P < 0.001). The responses to ACTH stimulation are shown in Fig. 7. CORT levels were higher in EIL-6 males at 30 min and in both EIL-6 and LIL-6 males at 120 min, compared with controls. In LIL-6 females at 90 min and in EIL-6 females at 120 min, CORT levels were higher than in controls. Fig. 7 Open in new tabDownload slide Plasma CORT (ng/ml) levels in 20-wk-old male (A) and female (B) rats before and after iv injection of ACTH (0.5 μg/kg), symbolized with arrow. ACTH stimulation did not further increase the high prestress values in IL-6-exposed female rats, which had lower net ACTH and CORT responses than controls. Values are mean ± sem (n = 8). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. †, P < 0.05, EIL-6 vs. LIL-6 (repeated-measures ANOVA). Fig. 7 Open in new tabDownload slide Plasma CORT (ng/ml) levels in 20-wk-old male (A) and female (B) rats before and after iv injection of ACTH (0.5 μg/kg), symbolized with arrow. ACTH stimulation did not further increase the high prestress values in IL-6-exposed female rats, which had lower net ACTH and CORT responses than controls. Values are mean ± sem (n = 8). *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. controls. †, P < 0.05, EIL-6 vs. LIL-6 (repeated-measures ANOVA). ANOVA showed that female gender was associated with increased basal CORT levels and CORT response but only in IL-6-exposed rats (P < 0.001). GR, MR, CRF, and CRF-1 expression in the brain The mRNA and protein levels of GR, MR, CRF, and CRF1 in the hippocampus, hypothalamus, and pituitary gland were measured at 24 wk. In the hippocampus, GR mRNA and protein levels were decreased in both genders of IL-6-exposed rats, (Fig. 8, A and B). The MR mRNA expression was also decreased, but there were no significant differences in the hippocampal MR protein levels, compared with controls (Fig. 8, C and D). In the hypothalamus, CRF mRNA and protein levels were higher in IL-6-exposed rats than in controls (Fig. 9, A and B). In the pituitary, CRF1 mRNA expression was higher in all IL-6-exposed rats except EIL-6 females; CRF1 protein levels were decreased in EIL-6 males and increased in LIL-6 females (Fig. 10, A and B). IL-6 exposure had no significant effect on hypothalamic GR mRNA or protein expression (Fig. 11, A and B). The hypothalamic MR mRNA and protein levels were significantly lower than control only in IL-6-exposed females (Fig. 11, C and D). Fig. 8 Open in new tabDownload slide Hippocampal GR (A and B) and MR (C and D) mRNA and protein levels at 24 wk. Representative blots are shown under each bar graph. In IL-6-exposed rats, GR and MR expression was down-regulated, except the MR protein levels. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Contr, Control. Fig. 8 Open in new tabDownload slide Hippocampal GR (A and B) and MR (C and D) mRNA and protein levels at 24 wk. Representative blots are shown under each bar graph. In IL-6-exposed rats, GR and MR expression was down-regulated, except the MR protein levels. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Contr, Control. Fig. 9 Open in new tabDownload slide CRF mRNA (A) and protein (B) levels in the hypothalamus. Representative blots are shown under each bar graph. CRF mRNA and protein levels were up-regulated in all IL-6-treated rats. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Fig. 9 Open in new tabDownload slide CRF mRNA (A) and protein (B) levels in the hypothalamus. Representative blots are shown under each bar graph. CRF mRNA and protein levels were up-regulated in all IL-6-treated rats. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Fig. 10 Open in new tabDownload slide CRF1 mRNA (A) and protein (B) levels in the pituitary. Representative blots are shown under each bar graph. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Fig. 10 Open in new tabDownload slide CRF1 mRNA (A) and protein (B) levels in the pituitary. Representative blots are shown under each bar graph. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Fig. 11 Open in new tabDownload slide Hypothalamic GR (A and B) and MR (C and D) mRNA and protein levels. Representative blots are shown under each bar graph. GR expression was unchanged, and MR was down-regulated in female IL-6-exposed rats. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Fig. 11 Open in new tabDownload slide Hypothalamic GR (A and B) and MR (C and D) mRNA and protein levels. Representative blots are shown under each bar graph. GR expression was unchanged, and MR was down-regulated in female IL-6-exposed rats. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). ANOVA showed an association between gender and CRF expression, with higher CRF protein levels in all female rats (P < 0.05). On the other hand, CRF1 mRNA levels were higher in male IL-6-exposed rats (P < 0.05). Pituitary GR mRNA and protein expression was significantly higher in IL-6-exposed female rats than in controls. In IL-6 males, GR mRNA was unaltered but protein levels increased (Fig. 12, A and B). MR mRNA and protein levels were significantly higher in EIL-6 males and females than in controls (Fig. 12, C and D). ANOVA showed an association with male gender, with higher GR protein levels (P < 0.01) and MR mRNA expression (P < 0.05) in the pituitary. Fig. 12 Open in new tabDownload slide Pituitary GR (A and B) and MR (C and D) mRNA and protein levels. Representative blots are shown under each bar graph. GR expression was unchanged, but protein level was up-regulated in male IL-6-exposed rats. Both GR expression and protein levels were up-regulated in female IL-6-exposed rats. MR expression and protein levels were up-regulated in EIL-6 males and females. