TY - JOUR
AU - Mariotti, Domenico
AB - Abstract A cDNA coding for a DNA (cytosine‐5)‐methyltransferase (METase) was isolated from peach (Prunus persica [L.] Batsch) and the corresponding gene designated as PpMETI. The latter encoded a predicted polypeptide of 1564 amino acid residues and harboured all the functional domains conserved in the maintenance METases group type I. PpMETI was a single copy in the cultivar Chiripa which was used as a model in the present study. Expression analyses revealed that PpMETI transcripts were more abundant in tissues with actively proliferating cells such as apical tips, uncurled leaves, elongating herbaceous stems, and small immature fruits. Peach plants bear bud clusters (triads or triple buds), consisting of two lateral and one central bud with floral and vegetative fates, respectively. PpMETIin situ hybridization was performed in triple buds during their entire developmental cycle. High and low levels of PpMETI transcript were related to burst and quiescence of vegetative growth, respectively. Message localization distinguished lateral from central buds during the meristem switch to the floral phase. In fact, the PpMETI message was abundant in the L1 layer of protruding domes, a morphological trait marking the beginning of floral transition. The PpMETI transcript was also monitored during organ flower formation. Altogether, these data suggest a relationship between DNA replication and PpMETI gene expression. Key words: Buds with distinct fates, DNA methylase expression, peach. Received 26 March 2003;; Accepted 29 July 2003 Introduction In higher plants, the major functions of DNA cytosine methylation have been proposed to be genome control and the regulation of normal development (Finnegan and Kovac, 2000; Finnegan, 2001). More specifically, cytosine methylation is crucially important in regulating gene silencing (Finnegan et al., 1998a), chromatin structure (Ng and Bird, 1999; Finnegan et al., 2000), genomic imprinting (Bestor, 2000), and both tissue and developmental specific gene expression (Finnegan et al., 1996; Ronemus et al., 1996; Jacobsen et al., 2000). In plants, 6–33% of the cytosine residues may be methylated and this occurs in heterochromatic repetitive DNA, single copy DNA, and in any plant DNA sequence context. However, methylation is most common in the so‐called symmetrical cytosines, CpG and CpNpG (reviewed by Finnegan et al., 2000). Methylation of these sequences is symmetrical so that the clonal transmission of methylation patterns is guaranteed. Moreover, the level and distribution of cytosine DNA methylation varied in tissue and development specific manners (Messeguer et al., 1991; Bitonti et al., 1996, 2002). Cytosine methylation is a post‐replicative process catalysed by DNA cytosine 5‐methyltransferase (DNA‐METase, EC 2.1.1.37), which transfers a methyl group from S‐adenosylmethionine (AdoMet) to the fifth position of a cytosine residue. Plant DNA methyltransferases have been divided into manteinance (METI‐type), de novo and chromometylase classes, the latter being unique to plants (Henikoff and Comai, 1998; Papa et al., 2001). METI members share homologies to mouse Dnmt1 methyltransferase and feature characteristic C‐terminal catalytic and regulatory N‐terminal domains, whereas chromomethylase members harbour a specific chromodomain, which is likely to direct these proteins to heterochromatin (Finnegan and Kovac, 2000). In addition, de novo METases of Arabidopsis share homologies with mammalian Dnmt3, contain a domain derived from the arrangements of the catalytic motifs and ubiquitin‐associated domains, and their role has been recently investigated (Cao et al., 2000; Cao and Jacobsen, 2002). As for plant maintenance METases, a few genes have been isolated from herbaceous species (Genger et al., 1999; Bernacchia et al., 1998; Nakano et al., 2000; Steward et al., 2000; Pradhan et al., 1998), but not in tree species so far. In Arabidopsis DDM1 mutants (Kakutani et al., 1999) and in plants expressing METI in antisense orientation (Ronemus et al., 1996), the decrease in DNA methylation affected the duration of both juvenile and vegetative phases and induced flowering in the absence of vernalization (Finnegan et al., 1998b). Hence, METases must have a role in regulating developmental phase change. In this work, a cDNA coding for a maintenance type DNA 5′ cytosine methylase (PpMETI) was isolated from peach and structural features are described. Transcript abundance was examined in developing leaves and message localization carried out on quiescent versus active bud meristems with distinct fates. Materials and methods Plant material, growth conditions and the major features of triple bud The adult plant OP16 (open pollinator 16, Prunus persica cultivar Chiripa) was seed‐derived and chosen as the starting material. OP16 seeds were germinated in vitro and two clonal lines were propagated by apex multiplication according to Gentile et al. (2002). Fully regenerated plants were transferred to soil and kept in growth chambers until environmental adaptation occurred (20–22 °C, 8 h of white light). Clones were subsequently transferred into a greenhouse (minimum temperature, 16 °C) under natural photoperiod and light intensity. One‐year‐old plants were moved to an open field and flowering first occurred 1–2 years later. From March onwards, buds borne on the apical shoot of mature plants were sampled every 2 weeks. Triads were borne on shoots of mature plants and consisted of a central bud surrounded by two lateral ones. During vegetative growth (March to July), the frequency of triple buds of the Chiripa cultivar was 8.1±2.2 per adult shoot and mainly located along the mid‐distal portion (76%) of shoot axes. In the summer, each of the side buds mostly differentiated into a single flower, whereas the central bud generated either a proleptic or a sylleptic shoot. The former sprouted in the spring following the winter rest, the latter developed in the same season as its mother bud had formed, that is in late spring–summer. Syllepsis is a mode of branching of temperate trees: the axillary meristems borne on the primary axes develop