TY - JOUR
AU - Yamamoto,, Nobuhiko
AB - Abstract Axon branching is a crucial process for cortical circuit formation. However, how the cytoskeletal changes in axon branching are regulated is not fully understood. In the present study, we investigated the role of RhoA guanine nucleotide exchange factors (RhoA-GEFs) in branch formation of horizontally elongating axons (horizontal axons) in the mammalian cortex. In situ hybridization showed that more than half of all known RhoA-GEFs were expressed in the developing rat cortex. These RhoA-GEFs were mostly expressed in the macaque cortex as well. An overexpression study using organotypic cortical slice cultures demonstrated that several RhoA-GEFs strongly promoted horizontal axon branching. Moreover, branching patterns were different between overexpressed RhoA-GEFs. In particular, ARHGEF18 markedly increased terminal arbors, whereas active breakpoint cluster region-related protein (ABR) increased short branches in both distal and proximal regions of horizontal axons. Rho kinase inhibitor treatment completely suppressed the branch-promoting effect of ARHGEF18 overexpression, but only partially affected that of ABR, suggesting that these RhoA-GEFs employ distinct downstream pathways. Furthermore, knockdown of either ARHGEF18 or ABR considerably suppressed axon branching. Taken together, the present study revealed that subsets of RhoA-GEFs differentially promote axon branching of mammalian cortical neurons. axon morphology, cortical development, cytoskeleton, RhoGEF, neuronal circuit Introduction Axon branching is an essential developmental process in neural circuit formation to make synaptic connections with multiple target cells. This process is known to be regulated by various extracellular molecules such as secreted molecules, extracellular matrix, and cell surface molecules (Gibson and Ma 2011; Bilimoria and Bonni 2013). These molecules are released from surrounding and target cells and bind to their specific receptors on growing axons. Such ligand–receptor interactions cause cytoskeletal changes via cytoplasmic signaling pathways (Hall and Lalli 2010; Gallo 2011; Kalil and Dent 2014; Spillane and Gallo 2014). However, the underlying molecular mechanism is not fully understood. Horizontal connections in the mammalian cerebral cortex are one of the suitable systems, in which to investigate the molecular mechanisms of axon branching, as their morphological and developmental aspects have been well characterized (Gilbert 1992; Katz and Callaway 1992; Callaway 1998a; Foeller and Feldman 2004). Horizontally elongating axons (horizontal axons) originate from layer 2/3 pyramidal neurons and form terminal branches to innervate distant layer 2/3 cells, which contributes to the horizontal spreading of sensory information (Gilbert and Wiesel 1979, 1983; Kisvárday et al. 1986; Lohmann and Rörig 1994; Weliky and Katz 1994; Nelson and Katz 1995; Callaway 1998b; Larsen and Callaway 2006). Horizontal axons are well conserved in mammalian cortex, suggesting a common mechanism for establishing horizontal connections. Previous studies have shown that horizontal axons form branches preferentially on terminal domains with dynamic branch addition and elimination (Callaway and Katz 1990; Durack and Katz 1996; Ruthazer and Stryker 1996; Uesaka et al. 2005). Evidence further demonstrated that an active form of RhoA, a member of Rho family small GTPases, positively regulates horizontal axon branching (Ahnert-Hilger et al. 2004; Ohnami et al. 2008). A plausible mechanism is that various extracellular signaling molecules induce RhoA activation via corresponding cytoplasmic mediators. To reveal the molecular mechanism that underlies this cytoplasmic signaling, we focused on Dbl family Rho guanine nucleotide exchange factors (RhoGEFs). RhoGEFs are composed of about 70 members in mammals, and each member activates Rho family small GTPases in response to upstream signals (Jaffe and Hall 2005). This property is suitable to mediate the convergence of various extracellular signals onto cytoskeletal remodeling through activation of Rho small GTPases. Among RhoGEFs, 28 members have been identified to activate RhoA (hereafter referred as RhoA-GEFs) (Rossman et al. 2005; Schiller 2006; Garcia-Mata and Burridge 2007; Loirand et al. 2008). Here, we sought to investigate whether RhoA-GEFs are involved in horizontal axon branching. First, RhoA-GEF expression in the developing cortex was investigated by in situ hybridization. Then, the function of RhoA-GEFs on horizontal axon branching was investigated through in vitro gain-of-function and loss-of-function studies. The results demonstrate that several RhoA-GEFs are expressed in the mammalian cortex beyond species and promote horizontal axon branching in distinct manners. Materials and Methods Animals Sprague–Dawley (SD) rats were purchased from Japan Lab Animals and used for in situ hybridization and culture experiments. Two brains of newborn macaque monkeys (a rhesus monkey, Macaca mulatta, from Primate Research Institute, Kyoto University and a Japanese monkey, M. fuscata, from Tsukuba Primate Research Center) were used for in situ hybridization. All experiments were performed according to the guidelines established by the animal welfare committees of Osaka University, the National Institute for Basic Biology, Japan, and the Japan Neuroscience Society. Preparation of Plasmid Constructs Full-length open reading frame (ORF) clones of human RhoA-GEFs were purchased from Promega, and were subcloned into pCAG-HA to obtain hemagglutinin (HA)-tagged RhoA-GEF expression vectors. Lists of ORF clones are given in Supplementary Table S1. The short hairpin RNAs (shRNAs) for rat Arhgef18 and active breakpoint cluster region-related protein (Abr) were designed and cloned into piGENE mU6 vector. The target sequence for Arhgef18 is 5′-GCAGCAGAGCAAGAAGTTTCA-3′ and that for Abr is 5′-GGAGAAGTTCAAAGTCTGG-3′. All plasmids were isolated (HiPure Plasmid Maxiprep Kit, Invitrogen) and suspended in Hanks’ solution. Probe Preparation and In Situ Hybridization cDNA fragments of rat and macaque RhoA-GEFs were amplified by Reverse transcription polymerase chain reaction (RT-PCR) from total RNA, which was isolated from P8 rat cortex and P0 macaque cortex, respectively. The primers used for PCR are listed in Supplementary Tables S2 and S3. The cDNA fragments were then cloned into pGEM-T vector. To produce a linearized template for the synthesis of RNA probes, the inserts were PCR-amplified with primers containing T7 and SP6 promoter sequences (T7 sequence, TTGTAAAACGACGGCCAGTG; SP6 sequence, TGACCATGATTACGCCAAGC), and the PCR products were purified (QIAquick PCR Purification Kit, Qiagen). A DIG-labeled RNA probe was synthesized (DIG RNA Labeling Mix, Roche) following the manufacturer’s instructions. In situ hybridization was performed on the developing rat and macaque brains, as previously described (Fengyi et al. 2000; Zhong et al. 2004; Komatsu et al. 2005; Hayano et al. 2014). Briefly, rat brains were harvested and fixed in 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) at 4 °C overnight. After cryopreservation with 30% sucrose in PBS, the brains were sectioned into 20-μm-thick coronal sections using a cryostat (Leica CM1850). The sections were subjected to refixation, acetylation, and pre-hybridization followed by hybridization with the DIG-labeled probe (4 μg/mL) at 60 °C. After extensive washing, the sections were incubated with alkaline phosphatase (AP)-conjugated anti-DIG antibody (1:2000, Roche) at 4 °C overnight. Finally, the hybridized probes were visualized with AP substrate (BM Purple, Roche) at RT. Macaque brains were sectioned into 40-μm-thick coronal sections using a sliding microtome (ROM-380, YAMATO, Japan). Free-floating sections were subjected to refixation, proteinase K (0.5 μg/mL) treatment, acetylation, pre-hybridization, followed by incubation in hybridization buffer containing 1 μg/mL DIG-labeled probes at 60 °C. The sections were washed and then treated with RNase buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 500 mM NaCl) containing 20 μg/mL RNase A. After washing, the hybridized probe was detected with AP-conjugated anti-DIG antibody (1:1000, Roche) and NBT/BCIP AP substrate (Roche). Organotypic Slice Culture of Cortex Organotypic slice culture of cortex was performed as described previously (Yamamoto et al. 1989; Yamamoto et al. 1992; Uesaka et al. 2005). In brief, approximately 300-μm-thick coronal slices were dissected from sensory cortices of P1 rat and were placed on collagen-coated culture membranes (Millicell-CMPICMORG50, Millipore). The cortical explants were cultured in slice culture medium containing Dulbecco’s modified Eagle medium/F12 (DMEM/F12), 10% modified N2 supplement, and 5% fetal bovine serum (FBS) for the first 3 days. Half of the