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Fig. 12 Open in new tabDownload slide Pituitary GR (A and B) and MR (C and D) mRNA and protein levels. Representative blots are shown under each bar graph. GR expression was unchanged, but protein level was up-regulated in male IL-6-exposed rats. Both GR expression and protein levels were up-regulated in female IL-6-exposed rats. MR expression and protein levels were up-regulated in EIL-6 males and females. Values are mean ± sem (n = 8) and are normalized to β-actin. *, P < 0.05; **, P < 0.01 vs. control (one-way ANOVA). Discussion This study shows that prenatal exposure to IL-6 caused hypertension, increased the basal activity of the HPA axis, flattened or reversed the circadian variation in ACTH and CORT levels, and resulted in abnormally extended responses to restraint and novel environment stress tests and to stimulation with CRF and ACTH in adulthood. At 24 wk of age, hippocampal levels of GR and MR mRNA were reduced, whereas CRF and CRF1 mRNA levels were increased. These findings demonstrate that the fetus is very sensitive to IL-6 exposure, as occurs during infection or inflammation in the pregnant mother. The HPA and SA axes and programming In rats, the HPA axis is particularly susceptible to early life programming (8, 20). Several studies have shown long-lasting effects on the HPA axis in adult offspring, generally in the direction of persistently hyperactivity (7, 8). Programming of HPA functions seems to involve a modification of glucocorticoid feedback in the limbic system, hypothalamus, or pituitary. However, the effect at each of these sites depends not only on the duration, timing, and kind of manipulation but also on the gender of the offspring (8). Both intrauterine events and postnatal sensory experience exert a formative influence over the maturation of numerous components of the nervous system, and it is therefore possible that all neural systems are susceptible to modification by afferent input during development. The sympathetic nervous system and adrenal medulla, which constitute the SA axis, are also affected by environmental factors during development. Although environmental programming of the SA axis has not been studied extensively, several factors affect the sympathetic nervous system later in life, including environmental temperature, nutrition, and stress (21). The HPA and SA axes and hypertension HPA axis overactivity increases blood pressure and stimulates the secretion of ACTH and CORT (22). Glucocorticoids reportedly increase blood pressure in humans (23, 24) and may contribute to the pathogenesis of essential hypertension by enhancing the vascular response to adrenergic agonists and angiotensin II (24). The central effects of glucocorticoids on arterial pressure regulation, however, are poorly understood (25, 26). The basal activity of the HPA axis, as reflected by ACTH and CORT values, was increased as early as 5 wk in EIL-6 rats. MSAP was significantly elevated at 5 wk in females and at 11 wk in males and remained elevated throughout the study. Thus, increased basal activity of the HPA axis, but probably also of the SA axis, at this early age may lead to earlier development of hypertension in females. Although MSAP levels increased with age in the IL-6-exposed rats, the increases relative to controls were much smaller in EIL-6 than LIL-6 females at 24 wk of age. The high MSAP levels in IL-6-exposed males may also have reflected increased basal activity of the HPA axis. The female LIL-6 rats also had higher HPA axis activity, both basally and in response to the novel environment stress test, than EIL-6 females and control rats at 24 wk of age. In one study (22), administration of CORT to adult rats, which resulted in serum concentrations (500 ng/ml) similar to the basal values in our study, increased systolic blood pressure by about 30 mm Hg, an increase similar to that in MSAP in the IL-6-exposesd rats. However, the combined elevations of MSAP and HR in the basal situation in the IL-6-exposed rats suggest that also the central drive on the SA axis is enhanced in these rats. In the immobilization stress test, the increase in MSAP was significantly higher in both males and females and was also delayed in IL-6-exposed males. No increase in HR over basal levels was seen in LIL-6 females, and the maximal increase was delayed in EIL-6 females. Neither EIL-6 nor LIL-6 male rats increased their HR over basal levels and showed even lower values at 60–120 min of the test. In both male and female IL-6 rats, MSAP and HR were higher than in controls 90 min after the immobilization stress test. These findings suggest that prenatal IL-6 exposure increases MSAP and HR under basal conditions but increases or decreases and/or delays sympathetic MSAP and HR response to severe stress such as immobilization. GR and MR mRNA expression and protein levels in the hippocampus The hippocampal region has the highest density of adrenocorticosteroid binding sites in the brain and is an important site of feedback control of the HPA axis (8, 9). MRs primarily mediate tonic inhibitory control of HPA axis activity, whereas GRs mediate the negative feedback of elevated glucocorticoid levels to restrain this activity (9). In addition, a majority