lateral shoots, whilst the main axis continues to elongate (Génard et al., 1994; Kervella et al., 1995). Flower differentiation of side buds proceeded through the autumn, it slowed in winter and reached completeness with associated macrosporogenesis just before the spring anthesis. Proleptic shoots develop from meristems after several scales have been produced, that is in the subsequent spring. The latter occurred before the bursting of the proleptic central buds, whereas it occurred after the sylleptic shoots, which often bear triple buds themselves. In some cases, side bud meristems did not undergo the floral transition and this phenomenon was mostly observed in triple buds located at the basal position of the shoot. In rare cases, bud clusters exhibit up to six individuals. Southern blot analysis The technique was performed as previously described (Giannino et al., 2000). Filters were hybridized at 60 °C, washed twice (2×, 1×, SSC/0.1%SDS) at 60 °C for 10 min and exposed to Biomax films (Kodak) for 4–12 h at –80 °C. Probes A and B spanned the 1343–2497 and 2501–3761 cDNA nucleotide stretches, respectively. EcoRI cuts at 2844 bp of PpMETI cDNA, EcoRV at 1313 bp, SphI at 3336 bp, and NcoI at 1846 and 4534 bp. Northern blot analysis RNA extraction and the northern technique were reported in Giannino et al. (2000). Poly A‐enriched RNA was isolated according to Sambrook et al. (1989). Starting from 50 µg total RNA, a 1% yield of poly A‐RNA was recovered in the first 15 ml elution buffer and concentrated by vacuum. Two µg of poly A‐RNA was used, hybridization conditions were the same as for Southern blot. Filter exposure took 24–48 h. The probes A and C were used, the latter spanned the 3452–3878 cDNA stretch, and gave identical hybridization patterns. Isolation and sequence analysis of cDNA and genomic clones PCR experiments were performed on oligo dT cDNA which was reverse transcribed from RNA of shoot apical tips (see next paragraph). Degenerate primers (see Results, Fig. 2A) MET1FW (5′‐GCTGGTTGT(C)GGT(C)GGCCTGTC‐3′), MET3BW (5′‐(G)TCCTCAC(A)GTTCTCCAG(G)A(G)AG‐3′), MET3FW (5′‐CT(C)T(C)CTGGAGAAC(T)GTGAGGA(C)‐3′), and MET5BW (5′‐TGCCAATGGTGGAGGGAC‐3′) were designed based on conserved regions of the plant METase catalytic domain and peach preferential amino acid code. The 427 bp MET 1‐3 and 834 bp MET 3‐5 fragments were cloned and sequenced. The full length PpMET gene was recovered by the 5′ and 3′ RACE methodologies starting from apical tips RNA and according to the manufacturer’s instructions (Life Technologies). Backward 5′ RACE primers used for the cDNA synthesis were: corrected MET3BW (5′‐TCCTCACATT CTCCAGCGG‐3′), MET4BW (5′‐AGTTTGATGTGAGCTGGC AACTGC‐3′), MET6BW (5′‐CCACAGCAGCTGCCTGTTTAA CT‐3′), MET7BW (5′‐GACACCAATTATGAAGCATGC‐3′), and MET8BW (5′‐GCCATCTTCATAACCAGA‐3′) which respectively lead to the cloning of fragments of 1212, 1008, 1503, 910, and 629 nucleotides. The 3′ RACE primers were: a dTn anchor primer provided by the kit for the cDNA synthesis and MET37FW primer (5′‐CCTCCATGCCGGGGTTTCTCTG‐3′). The GenBank accession number of PpMETI complete cDNA is AY128652. The final PCR conditions were 500 ng of genomic DNA or 200 ng of cDNA, 1 µM of each primer, 0.5 mM dNTPs, Taq DNA polymerase (TaqQUIA, Quiagen) 2.5 U, 1/10 of 10× Taq Buffer (Quiagen), 2.5 mM MgCl2, in a final volume of 50 µl. Cycling conditions included an initial cycle of 95 °C for 3 min followed by 35 cycles of 95 °C for 1 min, 50 °C for 2 min (in PCR performed to isolate MET homologues in peach) and 60 °C for 90 s (in PCR on genomic DNA), 72 °C for 90 s followed by final extension at 72 °C for 5 min. The intron search within the PpMETI gene (see Results, Fig. 2A) was approached by PCR on genomic DNA using the combinations: MET39FW (5′‐CGCATTCTAGGGTTTCACTG GCG‐3′)/MET22BW (5′‐GCCAATGATTATCCTCTACCCGC‐3′), MET22FW/MET11BW (5′‐CCGAACTGTATGCCTTCTCA ACAG‐3′), MET10FW (5′‐AGACTGTTCTTGGCAACACTG‐3′)/MET37BW (5′‐CAGAGAAACCCCGGCATGGAGG‐3′), MET37 FW/MET44BW (5′‐GAACTGCATTCCCAATCTGCCTGTG‐3′). The sequences of amplified fragments from cDNA and genomic DNA were aligned, compared and intron size and locations established. All PCR amplified fragments were cloned into pGEM‐T vector system (Promega). Clones were sequenced by the ENEA sequence service, Rome. Semi‐quantitative RT‐PCR Total RNA from distinct tissues was DNAse‐treated (RQ1, Promega), then precipitated (5 vols ethanol 99% and sodium acetate pH 5.3, final concentration 0.3 M), washed in 80% ethanol, resuspended in DEPC water, and quantified by spectrophotometer assays and compared with standard scales in ethidium‐bromide‐stained gels. DNA‐free RNA (3 µg) was reverse transcribed at 60 °C into single strand cDNA by corrected MET3BW (see above) and 26SBW primers (5′‐GCCCCGTCGATTCAGCCAAACTCC‐3′), using Superscript II‐RT and according to the manufacturer’s instructions (Life Technologies), in a final volume of 20 µl. PpMET transcripts (641 bp) were detected in PCR reactions by primers MET10FW (5′‐AGACTGTTCTTGGCAACACTGCCA‐3′) and MET11BW (5′‐CCGAACTGTATGCCTTCTCAACAG‐3′), whereas peach 26S cDNA was detected by 26SFW (5′‐AGCATTGCGATGGTCCCTGCGG‐3′) and 26SBW (5′‐GCC CCGTCGATTCAGCCAAACTCC‐3′). PCR parameters are those reported in the previous paragraph, starting from 2 µl of the cDNA batch. As for 26S cDNA, 20 PCR cycles were used to visualize whether tissue‐specific variation occurred (a higher number of cycles led to signal saturation). Reverse transcribed rRNA appeared to be equal in the tissues tested. As for PpMET, 35 PCR cycles were performed to detect the transcripts. PCR was also performed on DNAse‐treated RNA batches to check for non‐removed DNA contamination. Fifteen out of 50 µl of the PCR reaction was electrophoresed in a 1% agarose gel. Image analyses of bud meristems Excised shoot apices and triple buds (n=3 for each sample) were fixed in ethanol:acetic acid (3:1, v/v). After dehydration, the material was embedded in Tecnovit 81000 and polymerized for 4 h at 4 °C. Semi‐thin sections (3 µm) were cut with by a Leica Microtome RM 2155, collected on slides and dried overnight at 40 °C. Slides were stained in 1% toluidine blue (w/v) in benzoate buffer for 1 