medium was changed to DMEM/F12 with 10% modified N2 supplement at 3 days in vitro (DIV) and every other day from 7–14 DIV. Pharmacological Treatment of Cultured Cortical Slices To investigate the involvement of RhoA signaling in RhoA-GEF function, the Rho kinase (ROCK) inhibitor, Y-27632 (331752–47-7, FUJIFILM Wako Pure Chemical) was added at a concentration of 50 μM to the culture medium during the second week in culture. Y-27632-containing medium was exchanged every other day. In Vitro Electroporation To transfect EGFP expression vector, overexpression constructs and knockdown constructs, the cortical slice cultures were subjected to in vitro electroporation at 4–5 DIV as described previously (Uesaka et al. 2008; Matsumoto et al. 2015). Briefly, a small amount of plasmid solution containing pTα1-EGFP (2 μg/μL), a mixture of pTα1-EGFP plus pCAG-HA-RhoGEF (4 μg/μL), or mixture of pTα1-EGFP plus shRNA expression plasmid (1 μg/μL) was pressure ejected using a fine glass capillary onto the upper part of the cultured slice. Immediately after the application, five trains of 200 square pulses (1 msec duration at 200 Hz, 250 μA) were delivered with another glass micropipette (inner diameter of 150 μm) to the site. Immunohistochemistry Immunostaining of organotypic cortical slices was performed as described previously (Yamada et al. 2010). Cultured slices were fixed with PFA at 14 DIV, washed, and incubated with rat anti-GFP monoclonal (1:1000, Nacalai, GF090R, Cat# 04404–84) and mouse anti-HA monoclonal (1:200, cell signaling, 6E2, Cat# 2367) antibodies in blocking solution (5% normal goat serum, 0.3% Triton X-100 in PBS) at 4 °C overnight. After extensive washing, the slices were incubated with appropriate secondary antibodies for 2 h at RT. After washing, the slices were mounted in medium containing 2.3% DABCO, 1 μg/mL DAPI and 50% glycerol. Primary Neuron Culture, Electroporation, and qRT-PCR Dissociated primary cortical neurons were collected from E18 SD rats by trypsinization as described previously (Kitagawa et al. 2017). The cells (1 × 106 cells) were mixed with EGFP (0.1 μg/μL) and shRNA expression plasmid (0.1 μg/μL) in Opti-MEM (Invitrogen), and were subjected to electroporation in a cuvette electrode (SE202, Bex) with electrical pulses of single 275 V (10 ms) followed by ten 30 V pulses (50 ms on/off) using an electroporator (CUY21EX, Bex). After electroporation, the cells were transferred to 10 volumes of the slice culture medium and allowed to recover for 10 min at 37 °C. Then the cells were seeded in a poly-L-ornithine-coated 4-well plate at a density of 2 × 105 cells/cm2. Two days post-transfection, total RNA was extracted from each well using High Pure RNA Tissue Kit (Roche), and cDNA was synthesized from 200 ng total RNA using ReverTra Ace qPCR RT kit (Toyobo), following the manufacturer’s instructions. Messenger RNA (mRNA) expression was analyzed with the TaqMan Gene Expression Assay (Applied Biosystems), with an endogenous control of rat GAPD (Applied Biosystems). The following primer pairs and universal probes (Roche) were used: for Arhgef18, 5′-GGATGTAGCATATGCCAAGAAAC-3′, 5′-GTGATGCGCCTCTGTCTG-3′, and UPL #10; for Abr, 5′-TTGCCTTTGACAGAACGGTA-3′, 5′-AATAGGCAGCTGGGAAGTTG-3′, and UPL #69. Gene expression levels were calculated factoring in transfection efficacy (ca. 45%). COS7 Culture, Transfection, and Immunocytochemistry COS7 cells were cultured in a standard growth medium containing DMEM, high glucose (Thermo Fisher Scientific) and 10% FBS. The plasmids encoding EGFP (200 ng/μL), HA-RhoA-GEF (400 ng/μL), and shRNA (400 ng/μL) were co-transfected using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Four hours after transfection, the medium was changed to fresh growth medium. Two days after transfection, the cells were washed with PBS and fixed with PFA for 15 min at RT. Overexpressed RhoA-GEF was immunostained with mouse anti-HA-tag primary antibody and visualized with Alexa Fluor 594-conjugated donkey anti-mouse IgG (1:500, Invitrogen) secondary antibody. Image Acquisition and Analysis Fluorescently labeled neurons were imaged by confocal microscopy (Nikon C1). For cortical slice cultures, tiled z-stack images were acquired with a 10x objective (NA = 0.45, pinhole size 30 μm) at 5-μm steps. The images were stitched using the Stitching plugin in Fiji image processing software. Axons were traced in 2D-projected images using the Simple Neurite Tracer plugin in Fiji. Labeled neurons that met the following criteria were chosen for analysis. First, their soma was located within 100–400 μm from the pial surface. Second, they had prominent apical dendrite and spine-like protrusions. Third, they had single primary axons that extended vertically from the soma to the white matter. Data were collected from more than three independent experiments. The “total length” was measured as the length of an entire horizontal axon process. The “distance from origin to tip” was defined as a linear distance between the origin of horizontal axons and their farthest tip. The “tip length” was obtained by measuring the length from a tip to the first branch point (terminal segment). Quantification was achieved using L-measure software (Scorcioni et al. 2008). Statistical analysis was performed in R software. Sample numbers are presented as the number of horizontal axons for quantification of “number of branch points”, “total length”, and “distance from origin to tip”. The sample number for tip length analysis was presented as the number of terminal segments. Tukey Honest Significant Difference was used for multiple comparison statistical tests. All statistical values are presented as mean ± SEM. Results Gene Expression of RhoA-GEFs in the Developing Mammalian Cortex First, we examined which RhoA-GEFs are expressed in the developing rat sensory cortex, including visual and somatosensory areas. Gene expression of all the 28 RhoA-GEFs was investigated by in situ hybridization at postnatal day (P) 14, when horizontal axon branches are formed (Lohmann and Rörig 1994; van Brederode et al. 2000; Uesaka et al. 2005; Larsen and Callaway 2006). The result showed that ABR and NGEF were most strongly expressed, while 11 members including ARHGEF2, ARHGEF11, ARHGEF12, MCF2L, ARHGEF18, and BCR were moderately expressed (Fig. 1). Most of them were broadly expressed in all cortical layers irrespective of expression levels, although a few showed lamina-specific expression (e.g., NGEF). The expression levels of other members such as ARHGEF28, ARHGEF40, and VAV2 were very low, almost the same as those obtained with sense probes. Thus, about half of RhoA-GEF members were expressed in the developing rat cerebral cortex. Figure 1 Open in new tabDownload slide Thirteen RhoA-GEFs are clearly expressed in rat sensory cortices when horizontal axons form branches. In situ hybridization was performed on P14 rat cortex. The expression of 16 representative RhoA-GEFs out of all 28 members in primary visual cortex was shown. Panels are arranged in descending order of signal intensity. Horizontal lines on the left indicate the boundary of cortical layers as depicted in top left. Scale bar = 500 μm. Figure 1 Open in new tabDownload slide Thirteen RhoA-GEFs are clearly expressed in rat sensory cortices when horizontal axons form branches. In situ hybridization was performed on P14 rat cortex. The expression of 16 representative RhoA-GEFs out of all 28 members in primary visual cortex was shown. Panels are arranged in descending order of signal intensity. Horizontal lines on the left indicate the boundary of cortical layers as depicted in top left. Scale bar = 500 μm. RhoA-GEF expression was also investigated in the developing macaque cortex, because horizontal axon connections are evolutionarily conserved across mammalian species (Gilbert and Wiesel 1979; Callaway and Katz 1990; Lohmann and Rörig 1994; Callaway 1998a; Larsen and Callaway 2006). In situ hybridization was performed on the occipital cortex of P0 macaque monkeys (Supplementary Fig. S1A), as horizontal axon branching is thought to develop from late embryonic to early postnatal stages (Bourgeois and Rakic 1993; Callaway and Wiser 1996; Callaway 1998b). The result showed that about half of RhoA-GEF members were expressed in the macaque primary visual cortex (Supplementary Fig. S1B). As was the case with expression in rat cortex, ABR and NGEF were strongly expressed in macaque cortex, while ARHGEF2, ARHGEF11, ARHGEF12, MCF2L, ARHGEF18, and BCR were expressed moderately. Thus, the overall tendency in the gene expression of RhoA-GEFs was similar between the two species, although some members showed different gene expression in terms of expression levels (ARHGEF3, ARHGEF40, and VAV2) and expression pattern (ARHGEF8). As a result, more than half of RhoA-GEFs were found to be expressed in either of the two