of studies indicate that hippocampal GRs are up-regulated by adrenalectomy and down-regulated by stress and high-dose glucocorticoid treatment at both the binding site and mRNA levels, suggesting glucocorticoid autoregulation (9, 27). These findings support the hypothesis that hippocampal GR biosynthesis is controlled primarily at the level of transcription. Prenatal exposure to IL-6 increased basal CORT and ACTH levels and, particularly in LIL-6 females and EIL-6 males, extended the CORT and ACTH responses to stress or stimulation tests. Concomitantly, GR and MR mRNA expression levels in the hippocampus were markedly reduced, independently of exposure time and gender, as were GR protein levels. The lower levels of GR and MR mRNA at this important regulatory site could explain, at least in part, why the plasma levels of CORT and ACTH were elevated, especially under basal conditions and before the stress and stimulation tests. In contrast, MR mRNA expression was strongly decreased in all IL-6-exposed rats, but their MR protein levels were unaltered compared with controls, consistent with posttranscriptional regulation. The MR has at least three alternatively spliced forms, with three different exons immediately 5′ to the translation start site (28). These variants are thought to be generated, in part, through the use of different promoters (29). The selection of splice variants is closely tied to basal glucocorticoid levels. In rats, for example, the α 5′ splice variant is up-regulated after adrenalectomy (28) and down-regulated by stress (30); splice variants are also differentially expressed during early development (31). Recent data show that stress-induced decreases in α MR mRNA expression do not lead to reduced MR protein levels (30), suggesting that changes in the splicing pattern and in mRNA levels do not have a major impact on net MR availability. This might explain the discrepancy between the mRNA and protein levels we observed. However, developmental manipulations that alter GR or MR expression induce parallel changes in responsiveness to behavioral and neuroendocrine stress (32–34). In addition, the effects of glucocorticoid secretion on MR and GR mRNA pools may be modified by other stress-activated neuronal pathways. Consistent with this possibility, MR and GR mRNA levels are decreased by removal of norepinergic or serotonergic innervations of the hippocampus and increased by treatment with norepinephrine/serotonin reuptake blockers (35). However, we did not investigate the possible influence of monoamines on GR and MR mRNA levels. Thus, hippocampal adrenocorticosteroid receptors seem to undergo a very complex regulatory process after stress-induced elevation of endogenous glucocorticoid levels. Further studies are needed to elucidate the underlying mechanisms. CRF, GR, and MR mRNA expression and protein levels in the hypothalamus and CRF1 in the pituitary The hypothalamic paraventricular nucleus controls pituitary-adrenocortical activity, and parvocellular neurons in the paraventricular nucleus synthesize CRH and arginine vasopressin, which, when released, stimulate proopiomelanocortin synthesis and ACTH release in the pituitary. The regulation of pituitary hormone secretion is complex and includes a variety of neuropeptides and neuroamines. We measured only CRF, the main hypothalamic physiological regulator of pituitary ACTH secretion (11, 36). In the hypothalamus, CRF mRNA expression was up-regulated in all IL-6-exposed groups, resulting in increased CRF protein levels. However, the pituitary effects of CRF depend not only on the hypothalamic output of CRF but also on the abundance of CRF1 in the pituitary corticotroph and on the sensitivity of the receptor in response to ligand activation. Although CRF is the major hypothalamic stimulus of ACTH secretion (11, 36), regulation of the CRF1 mRNA levels appears to involve interactions among CRF, vasopressin, and GC. The increases in CRF1 mRNA in the pituitary were reflected in increased protein levels in LIL-6 females but not in IL-6 males, consistent with posttranscriptional regulation, as shown in a recent studies (37, 38). We did not investigate ligand binding and responsiveness of the steroid receptor. However, CRF binding does not correlate with corticotroph responsiveness; for example, in the case of CRF1, a full ACTH response can be achieved with only partial receptor occupancy (38). GR mRNA expression and protein levels in the hypothalamus were not altered in any of the IL-6-exposed groups. Similarly, MR mRNA and protein levels were not altered in any of the IL-6-exposed males. On the other hand, MR mRNA and protein levels were significantly lower in all IL-6-exposed females, pointing to a clear gender difference. GR and MR mRNA expression and protein levels in the pituitary In the pituitary, GR mRNA expression was significantly up-regulated in all IL-6-exposed offspring except IL-6 males, and MR mRNA expression was increased in EIL-6 males and females, with corresponding increases in protein levels. These findings may reflect an adaptive response or a compensatory process to counteract hypersensitivity or hyperactivity at the hippocampal and hypothalamic levels in the HPA axis. Interestingly, GR protein was significantly increased in both IL-6 males and females, but the mRNA expression was unchanged in the IL-6 males. This might reflect the difference in their responses to ACTH stimulation: the female IL-6 rats