min, dried and permanently mounted in Canada Balsam. Meristem areas were measured by using a Leica Q500/W image‐analyser equipped with a CCD camera. Eighty triple buds were scored (from April on) and the Student t‐test was used to analyse the morphometric data. In situ hybridization Excised shoot apices and triads were fixed, dehydrated and embedded in paraffin as described Cañas et al. (1994), and cut into 8 µm sections. The fragment spanning the region confined by the primers 1 and 3 (see Results, Fig. 2, probe C) was linearized by endonucleases SpeI and NcoI. Digoxigenin‐labelled RNA anti sense and sense probes were synthesized by T7 and SP6 polymerase driven in vitro transcription, respectively (Giannino et al., 2000). Results Isolation of PpMETI full length cDNA and features of its deduced product Two fragments (427 and 834 bp, respectively) of the PpMETI gene were initially amplified by PCR experiments performed on oligo dT cDNA which was reverse transcribed from RNA extracted from shoot apices. The primers were designed on the conserved catalytic I‐X domains of the plant METases. PCR bands were screened by cross hybridization with an Arabidopsis thalianaMETI probe. Subsequently, RACE technology was performed to achieve a full length PpMETI cDNA of 4992 bp (GenBank accession number AY128652). The open reading frame (ORF) of 4695 bp encoded a protein of 1564 amino acid residues and 175.205 kDa (BioEdit Software) calculated mass (Fig. 1A). The comparison of the deduced amino acid sequence (http://www.ncbi.nlm.nih.gov/BLAST/) with other higher plant METases revealed the highest identity (87%) of the catalytic site (1124–1548) and 84% identity of the carboxyl terminal region (1097–1564) to DNA METase type I of Arabidopsis thaliana (Finnegan et al., 2000). The identity of the amino terminal region (1–1096) was 60, 58 and 52% with the maintenance DNA METases of carrot, tomato and Arabidopsis, respectively. Thus, the gene product was designated as Prunus persica METI (PpMETI). PpMETI motifs I (1124–1144), II (1148–1167), IV (1214–1233), VI (1263–1278), VIII (1299–1319), IX (1508–1522), and X (1534–1548) of the carboxyl terminal region were as conserved as in all prokaryotic and eukaryotic METases (Fig. 1A). Motifs I, V and X together constitute the AdoMet binding site, motif IV is the thiolate donor by the proline cysteine dipeptide, motif VI releases protons to the target cytosine by the glutamyl residue, motif IX contributes to the integrity of the target recognition domain (TRD), which determines the sequence and base specificity of methylation and is located between motifs VIII and IX (reviewed by Bestor, 2000). As for PpMETI, the consensus fingerprint FxGxG of motif I and the prolylcysteinyl dipeptide of motif IV were kept intact and the TRD was 98% identical with Arabidopsis METI (Klimasauskas et al., 1991). The N‐ and C‐ terminal domains were joined by the lysine/glycine rich linker (RKRKGKCK, 1096–1104), homologous to the SV40 (KKKRK) large T antigen nuclear localization signal (NLS) (van der Krol and Chua, 1991). PpMETI far N terminus harboured a few clusters of basic amino acids such as lysine rich stretches (KKKK, 36–40 and PKAKK, 49–53), which are also alleged to be part of NLSs (Hicks and Raikhel, 1993). Similarly to the pea METase, a proline rich region (KKKKX9PX7PX6PX6RSRK, 35–69) was flanked by the NLS, starting with amino acid 36 (Pradhan et al., 1998). A slightly hydrophobic domain (169–357) followed, which is probably responsible for the enzyme localization at the replication foci during DNA duplication as proposed by Bernacchia et al. (1998). In common with all plant METases, PpMETI harboured the acidic stretch rich in 11 glutamic and 3 aspartic residues (695–715) instead of the typical mammalian Zn‐binding domain (Finnegan and Kovac, 2000). When animal and plant METases type I were aligned (by ClustalW and Genedoc programs), a relatively poor homology in the N‐terminal regions was observed. Consequently, a phylogram was constructed by using a clustering based on the C‐terminal regions (from the poly‐linker stretch to the end of motif X), which allowed a reliable and significant comparison between plants and mammals. The phylogram (Fig. 1B) indicated that plant DNA maintenance METases fell into a unique and highly supported monophyletic group and that PpMETI was mostly related to that of Arabidopsis. Moreover, the latter level of vicinity was also maintained when a phylogram was designed based on the complete amino acidic sequences of plant METases and without those of mammals (not shown). Genomic organization DNA gel blot analysis was performed using the radiolabelled probes A and B (Fig. 2A) derived from PpMETI cDNA. Genomic DNA of Chiripa was first digested with endonucleases which did not cut within probe A (Fig. 2B, left panel) and one signal band was detected. In a second experiment, genomic DNA was restricted by enzymes, which cleft (EcoRI and SphI) and did not cut (EcoRV and NcoI) in probe B. A two‐band pattern (Fig. 2B, right panel) featured the EcoRI and SphI digestions, whereas a single signal appeared with the other two. Taken together, these results strongly suggested the occurrence of one DNA methylase copy in the Chiripa genome (2n=16). In order to identify introns (Fig. 2A), PCR experiments were performed on genomic DNA, using primer couples designed along the full length transcript (details are also in the Materials and methods). The primer combinations 22/11 and 11/37 yielded amplified products which showed identical sequences to those of the cDNA, the 11/44 combination produced a product harbouring an intron of 16 nucleotides, whereas the 39/22 primer combination gave higher products than cDNA of 623 nucleotides (data not shown). Size and location of introns were established (Fig. 2A), moreover introns harboured the AG/GT consensus and were rich (c. 65%) in A/T nucleotides (not shown). Transcript abundance in distinct tissues Northern analysis (Fig. 3A) was performed with poly‐A‐enriched RNA derived from apical tips of shoots borne on young and adult plants and fully expanded leaves during vegetative development (May). PpMETI transcripts (Fig. 3A) were hybridized with probe A and probe C (not shown in Fig. 3A) and in both cases a single band was signalled, which had a calculated size consistent with that of the full length cDNA. PpMETI transcripts were more abundant in the apical tips than in fully expanded leaves in both shoot types. Semi‐quantitative RT‐PCR (Fig. 3B) was also carried out to test PpMETI tissue‐specific expression, which was confirmed to be higher in apices, followed by unfolded leaves and developing herbaceous stems. In fully expanded leaves and subtending woody stems very low abundant, if not absent, PpMETI messages were visualized. PpMET1 expression was observed in the side buds during the winter, but not in the central ones. PpMETI transcripts were hardly detected in sepals, petals or stamens of fully disclosed flowers (March), whereas they were more abundant in growing fruits (3 cm in diameter). Transcript localization in vegetative apical meristems of shoots The antisense RNA probe C (Fig. 2A) was used to detect PpMETI messages in the apical meristems of mature shoots and the triple buds borne on them (Figs 4, 6, 7). PpMETI mRNA was portrayed as a faint and diffuse signal in quiescent shoot apices (Fig. 4A), whereas an intense signal was observed on the resumption of vegetative growth occurring at the end of March (Fig. 4B). PpMETI messages were localized in the L1, L2, and L3 layers and the corpus of the apical dome, with a slightly stronger signal in the peripheral zone (pz), and leaf primordia. Abundant transcripts featured in leaf blastozones (Fig. 4B) as well as procambial strands (Fig. 4C). This signal pattern characterized active vegetative meristems in shoots apices borne on both adult and young plants (datum not shown). Transcript localization in triple bud meristems Triple buds of the Chiripa cultivar were analysed from their early formation onwards (Fig. 5). In April–May (pre‐inductive period), the central bud was elongated compared with the side buds (Fig. 5A). The latter lay on a lower plane and exhibited a smaller budding corpus than the former. Interestingly, at this early stage of development, the lateral bud meristems exhibited a smaller apical dome than the central one (Table 1). In June–July (inductive period), the lateral buds were co‐axial with the central bud (Fig. 5B) and the size of apical dome became larger than the central one (Table 1). Concerning PpMETI expression at the pre‐inductive period, transcripts were abundant and diffuse throughout the dome and the rib meristem of central buds (Fig. 6A). Later on (June), two patterns of expression were observed: (a) a diffuse signal (Fig. 6B), but less intense than the one detected in the previous stage (Fig. 6A), and (b) a localized signal in the rib‐zone (Fig. 6D), similar to resting buds in the winter (datum not shown). The former pattern is consistent with an active vegetative meristem suggesting that this would lead to a sylleptic shoot (Fig. 6C), whereas the latter may be related to the development of a proleptic shoot in the following spring (Fig. 6E). As for the lateral buds (Fig. 7), at early development (April) PpMETI transcripts appeared as weak and diffuse signals in the meristematic dome (Fig. 7A), whereas they were more intense (Fig. 7B) when the side buds reached a co‐axial position with the central bud. The latter pattern resembled that of the vegetative central bud (compare with Fig. 6A). After the occurrence of induction signals (July), the apical meristems of the side buds first assumed the shape of a protruding dome (see drawing of a meristem profile at the top of Fig. 7C), then elongated trilobate swollen (see the top of Fig. 7D), and then flattened shapes after which the receptacle and sepals were visible (Fig. 7E). The side buds exhibited a very strong signal in the tunica cell layers of the protruding dome (Fig. 7C). Subsequently, in trilobate‐shaped meristems, signals of PpMETI appeared confined to the tunica cell layers of protruding meristematic foci (Fig. 7D). When the side bud meristems flattened (Fig. 7E), PpMETI transcripts were mainly localized at the tip of flower primordia, whereas little or no expression was observed in the L1 layer. The development of petals, anthers and ovary followed relatively rapidly. The process of floral development, from the protruding dome of bud apices to the ovary completion, took approximately 60–70 d (September–October). Floral morphogenesis also occurred during the winter (November–December), pollen meiosis marked the end of winter rest. During the development of stamens and monocarpellar ovary (Fig. 7F–J), PpMETI signals were intense in the style along the joining cell layers of the carpel, in the stigma (Fig. 7F, G) and in developing anthers (Fig. 7F). During the period of flower completion, PpMETI transcripts were abundant in the ovary, in the developing ovule (Fig. 7H), in the vascular bundles of both pistil (Fig. 7H–I) and stamen threads (Fig. 7I) and in some late‐forming anthers (Fig. 7J). Control experiments were constantly performed on triple buds during their development with the dig‐labelled PpMETI probe C in sense orientation and no signal was ever revealed (data not shown). Discussion The PpMETI gene was cloned by RT‐PCR starting from RNA of apical meristems and using primers based on conserved functional domains among plant species. The complete cDNA was 4992 bp long and encoded a deduced product of 175.205 kDa. The protein harbours all the elements common among the plant METases type I, which are the nuclear localization signals, the acidic region, the serine‐rich stretches, lysine and glycine repetitions, and the I–X C‐terminal domains. Consequently, the observed homology allows the peach protein to be classified as a maintenance DNA METase typical of higher eukaryotes. Finally, plant METases type I constitute a monophyletic group: peach (Rosales) and Arabidopsis (Brassicales) are the most related species within the group, in agreement with the vicinity of their respective systematic orders as proposed by the Angiosperm Phylogeny Website (http://www.mobot.org/MOBOT/Research/APweb/welcome.html). In plants, the METI genes belong to