species. Overexpression of 7 RhoA-GEFs Increases Horizontal Axon Branches Based on the pattern of gene expression, we selected 17 RhoA-GEF members (Supplementary Table S1) and investigated their role in horizontal axon branching through an overexpression study using organotypic cortical slice cultures. This culture technique is useful to assess molecular functions in a cellular environment that is close to in vivo (Yamamoto et al. 1992). As illustrated in Figure 2A, coronal slices were dissected from rat sensory cortices at P1 and cultured on membrane filters. At 4–5 DIV, a few days before the onset of horizontal axon branching, a plasmid encoding enhanced green fluorescent protein (EGFP) under a neuron-specific promoter (pTα1-EGFP) was transfected into a small number of upper layer neurons together with or without each RhoA-GEF expression plasmid. The expression of transfected RhoA-GEFs was confirmed by immunohistochemical staining against the HA-tag (Supplementary Fig. S2) and the morphology of labeled horizontal axons was analyzed at 14 DIV. Figure 2 Open in new tabDownload slide Overexpression of 7 RhoA-GEFs markedly increased horizontal axon branches. (A) A schematic illustrating experimental design of organotypic cortical slice culture experiments. (B) Example photo micrograph showing a cultured cortical slice in a control experiment at 14 DIV. Only a few upper layer cells (3–5 cells) were fluorescently labeled with EGFP, most of which showed the typical pyramidal morphology of cortical layer 2/3 neurons. Primary axons (arrow heads) extend perpendicularly to the pial surface (broken line), and horizontal axons emerge from primary axons and extend along the pial surface. One representative horizontal axon is colored in red. Scale bar = 500 μm. (C) Example photo micrographs showing part of a horizontal axon at 14 DIV. Control and the 7 RhoA-GEF members that markedly increased branches are shown. RhoA-GEFs, especially ABR, increased short branches. Scale bar = 100 μm. Figure 2 Open in new tabDownload slide Overexpression of 7 RhoA-GEFs markedly increased horizontal axon branches. (A) A schematic illustrating experimental design of organotypic cortical slice culture experiments. (B) Example photo micrograph showing a cultured cortical slice in a control experiment at 14 DIV. Only a few upper layer cells (3–5 cells) were fluorescently labeled with EGFP, most of which showed the typical pyramidal morphology of cortical layer 2/3 neurons. Primary axons (arrow heads) extend perpendicularly to the pial surface (broken line), and horizontal axons emerge from primary axons and extend along the pial surface. One representative horizontal axon is colored in red. Scale bar = 500 μm. (C) Example photo micrographs showing part of a horizontal axon at 14 DIV. Control and the 7 RhoA-GEF members that markedly increased branches are shown. RhoA-GEFs, especially ABR, increased short branches. Scale bar = 100 μm. In the control, where only EGFP was transfected, labeled upper layer neurons showed typical pyramidal morphology with apical and basal dendrites, and primary descending axons that ran perpendicularly to the pial surface (Fig. 2B). Horizontal axons were found to extend from the proximal part of the primary descending axons, and form several branches (Fig. 2B), as reported previously (Uesaka et al. 2005; Ohnami et al. 2008). Horizontal axon branches were increased dramatically when any of several RhoA-GEFs were overexpressed (Fig. 2C). To quantify the number of axon branches, individually distinguishable horizontal axons were traced from origin to axonal tips (Fig. 3A). The result showed that the branch number was significantly increased when either ABR, BCR, MCF2L, ARHGEF2, ARHGEF11, ARHGEF12, or ARHGEF18 were overexpressed (Fig. 3B, control, 6.4 ± 0.9, n = 31; HA-ABR, 35.6 ± 19.0, n = 7, P < 0.05; HA-BCR, 51.7 ± 12.1, n = 6, P < 0.01; HA-MCF2L, 15.8 ± 5.2, n = 6, P < 0.05; HA-ARHGEF2, 17.2 ± 5.0, n = 6, P < 0.05; HA-ARHGEF11, 21.0 ± 5.1, n = 6, P < 0.01; HA-ARHGEF12, 27.3 ± 10.1, n = 7, P < 0.001; HA-ARHGEF18, 18.7 ± 3.4, n = 12, P < 0.001 against control, Pairwise Wilcoxon rank-sum test with P-value adjusted by Holm’s method). Thus, horizontal axon branching was promoted by overexpression of these seven RhoA-GEFs. Figure 3 Open in new tabDownload slide RhoA-GEF overexpressing axons in slice culture at 14 DIV. (A) Representative traced images of horizontal axons in control and 7 overexpression experiments. Entire individual horizontal axons were traced in order to analyze aspects of horizontal axon morphology, and were aligned so as to extend from right to left. After overexpression horizontal axons form more branches than control. Note that ABR-, BCR-, and MCF2L-overexpressing axons form branches throughout axon shafts, while ARHGEF12- and ARHGEF18-overexpressing axons form many terminal branches. Scale bar = 500 μm. (B) Quantitative analysis of the number of branch points per horizontal axon. *P < 0.05, **P < 0.01, ***P < 0.001 against control, Pairwise Wilcoxon rank-sum test with P-value adjusted by Holm’s method. Figure 3 Open in new tabDownload slide RhoA-GEF overexpressing axons in slice culture at 14 DIV. (A) Representative traced images of horizontal axons in control and 7 overexpression experiments. Entire individual horizontal axons were traced in order to analyze aspects of horizontal axon morphology, and were aligned so as to extend from right to left. After overexpression horizontal axons form more branches than control. Note that ABR-, BCR-, and MCF2L-overexpressing axons form branches throughout axon shafts, while ARHGEF12- and ARHGEF18-overexpressing axons form many terminal branches. Scale bar = 500 μm. (B) Quantitative analysis of the number of branch points per horizontal axon. *P < 0.05, **P < 0.01, ***P < 0.001 against control, Pairwise Wilcoxon rank-sum test with P-value adjusted by Holm’s method. ARHGEF18 and ABR Overexpression Induces Different Branching Patterns As shown in Figure 3A, it is likely that axonal branching patterns are somewhat different between the overexpressed RhoA-GEFs. The horizontal axons transfected with ARHGEF12 or ARHGEF18 appeared to form many branches in the distal part of horizontal axons, whereas ABR, BCR, or MCF2L increased short branches in axon shafts. Such morphological aspects were further analyzed, focusing on ABR and ARHGEF18, whose overexpression caused these marked effects. In spite of the increase in the number of branch points (see above), overall axon growth (the total length) was not obviously increased in either ABR- or ARHGEF18-overexpressing axons (Fig. 4A, control, 2429 ± 256 μm, n = 31; HA-ABR, 2656 ± 809 μm, n = 7; HA-ARHGEF18, 3017 ± 550 μm, n = 12, P > 0.05, Tukey test). In addition, tip lengths became significantly shorter in overexpressing neurons (Fig. 4B, control, 127.8 ± 11.7 μm, tip number = 210; HA-ABR, 22.8 ± 1.7 μm, tip number = 280, P < 0.001; HA-ARHGEF18, 51.7 ± 4.2 μm, tip number = 263, P < 0.001 against control, Tukey test), suggesting that overexpression of ABR and ARHGEF18 increased the formation of short branches. Noticeably, tip length was much shorter in ABR-overexpressing (P < 0.01, Tukey test) than in ARHGEF18-overexpressing axons. Figure 4 Open in new tabDownload slide ABR and ARHGEF18 induce distinct aspects of horizontal axon morphology. (A–C) Quantitative analysis of the total length, the tip length, and the distance from the origin to the tip, respectively. **P < 0.01, ***P < 0.001; n.s., not significant, Tukey test. (D) The distribution of branch points along horizontal axon shafts was analyzed quantitatively. The distance from the origin to the tip of the horizontal axon was divided by 6 equally spaced concentric circles, and then the number of branch points in each annulus was quantified. (E) Quantification of the number of branch points in each annulus shows that ABR overexpression increased the number of branches throughout axon shafts, while ARHGEF18 increased branches around terminal parts selectively. (F) Relative cumulative frequency plots of branch points over each annulus. The right-shifted curve in ARHGEF18-overexpression indicates that relative branch distribution was higher in the terminal domain of horizontal axons. ABR did not change the branch distribution significantly compared to control. **P < 0.01, Kolmogorov–Smirnov test. Figure 4 Open in new tabDownload slide ABR and ARHGEF18 induce distinct aspects of horizontal axon morphology. (A–C) Quantitative analysis of the total length, the tip length, and the distance from the origin to the tip, respectively. **P < 0.01, ***P < 0.001; n.s., not significant, Tukey test. (D) The distribution of branch points along horizontal axon shafts was analyzed quantitatively. The distance from the origin to the tip of the horizontal axon was divided by 6 equally spaced concentric