showed a flattened pattern with no maximal response, whereas the male IL-6 rats had a maximal increase at 15 min like the controls. However, the attenuated CORT response to stimulation with ACTH seen in IL-6-exposed female rats might be explained by the higher prestimulation levels. This clearly indicates a reduced ability to further increase CORT synthesis, possibly because of increased feedback sensitivity at the GR/MR pituitary level or because secretion in the adrenal cortex has already reached its maximum. It is also important to remember that the responses to the challenges and stress tests at different levels of the HPA axis can also be affected by secretagogues that we did not measure, such as arginine vasopressin and monoamines. Effects of IL-6 exposure and changes in diurnal ACTH and CORT levels Analysis of the circadian variation in CORT levels (0800–1700 h) in control rats showed that the peak was reached just before the end of the light period, as in other studies (39, 40). Prenatal IL-6 exposure therefore seems to modify the light period pattern, as reflected by largely constant and increased levels of CORT. CORT levels were also high just before the stress tests, which were performed between 0700 and 0900 h. In another study of repeated restraint stress in pregnant rats, CORT levels were also higher at the end of the light period in both female and male offspring, and hippocampal GR binding capacity was reduced (40). This reduction is comparable with the reduced GR mRNA expression and protein levels we observed at this site. In conclusion, our results point to an altered, reversed, and flattened HPA axis circadian rhythmicity during the daylight period. Effects of prenatal IL-6 exposure on the dams, fetus, and fetal growth Injection of IL-6 caused small, but significant, increases in CORT and ACTH levels in the maternal circulation, 4 h after the first injection. The fetus is probably protected from elevated maternal levels of CORT by placental 11β-hydroxysteroid dehydrogenase type 2, which rapidly converts CORT to inert 11-keto products (41). However, CORT (42) and IL-6 (43) may stimulate placental CRF production, which could, in turn, stimulate the fetal HPA axis. Alternatively, this stimulation could be a direct action of IL-6, because cytokines can stimulate the HPA axis when the body is under stress or exposed to an infection (13). Both CRF and cytokines may cause many immunologic and pathologic disturbances in the brain during development (44–46), and cytokines have been implicated in the development of learning disabilities (47), anxiety, and depression (48). In addition, children born to women with fever and bacteriuria during pregnancy have an increased incidence of neurologic defects (49). Although overexposure to glucocorticoids retards fetal growth and produces lower birth weight in humans and nonhuman primates and in other experimental mammals (50–52), prenatal exposure to IL-6 increased the birth weight of male offspring in our study. This finding suggests that IL-6 has a direct programming effect on the regulation of MSAP and the HPA axis. Our recent studies with a radioactive tracer show that IL-6 administered early or late in pregnancy passes the placental barrier, allowing direct exposure of the fetus (unpublished observations). IL-6 programming and gender differences We found increased basal and maximal MSAP response (also in HR) during immobilization stress and a delayed MSAP recovery in IL-6-exposed females compared with IL-6-exposed males. To our knowledge, sex-specific effects of prenatal stress on cardiovascular system stress responsiveness have been investigated only in one previous study (53), which subjected female pregnant Sprague Dawley rats to stress three times daily from d 15–21 of gestation. The prenatally stressed offspring were then investigated, at 6 months of age, during restraint stress and recovery. These rats demonstrated a greater increase in BP and delayed recovery than controls. In addition, the prenatally stressed female rats showed a greater increase in systolic arterial pressure and BP variability and delayed HR recovery, after return to the home cage, then did the males. These results are in accordance with our study and indicate that females might be more sensitive and susceptible to prenatal stress affecting the cardiovascular system. This might also be shown by the earlier development of hypertension already at 5 wk of age, but IL-6-exposed male rats did not develop elevated MSAP levels until 11 wk of age. In regard to the sex differences in the control rats, the females showed an increased maximal MSAP and a delayed recovery compared with male control rats. Sex differences in cardiovascular responses to stress have been demonstrated in both human and animal studies, with greater cardiovascular and plasma catecholamine responses to environmental challenges generally observed in males (54). However, some studies have found greater stress-induced increases in catecholamines in female than in male rats (55) and higher cardiac stress reactivity in women compared with men (56). Few studies have compared the impact of prenatal stress on HPA activity in male and female offspring using identical prenatal exposure (40, 57–59). These studies indicate that the female HPA axis is more susceptible to prenatal programming induced by prenatal stress. Some studies also show that prenatal stress can cause permanent alterations in the