families from one to five members with, probably, distinct functions (Finnegan and Kovac, 2000). The Southern analyses carried out strongly suggested the occurrence of one copy in the genome of cultivar Chiripa. Moreover, a single intron was located 97 nucleotides downstream of the ATG codon start which is similar to carrot (Bernacchia et al., 1998), whereas a small intron (15 nucleotides) was revealed between the VI and VIII domains, similar to the METI from Arabidopsis (Genger et al., 1999). In addition, no sequence polymorphism was observed in reverse‐transcribed messages derived from distinct tissues and the signalled message sizes corresponded to that of full length cDNA. However, METases post‐translational editing cannot be excluded, as observed in animals (Liu et al., 1996). With regard to PpMETI expression, transcripts were abundant in organs where cell proliferation was active, that is shoot apical tips, unfolded leaves, immature (green) fruits, but it was barely detected in fully expanded leaves, woody stems or quiescent buds. Moreover, a progressive decrease of PpMETI messages was observed starting from early to full development of the leaves. These data further support the hypothesis that METI gene activity is associated with DNA replication in order to maintain the methylation patterns in cell lineages (Nakano et al., 2000; Finnegan et al., 2000; Steward et al., 2000). In situ hybridization was carried out to define the histological domains of PpMETI expression in both vegetative and reproductive meristems. In the vegetative shoot apical meristem (SAM), PpMETI transcript abundance was associated with the resumption of growth, which follows a two‐peak trend after flowering in peach trees (Grossman and Dejong, 1994). In the active meristems, signals were intense in zones with high cell proliferation (i.e. the peripheral zone of SAM and the leaf blastozone), leading to hypothesize the occurrence of a relationship between DNA replication and PpMETI gene expression as observed in maize root meristems, (Steward et al., 2000). The triple bud morphology and physiology of peach plants have been described (Luna et al., 1990; Kervella et al., 1995). As for the organogenetic model of triads, the side buds originate at the axillary position of an extremely shortened internode rather than being derived from a tripartite meristem. The side buds reach a co‐axial position with respect to the central one, suggesting that apical dominance is suppressed (Lauri, 1991; Cline, 2000). The co‐axial side buds exhibit a meristem 1.8‐fold wider than the central one. After induction signals occur (Faust, 1989), it was observed that timing and patterns of flower development of Chiripa were consistent with those reported for other peach cultivars (Faust, 1989). With regard to triple bud meristems, the patterns of PpMETI message distribution in lateral and central buds were alike until they reached a co‐axial position. Subsequently, when the meristem switch of the side buds was distinguished by the protruding dome morphology, PpMETI transcripts were confined to the outer cell layers with an intense signal in L1. In meristem phase transition, the L1 layer has been proposed to play a role in re‐programming the morphogenetic project underlying flower development (Ronemus et al., 1996). The increase of the PpMETI signal in the side bud meristems is hypothesized to mark this new project, being related to cell proliferation. In the following stages, PpMETI activity was clearly linked to cell proliferation that underlies the development of flower organs, which proceeded during the winter. The perception of cold is hypothesized to be mediated by DNA methylation, in fact Arabidopsis plants, which express antisense METI, do not require vernalization (Finnegan et al., 1998b; Finnegan, 2001). Similar results are achieved when demethylating compounds (5‐azacytidine) are provided to plants (Dennis et al., 1996). In this context, the hypothesis must be considered that the increase of signal in L1 at the phase transition layer might be related to the perception of external stimuli, including temperature variations. Ideally, an antisense approach based on inducible down‐regulation of PpMETI in buds (before the induction) might help to provide functional evidence for the hypothesis considered above (Finnegan et al., 1998a, b). In turn, this approach will depend on a reliable transformation protocol for peach, work that is currently in progress in this laboratory on the basis of previous attempts (Scorza et al., 1990; Gentile et al., 2002). Acknowledgements This work was supported by MIPAF of Italy, Piano Nazionale Biotecnologie Vegetali (CNR programme 360, Area 4.2.8) and by the EU project FAIR CT 96‐1445. We are grateful to Mr Luigi Santini for his technical support in plant growing and photo making, Dr Damiano Carmine (Institute for Fruit Tree Culture of MiPAF, Rome) for providing plant material, Dr Massimo Galbiati and Professor Steve Dellaporta (Department of Biology, Yale University, USA) for providing the METI probe from A. thaliana, and Dr Ernesto Picardi for precious suggestions and comments in phylogenetic tree construction. View largeDownload slide Fig. 1. PpMETI deduced product. (A) Scheme of PpMETI protein (thick horizontal bar). Thin vertical bars indicate the start position of functional motifs: NLS, nuclear localization signal; NLS‐like, possible NLS; HR, hydrophobic region; AR, acidic region; L, linker region. I‐X, conserved motifs of DNA maintenance MET I type. M, Starting methionine. More details concerning the amino acids and their position of these motifs are reported in the Results and referring to GenBank accession number AY128652. Small horizontal bar, unit of 100 amino acids (aa). (B) Phylogram was constructed by the MEGA2 program and clustering analysis performed with the minimum evolution criterion. The C‐terminal regions of DNA maintenance METases of plants and mammals were aligned by the ClustalW service and processed with Genedoc. Accession numbers are: Arabidopsis thaliana (L10692); tomato, Lycopersicon esculentum (AJ002140); tobacco, Nicotiana tabacum (AB030726); carrot, Daucus