circles, and then the number of branch points in each annulus was quantified. (E) Quantification of the number of branch points in each annulus shows that ABR overexpression increased the number of branches throughout axon shafts, while ARHGEF18 increased branches around terminal parts selectively. (F) Relative cumulative frequency plots of branch points over each annulus. The right-shifted curve in ARHGEF18-overexpression indicates that relative branch distribution was higher in the terminal domain of horizontal axons. ABR did not change the branch distribution significantly compared to control. **P < 0.01, Kolmogorov–Smirnov test. To analyze the spatial distribution of branches, the distance between the origin and the tip of horizontal axons was divided by 6 equally spaced concentric circles, and the number of branch points in each annulus was quantified (Fig. 4D). As shown in Figure 4E, control horizontal axons formed more branches in the distal than in the proximal part. Overexpression of ABR increased branches in the both proximal and distal parts. In contrast, branches were dramatically increased in the distal but not in the proximal part when ARHGEF18 was overexpressed, as analyzed by plotting relative cumulative frequency of branch points (Fig. 4F). The result clearly showed that the branch distribution of ARHGEF18-overexpressing horizontal axons were shifted toward the terminal domain of horizontal axons (P < 0.01, Kolmogorov–Smirnov test), whereas that of ABR-overexpressing axons did not change significantly. This was not due to the changes in horizontal axon extension because the distance between the origin and the tip was not different significantly between control, ABR-overexpressing and ARHGEF18-overexpressing horizontal axons (Fig. 4C, control, 1080 ± 73 μm, n = 31; HA-ABR, 1100 ± 137 μm, n = 7; HA-ARHGEF18, 1158 ± 130 μm, n = 12, P > 0.05, Tukey test). These results indicate that ARHGEF18 and ABR are involved in distinct aspects of axon branching. Downstream Effector of ARHGEF18 and ABR for Axon Branching As it is known that ARHGEF18 and ABR act not only on RhoA but also on other Rho family small GTPases (Heisterkamp et al. 1993; Tan et al. 1993; Blomquist et al. 2000; Kaartinen et al. 2001; Niu et al. 2003; Nagata and Inagaki 2005), we sought to investigate to what extent RhoA acts as the downstream molecule for the branch-promoting activity of ARHGEF18 and ABR. To this end, cultured cortical slices were treated with Y-27632, a ROCK inhibitor, which inhibits downstream RhoA signaling (Uehata et al. 1997; Madaule et al. 1998), during the second week in vitro. If these RhoA-GEFs work via RhoA-ROCK signaling, the overexpression phenotype should be diminished. As shown in Figure 5A-27632-treated ARHGEF18-overexpressing axons formed few branches (see also ARHGEF18 in Fig. 3A). Quantitatively, the ARHGEF18-induced increase in the number of branch points was dramatically blocked by treatment with Y-27632 (Fig. 5B, control, 6.4 ± 0.9, n = 31; HA-ARHGEF18, 18.7 ± 3.4, n = 12; HA-ARHGEF18 + Y-27632, 3.8 ± 0.9, n = 12, P < 0.001 against HA-ARHGEF18, Tukey test). In addition, the tip lengths were longer in Y-27632 treated ARHGEF18-overexpressing axons than the control and untreated ARHGEF18 overexpressing axons (Fig. 5C, control, 127.8 ± 11.7 μm, tip number = 210; HA-ARHGEF18, 51.7 ± 4.2 μm, tip number = 263; HA-ARHGEF18 + Y-27632, 384.1 ± 55.3 μm, tip number = 55, P < 0.001 against control and HA-ARHGEF18, Tukey test), indicating suppression of branch formation in the presence of the ROCK inhibitor. Overall axon growth was not affected significantly (Fig. 5D, the total length: control, 2429 ± 256 μm, n = 31; HA-ARHGEF18, 3017 ± 550 μm, n = 12; HA-ARHGEF18 + Y-27632, 3372 ± 577 μm, n = 12, P > 0.05, Tukey test). Moreover, Y-27632 treatment also similarly suppressed branching of the control axons (Ohnami et al., 2008) (Supplementary Fig. S4), indicating that the action of ARHGEF18 is mostly mediated by the downstream RhoA. Figure 5 Open in new tabDownload slide Involvement of RhoA signaling in the action of the two RhoA-GEFs. (A) Representative traced images of horizontal axons at 14DIV. Cultured cortical slices were subjected to transfection with ARHGEF18 expression vectors at 4-5DIV and were treated with Y-27632 (50 μM) during the second week (see also Fig. 3A). Scale bar = 500 μm (also applies to panel E). (B–D) Quantitative analysis of the number of branch points, the tip length, and the total length, respectively. Y-27632 blocked the action of ARHGEF18. (E) Representative traced images of horizontal axons at 14 DIV. Cultured cortical slices were transfected with ABR expression vectors at 4–5 DIV and were treated with Y-27632 during the second week. (F–H) Quantifications of the number of branch points, tip length, and total length. In contrast to the results in ARHGEF18, the effects of Y-27632 on ABR overexpression was partial. *P < 0.05, ***P < 0.001; n.s., not significant, Tukey test. Figure 5 Open in new tabDownload slide Involvement of RhoA signaling in the action of the two RhoA-GEFs. (A) Representative traced images of horizontal axons at 14DIV. Cultured cortical slices were subjected to transfection with ARHGEF18 expression vectors at 4-5DIV and were treated with Y-27632 (50 μM) during the second week (see also Fig. 3A). Scale bar = 500 μm (also applies to panel E). (B–D) Quantitative analysis of the number of branch points, the tip length, and the total length, respectively. Y-27632 blocked the action of ARHGEF18. (E) Representative traced images of horizontal axons at 14 DIV. Cultured cortical slices were transfected with ABR expression vectors at 4–5 DIV and were treated with Y-27632 during the second week. (F–H) Quantifications of the number of branch points, tip length, and total length. In contrast to the results in ARHGEF18, the effects of Y-27632 on ABR overexpression was partial. *P < 0.05, ***P < 0.001; n.s., not significant, Tukey test. In contrast to ARHGEF18, Y-27632 treatment did not completely suppress the branch-promoting activity of ABR (Fig. 5E). Quantitative analysis showed that the number of horizontal axon branches in Y-27632-treated ABR-overexpressing cultures was not significantly different from that in untreated ABR-overexpressing axons, and was even higher than that in the control (Fig. 5F, HA-ABR, 35.6 ± 19.0, n = 7; HA-ABR + Y-27632, 26.8 ± 9.8, n = 8, P = 0.97 against HA-ABR and P = 0.016 against control, Tukey test). On the other hand, tip lengths became significantly longer in Y-27632-treated compared to untreated axons, although they were still shorter than control (Fig. 5G, HA-ABR, 22.8 ± 1.7 μm, tip number = 280; HA-ABR + Y-27632, 61.6 ± 4.9 μm, tip number = 222, P < 0.001, Tukey test). The total length was not different between the control, ABR-overexpressing and ABR-overexpressing Y-27632-treated axons. (Fig. 5H, HA-ABR, 2656 ± 809 μm, n = 7; HA-ABR + Y-27632, 3829 ± 1217 μm, n = 8, P = 0.5, Tukey test). Therefore, the involvement of RhoA signaling in the action of ABR on axon branch formation may only be partial. Endogenous ARHGEF18 and ABR are Necessary to Form Horizontal Axon Branches The role of endogenous ARHGEF18 and ABR was further examined by RNA interference. We constructed plasmid vectors, which encoded shRNA targeting rat Arhgef18 (shArhgef18) or Abr (shAbr). Then, the knockdown efficacy was examined by real-time quantitative reverse transcription PCR (qRT-PCR) and immunocytochemistry (see Methods). When each vector was transfected into cortical neurons, shArhgef18 suppressed mRNA expression of endogenous Arhgef18 by about 90% (Supplementary Fig. S3A, relative Arhgef18 expression 0.09 ± 0.31, n = 3), and shAbr suppressed endogenous Abr expression by about 50% (Supplementary Fig. S3B, relative Abr expression 0.55 ± 0.29, n = 3). The knockdown efficiency was also confirmed by immunocytochemistry for exogenously expressed RhoA-GEFs using COS7 cells. Consistent with the result from qRT-PCR, shArhgef18 considerably reduced the expression of Arhgef18 protein in the transfected cells (Supplementary Fig. S3C). Similarly, shAbr efficiently suppressed exogenous Abr expression (Supplementary Fig. S3D). After confirming the knockdown efficiency, each shRNA vector, together with EGFP, was transfected into upper layer neurons of cultured slices and horizontal axon morphology was examined at 14 DIV. As shown in Figure 6A, the cortical neurons transfected with shArhgef18 formed fewer horizontal axon branches (Fig. 3A), and this effect was rescued by co-transfection of shArhgef18 with shRNA-resistant ARHGEF18. Quantification confirmed that Arhgef18 knockdown reduced the number of branch points significantly (Fig. 6B, control, 6.4 ± 0.9, n = 31; shArhgef18, 2.5 ± 0.5, n = 19, P = 0.034, Tukey test), despite a lack of significant difference in the total length (Fig. 6C, control, 2429 ± 256 μm, n = 31; shArhgef18, 1548 ± 224 μm, n = 19; shArhgef18 + HA-ARHGEF18, 2115 ± 635 μm, n = 14, P > 0.05, Tukey test). The decrease in the number of branch points followed by ARHGEF18 knockdown was rescued by co-transfection of shRNA-resistant ARHGEF18 (Fig. 6A,B, shARHGEF18 + HA-ARHGEF18, 8.0 ± 2.2, n = 14, P = 0.016 against shArhgef18, Tukey test). Furthermore, the tip lengths were roughly two times longer in shArhgef18 transfected axons than in control, and this reduction was restored by co-transfection with the rescue construct (Fig. 6D, control, 127.8 ± 11.7 μm, tip number = 210; shArhgef18, 267.4 ± 36.1 μm, tip number = 66, P < 0.001 against control; shArhgef18 + HA-ARHGEF18, 105.5 ± 13.4 μm, tip number = 124, P < 0.001 against shArhgef18, Tukey test). Figure 6 Open in new tabDownload slide Endogenous Arhgef18 and Abr are necessary for horizontal axon branching. (A) Representative traced images of horizontal axons at 14 DIV after transfection of Arhgef18-targetting shRNA construct only (shArhgef18) or together with the shRNA-resistant ARHGEF18 expression vector (shArhgef18 + HA-ARHGEF18; see also control in Figure 3A). Knockdown of Arhgef18 strongly suppressed branch formation (shArhgef18), which was rescued by shRNA-resistant ARHGEF18 (shArhgef18 + HA-ARHGEF18). (B) Quantitative analysis of the number of branch points per horizontal axon. (C,D) Quantitative analysis of total axon length and tip length, respectively. (E–H) Endogenous Abr is necessary for horizontal axon branching. (E) Representative traced images of horizontal axons at 14 DIV after transfection of Abr-targeting shRNA construct only (shAbr) or together with the shRNA-resistant ABR expression vector (shAbr + HA-ABR). Scale bar = 500 μm. (F) Quantitative analysis of the number of branch points per horizontal axon. (G) Quantitative analysis of total length and tip length. *P < 0.05, **P < 0.01, ***P < 0.001; n.s., not significant, Tukey test. Figure 6 Open in new tabDownload slide Endogenous Arhgef18 and Abr are necessary for horizontal axon branching. (A) Representative traced images of horizontal axons at 14 DIV after transfection of Arhgef18-targetting shRNA construct only (shArhgef18) or together with the shRNA-resistant ARHGEF18 expression vector (shArhgef18 + HA-ARHGEF18; see also control in Figure 3A). Knockdown of Arhgef18 strongly suppressed branch formation (shArhgef18), which was rescued by shRNA-resistant ARHGEF18 (shArhgef18 + HA-ARHGEF18). (B) Quantitative analysis of the number of branch points per horizontal axon. (C,D) Quantitative analysis of total axon length and tip length, respectively. (E–H) Endogenous Abr is necessary for horizontal axon branching. (E) Representative traced images of horizontal axons at 14 DIV after transfection of Abr-targeting shRNA construct only (shAbr) or together with the shRNA-resistant ABR expression vector (shAbr + HA-ABR). Scale bar = 500 μm. (F) Quantitative analysis of the number of branch points per horizontal axon. (G) Quantitative analysis of total length and tip length. *P < 0.05, **P < 0.01, ***P < 0.001; n.s., not significant, Tukey test. Knockdown of ABR expression also decreased the number of horizontal axon branches, and this effect was rescued by shRNA-resistant ABR (Fig. 6E,F, control, 6.4 ± 0.9, n = 31; shAbr, 2.8 ± 0.8, n = 13, P < 0.05 against control; shAbr+HA-ABR, 17.3 ± 2.5, n = 6, P < 0.01 against shABR, Tukey test), without affecting the total length significantly (Fig. 6G, control, 2429 ± 256 μm, n = 31; shAbr, 1943 ± 304 μm, n = 13; shAbr+HA-ABR, 2299 ± 219 μm, n = 6, P > 0.05, Tukey test). The tip lengths became longer in shAbr than in control, and this effect was also rescued by co-transfection with the resistant vector (Fig. 6H, control, 127.8 ± 11.7 μm, tip number = 210; shAbr, 206 ± 29.1 μm, tip number = 46, P < 0.01 against control; shAbr+HA-ABR, 53.5 ± 11.1 μm, tip number = 110, P < 0.001 against control and shAbr, Tukey test). These results indicate that endogenous ARHGEF18 and ABR are required for horizontal axon branching. Discussion The present study demonstrated that several RhoA-GEFs promote branching of horizontal axons that originate from cortical upper layer neurons. Interestingly, the branching phenotypes were different between overexpressed RhoA-GEFs. In particular, ARHGEF18 increased short branches in the distal portion, while ABR enhanced much shorter branches along entire axonal shafts. The data also indicates that the distinct aspects were due to the different influences of these RhoA-GEFs on downstream molecules. Moreover, the knockdown study demonstrated the necessity of endogenous ARHGEF18 and ABR for branch formation. Taking account into the fact that these RhoA-GEFs are expressed in both rat and macaque cortices, all of these results suggest that multiple RhoA-GEFs contribute to horizontal axon branching in different morphological manners, which appear to be evolutionarily conserved. Promoting Activity of RhoGEFs on Axon Branching To date, it has been shown that Dbl family RhoGEFs are involved in axonal and dendritic development (Luo 2000; Van Aelst and Cline 2004; Hall and Lalli 2010). For example, Trio regulates axon guidance through Rac activation (Steven et al. 1998; Awasaki et al. 2000; Liebl et al. 2000; Newsome et al. 2000), Ephexin, also known as Ngef, regulates axon growth (Shamah et al. 2001), and Kalirin regulates dendritic spine morphogenesis (Penzes et al. 2001). However, their involvement in axon branching remained elusive (Rico et al. 2004; Spillane and Gallo 2014). The present finding is the first to demonstrate that RhoGEFs promote axon branching of mammalian CNS neurons. Among the 17 RhoA-GEFs examined in the overexpression study, 7 showed obvious branch-promoting activity. A potential role for the other 10 members in axon branching cannot be ruled out, as GEF activity may not necessarily be increased by simple overexpression (Schmidt and Hall 2002). In general, interaction with other regulatory molecules is thought to be necessary for GEF function. In accordance with this view, ARHGEF25 has been reported to function with focal adhesion kinase, which regulates axon branching of Purkinje cells (Rico et al. 2004). The fact that overexpression of the 7 RhoA-GEFs promoted axon branching suggests some intrinsic factors or upstream molecules may work in conjunction with these RhoGEFs. Possible Mechanisms for Different Branching Patterns An interesting aspect of this study is that the overexpression of several RhoA-GEFs induced distinct branching patterns. Since some RhoA-GEFs have been reported to localize or accumulate in subcellular compartments (Oh et al. 2010; Terry et al. 2011) one possible mechanism for differing branch distribution is that subcellular localization of RhoA-GEFs induces axonal branching by locally activating the downstream effector molecules. However, this is unlikely because immunohistochemical staining using antibody against the HA-tag revealed that overexpressed ARHGEF18 was distributed throughout horizontal axon shafts (Supplementary Fig. S2), in spite of locally enhanced axon branching. A plausible mechanism may be due to localization of upstream molecules that activate ARHGEF18 selectively at specific subcellular compartments. For example, ARHGEF18 is regulated by a Wnt member (Tsuji et al. 2010), which promotes axon branching (Lucas and Salinas 1997; Krylova et al. 2002; Bodmer et al. 2009) and its receptor, Frizzled, is known to be localized in specific axonal portions (Varela-Nallar et al. 2009; Varela-Nallar et al. 2012). Such localization of upstream molecules may function to produce different branching morphology. Alternatively, subcellular localization of intracellular co-factors could also induce a bias in branch formation toward specific axonal domains (Courchet et al. 2013; Xu et al. 2013; Matsumoto et al. 2016; Lewis et al. 2018). Downstream Effector Molecules of RhoA-GEFs Some RhoA-GEFs activate not only RhoA but also other Rho family small GTPases. ARHGEF18 has been reported to act as a GEF for RhoA when it regulates actin stress fibers, and act on Rac1 when it induces production of reactive oxygen species (Blomquist et al. 2000; Niu et al. 2003; Nagata and Inagaki 2005; Terry et al. 2011; Herder et al. 2013). Furthermore, ABR can act as GEF for Cdc42 and Rac1 as well as RhoA, and ABR also functions as GAP for Rac1 and Cdc42 (Heisterkamp et al. 1993; Tan et al. 1993; Kaartinen et al. 2001). The present result showed that ROCK inhibitor treatment completely suppressed branch-promoting activity of ARHGEF18 in agreement with the previous result that RhoA-Rock signaling promotes horizontal axon branching (Ohnami et al., 2008). Thus, it is likely that RhoA-ROCK signaling is the major downstream pathway of ARHGEF18 in the regulation of horizontal axon branching. In contrast, the effect of the ROCK