behavior of both sexes in stressful situations but appears to cause a selective effect on HPA axis in the female rats (57, 58). We generally found increased basal plasma CORT levels in both IL-6-exposed and control (except before CRF- and ACTH-stimulating tests) females compared with the respective male group. In addition, the CORT responses to CRF and ACTH stimulation were higher in IL-6-exposed females compared with IL-6-exposed males. However, we did not find any sex-specific increase in basal ACTH levels in female rats (except before CRF stimulation in IL-6-exposed rats) but an increased ACTH response after CRF stimulation in all female rats compared with the respective male group. It is well known that there is a sexual dimorphism in the HPA-axis function, where females, compared with male rats, have higher basal levels of plasma CORT and higher corticosteroidogenesis by adrenal slices in vitro, and ACTH or CRF produce higher or more prolonged elevated plasma CORT (60). Sex differences also exist in the two brain corticoid receptor systems (61). Although GR expression in the hippocampus seems to be similar in both sexes, there are sex differences in GR, but also in MR, levels in the pituitary, with lower levels in the females compared with male rats (61). In addition, protein levels of CRF have been reported to be higher in the hypothalamus in female rats (59). These findings are all in agreement with our results found in control female and male rats. However, in IL-6-exposed female rats, the basal plasma CORT levels were found to be higher, and they also had increased CORT responses to CRF and ACTH stimulation compared with IL-6-exposed males. In a recent study, it was shown that a heightened activity of the HPA axis in female sheep occurs primarily due to differences at the level of the adrenal gland (62). This finding points to the possibility of an increased susceptibility for IL-6 prenatal exposure in females at this level of the HPA axis, which could explain the sex differences found in our study. Interestingly, depression in humans, which, in most cases, is associated with high cortisol levels, is more prevalent in women than in men (63). In addition, abnormal regulation of the HPA axis is more common in depressed women than in depressed men (64). It is thought that the differences observed between males and females reflect differential effects of sex steroids on the HPA and SA axes, because the activity of many proteins that regulate the axes are directly regulated by the steroids, and sex steroid receptors are present at many levels of the axes (65). However, in our study, no differences were found in circulating plasma levels of testosterone and estradiol between IL-6-exposed rats and the respective control group (results not shown). These findings do not, of course, exclude differences in distribution, regulation, and binding of sex steroid receptors within CNS affected by prenatal IL-6 exposure. IL-6 programming and human disease Several clinical studies have suggested that the essential disturbance of neuroendocrine regulation in depression is a failure of normal brain inhibitory influences on the HPA axis (66, 67). This dysinhibition of the HPA axis results in basal hypercortisolism and alters the temporal pattern of cortisol circadian rhythms in depressed patients (68). Consistent with our findings in IL-6-exposed rats, depressed patients have elevations of CRF mRNA levels in the hypothalamus (69) and CRF protein in cerebrospinal fluid (70). These patients also have an increased risk of hypertension and increased cardiovascular morbidity and mortality (71). Conclusions Our findings demonstrate that prenatal exposure to IL-6 produces long-lasting effects on cardiovascular and HPA axis regulation. Once the mechanisms underlying the programming effects of cytokines on MSAP and HPA axis regulation have been identified in animal models, they can be compared with analogous processes in humans. This knowledge will be necessary to design effective perinatal interventions to prevent chronic adult disease. Acknowledgments We are grateful to B. M. Larsson for excellent laboratory work. This work was supported by grants from the Novo Nordisk Foundation, the Royal Society of Arts and Sciences in Göteborg, The Göteborg Medical Society, the Swedish Medical Research Council (Project No. 12206, 7137, 8668), and the Swedish Heart Lung Foundation. Abbreviations: BW, Body weight; CORT, corticosterone; CRF, corticotropin-releasing factor; CRF1, CRF receptor type 1; EIL-6, early IL-6 exposure; GR, glucocorticoid receptor; HPA, hypothalamic-pituitary-adrenal; HR, heart rate; LIL-6, late IL-6 exposure; MR, mineralocorticoid receptor; MSAP, mean systolic arterial pressure; SA, sympathoadrenomedullary. 