carota (AF007807); pea, Pisum sativum (AF034419); human, Homo sapiens (NP_001370.1); mouse, Mus musculus (AAH53047.1). Numbers on the tree indicate bootstraps (1000 replicates), which assign proteins to a clade; the genetic distances are measured by horizontal bars. View largeDownload slide Fig. 1. PpMETI deduced product. (A) Scheme of PpMETI protein (thick horizontal bar). Thin vertical bars indicate the start position of functional motifs: NLS, nuclear localization signal; NLS‐like, possible NLS; HR, hydrophobic region; AR, acidic region; L, linker region. I‐X, conserved motifs of DNA maintenance MET I type. M, Starting methionine. More details concerning the amino acids and their position of these motifs are reported in the Results and referring to GenBank accession number AY128652. Small horizontal bar, unit of 100 amino acids (aa). (B) Phylogram was constructed by the MEGA2 program and clustering analysis performed with the minimum evolution criterion. The C‐terminal regions of DNA maintenance METases of plants and mammals were aligned by the ClustalW service and processed with Genedoc. Accession numbers are: Arabidopsis thaliana (L10692); tomato, Lycopersicon esculentum (AJ002140); tobacco, Nicotiana tabacum (AB030726); carrot, Daucus carota (AF007807); pea, Pisum sativum (AF034419); human, Homo sapiens (NP_001370.1); mouse, Mus musculus (AAH53047.1). Numbers on the tree indicate bootstraps (1000 replicates), which assign proteins to a clade; the genetic distances are measured by horizontal bars. View largeDownload slide Fig. 2. PpMETI genomic features. (A) Scheme of the partial genomic organization of PpMETI. Probes and endonuclease recognition sites are indicated. Primers used for probe making are indicated as arrows below the probes (thick bars), primers used for the intron search are indicated as arrows on the gene (thin bar). The position and the size of top side of black triangles indicate the location and length of introns, respectively. Primers used to clone the full length cDNA, and sequences of all mentioned primers are reported in the materials and methods, referring to the accession number. (B) Southern analysis: genomic DNA was digested with EcoRI (EI), EcoRV (EV), NcoI (NI), SacI (SaI), SphI (SpI), electrophoresed on 0.8% agarose gel, blotted and hybridized with the radiolabelled probes A (left panel) and B (right panel). View largeDownload slide Fig. 2. PpMETI genomic features. (A) Scheme of the partial genomic organization of PpMETI. Probes and endonuclease recognition sites are indicated. Primers used for probe making are indicated as arrows below the probes (thick bars), primers used for the intron search are indicated as arrows on the gene (thin bar). The position and the size of top side of black triangles indicate the location and length of introns, respectively. Primers used to clone the full length cDNA, and sequences of all mentioned primers are reported in the materials and methods, referring to the accession number. (B) Southern analysis: genomic DNA was digested with EcoRI (EI), EcoRV (EV), NcoI (NI), SacI (SaI), SphI (SpI), electrophoresed on 0.8% agarose gel, blotted and hybridized with the radiolabelled probes A (left panel) and B (right panel). View largeDownload slide Fig. 3. PpMETI tissue‐specific expression. (A) Northern analysis. Poly A‐enriched‐RNA (3 µg) was electrophoresed on 1.2% agarose gel, blotted and hybridized with probe A (in Fig. 2A). AT, apical tips; FEL, fully expanded leaves; a, shoot borne on adult plant; y, shoot borne on young (non‐flowering) plant. The arrow indicates the estimated message size by comparison with a co‐migrating RNA marker. (B) Semi‐quantitative RT‐PCR analysis. Top panels: RNA from distinct tissues was reverse transcribed and amplified in the region upstream the I–X domains as described in the Materials and methods. Bottom panels: a portion of the 26S rRNA was reverse transcribed to check for an effective reverse transcription and that an equal cDNA synthesis from distinct tissues occurred. at, apical tips; cl, unfolded leaves; es, elongating herbaceous stems; l, mature leaves; ws, woody stems; df, immature fruits; c, calyx; p, petals; st, stamens; sb, side buds in March; cb, central buds in March; wc, control for DNA contamination; m, molecular size marker. View largeDownload slide Fig. 3. PpMETI tissue‐specific expression. (A) Northern analysis. Poly A‐enriched‐RNA (3 µg) was electrophoresed on 1.2% agarose gel, blotted and hybridized with probe A (in Fig. 2A). AT, apical tips; FEL, fully expanded leaves; a, shoot borne on adult plant; y, shoot borne on young (non‐flowering) plant. The arrow indicates the estimated message size by comparison with a co‐migrating RNA marker. (B) Semi‐quantitative RT‐PCR analysis. Top panels: RNA from distinct tissues was reverse transcribed and amplified in the region upstream the I–X domains as described in the Materials and methods. Bottom panels: a portion of the 26S rRNA was reverse transcribed to check for an effective reverse transcription and that an equal cDNA synthesis from distinct tissues occurred. at, apical tips; cl, unfolded leaves; es, elongating herbaceous stems; l, mature leaves; ws, woody stems; df, immature fruits; c, calyx; p, petals; st, stamens; sb, side buds in March; cb, central buds in March; wc, control for DNA contamination; m, molecular size marker. View largeDownload slide Fig. 4. PpMETI message localization in vegetative meristems. (A–D) Meristems at the apex of shoots were subjected to in situ hybridization using the dig‐labelled antisense probe C (in Fig. 2A), spanning the I–V domains. The first picture on the left shows the stage of vegetative resumption in March. (A) Low or absent signal in February and early March; (B–C) During the active growth at the end of March, intense signal in the whole meristematic dome and leaf blastozone (B), and in vascular bundles (C); (D) Control experiment performed with dig‐labelled PpMETI sense probe. lb, leaf blastozone; cz, central zone; pz, peripheral zone; rz rib‐zone; vb, vascular bundles. View largeDownload slide Fig. 4. PpMETI message localization in vegetative meristems. (A–D) Meristems at