inhibitor on ABR overexpression was partial, suggesting that not only RhoA but also other downstream molecules are involved. Indeed, it has been reported that overexpression of ABR suppresses Rac1 and Cdc42 activity and vice versa (Kaartinen et al. 2001; Oh et al. 2010). Thus, it is likely that the branch regulatory function of RhoA-GEFs is achieved in part by employing different downstream effectors. A few studies have demonstrated that the RhoA pathway promotes axon branching (Ahnert-Hilger et al. 2004; Ohnami et al. 2008), which is further supported by the present result that RhoA mediates branch-promoting activity of RhoA-GEFs. In accordance with this view, Nogo, which is known to suppress axon growth via RhoA, acts as a positive regulator for axon branching (Iketani et al. 2016). These findings may appear to be contradictory to the general notion that RhoA inhibits axon growth (Govek et al. 2005; Hall and Lalli 2010). However, branch formation does not necessarily link with growth. Instead, axon branching frequently occurs after termination of axon elongation (Harris et al. 1987; Yamamoto et al. 1997; Kalil et al. 2000). Thus, it is likely that axon branching and growth inhibition is regulated by similar molecular mechanisms including RhoA signaling. RhoA-GEF Function in the Development of Cortical Circuits By taking advantage of organotypic cortical slice cultures and single cell labeling, we quantitatively analyzed horizontal axon morphology, demonstrating some RhoA-GEF members preferentially increased terminal branches. This observation is noteworthy, because horizontal axons in vivo form clustered terminal branches and this morphological feature is thought to underlie physiological connectivity between functionally related cortical columns (Gilbert and Wiesel 1979; Callaway and Katz 1990; Gilbert et al. 1990; Lohmann and Rörig 1994). Given the fact that ARHGEF18 promoted terminal branches, it is likely that the action of ARHGEF18 may play an important role in functional connectivity. In general, axonal branching is thought to be regulated by activity-dependent and -independent mechanisms (Hubel et al. 1977; Shatz and Stryker 1988; Katz and Shatz 1996; Penn et al. 1998; Hata et al. 1999; Sanes and Yamagata 1999; Acebes and Ferrus 2000; Yamamoto et al. 2002; McLaughlin et al. 2003; Yamamoto and Lopez-Bendito 2012). Although both mechanisms are involved in horizontal axon branching, it is likely that an activity-dependent mechanism is dominant (Callaway and Katz 1990, 1991; Lowel and Singer 1992; Ruthazer and Stryker 1996; Uesaka et al. 2005; Smith et al. 2018). Our previous studies have demonstrated that horizontal axon branching is promoted by neuronal activity via RhoA signaling pathways (Ohnami et al. 2008). As RhoA-GEFs are upstream activators of RhoA, some branch-promoting RhoA-GEFs might contribute to activity-dependent aspects of axonal branching. Evolutional Aspects The 7 RhoA-GEFs that promoted horizontal axon branching are expressed in not only rodent but also primate sensory cortices, suggesting that the gene regulation mechanism is conserved evolutionally. In addition, the fact that human RhoA-GEFs have branch-promoting activity in rat cortical neurons suggests that the functional role is fundamentally conserved and may contribute to horizontal axon branching in the mammalian cortex. On the other hand, horizontal axon branching appears to become more complex during the evolution of mammalian species (Gilbert and Wiesel 1979; Callaway and Katz 1990; van Brederode et al. 2000). This alteration may be accounted for by evolutionary changes of gene expression regulation, such as promoter and/or enhancer activity with transcription factors, epigenetic regulation, and gene duplication or deletion. A previous study has shown that duplication of specific domains during evolution in SR-GAP2 causes variation in spine morphology (Fossati et al. 2016). Although such a drastic evolutional change in the genome has not been found in RhoGEFs, even subtle differences in the expression level of each RhoGEF might contribute to branching complexity of horizontal axons via combinatory actions of multiple RhoGEFs. The large number of members and the functional diversity of this molecular species, which is also true for RhoGAPs, could underlie interspecies differences in axonal branching. Notes This work was supported by Ministry of Education, Culture, Sports, Science and Technology KAKENHI on Innovative Areas Mesoscopic Neurocircuitry 23115102, Adaptive Circuit Shift 15H01436, and Dynamic Regulation of Brain Function by Scrap and Build System 16H06460 to N.Y., Japan Society for the Promotion of Science KAKENHI Grants 15H04260 to N.Y., and the Mitsubishi Foundation to N.Y. We thank Mr Gabriel Hand for critical reading of the manuscript. References Acebes A , Ferrus A . 2000 . Cellular and molecular features of axon collaterals and dendrites . Trends Neurosci. 23 : 557 – 565 . Google Scholar Crossref Search ADS PubMed WorldCat Ahnert-Hilger G , Holtje M , Grosse G , Pickert G , Mucke C , Nixdorf-Bergweiler B , Boquet P , Hofmann F , Just I . 2004 . Differential effects of rho GTPases on axonal and dendritic development in hippocampal neurones . J Neurochem. 90 : 9 – 18 . Google Scholar Crossref Search ADS PubMed WorldCat Awasaki T , Saito M , Sone M , Suzuki E , Sakai R , Ito K , Hama C . 2000 . The Drosophila Trio plays an essential role in patterning of axons by regulating their directional extension . Neuron. 26 : 119 – 131 . Google Scholar Crossref Search ADS PubMed WorldCat Bilimoria PM , Bonni A . 2013 . Molecular control of axon branching . Neuroscientist. 19 : 16 – 24 . Google Scholar Crossref Search ADS PubMed WorldCat Blomquist A , Schworer G , Schablowski H , Psoma A , Lehnen M , Jakobs KH , Rumenapp U . 2000 . Identification and characterization of a novel Rho-specific guanine nucleotide exchange factor . Biochem J. 352 : 319 – 325 . Google Scholar Crossref Search ADS PubMed WorldCat Bodmer D , Levine-Wilkinson S , Richmond A , Hirsh S , Kuruvilla R . 2009 . Wnt5a mediates nerve growth factor-dependent axonal branching and growth in developing sympathetic neurons . J Neurosci. 29 : 7569 – 7581 . Google Scholar Crossref Search ADS PubMed WorldCat Bourgeois JP , Rakic P . 1993 . Changes of synaptic density in the primary visual cortex of the macaque monkey from fetal to adult stage . J Neurosci. 13 : 2801 – 2820 . Google Scholar Crossref Search ADS PubMed WorldCat Callaway EM . 1998a . Local circuits in primary visual cortex of the macaque monkey . Annu Rev Neurosci. 21 : 47 – 74 . Google Scholar Crossref Search ADS WorldCat Callaway EM . 1998b . Prenatal development of layer-specific local circuits in primary visual cortex of the macaque monkey . J Neurosci. 18 : 1505 – 1527 . Google Scholar Crossref Search ADS WorldCat Callaway EM , Katz LC . 1990 . Emergence and refinement of clustered horizontal connections in cat striate cortex . J Neurosci. 10 : 1134 – 1153 . Google Scholar Crossref Search ADS PubMed WorldCat Callaway EM , Katz LC . 1991 . Effects of binocular deprivation on the development of clustered horizontal connections in cat striate cortex . Proc Natl Acad Sci U S A. 88 : 745 – 749 . Google Scholar Crossref Search ADS PubMed WorldCat Callaway EM , Wiser AK . 1996 . Contributions of individual layer 2–5 spiny neurons to local circuits in macaque primary visual cortex . Visual Neurosci. 13 : 907 – 922 . Google Scholar Crossref Search ADS WorldCat Courchet J , Lewis TL Jr , Lee S , Courchet V , Liou DY , Aizawa S , Polleux F . 2013 . Terminal axon branching is regulated by the LKB1-NUAK1 kinase pathway via presynaptic mitochondrial capture . Cell. 153 : 1510 – 1525 . Google Scholar Crossref Search ADS PubMed WorldCat Durack JC , Katz LC . 1996 . Development of horizontal projections in layer 2/3 of ferret visual cortex . Cereb Cortex. 6 : 178 – 183 . Google Scholar Crossref Search ADS PubMed WorldCat Fengyi L , Yumiko H , Harumi S , Tetsuo Y , Tsutomu H . 2000 . Differential expression of γ-aminobutyric acid type B receptor-1a and -1b mRNA variants in GABA and non-GABAergic neurons of the rat brain . J Comp Neurol. 416 : 475 – 495 . Google Scholar Crossref Search ADS PubMed WorldCat Foeller E , Feldman DE . 2004 . Synaptic basis for developmental plasticity in somatosensory cortex . Curr Opin Neurobiol. 14 : 89 – 95 . Google Scholar Crossref Search ADS PubMed WorldCat Fossati M , Pizzarelli R , Schmidt ER , Kupferman JV , Stroebel D , Polleux F , Charrier C . 2016 . SRGAP2 and its human-specific paralog co-regulate the development of excitatory and inhibitory synapses . Neuron. 91 : 356 – 369 . Google Scholar Crossref Search ADS PubMed WorldCat Gallo G . 2011 . The cytoskeletal and signaling mechanisms of axon collateral branching . Dev Neurobiol. 71 : 201 – 220 . Google Scholar Crossref Search ADS PubMed WorldCat Garcia-Mata R , Burridge K . 