1 Barker DJ 1990 The fetal and infant origins of adult disease. BMJ 301 : 1111 Google Scholar Crossref Search ADS PubMed WorldCat 2 McEwen BS 1997 Stress, brain, and behaviour: life-long effects upon health and disease. In: Kinney JM, Tucker HN, eds. Philadelphia : Lippincott-Raven; 113–130 COPAC 3 Folkow BS , Schmidt T , Uvnäs-Moberg K 1997 Stress, health and the social environment. In: James P. Henry′s ethnologic approach to medicine, reflected by recent research in animals and man. Acta Physiol Scand 61 : 1 – 179 WorldCat 4 Welberg LA , Seckl JR 2001 Prenatal stress, glucocorticoids and the programming of the brain. J Neuroendocrinol 13 : 113 – 128 Google Scholar Crossref Search ADS PubMed WorldCat 5 Matthews SG 2000 Antenatal glucocorticoids and programming of the developing CNS. Pediatr Res 47 : 291 – 300 Google Scholar Crossref Search ADS PubMed WorldCat 6 Weinstock M 2001 Alterations induced by gestational stress in brain morphology and behaviour of the offspring. Prog Neurobiol 65 : 427 – 451 Google Scholar Crossref Search ADS PubMed WorldCat 7 Clark PM 1998 Programming of the hypothalamo-pituitary-adrenal axis and the fetal origins of adult disease hypothesis . Eur J Pediatr 157 ( Suppl 1 ): S7 – S10 Google Scholar Crossref Search ADS PubMed WorldCat 8 Matthews SG 2002 Early programming of the hypothalamo-pituitary-adrenal axis. Trends Endocrinol Metab 13 : 373 – 380 Google Scholar Crossref Search ADS PubMed WorldCat 9 Reul JM , van den Bosch FR , de Kloet ER 1987 Relative occupation of type-I and type-II corticosteroid receptors in rat brain following stress and dexamethasone treatment: functional implications. J Endocrinol 115 : 459 – 467 Google Scholar Crossref Search ADS PubMed WorldCat 10 Bradbury MJ , Akana SF , Cascio CS , Levin N , Jacobson L , Dallman MF 1991 Regulation of basal ACTH secretion by corticosterone is mediated by both type I (MR) and type II (GR) receptors in rat brain. J Steroid Biochem Mol Biol 40 : 133 – 142 Google Scholar Crossref Search ADS PubMed WorldCat 11 Rivier CL , Grigoriadis DE , Rivier JE 2003 Role of corticotropin-releasing factor receptors type 1 and 2 in modulating the rat adrenocorticotropin response to stressors. Endocrinology 144 : 2396 – 2403 Google Scholar Crossref Search ADS PubMed WorldCat 12 Reul JM , Gesing A , Droste S , Stec IS , Weber A , Bachmann C , Bilang-Bleuel A , Holsboer F , Linthorst AC 2000 The brain mineralocorticoid receptor: greedy for ligand, mysterious in function. Eur J Pharmacol 405 : 235 – 249 Google Scholar Crossref Search ADS PubMed WorldCat 13 Turnbull AV , Rivier CL 1999 Regulation of the hypothalamic-pituitary-adrenal axis by cytokines: actions and mechanisms of action. Physiol Rev 79 : 1 – 71 Google Scholar PubMed WorldCat 14 Chrousos GP 1998 Stressors, stress, and neuroendocrine integration of the adaptive response. The 1997 Hans Selye Memorial Lecture. Ann NY Acad Sci 851 : 311 – 335 Google Scholar Crossref Search ADS PubMed WorldCat 15 Nilsson C , Larsson BM , Jennische E , Eriksson E , Bjorntorp P , York DA , Holmang A 2001 Maternal endotoxemia results in obesity and insulin resistance in adult male offspring. Endocrinology 142 : 2622 – 2630 Google Scholar PubMed WorldCat 16 Dahlgren J , Nilsson C , Jennische E , Ho HP , Eriksson E , Niklasson A , Bjorntorp P , Albertsson Wikland K , Holmang A 2001 Prenatal cytokine exposure results in obesity and gender-specific programming . Am J Physiol Endocrinol Metab 281 : E326 – E334 Google Scholar PubMed WorldCat 17 Harbuz MS , Lightman SL 1992 Stress and the hypothalamo-pituitary-adrenal axis: acute, chronic and immunological activation. J Endocrinol 134 : 327 – 339 Google Scholar Crossref Search ADS PubMed WorldCat 18 Lahti RA , Barsuhn C 1974 The effect of minor tranquilizers on stress-induced increases in rat plasma corticosteroids. Psychopharmacologia 35 : 215 – 220 Google Scholar Crossref Search ADS PubMed WorldCat 19 Hogstrand C , Haux C 1990 A radioimmunoassay for perch (Perca fluviatilis) metallothionein. Toxicol Appl Pharmacol 103 : 56 – 65 Google Scholar Crossref Search ADS PubMed WorldCat 20 Levitt NS , Lindsay RS , Holmes MC , Seckl JR 1996 Dexamethasone in the last week of pregnancy attenuates hippocampal glucocorticoid receptor gene expression and elevates blood pressure in the adult offspring in the rat. Neuroendocrinology 64 : 412 – 418 Google Scholar Crossref Search ADS PubMed WorldCat 21 Young JB 2002 Programming of sympathoadrenal function. Trends Endocrinol Metab 13 : 381 – 385 Google Scholar Crossref Search ADS PubMed WorldCat 22 Mangos GJ , Turner SW , Fraser TB , Whitworth JA 2000 The role of corticosterone in corticotrophin (ACTH)-induced hypertension in the rat. J Hypertens 18 : 1849 – 1855 Google Scholar Crossref Search ADS PubMed WorldCat 23 Filipovsky J , Ducimetiere P , Eschwege E , Richard JL , Rosselin G , Claude JR 1996 The relationship of blood pressure with glucose, insulin, heart rate, free fatty acids and plasma cortisol levels according to degree of obesity in middle-aged men. J Hypertens 14 : 229 – 235 Google Scholar Crossref Search ADS PubMed WorldCat 24 Whitworth JA , Mangos GJ , Kelly JJ 2000 Cushing, cortisol, and cardiovascular disease. Hypertension 36 : 912 – 916 Google Scholar Crossref Search ADS PubMed WorldCat 25 Takahashi H , Takeda K , Ashizawa H , Inoue A , Yoneda S , Yoshimura M , Ijichi H 1983 Centrally induced cardiovascular and sympathetic responses to hydrocortisone in rats . Am J Physiol 245 : H1013 – H1018 Google Scholar PubMed WorldCat 26 Schacke H , Docke WD , Asadullah K 2002 Mechanisms involved in the side effects of glucocorticoids. Pharmacol Ther 96 : 23 – 43 Google Scholar Crossref Search ADS PubMed WorldCat 27 Herman JP , Spencer R 1998 Regulation of hippocampal glucocorticoid receptor gene transcription and protein expression in vivo. J Neurosci 18 : 7462 – 7473 Google Scholar PubMed WorldCat 28 Kwak SP , Patel PD , Thompson RC , Akil H , Watson SJ 1993 5′-Heterogeneity of the mineralocorticoid receptor messenger ribonucleic acid: differential expression and regulation of splice variants within the rat hippocampus. Endocrinology 133 : 2344 – 2350 Google Scholar PubMed