the apex of shoots were subjected to in situ hybridization using the dig‐labelled antisense probe C (in Fig. 2A), spanning the I–V domains. The first picture on the left shows the stage of vegetative resumption in March. (A) Low or absent signal in February and early March; (B–C) During the active growth at the end of March, intense signal in the whole meristematic dome and leaf blastozone (B), and in vascular bundles (C); (D) Control experiment performed with dig‐labelled PpMETI sense probe. lb, leaf blastozone; cz, central zone; pz, peripheral zone; rz rib‐zone; vb, vascular bundles. View largeDownload slide Fig. 5. Morphology of triads. Longitudinal median section of triple buds before (A) and at co‐axial (B) phases stained with toluidine blue (black and white picture). Size bars: 150 µm. View largeDownload slide Fig. 5. Morphology of triads. Longitudinal median section of triple buds before (A) and at co‐axial (B) phases stained with toluidine blue (black and white picture). Size bars: 150 µm. View largeDownload slide Fig. 6. PpMETI message localization in central buds of triads. Central bud meristems: (A) intense signal during coaxial phase in April‐May; (B) abundant transcript (June–July) suggests that a sylleptic shoot derives (C); (D) messages confined to rib meristem suggest a propleptic shoot formation (E). cz, pz, rz, central, periheral and rib zones. Size bars: 30 µm. View largeDownload slide Fig. 6. PpMETI message localization in central buds of triads. Central bud meristems: (A) intense signal during coaxial phase in April‐May; (B) abundant transcript (June–July) suggests that a sylleptic shoot derives (C); (D) messages confined to rib meristem suggest a propleptic shoot formation (E). cz, pz, rz, central, periheral and rib zones. Size bars: 30 µm. View largeDownload slide Fig. 7. PpMETI message localization in lateral buds of triads. (A) Weak and diffuse signal in side buds at early formation, in April; (B) intense signal in domes at the coaxial phase, in May;(C) abundant transcripts confined to the L1 layer of protruding domes, in June and July; (D) messages localized in the outer cell layers of the trilobate dome, in August–September. On the top of figures: sections of meristems at distinct developmental stages were digitally enlarged so as to portray dome profiles and processed by the Corel Draw program. (E–J) Presence of transcripts, indicated by arrows, at specific stages of flower differentiation from August to January (details are in the text). pr, flower primordia; sm, stigma; c, carpel; a, anthers, st, stylus; o, ovule, p, pollen, t, stamen thread; pt, pollen theca. Size bars: (A) 40 µm; (B, C) 35 µm; (D) 45 µm; (E) 80 µm; (F) 60 µm; (G) 85 µm; (H) 90 µm; (I) 60 µm; (J) 40 µm. View largeDownload slide Fig. 7. PpMETI message localization in lateral buds of triads. (A) Weak and diffuse signal in side buds at early formation, in April; (B) intense signal in domes at the coaxial phase, in May;(C) abundant transcripts confined to the L1 layer of protruding domes, in June and July; (D) messages localized in the outer cell layers of the trilobate dome, in August–September. On the top of figures: sections of meristems at distinct developmental stages were digitally enlarged so as to portray dome profiles and processed by the Corel Draw program. (E–J) Presence of transcripts, indicated by arrows, at specific stages of flower differentiation from August to January (details are in the text). pr, flower primordia; sm, stigma; c, carpel; a, anthers, st, stylus; o, ovule, p, pollen, t, stamen thread; pt, pollen theca. Size bars: (A) 40 µm; (B, C) 35 µm; (D) 45 µm; (E) 80 µm; (F) 60 µm; (G) 85 µm; (H) 90 µm; (I) 60 µm; (J) 40 µm. Table 1. Size of apical dome (µm2) in the central and lateral budsaof P. persica in the pre‐inductive (April–May) and inductive (June–July) period Period   Central bud (µm2)  Lateral bud (mm2)  April–May   6668.9±397b  3577.2±304        June–July  3643.3±134  5046.2±74  Period   Central bud (µm2)  Lateral bud (mm2)  April–May   6668.9±397b  3577.2±304        June–July  3643.3±134  5046.2±74   a 80 triple buds were scored for the entire period.  b Standard deviation. View Large References BernacchiaG, Primo A, Giorgetti L, Pitto L, Cella R. 1998. Carrot DNA‐methyltransferase is encode by two classes of genes with differing patterns of expression. The Plant Journal  13, 17–32. Google Scholar BestorTH. 2000. The DNA methyltransferases of mammals. Human Molecular Genetics  9, 2395–2402. Google Scholar BitontiMB, Cozza R, Chiappetta A, Giannino D, Ruffini‐Castiglione M, Dewitte W, Mariotti D, Van Onckelen H, Innocenti AM. 2002. Distinct nuclear organization, DNA methylation pattern and cytokinin distribution mark juvenile, juvenile like and adult vegetative apical meristems in peach (Prunus persica L. Batsch). Journal of Experimental Botany  53, 1047–1054. Google Scholar BitontiMB, Cozza R, Wang G, Ruffini‐Castiglione M, Mazzuca S, Castiglione S, Sala F, Innocenti AM. 1996. Nuclear and genomic changes in floating and submerged buds and leaves of heterophyllous waterchestnut (Trapa natans). Physiologia Plantarum  97, 21–27. Google Scholar CañasLA, Busscher M, Angenent GC, Beltrán JP, van Tunen AJ. 1994. Nuclear localization of the petunia MADS box protein FBP1. The Plant Journal  6, 597–604. Google Scholar CaoX, Jacobsen B. 2002. Role of the Arabidopsis DRM methyltransferases in de novo DNA methylation and gene silencing. Current Biology  12, 1138–1144. Google Scholar CaoX, Springer NM, Muszynski MG, Phillips RL, Kaeppler S, Jacobsen B. 2000. Conserved plant genes with similarity to mammalian de novo DNA methyltransferases. Proceedings of the National Academy of Sciences, USA  97, 4979–84. Google Scholar ClineMG. 2000. Execution of the auxin replacement apical dominance experiment in template woody species. American Journal of Botany  87, 182–190. Google Scholar DennisES, Finnegan EJ, Bilodeau P, Chaudhury A, Genger RK, Peacock WJ, Helliwell CA, Sheldon CC. 1996. Vernalization and the initiation of flowering. Seminars in Cell and Development Biology   7, 441–448. Google Scholar FaustM. 