2007 . Catching a GEF by its tail . Trends Cell Biol. 17 : 36 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat Gibson DA , Ma L . 2011 . Developmental regulation of axon branching in the vertebrate nervous system . Development. 138 : 183 – 195 . Google Scholar Crossref Search ADS PubMed WorldCat Gilbert CD . 1992 . Horizontal integration and cortical dynamics . Neuron. 9 : 1 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat Gilbert CD , Hirsch JA , Wiesel TN . 1990 . Lateral interactions in visual cortex . Cold Spring Harb Symp Quant Biol. 55 : 663 – 677 . Google Scholar Crossref Search ADS PubMed WorldCat Gilbert CD , Wiesel TN . 1979 . Morphology and intracortical projections of functionally characterised neurones in the cat visual cortex . Nature. 280 : 120 – 125 . Google Scholar Crossref Search ADS PubMed WorldCat Gilbert CD , Wiesel TN . 1983 . Clustered intrinsic connections in cat visual cortex . J Neurosci. 3 : 1116 – 1133 . Google Scholar Crossref Search ADS PubMed WorldCat Govek EE , Newey SE , Van Aelst L . 2005 . The role of the Rho GTPases in neuronal development . Genes Dev . 19 : 1 – 49 . Google Scholar Crossref Search ADS PubMed WorldCat Hall A , Lalli G . 2010 . Rho and Ras GTPases in axon growth, guidance, and branching . Cold Spring Harb Perspect Biol. 2 : a001818 . WorldCat Harris WA , Holt CE , Bonhoeffer F . 1987 . Retinal axons with and without their somata, growing to and arborizing in the tectum of Xenopus embryos: a time-lapse video study of single fibres in vivo . Development. 101 : 123 – 133 . Google Scholar PubMed WorldCat Hata Y , Tsumoto T , Stryker MP . 1999 . Selective pruning of more active afferents when cat visual cortex is pharmacologically inhibited . Neuron. 22 : 375 – 381 . Google Scholar Crossref Search ADS PubMed WorldCat Hayano Y , Sasaki K , Ohmura N , Takemoto M , Maeda Y , Yamashita T , Hata Y , Kitada K , Yamamoto N . 2014 . Netrin-4 regulates thalamocortical axon branching in an activity-dependent fashion . Proc Natl Acad Sci U S A. 111 : 15226 – 15231 . Google Scholar Crossref Search ADS PubMed WorldCat Heisterkamp N , Kaartinen V , Simone van S , Bokoch GM , Groffen J . 1993 . Human ABR encodes a protein with GAPrac activity and homology to the DBL nucleotide exchange factor domain . J Biol Chem. 268 : 16903 – 16906 . Google Scholar PubMed WorldCat Herder C , Swiercz JM , Muller C , Peravali R , Quiring R , Offermanns S , Wittbrodt J , Loosli F . 2013 . ArhGEF18 regulates RhoA-Rock2 signaling to maintain neuro-epithelial apico-basal polarity and proliferation . Development. 140 : 2787 – 2797 . Google Scholar Crossref Search ADS PubMed WorldCat Hubel DH , Wiesel TN , LeVay S . 1977 . Plasticity of ocular dominance columns in monkey striate cortex . Philos Trans R Soc Lond B Biol Sci. 278 : 377 – 409 . Google Scholar Crossref Search ADS PubMed WorldCat Iketani M , Yokoyama T , Kurihara Y , Strittmatter SM , Goshima Y , Kawahara N , Takei K . 2016 . Axonal branching in lateral olfactory tract is promoted by Nogo signaling . Sci Rep. 6 : 39586. WorldCat Jaffe AB , Hall A . 2005 . Rho GTPases: biochemistry and biology . Annu Rev Cell Dev Biol. 21 : 247 – 269 . Google Scholar Crossref Search ADS PubMed WorldCat Kaartinen V , Gonzalez-Gomez I , Voncken JW , Haataja L , Faure E , Nagy A , Groffen J , Heisterkamp N . 2001 . Abnormal function of astroglia lacking Abr and Bcr RacGAPs . Development. 128 : 4217 – 4227 . Google Scholar PubMed WorldCat Kalil K , Dent EW . 2014 . Branch management: mechanisms of axon branching in the developing vertebrate CNS . Nat Rev Neurosci. 15 : 7 – 18 . Google Scholar Crossref Search ADS PubMed WorldCat Kalil K , Szebenyi G , Dent EW . 2000 . Common mechanisms underlying growth cone guidance and axon branching . J Neurobiol. 44 : 145 – 158 . Google Scholar Crossref Search ADS PubMed WorldCat Katz LC , Callaway EM . 1992 . Development of local circuits in mammalian visual cortex . Annu Rev Neurosci. 15 : 31 – 56 . Google Scholar Crossref Search ADS PubMed WorldCat Katz LC , Shatz CJ . 1996 . Synaptic activity and the construction of cortical circuits . Science. 274 : 1133 – 1138 . Google Scholar Crossref Search ADS PubMed WorldCat Kisvárday ZF , Martin KAC , Freund TF , Maglóczky Z , Whitteridge D , Somogyi P . 1986 . Synaptic targets of HRP-filled layer III pyramidal cells in the cat striate cortex . Exp Brain Res. 64 : 541 – 552 . Google Scholar Crossref Search ADS PubMed WorldCat Kitagawa H , Sugo N , Morimatsu M , Arai Y , Yanagida T , Yamamoto N . 2017 . Activity-dependent dynamics of the transcription factor of cAMP-response element binding protein in cortical neurons revealed by single-molecule imaging . J Neurosci. 37 : 1 – 10 . Google Scholar Crossref Search ADS PubMed WorldCat Komatsu Y , Watakabe A , Hashikawa T , Tochitani S , Yamamori T . 2005 . Retinol-binding protein gene is highly expressed in higher-order association areas of the primate Neocortex . Cerebral Cortex. 15 : 96 – 108 . Google Scholar Crossref Search ADS WorldCat Krylova O , Herreros J , Cleverley KE , Ehler E , Henriquez JP , Hughes SM , Salinas PC . 2002 . WNT-3, expressed by motoneurons, regulates terminal arborization of neurotrophin-3-responsive spinal sensory neurons . Neuron. 35 : 1043 – 1056 . Google Scholar Crossref Search ADS PubMed WorldCat Larsen DD , Callaway EM . 2006 . Development of layer-specific axonal arborizations in mouse primary somatosensory cortex . J Comp Neurol. 494 : 398 – 414 . Google Scholar Crossref Search ADS PubMed WorldCat Lewis TL Jr , Kwon SK , Lee A , Shaw R , Polleux F . 2018 . MFF-dependent mitochondrial fission regulates presynaptic release and axon branching by limiting axonal mitochondria size . Nat Commun. 9 : 5008 . Google Scholar Crossref Search ADS PubMed WorldCat Liebl EC , Forsthoefel DJ , Franco LS , Sample SH , Hess JE , Cowger JA , Chandler MP , Shupert AM , Seeger MA . 2000 . Dosage-sensitive, reciprocal genetic interactions between the Abl tyrosine kinase and the putative GEF trio reveal trio's role in axon pathfinding . Neuron. 26 : 107 – 118 . Google Scholar Crossref Search ADS PubMed WorldCat Lohmann H , Rörig B . 1994 . Long-range horizontal connections between supragranular pyramidal cells in the extrastriate visual cortex of the rat . J Comp Neurol. 344 : 543 – 558 . Google Scholar Crossref Search ADS PubMed WorldCat Loirand G , Scalbert E , Bril A , Pacaud P . 2008 . Rho exchange factors in the cardiovascular system . Curr Opin Pharmacol. 8 : 174 – 180 . Google Scholar Crossref Search ADS PubMed WorldCat Lowel S , Singer W . 1992 . Selection of intrinsic horizontal connections in the visual cortex by correlated neuronal activity . Science. 255 : 209 – 212 . Google Scholar Crossref Search ADS PubMed WorldCat Lucas FR , Salinas PC . 1997 . WNT-7a induces axonal remodeling and increases synapsin I levels in cerebellar neurons . Dev Biol. 192 : 31 – 44 . Google Scholar Crossref Search ADS PubMed WorldCat Luo L . 2000 . RHO GTPASES in neuronal morphogenesis . Nat Rev Neurosci. 1 : 173 . Google Scholar Crossref Search ADS PubMed WorldCat Madaule P , Eda M , Watanabe N , Fujisawa K , Matsuoka T , Bito H , Ishizaki T , Narumiya S . 1998 . Role of citron kinase as a target of the small GTPase rho in cytokinesis . Nature. 394 : 491 – 494 . Google Scholar Crossref Search ADS PubMed WorldCat Matsumoto N , Hoshiko M , Sugo N , Fukazawa Y , Yamamoto N . 2016 . Synapse-dependent and independent mechanisms of thalamocortical axon branching are regulated by neuronal activity . Dev Neurobiol. 76 : 323 – 336 . Google Scholar Crossref Search ADS PubMed WorldCat Matsumoto N , Sasaki K , Yamamoto N . 2015 . Electroporation method for mammalian CNS neurons in organotypic slice cultures . Electroporation Methods Neurosci, Neuromethods. 102 : 159 – 168 . WorldCat McLaughlin T , Hindges R , O'Leary DD . 2003 . Regulation of axial patterning of the retina and its topographic mapping in the brain . Curr Opin Neurobiol. 13 : 57 – 69 . Google Scholar Crossref Search ADS PubMed WorldCat Nagata K , Inagaki M . 2005 . Cytoskeletal modification of rho guanine nucleotide exchange factor activity: identification of a rho guanine nucleotide exchange factor as a binding partner for Sept9b, a mammalian septin . Oncogene. 24 : 65 – 76 . Google Scholar Crossref Search ADS PubMed WorldCat Nelson DA , Katz LC . 1995 . Emergence of functional circuits in ferret visual cortex visualized by optical imaging . Neuron. 15 : 23 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat Newsome TP , Schmidt S , Dietzl G , Keleman K , Åsling B , Debant A , Dickson BJ . 2000 . Trio combines with dock to regulate Pak activity during photoreceptor axon pathfinding in drosophila . Cell. 101 : 283 – 294 . Google Scholar Crossref Search ADS PubMed WorldCat Niu J , Profirovic J , Pan H , Vaiskunaite R , Voyno-Yasenetskaya T . 