WorldCat 29 Zennaro MC , Le Menuet D , Lombes M 1996 Characterization of the human mineralocorticoid receptor gene 5′-regulatory region: evidence for differential hormonal regulation of two alternative promoters via nonclassical mechanisms. Mol Endocrinol 10 : 1549 – 1560 Google Scholar PubMed WorldCat 30 Herman JP , Watson SJ , Spencer RL 1999 Defense of adrenocorticosteroid receptor expression in rat hippocampus: effects of stress and strain. Endocrinology 140 : 3981 – 3991 Google Scholar PubMed WorldCat 31 Vazquez DM , Lopez JF , Morano MI , Kwak SP , Watson SJ , Akil H 1998 α-, β-, and γ-Mineralocorticoid receptor messenger ribonucleic acid splice variants: differential expression and rapid regulation in the developing hippocampus. Endocrinology 139 : 3165 – 3177 Google Scholar PubMed WorldCat 32 Liu D , Diorio J , Tannenbaum B , Caldji C , Francis D , Freedman A , Sharma S , Pearson D , Plotsky PM , Meaney MJ 1997 Maternal care, hippocampal glucocorticoid receptors, and hypothalamic-pituitary-adrenal responses to stress. Science 277 : 1659 – 1662 Google Scholar Crossref Search ADS PubMed WorldCat 33 Meaney MJ , Diorio J , Francis D , Widdowson J , LaPlante P , Caldji C , Sharma S , Seckl JR , Plotsky PM 1996 Early environmental regulation of forebrain glucocorticoid receptor gene expression: implications for adrenocortical responses to stress. Dev Neurosci 18 : 49 – 72 Google Scholar Crossref Search ADS PubMed WorldCat 34 Vazquez DM , Van Oers H , Levine S , Akil H 1996 Regulation of glucocorticoid and mineralocorticoid receptor mRNAs in the hippocampus of the maternally deprived infant rat. Brain Res 731 : 79 – 90 Google Scholar Crossref Search ADS PubMed WorldCat 35 Seckl JR , Fink G 1992 Antidepressants increase glucocorticoid and mineralocorticoid receptor mRNA expression in rat hippocampus in vivo. Neuroendocrinology 55 : 621 – 626 Google Scholar Crossref Search ADS PubMed WorldCat 36 Vale W , Spiess J , Rivier C , Rivier J 1981 Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and β-endorphin. Science 213 : 1394 – 1397 Google Scholar Crossref Search ADS PubMed WorldCat 37 Wu Z , Ji H , Hassan A , Aguilera G , Sandberg K 2004 Regulation of pituitary corticotropin releasing factor type-1 receptor mRNA binding proteins by modulation of the hypothalamic-pituitary-adrenal axis. J Neuroendocrinol 16 : 214 – 220 Google Scholar Crossref Search ADS PubMed WorldCat 38 Aguilera G , Rabadan-Diehl C , Nikodemova M 2001 Regulation of pituitary corticotropin releasing hormone receptors. Peptides 22 : 769 – 774 Google Scholar Crossref Search ADS PubMed WorldCat 39 Kafka MS , Benedito MA , Steele LK , Gibson MJ , Zerbe RL , Jacobowitz DM , Roth RH , Zander K 1986 Relationships between behavioral rhythms, plasma corticosterone and hypothalamic circadian rhythms. Chronobiol Int 3 : 117 – 122 Google Scholar Crossref Search ADS PubMed WorldCat 40 Koehl M , Darnaudery M , Dulluc J , Van Reeth O , Le Moal M , Maccari S 1999 Prenatal stress alters circadian activity of hypothalamo-pituitary-adrenal axis and hippocampal corticosteroid receptors in adult rats of both gender. J Neurobiol 40 : 302 – 315 Google Scholar Crossref Search ADS PubMed WorldCat 41 Murphy BE , Clark SJ , Donald IR , Pinsky M , Vedady D 1974 Conversion of maternal cortisol to cortisone during placental transfer to the human fetus. Am J Obstet Gynecol 118 : 538 – 541 Google Scholar Crossref Search ADS PubMed WorldCat 42 Riley SC , Challis JR 1991 Corticotrophin-releasing hormone production by the placenta and fetal membranes. Placenta 12 : 105 – 119 Google Scholar Crossref Search ADS PubMed WorldCat 43 Dudley DJ 1999 Immunoendocrinology of preterm labor: the link between corticotropin-releasing hormone and inflammation . Am J Obstet Gynecol 180 : S251 – S256 Google Scholar Crossref Search ADS PubMed WorldCat 44 Raber J , Sorg O , Horn TF , Yu N , Koob GF , Campbell IL , Bloom FE 1998 Inflammatory cytokines: putative regulators of neuronal and neuro-endocrine function. Brain Res Brain Res Rev 26 : 320 – 326 Google Scholar Crossref Search ADS PubMed WorldCat 45 Reul JM , Stec I , Wiegers GJ , Labeur MS , Linthorst AC , Arzt E , Holsboer F 1994 Prenatal immune challenge alters the hypothalamic-pituitary-adrenocortical axis in adult rats. J Clin Invest 93 : 2600 – 2607 Google Scholar Crossref Search ADS PubMed WorldCat 46 Gotz F , Dorner G , Malz U , Rohde W , Stahl F , Poppe I , Schulze M , Plagemann A 1993 Short- and long-term effects of perinatal interleukin-1 β-application in rats. Neuroendocrinology 58 : 344 – 351 Google Scholar Crossref Search ADS PubMed WorldCat 47 Shimizu I , Adachi N , Liu K , Lei B , Nagaro T , Arai T 1999 Sepsis facilitates brain serotonin activity and impairs learning ability in rats. Brain Res 830 : 94 – 100 Google Scholar Crossref Search ADS PubMed WorldCat 48 Arborelius L , Owens MJ , Plotsky PM , Nemeroff CB 1999 The role of corticotropin-releasing factor in depression and anxiety disorders. J Endocrinol 160 : 1 – 12 Google Scholar Crossref Search ADS PubMed WorldCat 49 Patrick MJ 1967 Influence of maternal renal infection on the foetus and infant. Arch Dis Child 42 : 208 – 213 Google Scholar Crossref Search ADS PubMed WorldCat 50 Mosier Jr HD , Dearden LC , Jansons RA , Roberts RC , Biggs CS 1982 Disproportionate growth of organs and body weight following glucocorticoid treatment of the rat fetus. Dev Pharmacol Ther 4 : 89 – 105 Google Scholar PubMed WorldCat 51 Novy MJ , Walsh SW 1983 Dexamethasone and estradiol treatment in pregnant rhesus macaques: effects on gestational length, maternal plasma hormones, and fetal growth. Am J Obstet Gynecol 145 : 920 – 931 Google Scholar Crossref Search ADS PubMed WorldCat 52 Reinisch JM , Simon NG , Karow WG , Gandelman R 1978 Prenatal exposure to prednisone in humans and animals retards intrauterine growth. Science 202 : 436 – 438 Google Scholar Crossref Search ADS PubMed WorldCat 53 Igosheva N , Klimova O , Anishchenko T , Glover V 2004 Prenatal stress alters cardiovascular responses in adult rats. J Physiol 557 : 273 – 285 Google Scholar Crossref Search ADS PubMed WorldCat 54 Zukowska-Grojec Z , Shen GH , Capraro PA , Vaz CA 1991 Cardiovascular, neuropeptide Y, and adrenergic responses in stress are sexually differentiated. Physiol Behav 49 : 771 – 777 Google Scholar Crossref Search ADS PubMed WorldCat 55 Livezey GT , Miller JM , Vogel WH 1985 Plasma norepinephrine, epinephrine and corticosterone stress responses to restraint in individual male and female rats, and their correlations. Neurosci Lett 62 : 51 – 56 Google Scholar Crossref Search ADS PubMed WorldCat 56 Girdler SS , Turner JR , Sherwood A , Light KC 1990 Gender differences in blood pressure control during a variety of behavioral stressors. Psychosom Med 52 : 571 – 591 Google Scholar Crossref Search ADS PubMed WorldCat 57 Szuran TF , Pliska V , Pokorny J , Welzl H 2000 Prenatal stress in rats: effects on plasma corticosterone, hippocampal glucocorticoid receptors, and maze performance. Physiol Behav 71 : 353 – 362 Google Scholar Crossref Search ADS PubMed WorldCat 58 Weinstock M , Matlina E , Maor GI , Rosen H , McEwen BS 1992 Prenatal stress selectively alters the reactivity of the hypothalamic-pituitary adrenal system in the female rat. Brain Res 595 : 195 – 200 Google Scholar Crossref Search ADS PubMed WorldCat 59 McCormick CM , Smythe JW , Sharma S , Meaney MJ 1995 Sex-specific effects of prenatal stress on hypothalamic-pituitary-adrenal responses to stress and brain glucocorticoid receptor density in adult rats. Brain Res Dev Brain Res 84 : 55 – 61 Google Scholar Crossref Search ADS PubMed WorldCat 60 Gaillard RC , Spinedi E 1998 Sex- and stress-steroids interactions and the immune system: evidence for a neuroendocrine-immunological sexual dimorphism. Domest Anim Endocrinol 15 : 345 – 352 Google Scholar Crossref Search ADS PubMed WorldCat 61 Turner BB 1997 Influence of gonadal steroids on brain corticosteroid receptors: a minireview. Neurochem Res 22 : 1375 – 1385 Google Scholar Crossref Search ADS PubMed WorldCat 62 Canny BJ , O’Farrell KA , Clarke IJ , Tilbrook AJ 1999 The influence of sex and gonadectomy on the hypothalamo-pituitary-adrenal axis of the sheep. J Endocrinol 162 : 215 – 225 Google Scholar Crossref Search ADS PubMed WorldCat 63 Gold PW , Licinio J , Wong ML , Chrousos GP 1995 Corticotropin releasing hormone in the pathophysiology of melancholic and atypical depression and in the mechanism of action of antidepressant drugs. Ann NY Acad Sci 771 : 716 – 729 Google Scholar Crossref Search ADS PubMed WorldCat 64 Rhodes ME , Rubin RT 1999 Functional sex differences (’sexual diergism’) of central nervous system cholinergic systems, vasopressin, and hypothalamic-pituitary-adrenal axis activity in mammals: a selective review. Brain Res Brain Res Rev 30 : 135 – 152 Google Scholar Crossref Search ADS PubMed WorldCat 65 Handa RJ , Burgess LH , Kerr JE , O’Keefe JA 1994 Gonadal steroid hormone receptors and sex differences in the hypothalamo-pituitary-adrenal axis. Horm Behav 28 : 464 – 476 Google Scholar Crossref Search ADS PubMed WorldCat 66 Holsboer F , Von Bardeleben U , Gerken A , Stalla GK , Muller OA 1984 Blunted corticotropin and normal cortisol response to human corticotropin-releasing factor in depression. N Engl J Med 311 : 1127 Google Scholar PubMed WorldCat 67 Carroll BJ , Curtis GC , Mendels J 1976 Neuroendocrine regulation in depression. II. Discrimination of depressed from nondepressed patients. Arch Gen Psychiatry 33 : 1051 – 1058 Google Scholar Crossref Search ADS PubMed WorldCat 68 Van Cauter E , Turek FW 1986 Depression: a disorder of timekeeping? Perspect Biol Med 29 : 510 – 519 Google Scholar Crossref Search ADS PubMed WorldCat 69 Raadsheer FC , Hoogendijk WJ , Stam FC , Tilders FJ , Swaab DF 1994 Increased numbers of corticotropin-releasing hormone expressing neurons in the hypothalamic paraventricular nucleus of depressed patients. Neuroendocrinology 60 : 436 – 444 Google Scholar Crossref Search ADS PubMed WorldCat 70 Nemeroff CB , Widerlov E , Bissette G , Walleus H , Karlsson I , Eklund K , Kilts CD , Loosen PT , Vale W 1984 Elevated concentrations of CSF corticotropin-releasing factor-like immunoreactivity in depressed patients. Science 226 : 1342 – 1344 Google Scholar Crossref Search ADS PubMed WorldCat 71 Musselman DL , Evans DL , Nemeroff CB 1998 The relationship of depression to cardiovascular disease: epidemiology, biology, and treatment. Arch Gen Psychiatry 55 : 580 – 592 Google Scholar Crossref Search ADS PubMed WorldCat Copyright © 2004 by The Endocrine Society
TI - Prenatal Exposure to Interleukin-6 Results in Hypertension and Increased Hypothalamic-Pituitary-Adrenal Axis Activity in Adult Rats
JO - Endocrinology
DO - 10.1210/en.2004-0742
DA - 2004-11-01
UR - https://www.deepdyve.com/lp/oxford-university-press/prenatal-exposure-to-interleukin-6-results-in-hypertension-and-aCMIXlOsHs
SP - 4897
VL - 145
IS - 11
DP - DeepDyve
ER -