1989. In: Faust M, eds. Physiology of temperate zone fruit trees. USA: Wiley‐Interscience Publication. Google Scholar FinneganEJ. 2001. Is plant gene expression regulated globally? Trends in Genetics  17, 361–365. Google Scholar FinneganEJ, Genger RK, Kovac KA, Peacock WJ, Dennis ES. 1998a. DNA methylation in plants. Annual Review of Plant Physiology and Plant Molecular Biology  49, 223–247. Google Scholar FinneganEJ, Genger RK, Kovac KA, Peacock WJ, Dennis ES. 1998b. DNA methylation and the promotion of flowering by vernalization. Proceedings of the National Academy of Sciences, USA  95, 5824–5829. Google Scholar FinneganEJ, Kovac KA. 2000. Plant DNA methyltransferases. Plant Molecular Biology  43, 189–201. Google Scholar FinneganEJ, Peacock WJ, Dennis E. 1996. Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proceedings of the National Academy of Sciences, USA  93, 8449–8454. Google Scholar FinneganEJ, Peacock WJ, Dennis E. 2000. DNA methylation, a key regulator of plant development and other processes. Current Opinions in Genetic Developopment   10, 217–223. Google Scholar GengerRK, Kovac KA, Dennis ES, Peachock WJ, Finnegan EJ. 1999. Multiple DNA methyltransferase genes in Arabidopsis thaliana. Plant Molecular Biology  41, 269–278. Google Scholar GentileA, Monticelli S, Damiano C. 2002. Adventitious shoot regeneration in peach [Prunus persica (L.) Batsch]. Plant and Cell Reproduction  20, 1011–1016. Google Scholar GénardM, Pagés L, Kervella J. 1994. Relationship between sylleptyc branching and components of parent shoot development in the peach tree. Annals of Botany  74, 465–470. Google Scholar GianninoD, Frugis G, Ticconi C, Florio S, Mele G, Santini L, Cozza R, Bitonti, MB, Innocenti AM, Mariotti D. 2000. Isolation and molecular characterization of the gene encoding the cytoplasmic ribosomal protein S28 in Prunus persica [L.] Batsch. Molecular and General Genetics  263, 201–212. Google Scholar GrossmanYL, DeJong TM. 1994. PEACH: a model of reproductive and vegetative growth in peach trees. Tree Physiology  14, 329–345. Google Scholar HenikoffS, Comai LA. 1998. DNA methyltransferase homolog with a chromodomain exists in multiple polymorphic forms in Arabidopsis. Genetics  149, 307–318. Google Scholar HicksGR, Raikhel NV. 1993. Specific binding of nuclear localization sequences to plant nuclei. The Plant Cell  5, 983–994. Google Scholar JacobsenSE, Sakai H, Finnegan EJ, Cao X, Meyerowitz EM. 2000. Ectopic hypermethylation of flower‐specific genes in Arabidopsis. Current Biology  10, 179–186. Google Scholar KakutaniT, Munakata K, Richards EJ, Hirochika H. 1999. Meiotically and mitotically stable inheritance of DNA hypomethylation induced by ddm1 mutation of Arabidopsis thaliana. Genetics  151, 831–838. Google Scholar KervellaJ, Pages L, Genard M. 1995. Growth context and axillary meristems of young peach trees. Influence of parent shoot growth characteristics and of emergence date. Annals of Botany  76, 559–567. Google Scholar KlimasauskasS, Nelson JL, Roberts RJ. 1991. The sequence specificity domain of cytosine‐C5 methylases. Nucleic Acids Research  19, 6183–6190. Google Scholar LauriPE. 1991. Données sur l’évolution de la ramification et de la floraison du pêcher (Prunus persica L. Batsch) au cours de sa croissance. Annales des Sciences Naturelles (Botanique), Paris  11, 95–103. Google Scholar LiuY, Sun L, Jost JP. 1996. In differentiating mouse myoblast DNA methyltransferase is post transcriptionally and post translationally regulated. Nucleic Acids Research  24, 2718–2722. Google Scholar LunaV, Lorenzo E, Reinoso H, Tordable C, Abdala G, Pharis P, Bottini R. 1990. Dormancy in Peach (Prunus persica L. Batsch) flower buds. Floral morphogenesis and endogenous gibberellins at the end of the dormancy period. Plant Physiology  93, 20–25. Google Scholar MesseguerR, Ganal MW, Steffens GC, Tanksley SD. 1991. Characterization of the level, target sites and inheritance of cytosine methylation in tomato nuclear DNA. Plant Molecular Biology  16, 753–770. Google Scholar NakanoY, Steward N, Kusano T, Sano H. 2000. A tobacco NtMET1 cDNA encoding a DNA methyltransferase, molecular characterization and abnormal phenotypes of transgenic tobacco plants. Plant Cell Physiology  41, 448–457. Google Scholar NgHH, Bird A. 1999. DNA methylation and chromatin modification. Current Opinions in Genetic Development   9, 158–163. Google Scholar PapaCM, Springer NM, Muszynski MG, Meeley R, Kaeppler SM. 2001. Maize chromomethylase methyltransferase 2 is required for CpNpG methylation. The Plant Cell  13, 1919–1928. Google Scholar PradhanS, Cummings M, Roberts RJ, Adams RL. 1998. DNA methyltransferase from Pisum sativum. Nucleic Acids Research  26, 1214–1222. Google Scholar RonemusJ, Galbiati M, Ticknor C, Chen J, Dellaporta SL. 1996. Demethylation induced developmental pleiotropy in Arabidopsis. Science  273, 654–657. Google Scholar SambrookJ, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory. Google Scholar ScorzaR, Morgens PH, Mante S, Cordts B, Callahan AM. 1990. Agrobacterium mediated transformation of peach (Prunus persica Batsch L.) leaf segments, immature embryos, and long term embryogenic calli. In Vitro Cellular Development Biology   26, 829–834. Google Scholar StewardN, Kusano T, Sano H. 2000. Expression of ZmMET1, a gene encoding a DNA methyltransferase from maize, is associated not only with DNA replication in actively proliferating cells, but also with altered DNA methylation status in cold‐stressed quiescent cells. Nucleic Acids Research  28, 3250–3259. Google Scholar van der KrolAR, Chua NH. 1991. The basic domain of plant B‐ZIP proteins facilitates import of a reporter protein into plant nuclei. The Plant Cell  3, 667–675. Google Scholar Society for Experimental Biology
TI - Isolation and characterization of a maintenance DNA‐methyltransferase gene from peach (Prunus persica [L.] Batsch): transcript localization in vegetative and reproductive meristems of triple buds
JF - Journal of Experimental Botany
DO - 10.1093/jxb/erg292
DA - 2003-12-01
UR - https://www.deepdyve.com/lp/oxford-university-press/isolation-and-characterization-of-a-maintenance-dna-methyltransferase-YS4PWQYCPC
SP - 2623
EP - 2633
VL - 54
IS - 393
DP - DeepDyve
ER -