2003 . G protein betagamma subunits stimulate p114RhoGEF, a guanine nucleotide exchange factor for RhoA and Rac1: regulation of cell shape and reactive oxygen species production . Circ Res. 93 : 848 – 856 . Google Scholar Crossref Search ADS PubMed WorldCat Oh D , Han S , Seo J , Lee JR , Choi J , Groffen J , Kim K , Cho YS , Choi HS , Shin H , et al. 2010 . Regulation of synaptic Rac1 activity, long-term potentiation maintenance, and learning and memory by BCR and ABR Rac GTPase-activating proteins . J Neurosci. 30 : 14134 – 14144 . Google Scholar Crossref Search ADS PubMed WorldCat Ohnami S , Endo M , Hirai S , Uesaka N , Hatanaka Y , Yamashita T , Yamamoto N . 2008 . Role of RhoA in activity-dependent cortical axon branching . J Neurosci. 28 : 9117 – 9121 . Google Scholar Crossref Search ADS PubMed WorldCat Penn AA , Riquelme PA , Feller MB , Shatz CJ . 1998 . Competition in retinogeniculate patterning driven by spontaneous activity . Science. 279 : 2108 – 2112 . Google Scholar Crossref Search ADS PubMed WorldCat Penzes P , Johnson RC , Sattler R , Zhang X , Huganir RL , Kambampati V , Mains RE , Eipper BA . 2001 . The neuronal rho-GEF Kalirin-7 interacts with PDZ domain–containing proteins and regulates dendritic morphogenesis . Neuron. 29 : 229 – 242 . Google Scholar Crossref Search ADS PubMed WorldCat Rico B , Beggs HE , Schahin-Reed D , Kimes N , Schmidt A , Reichardt LF . 2004 . Control of axonal branching and synapse formation by focal adhesion kinase . Nat Neurosci. 7 : 1059 – 1069 . Google Scholar Crossref Search ADS PubMed WorldCat Rossman KL , Der CJ , Sondek J . 2005 . GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors . Nat Rev Mol Cell Biol. 6 : 167 – 180 . Google Scholar Crossref Search ADS PubMed WorldCat Ruthazer ES , Stryker MP . 1996 . The role of activity in the development of long-range horizontal connections in area 17 of the ferret . J Neurosci. 16 : 7253 – 7269 . Google Scholar Crossref Search ADS PubMed WorldCat Sanes JR , Yamagata M . 1999 . Formation of lamina-specific synaptic connections . Curr Opin Neurobiol. 9 : 79 – 87 . Google Scholar Crossref Search ADS PubMed WorldCat Schiller MR . 2006 . Coupling receptor tyrosine kinases to rho GTPases-GEFs what's the link . Cell Signal. 18 : 1834 – 1843 . Google Scholar Crossref Search ADS PubMed WorldCat Schmidt A , Hall A . 2002 . Guanine nucleotide exchange factors for rho GTPases: turning on the switch . Genes Dev. 16 : 1587 – 1609 . Google Scholar Crossref Search ADS PubMed WorldCat Scorcioni R , Polavaram S , Ascoli GA . 2008 . L-measure: a web-accessible tool for the analysis, comparison and search of digital reconstructions of neuronal morphologies . Nat Protoc. 3 : 866 – 876 . Google Scholar Crossref Search ADS PubMed WorldCat Shamah SM , Lin MZ , Goldberg JL , Estrach S , Sahin M , Hu L , Bazalakova M , Neve RL , Corfas G , Debant A , et al. 2001 . EphA receptors regulate growth cone dynamics through the novel guanine nucleotide exchange factor ephexin . Cell. 105 : 233 – 244 . Google Scholar Crossref Search ADS PubMed WorldCat Shatz CJ , Stryker MP . 1988 . Prenatal tetrodotoxin infusion blocks segregation of retinogeniculate afferents . Science. 242 : 87 – 89 . Google Scholar Crossref Search ADS PubMed WorldCat Smith GB , Hein B , Whitney DE , Fitzpatrick D , Kaschube M . 2018 . Distributed network interactions and their emergence in developing neocortex . Nat Neurosci. 21 : 1600 – 1608 . Google Scholar Crossref Search ADS PubMed WorldCat Spillane M , Gallo G . 2014 . Involvement of rho-family GTPases in axon branching . Small GTPases. 5 :e27974. WorldCat Steven R , Kubiseski TJ , Zheng H , Kulkarni S , Mancillas J , Morales AR , Hogue CWV , Pawson T , Culotti J . 1998 . UNC-73 activates the Rac GTPase and is required for cell and growth cone migrations in C. elegans . Cell. 92 : 785 – 795 . Google Scholar Crossref Search ADS PubMed WorldCat Tan E-C , Leung T , Manser E , Lim L . 1993 . The human active breakpoint cluster region-related gene encodes a brain protein with homology to guanine nucleotide exchange proteins and GTPase-activating proteins . J Biol Chem. 268 : 27291 – 27298 . Google Scholar PubMed WorldCat Terry SJ , Zihni C , Elbediwy A , Vitiello E , Leefa Chong San IV , Balda MS , Matter K . 2011 . Spatially restricted activation of RhoA signalling at epithelial junctions by p114RhoGEF drives junction formation and morphogenesis . Nat Cell Biol. 13 : 159 – 166 . Google Scholar Crossref Search ADS PubMed WorldCat Tsuji T , Ohta Y , Kanno Y , Hirose K , Ohashi K , Mizuno K . 2010 . Involvement of p114-RhoGEF and Lfc in Wnt-3a- and dishevelled-induced RhoA activation and neurite retraction in N1E-115 mouse neuroblastoma cells . Mol Biol Cell. 21 : 3590 – 3600 . Google Scholar Crossref Search ADS PubMed WorldCat Uehata M , Ishizaki T , Satoh H , Ono T , Kawahara T , Morishita T , Tamakawa H , Yamagami K , Inui J , Maekawa M , et al. 1997 . Calcium sensitization of smooth muscle mediated by a rho-associated protein kinase in hypertension . Nature. 389 : 990 – 994 . Google Scholar Crossref Search ADS PubMed WorldCat Uesaka N , Hirai S , Maruyama T , Ruthazer ES , Yamamoto N . 2005 . Activity dependence of cortical axon branch formation: a morphological and electrophysiological study using organotypic slice cultures . J Neurosci. 25 : 1 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Uesaka N , Nishiwaki M , Yamamoto N . 2008 . Single cell electroporation method for axon tracing in cultured slices . Dev Growth Differ. 50 : 475 – 477 . Google Scholar Crossref Search ADS PubMed WorldCat Van Aelst L , Cline HT . 2004 . Rho GTPases and activity-dependent dendrite development . Curr Opin Neurobiol. 14 : 297 – 304 . Google Scholar Crossref Search ADS PubMed WorldCat van Brederode JFM , Foehring RC , Spain WJ . 2000 . Morphological and electrophysiological properties of atypically oriented layer 2 pyramidal cells of the juvenile rat neocortex . Neuroscience. 101 : 851 – 861 . Google Scholar Crossref Search ADS PubMed WorldCat Varela-Nallar L , Grabowski CP , Alfaro IE , Alvarez AR , Inestrosa NC . 2009 . Role of the Wnt receptor Frizzled-1 in presynaptic differentiation and function . Neural Dev. 4 : 41 . Google Scholar Crossref Search ADS PubMed WorldCat Varela-Nallar L , Ramirez VT , Gonzalez-Billault C , Inestrosa NC . 2012 . Frizzled receptors in neurons: from growth cones to the synapse . Cytoskeleton. 69 : 528 – 534 . Google Scholar Crossref Search ADS WorldCat Weliky M , Katz LC . 1994 . Functional mapping of horizontal connections in developing ferret visual cortex: experiments and modeling . J Neurosci. 14 : 7291 – 7305 . Google Scholar Crossref Search ADS PubMed WorldCat Xu X , Jin D , Durgan J , Hall A . 2013 . LKB1 controls human bronchial epithelial morphogenesis through p114RhoGEF-dependent RhoA activation . Mol Cell Biol. 33 : 2671 – 2682 . Google Scholar Crossref Search ADS PubMed WorldCat Yamada A , Uesaka N , Hayano Y , Tabata T , Kano M , Yamamoto N . 2010 . Role of pre- and postsynaptic activity in thalamocortical axon branching . Proc Natl Acad Sci U S A. 107 : 7562 – 7567 . Google Scholar Crossref Search ADS PubMed WorldCat Yamamoto N , Higashi S , Toyama K . 1997 . Stop and branch behaviors of geniculocortical axons: a time-lapse study in organotypic cocultures . J Neurosci. 17 : 3653 – 3663 . Google Scholar Crossref Search ADS PubMed WorldCat Yamamoto N , Kurotani T , Toyama K . 1989 . Neural connections between the lateral geniculate nucleus and visual cortex in vitro . Science. 245 : 192 – 194 . Google Scholar Crossref Search ADS PubMed WorldCat Yamamoto N , Lopez-Bendito G . 2012 . Shaping brain connections through spontaneous neural activity . Eur J Neurosci. 35 : 1595 – 1604 . Google Scholar Crossref Search ADS PubMed WorldCat Yamamoto N , Tamada A , Murakami F . 2002 . Wiring of the brain by a range of guidance cues . Prog Neurobiol. 68 : 393 – 407 . Google Scholar Crossref Search ADS PubMed WorldCat Yamamoto N , Yamada K , Kurotani T , Toyama K . 1992 . Laminar specificity of extrinsic cortical connections studied in coculture preparations . Neuron. 9 : 217 – 228 . Google Scholar Crossref Search ADS PubMed WorldCat Zhong Y , Takemoto M , Fukuda T , Hattori Y , Murakami F , Nakajima D , Nakayama M , Yamamoto N . 2004 . Identification of the genes that are expressed in the upper layers of the neocortex . Cereb Cortex. 14 : 1144 – 1152 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2019. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Rho Guanine Nucleotide Exchange Factors Regulate Horizontal Axon Branching of Cortical Upper Layer Neurons
JF - Cerebral Cortex
DO - 10.1093/cercor/bhz256
DA - 2020-04-14
UR - https://www.deepdyve.com/lp/oxford-university-press/rho-guanine-nucleotide-exchange-factors-regulate-horizontal-axon-a4agRkDIUv
SP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -