TY - JOUR
AU - Bazzolli, Denise Mara, Soares
AB - ABSTRACT The RNA chaperone Hfq regulates diverse processes in numerous bacteria. In this study, we compared phenotypes (growth rate, adherence, response to different stress conditions and virulence in Galleria mellonella) of wild-type (WT) and isogenic hfq mutants of three serovars (1, 8 and 15) of the porcine pathogen Actinobacillus pleuropneumoniae. Similar growth in rich broth was seen for all strains except Ap1∆hfq, which showed slightly reduced growth throughout the 24 h time course, and the complemented Ap8∆hfqC mutant had a prolonged lag phase. Differences were seen between the three serovar WT strains regarding adherence, stress response and virulence in G. mellonella, and deletion of hfq affected some, but not all of these phenotypes, depending on serovar. Complementation by expression of cloned hfq from an endogenous promoter only restored some WT phenotypes, indicating that complex regulatory networks may be involved, and that levels of Hfq may be as important as presence/absence of the protein regarding its contribution to gene regulation. Our results support that Hfq is a pleiotropic global regulator in A. pleuropneumoniae, but serovar-related differences exist. These results highlight the importance of testing multiple strains/serovars within a given species when determining contributions of global regulators, such as Hfq, to expression of complex phenotypes. Pasteurellaceae, RNA chaperone, Galleria mellonella, virulence, stress INTRODUCTION The Gram-negative bacterium Actinobacillus pleuropneumoniae causes porcine pleuropneumonia, a disease that has a negative economic impact on the worldwide swine industry (Sassu et al. 2018). Currently, eighteen serovars are recognized based on capsular polysaccharides (Bossé et al. 2018). All serovars are pathogenic, but some are more virulent than others, e.g. serovar 3 is rarely pathogenic, but serovar 1 is considered of high virulence (Rogers et al. 1990; Frey 2011). In part, this is related to the combinations of repeat in toxin (RTX) toxins (ApxI-III) present in different serovars (Frey 2011). Other virulence factors, some of which also differ depending on serovar, have been reported for A. pleuropneumoniae including: capsule, lipopolysaccharide (LPS), fimbriae, outer membrane proteins, iron-binding proteins and the ability to form biofilms [reviewed in Bossé et al. 2002; Chiers et al. 2010]. In addition, roles in virulence have been indicated for global regulators of gene expression such as RpoE (Bossé et al. 2010), HlyX (Buettner et al. 2009), ArcA (Buettner et al. 2008) and Hfq (Zhou et al. 2008; Subashchandrabose et al. 2013), the latter being the subject of this study. Hfq was first identified in 1972 as regulator of phage Qβ RNA replication in Escherichia coli (Franze de Fernandez, Hayward and August 1972). It is now known that, through its interactions with small RNAs (sRNAs), Hfq is a major global regulator of gene expression in a wide variety of bacteria (Vogel and Luisi 2011; Sobrero and Valverde 2012; Feliciano et al. 2016; Dos Santos, Arraiano & Andrade 2019). In E. coli, deletion of the hfq gene results in pleiotropic changes when compared to wild-type (WT), including increased cell size, reduced growth rate, increased sensitivity to ultraviolet light and other processes (Tsui, Leung and Winkler 1994; Kendall et al. 2011). A role for Hfq in virulence, as adjudged in vivo or by surrogate markers such as tolerance to stress and ability to form biofilms, has been shown for many Gram-negative bacteria including: Neisseria meningitidis (Fantappiè et al. 2009), Haemophilus influenzae (Hempel et al. 2013), Yersinia enterocolitica (Kakoschke et al. 2014), Brucella melitensis (Cui et al. 2013), Salmonella enterica serovar Typhimurium (Behere et al. 2016), Pasteurella multocida (Mégroz et al. 2016), Xanthomonas campestris (Lai et al. 2018) and Bordetella pertussis (Hayes et al. 2020). With A. pleuropneumoniae, it has also been established that Hfq has a role in virulence. Both Zhou et al. (2008) and Subashchandrabose et al. (2013) demonstrated that A. pleuropneumoniae hfq mutants of serovar 1 strains Shope 4074 and AP 93-9, respectively, were less virulent in pigs. In addition, an hfq mutant of a clinical serovar 8 isolate, MIDG2331, was attenuated in the Galleria mellonella (wax moth) model of infection (Pereira et al. 2015). In vitro, the AP 93-9 serovar 1 hfq mutant was defective in biofilm formation and was more sensitive to superoxide stress (Subashchandrabose et al. 2013). In this study, we undertook a comparative analysis of the effect of hfq mutagenesis on three different serovars of A. pleuropneumoniae to determine if regulation of different Hfq phenotypes is serovar dependent. MATERIALS AND METHODS Bacterial strains, growth conditions and maintenance The A. pleuropneumoniae strains used in this study (listed in Table 1) were routinely grown at 37°C with 5% CO2 in brain heart infusion (BHI; Difco) broth and agar supplement with 10 µg/mL nicotinamide adenine dinucleotide (NAD; Sigma-Aldrich) and the E. coli strains in LB broth and agar. Chloramphenicol (1 or 20 µg/mL, for A. pleuropneumoniae and E. coli, respectively) or kanamycin (75 µg/mL) was added to the medium when required. Salt-free LB agar (10 g tryptone, 5 g yeast extract and 15 g agar per L) supplemented with 10% filter-sterilized sucrose, 10% horse serum (TCS Biosciences) and 10 µg/mL NAD (Sigma-Aldrich) was used for counter selection of A. pleuropneumoniae mutants, as previously described (Bossé et al. 2014). E. coli MFDpir (Ferrières et al. 2010) and Stellar (Clontech) strains were used in conjugation and transformation assays, respectively. Table 1. Strains and plasmids used in this study. Strains and plasmids . Description . Source or reference . A. pleuropneumoniae Serotype 1  Shope 4074 WT Shope 4074 WT ATCC 27 088  Ap1∆hfqcatsacB Δhfq mutant of Shope 4074 This study  Ap1∆hfqcatsacBC Complemented strain This study  Ap1hfq::3XFLAGcat WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 8  MIDG2331 WT Serotype 8 clinical isolate from UK (Bossé et al. 2016)  Ap8∆hfqa Δhfq mutant of MIDG2331 This study  Ap8∆hfqC Complemented strain This study  Ap8hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 15  HS143 WT HS143 WT (Blackall et al. 2002)  Ap15∆hfqcat Δhfq mutant This study  Ap15∆hqC Complemented strain This study  Ap15hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study E. coli  Stellar Competent cell: F–, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ (lacZYA—argF) U169, Δ (mrr-hsdRMS-mcrBC), ΔmcrA, λ– Takara  MFDpir Conjugative cell: MG1655 RP4-2-Tc::[ΔMu1::aac(3)IV- ΔaphA- Δnic35- ΔMu2::zeo] ΔdapA::(erm-pir) ΔrecA. Strain used to introduce pMIDG_hfq in A. pleuropneumoniae ∆hq strains. (Ferrières et al. 2010) Plasmids  pUSScatsac Template DNA for amplification of catsacB cassette which contains DNA uptake sequences for natural transformation into A. pleuropneumoniae. (Bossé et al. 2014)  pThfqFlank Plasmid pGEM-T containing 600 nucleotides upstream hfq gene, hfq gene and 600 nucleotides downstream hfq gene. This study  pT∆hfqcatsacB Plasmid pT∆hfq containing the hfq gene disrupted by catsacB cassette. This study  pThfq3XFLAG Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene. This study  pThfq3XFLAGcat Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene followed by the cat gene. This study  pThfq::3XFLAGcatsacB Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene disrupted by catsacB cassette. This study  pMIDG_hfq pMIDG plasmid (Bossé et al. 2009) containing the hfq gene under promoter inside of the miaA gene. Strain used to complement the ∆hfq strains. This study Strains and plasmids . Description . Source or reference . A. pleuropneumoniae Serotype 1  Shope 4074 WT Shope 4074 WT ATCC 27 088  Ap1∆hfqcatsacB Δhfq mutant of Shope 4074 This study  Ap1∆hfqcatsacBC Complemented strain This study  Ap1hfq::3XFLAGcat WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 8  MIDG2331 WT Serotype 8 clinical isolate from UK (Bossé et al. 2016)  Ap8∆hfqa Δhfq mutant of MIDG2331 This study  Ap8∆hfqC Complemented strain This study  Ap8hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 15  HS143 WT HS143 WT (Blackall et al. 2002)  Ap15∆hfqcat Δhfq mutant This study  Ap15∆hqC Complemented strain This study  Ap15hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study E. coli  Stellar Competent cell: F–, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ (lacZYA—argF) U169, Δ (mrr-hsdRMS-mcrBC), ΔmcrA, λ– Takara  MFDpir Conjugative cell: MG1655 RP4-2-Tc::[ΔMu1::aac(3)IV- ΔaphA- Δnic35- ΔMu2::zeo] ΔdapA::(erm-pir) ΔrecA. Strain used to introduce pMIDG_hfq in A. pleuropneumoniae ∆hq strains. (Ferrières et al. 2010) Plasmids  pUSScatsac Template DNA for amplification of catsacB cassette which contains DNA uptake sequences for natural transformation into A. pleuropneumoniae. (Bossé et al. 2014)  pThfqFlank Plasmid pGEM-T containing 600 nucleotides upstream hfq gene, hfq gene and 600 nucleotides downstream hfq gene. This study  pT∆hfqcatsacB Plasmid pT∆hfq containing the hfq gene disrupted by catsacB cassette. This study  pThfq3XFLAG Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene. This study  pThfq3XFLAGcat Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene followed by the cat gene. This study  pThfq::3XFLAGcatsacB Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene disrupted by catsacB cassette. This study  pMIDG_hfq pMIDG plasmid (Bossé et al. 2009) containing the hfq gene under promoter inside of the miaA gene. Strain used to complement the ∆hfq strains. This study a Although this mutant strain has been used in a previous study by our group (Pereira et al. 2015), this is the first description of the generation of the mutation. Open in new tab Table 1. Strains and plasmids used in this study. Strains and plasmids . Description . Source or reference . A. pleuropneumoniae Serotype 1  Shope 4074 WT Shope 4074 WT ATCC 27 088  Ap1∆hfqcatsacB Δhfq mutant of Shope 4074 This study  Ap1∆hfqcatsacBC Complemented strain This study  Ap1hfq::3XFLAGcat WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 8  MIDG2331 WT Serotype 8 clinical isolate from UK (Bossé et al. 2016)  Ap8∆hfqa Δhfq mutant of MIDG2331 This study  Ap8∆hfqC Complemented strain This study  Ap8hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 15  HS143 WT HS143 WT (Blackall et al. 2002)  Ap15∆hfqcat Δhfq mutant This study  Ap15∆hqC Complemented strain This study  Ap15hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study E. coli  Stellar Competent cell: F–, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ (lacZYA—argF) U169, Δ (mrr-hsdRMS-mcrBC), ΔmcrA, λ– Takara  MFDpir Conjugative cell: MG1655 RP4-2-Tc::[ΔMu1::aac(3)IV- ΔaphA- Δnic35- ΔMu2::zeo] ΔdapA::(erm-pir) ΔrecA. Strain used to introduce pMIDG_hfq in A. pleuropneumoniae ∆hq strains. (Ferrières et al. 2010) Plasmids  pUSScatsac Template DNA for amplification of catsacB cassette which contains DNA uptake sequences for natural transformation into A. pleuropneumoniae. (Bossé et al. 2014)  pThfqFlank Plasmid pGEM-T containing 600 nucleotides upstream hfq gene, hfq gene and 600 nucleotides downstream hfq gene. This study  pT∆hfqcatsacB Plasmid pT∆hfq containing the hfq gene disrupted by catsacB cassette. This study  pThfq3XFLAG Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene. This study  pThfq3XFLAGcat Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene followed by the cat gene. This study  pThfq::3XFLAGcatsacB Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene disrupted by catsacB cassette. This study  pMIDG_hfq pMIDG plasmid (Bossé et al. 2009) containing the hfq gene under promoter inside of the miaA gene. Strain used to complement the ∆hfq strains. This study Strains and plasmids . Description . Source or reference . A. pleuropneumoniae Serotype 1  Shope 4074 WT Shope 4074 WT ATCC 27 088  Ap1∆hfqcatsacB Δhfq mutant of Shope 4074 This study  Ap1∆hfqcatsacBC Complemented strain This study  Ap1hfq::3XFLAGcat WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 8  MIDG2331 WT Serotype 8 clinical isolate from UK (Bossé et al. 2016)  Ap8∆hfqa Δhfq mutant of MIDG2331 This study  Ap8∆hfqC Complemented strain This study  Ap8hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study Serotype 15  HS143 WT HS143 WT (Blackall et al. 2002)  Ap15∆hfqcat Δhfq mutant This study  Ap15∆hqC Complemented strain This study  Ap15hfq::3XFLAG WT containing a 3XFLAG tag replacing the last codon of the hfq gene. This study E. coli  Stellar Competent cell: F–, endA1, supE44, thi-1, recA1, relA1, gyrA96, phoA, Φ80d lacZΔ M15, Δ (lacZYA—argF) U169, Δ (mrr-hsdRMS-mcrBC), ΔmcrA, λ– Takara  MFDpir Conjugative cell: MG1655 RP4-2-Tc::[ΔMu1::aac(3)IV- ΔaphA- Δnic35- ΔMu2::zeo] ΔdapA::(erm-pir) ΔrecA. Strain used to introduce pMIDG_hfq in A. pleuropneumoniae ∆hq strains. (Ferrières et al. 2010) Plasmids  pUSScatsac Template DNA for amplification of catsacB cassette which contains DNA uptake sequences for natural transformation into A. pleuropneumoniae. (Bossé et al. 2014)  pThfqFlank Plasmid pGEM-T containing 600 nucleotides upstream hfq gene, hfq gene and 600 nucleotides downstream hfq gene. This study  pT∆hfqcatsacB Plasmid pT∆hfq containing the hfq gene disrupted by catsacB cassette. This study  pThfq3XFLAG Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene. This study  pThfq3XFLAGcat Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene followed by the cat gene. This study  pThfq::3XFLAGcatsacB Plasmid pGEM-T containing the hfq gene with a 3XFLAG tag in the region 3′ of the hfq gene disrupted by catsacB cassette. This study  pMIDG_hfq pMIDG plasmid (Bossé et al. 2009) containing the hfq gene under promoter inside of the miaA gene. Strain used to complement the ∆hfq strains. This study a Although this mutant strain has been used in a previous study by our group (Pereira et al. 2015), this is the first description of the generation of the mutation. Open in new tab Strain construction Unless otherwise stated, all PCRs were performed using CloneAmpTM HiFi PCR Premix (Takara), and genomic DNA from the serovar 8 strain MIDG2331 (Bossé et al. 2016) was used as the template for amplification of A. pleuropneumoniae products for cloning. For direct cloning into the T-vector, pGEM-T (Promega), products amplified with the CloneAmpTM HiFi polymerase were first A-tailed by incubation at 70°C for 30 minutes with 0.2 mM dATP and 5 U of Taq polymerase (Promega), according to manufacturer's instructions. All initial constructs were transformed into E. coli Stellar cells (Takara), according to manufacturer's protocol, with selection of clones on media containing chloramphenicol or kanamycin, as appropriate. A description of all primers used in this study is given in Table 2. Table 2. Primers used in this study. N° . Primer . Oligonucleotide sequence (5′ to 3′) . Description . 1 hfqflank_for TTCCGGTGGAAGTAATTAGCGTAGA For amplification of the hfq cassette. 2 hfqflank_rev ATATCCGCTTTCTGACGAGTTTTGC 3 cat_deltahfq ATCTTTACAAGATCCTACAAGCGGTCGGCAATAAGTTACC For amplification of catsacB cassette containing 15 bp overhangs (underlined) complimentary to pThfqFlank opened by inverse PCR with primers 5 and 6. 4 sac_deltahfq CGCAACCGCTTCAACGAATTGCGTGAAGCTCGAGGTATG 5 deltahfq_invcat TGCCGACCGCTTGTAGGATCTTGTAAAGATTGACCTTTTGC For inverse PCR of pThfqFlank to remove all but 59 bp of the hfq gene and adding 15 bp overhangs (underlined) complementary to the catsacB cassette generated with primers 3 and 4. 6 deltahfq_invsac AGCTTCACGCAATTCGTTGAAGCGGTTGCGGATAAAGC 7 deltahfq_1 CGCAACCGCTTCAACGGATCTTGTAAAGATTGACCTTTTGC For generation of ∆hfq construct. Addition of 15 bp overhangs (underlined) allow direct fusion of left flank amplified using primers 1 and 7 to right flank generated using primers 2 and 8. 8 deltahfq_2 ATCTTTACAAGATCCGTTGAAGCGGTTGCGGATAAAGC 9 FLAG_hfq GTTGCGGATAAAGCGGGTACCGACTACAAAGACCATGAC For amplification of the 3XxFLAG tag containing 15 bp overhangs (underlined) complementary to pThfqFlank opened by inverse PCR with primers 11 and 12. 10 FLAG_hflX TTGGTATCTGATCGGCTCCAGCCTACATTACTATTTATCG 11 hfq_inv1 CGCTTTATCCGCAACCGCTTCAAC For generation of pThfq::3XFLAG 12 hfq_inv2 CCGATCAGATACCAAATACAGATG 13 cat_FLAG TAATGTAGGCTGGAGGTACAAGCGGTCGGCAATAGTTACC For amplification of the cat cassette containing 15 bp overhangs (underlined) complimentary to 3XFLAG and pThfqFlank opened by inverse PCR with primers 11 and 12. 14 cat_hflX TTGGTATCTGATCGGGAAGTGCGGTATGCCGTCTGAAC 15 FLAG_cat GCCGACCGCTTGTACCTCCAGCCTACATTACTATTTATCG For amplification, in combination with primer 9, of the 3xFLAG cassette containing 15 bp overhangs (underlined) complementary to cat cassette and pThfqFlank opened by inverse PCR with primers 11 and 12. 16 hflX_for CACGAGCTTAGTCCGTCACA For RT-PCR analysis of hflX expression. 17 hflX_rev AATGCTACCCGCTGTATGCT 18 miaA_ for TAATGGGTCCAACGGCTTCG For RT-PCR analysis of miaA expression. 19 miaA_rev CACTGTTCCAACCTCGCAGCCAAG 20 EcoRI_hfq GCGCGAATTCAGGAAAAGAAAATGGCAAAAGGTCAATCT For RT-PCR analysis of hfq expression. 21 hfq_SacI GCGCGAGCTCATTATTCCGCTTTATCCGCAACCGC 22 hfqMIDG_for GCTCAAGCTTCGAATTCGAGCTTGCCCCTCACCGCTTGATTG For amplification of hfq gene with its own promoter region and containing 15 bp overhangs complementary to pMIDG100 cut with EcoRI and BstBI. 23 hfqMIDG_rev TTGGGATCTTTCGAAGCGTTTTCATCTGTATTTGGTATCTG N° . Primer . Oligonucleotide sequence (5′ to 3′) . Description . 1 hfqflank_for TTCCGGTGGAAGTAATTAGCGTAGA For amplification of the hfq cassette. 2 hfqflank_rev ATATCCGCTTTCTGACGAGTTTTGC 3 cat_deltahfq ATCTTTACAAGATCCTACAAGCGGTCGGCAATAAGTTACC For amplification of catsacB cassette containing 15 bp overhangs (underlined) complimentary to pThfqFlank opened by inverse PCR with primers 5 and 6. 4 sac_deltahfq CGCAACCGCTTCAACGAATTGCGTGAAGCTCGAGGTATG 5 deltahfq_invcat TGCCGACCGCTTGTAGGATCTTGTAAAGATTGACCTTTTGC For inverse PCR of pThfqFlank to remove all but 59 bp of the hfq gene and adding 15 bp overhangs (underlined) complementary to the catsacB cassette generated with primers 3 and 4. 6 deltahfq_invsac AGCTTCACGCAATTCGTTGAAGCGGTTGCGGATAAAGC 7 deltahfq_1 CGCAACCGCTTCAACGGATCTTGTAAAGATTGACCTTTTGC For generation of ∆hfq construct. Addition of 15 bp overhangs (underlined) allow direct fusion of left flank amplified using primers 1 and 7 to right flank generated using primers 2 and 8. 8 deltahfq_2 ATCTTTACAAGATCCGTTGAAGCGGTTGCGGATAAAGC 9 FLAG_hfq GTTGCGGATAAAGCGGGTACCGACTACAAAGACCATGAC For amplification of the 3XxFLAG tag containing 15 bp overhangs (underlined) complementary to pThfqFlank opened by inverse PCR with primers 11 and 12. 10 FLAG_hflX TTGGTATCTGATCGGCTCCAGCCTACATTACTATTTATCG 11 hfq_inv1 CGCTTTATCCGCAACCGCTTCAAC For generation of pThfq::3XFLAG 12 hfq_inv2 CCGATCAGATACCAAATACAGATG 13 cat_FLAG TAATGTAGGCTGGAGGTACAAGCGGTCGGCAATAGTTACC For amplification of the cat cassette containing 15 bp overhangs (underlined) complimentary to 3XFLAG and pThfqFlank opened by inverse PCR with primers 11 and 12. 14 cat_hflX TTGGTATCTGATCGGGAAGTGCGGTATGCCGTCTGAAC 15 FLAG_cat GCCGACCGCTTGTACCTCCAGCCTACATTACTATTTATCG For amplification, in combination with primer 9, of the 3xFLAG cassette containing 15 bp overhangs (underlined) complementary to cat cassette and pThfqFlank opened by inverse PCR with primers 11 and 12. 16 hflX_for CACGAGCTTAGTCCGTCACA For RT-PCR analysis of hflX expression. 17 hflX_rev AATGCTACCCGCTGTATGCT 18 miaA_ for TAATGGGTCCAACGGCTTCG For RT-PCR analysis of miaA expression. 19 miaA_rev CACTGTTCCAACCTCGCAGCCAAG 20 EcoRI_hfq GCGCGAATTCAGGAAAAGAAAATGGCAAAAGGTCAATCT For RT-PCR analysis of hfq expression. 21 hfq_SacI GCGCGAGCTCATTATTCCGCTTTATCCGCAACCGC 22 hfqMIDG_for GCTCAAGCTTCGAATTCGAGCTTGCCCCTCACCGCTTGATTG For amplification of hfq gene with its own promoter region and containing 15 bp overhangs complementary to pMIDG100 cut with EcoRI and BstBI. 23 hfqMIDG_rev TTGGGATCTTTCGAAGCGTTTTCATCTGTATTTGGTATCTG Open in new tab Table 2. Primers used in this study. N° . Primer . Oligonucleotide sequence (5′ to 3′) . Description . 1 hfqflank_for TTCCGGTGGAAGTAATTAGCGTAGA For amplification of the hfq cassette. 2 hfqflank_rev ATATCCGCTTTCTGACGAGTTTTGC 3 cat_deltahfq ATCTTTACAAGATCCTACAAGCGGTCGGCAATAAGTTACC For amplification of catsacB cassette containing 15 bp overhangs (underlined) complimentary to pThfqFlank opened by inverse PCR with primers 5 and 6. 4 sac_deltahfq CGCAACCGCTTCAACGAATTGCGTGAAGCTCGAGGTATG 5 deltahfq_invcat TGCCGACCGCTTGTAGGATCTTGTAAAGATTGACCTTTTGC For inverse PCR of pThfqFlank to remove all but 59 bp of the hfq gene and adding 15 bp overhangs (underlined) complementary to the catsacB cassette generated with primers 3 and 4. 6 deltahfq_invsac AGCTTCACGCAATTCGTTGAAGCGGTTGCGGATAAAGC 7 deltahfq_1 CGCAACCGCTTCAACGGATCTTGTAAAGATTGACCTTTTGC For generation of ∆hfq construct. Addition of 15 bp overhangs (underlined) allow direct fusion of left flank amplified using primers 1 and 7 to right flank generated using primers 2 and 8. 8 deltahfq_2 ATCTTTACAAGATCCGTTGAAGCGGTTGCGGATAAAGC 9 FLAG_hfq GTTGCGGATAAAGCGGGTACCGACTACAAAGACCATGAC For amplification of the 3XxFLAG tag containing 15 bp overhangs (underlined) complementary to pThfqFlank opened by inverse PCR with primers 11 and 12. 10 FLAG_hflX TTGGTATCTGATCGGCTCCAGCCTACATTACTATTTATCG 11 hfq_inv1 CGCTTTATCCGCAACCGCTTCAAC For generation of pThfq::3XFLAG 12 hfq_inv2 CCGATCAGATACCAAATACAGATG 13 cat_FLAG TAATGTAGGCTGGAGGTACAAGCGGTCGGCAATAGTTACC For amplification of the cat cassette containing 15 bp overhangs (underlined) complimentary to 3XFLAG and pThfqFlank opened by inverse PCR with primers 11 and 12. 14 cat_hflX TTGGTATCTGATCGGGAAGTGCGGTATGCCGTCTGAAC 15 FLAG_cat GCCGACCGCTTGTACCTCCAGCCTACATTACTATTTATCG For amplification, in combination with primer 9, of the 3xFLAG cassette containing 15 bp overhangs (underlined) complementary to cat cassette and pThfqFlank opened by inverse PCR with primers 11 and 12. 16 hflX_for CACGAGCTTAGTCCGTCACA For RT-PCR analysis of hflX expression. 17 hflX_rev AATGCTACCCGCTGTATGCT 18 miaA_ for TAATGGGTCCAACGGCTTCG For RT-PCR analysis of miaA expression. 19 miaA_rev CACTGTTCCAACCTCGCAGCCAAG 20 EcoRI_hfq GCGCGAATTCAGGAAAAGAAAATGGCAAAAGGTCAATCT For RT-PCR analysis of hfq expression. 21 hfq_SacI GCGCGAGCTCATTATTCCGCTTTATCCGCAACCGC 22 hfqMIDG_for GCTCAAGCTTCGAATTCGAGCTTGCCCCTCACCGCTTGATTG For amplification of hfq gene with its own promoter region and containing 15 bp overhangs complementary to pMIDG100 cut with EcoRI and BstBI. 23 hfqMIDG_rev TTGGGATCTTTCGAAGCGTTTTCATCTGTATTTGGTATCTG N° . Primer . Oligonucleotide sequence (5′ to 3′) . Description . 1 hfqflank_for TTCCGGTGGAAGTAATTAGCGTAGA For amplification of the hfq cassette. 2 hfqflank_rev ATATCCGCTTTCTGACGAGTTTTGC 3 cat_deltahfq ATCTTTACAAGATCCTACAAGCGGTCGGCAATAAGTTACC For amplification of catsacB cassette containing 15 bp overhangs (underlined) complimentary to pThfqFlank opened by inverse PCR with primers 5 and 6. 4 sac_deltahfq CGCAACCGCTTCAACGAATTGCGTGAAGCTCGAGGTATG 5 deltahfq_invcat TGCCGACCGCTTGTAGGATCTTGTAAAGATTGACCTTTTGC For inverse PCR of pThfqFlank to remove all but 59 bp of the hfq gene and adding 15 bp overhangs (underlined) complementary to the catsacB cassette generated with primers 3 and 4. 6 deltahfq_invsac AGCTTCACGCAATTCGTTGAAGCGGTTGCGGATAAAGC 7 deltahfq_1 CGCAACCGCTTCAACGGATCTTGTAAAGATTGACCTTTTGC For generation of ∆hfq construct. Addition of 15 bp overhangs (underlined) allow direct fusion of left flank amplified using primers 1 and 7 to right flank generated using primers 2 and 8. 8 deltahfq_2 ATCTTTACAAGATCCGTTGAAGCGGTTGCGGATAAAGC 9 FLAG_hfq GTTGCGGATAAAGCGGGTACCGACTACAAAGACCATGAC For amplification of the 3XxFLAG tag containing 15 bp overhangs (underlined) complementary to pThfqFlank opened by inverse PCR with primers 11 and 12. 10 FLAG_hflX TTGGTATCTGATCGGCTCCAGCCTACATTACTATTTATCG 11 hfq_inv1 CGCTTTATCCGCAACCGCTTCAAC For generation of pThfq::3XFLAG 12 hfq_inv2 CCGATCAGATACCAAATACAGATG 13 cat_FLAG TAATGTAGGCTGGAGGTACAAGCGGTCGGCAATAGTTACC For amplification of the cat cassette containing 15 bp overhangs (underlined) complimentary to 3XFLAG and pThfqFlank opened by inverse PCR with primers 11 and 12. 14 cat_hflX TTGGTATCTGATCGGGAAGTGCGGTATGCCGTCTGAAC 15 FLAG_cat GCCGACCGCTTGTACCTCCAGCCTACATTACTATTTATCG For amplification, in combination with primer 9, of the 3xFLAG cassette containing 15 bp overhangs (underlined) complementary to cat cassette and pThfqFlank opened by inverse PCR with primers 11 and 12. 16 hflX_for CACGAGCTTAGTCCGTCACA For RT-PCR analysis of hflX expression. 17 hflX_rev AATGCTACCCGCTGTATGCT 18 miaA_ for TAATGGGTCCAACGGCTTCG For RT-PCR analysis of miaA expression. 19 miaA_rev CACTGTTCCAACCTCGCAGCCAAG 20 EcoRI_hfq GCGCGAATTCAGGAAAAGAAAATGGCAAAAGGTCAATCT For RT-PCR analysis of hfq expression. 21 hfq_SacI GCGCGAGCTCATTATTCCGCTTTATCCGCAACCGC 22 hfqMIDG_for GCTCAAGCTTCGAATTCGAGCTTGCCCCTCACCGCTTGATTG For amplification of hfq gene with its own promoter region and containing 15 bp overhangs complementary to pMIDG100 cut with EcoRI and BstBI. 23 hfqMIDG_rev TTGGGATCTTTCGAAGCGTTTTCATCTGTATTTGGTATCTG Open in new tab The Δhfq and hfq::3XFLAG strains of A. pleuropneumoniae serovars 8 and 15, and the Ap1∆hfqcatsacB and Ap1hfq::3XFLAGcat strains of serovar 1, were obtained using the previously described natural transformation technique (Bossé et al. 2014). Briefly, the sequence comprising the hfq gene, and ∼600 bp to either side, was amplified using primers 1 and 2 (Table 2), A-tailed and cloned in pGEM-T (Promega), resulting in pThfqFlank. A selection/counterselection cassette, catsacB, was amplified from pUSScatsac (Bossé et al. 2014) using primers 3 and 4. pThfqFlank was opened by inverse PCR using primers 5 and 6 designed with 15 bp overhangs to allow In-Fusion (Takara) cloning, according to manufacturer's instructions, of the catsacB cassette in place of the deleted hfq gene to generate plasmid pTΔhfqcatsacB. This plasmid was transformed into A. pleuropneumoniae serovars 1, 8 and 15 to obtain ΔhfqcatsacB mutants, as previously described (Bossé et al. 2014). An unmarked deletion construct was made by amplifying the flanking regions to either side of hfq, using primers 1 and 7 for the left flank, and 2 and 8 for the right flank. Primers 7 and 8 contain 15 bp overhangs to allow direct fusion of the two amplicons by over-lap extension (OE) PCR (Bossé et al. 2014). The OE PCR product was cloned into pGEM-T (Promega), resulting in pTΔhfq. A construct containing hfq with a 3′ fusion to a 3XFLAG tag (3x GAT TAC AAG GAT GAC GAT GAC AGG) was also generated. The 3XFLAG tag was amplified from pDOC-F (accession number GQ889496), a generous gift from S. Wigneshweraraj, using primers 9 and 10. The pThfqFlank construct was opened by inverse PCR using primers 11 and 12, and the 3XFLAG amplicon was inserted by In-Fusion cloning, creating pThfq::3XFLAG. To obtain the unmarked Δhfq and hfq::3XFLAG mutant strains, the ΔhfqcatsacB mutants were subjected to a second natural transformation with linearized plasmids, either pTΔhfq or pThfq::3XFLAG, with counterselection on LB-SSN plates (Bossé et al. 2014). As counterselection with the unmarked deletion constructs was not successful with the Ap1ΔhfqcatsacB mutant, an alternate construct, pThfq::3XFLAGcat, was used to obtain the FLAG-tagged mutant. Primers 13 and 14 were used for amplification of the cat cassette of plasmid pUSScatsac. The 3xFLAG tag was amplified from pDOC-F using primers 9 and 15. Primers 14 and 15 contain 15 bp overhangs to allow direct fusion of the two amplicons by OE PCR, as above. The pThfqFlank construct was opened by inverse PCR using primers 11 and 12, and the 3xFLAGcat amplicon was inserted by In-Fusion cloning, creating pThfq::3XFLAGcat. This plasmid was transformed, as previously described (Bossé et al. 2014), into A. pleuropneumoniae serovar 1 to obtain the Ap1Δhfq::3XFLAGcat mutant. Deletion of hfq, or the presence of FLAG-tagged hfq, in the chromosome of respective mutants was confirmed by PCR and sequencing using primers 1 and 2. RT-PCR analysis using cDNA from both WT and Δhfq mutant strains was performed with primer pairs 16 and 17, 18 and 19, as well as 20 and 21 (for detection of expression of hflX, miaA and hfq, respectively) in order to confirm that deletion of hfq did not affect expression of the flanking genes. As a positive control for each primer pair, gDNA from the WT strain was used. The presence of expressed FLAG-tagged Hfq was confirmed by Western blot using anti-FLAG antibodies (see below). Hfq promoter analysis and mutation complementation For a better understanding of the promoter(s) involved in the transcription of the hfq gene, a prediction of the hfq operon was performed using DOOR (Database for prOkaryotic OpeRons) (Mao et al. 2009), followed by prediction of promoters using BPROM (Solovyev, Shahmuradov and Salamov 2010) and visual analysis of the sequences. Complementation of the Δhfq mutants was achieved by cloning the hfq gene, with three of the predicted endogenous promoters, into the low copy plasmid pMIDG100 (O'Dwyer et al. 2004; Bossé et al. 2009). Primers 22 and 23 were used to amplify the sequence from 850 bp upstream, to 72 bp downstream, of hfq. The vector pMIDG100 was digested with EcoRI and BstBI (New England Biolabs) and the 1.2 kb PCR product was inserted using In-Fusion cloning, as above. The plasmid pMIDG_hfq was transformed into E. coli MFDpir (Ferrières et al. 2010) with selection on LB agar containing kanamycin (75 µg/mL), prior to conjugation into the A. pleuropneumoniae Δhfq strains to obtain the complemented (ΔhfqC) strains. Confirmation of the presence of the gene was performed by PCR and sequencing of the intact gene using the same primers described above. Growth rate and Hfq expression For growth curves, the A. pleuropneumoniae WT and mutant strains were cultivated in 20 mL of broth in Erlenmeyer flasks incubated at 37°C for 24 h with agitation (180 rpm). Optical density at 600 nm (OD600) was measured every hour for the first 12 h, and then at 24 h, using an Ultrospec 10 (GE Healthcare Life Sciences). In order to verify expression of Hfq during growth in broth culture, each of the three serovar hfq::3XFLAG strains were inoculated into 200 mL of broth (initial OD600 0.01) and then aliquoted into seven flasks of 20 mL each. At time points (1, 2, 3, 4, 6, 8 and 12 h), one of each serovar culture was centrifuged at 9000x g, and the resulting pellets were re-suspended in 1 mL of lysis buffer (20 mM Tris-HCl, 1 mM EDTA and pH 7.4) and disrupted by mechanical lysis using Matrix B tubes (MP Biomedicals). For each sample, 10 µg of soluble protein were applied to wells of 4%–12% NuPAGE Bolt BisTris Plus (Life Technologies—BG04120BOX) gels. Following electrophoretic separation, the proteins were transferred to nitrocellulose membrane (iBlot 2 NC Regular Stacks; Life Technologies—IB23001) using the iBlot 2 system (Life Technologies—IB21001). The membrane was processed, as previously described (Beddek et al. 2004), using an anti-FLAG monoclonal (Sigma) as the primary antibody, and detection using ECLTM Western blotting detection reagents (GE Healthcare) and Hyperfilm ECL (GE Healthcare). Bacterial adhesion Bacterial adhesion to three different surfaces was investigated. Adhesion to epithelial A549 cells was determined as previously described by Cuccui et al. (2017), and adherence to polystyrene microtiter plates (Kasvi—K12-096) following growth for 24 h at 37°C was visualized using crystal violet, as described by Kaplan and Mulks (2005). For the third adhesion assay, strains were inoculated in vials containing 1 cm2 steel coupons, as described previously by Moen et al. (2015). Briefly, the vials were incubated at 37°C for a period of 24 h. Cultures were then fixed to the steel coupons with 2.5% glutaraldehyde in 0.05 M phosphate buffered saline (PBS) and dehydrated in a graded ethanol series up to 100%. The cells were dried using a CPD 030 critical point dryer (Bal-Tec) and shadowed with gold using a Sputter Coater (Electron Microscopy Sciences) prior to visualization with a scanning electron microscope (VP1430; LEO). Stress tolerance The following agents and their concentrations were used in BHI-NAD agar to investigate the sensitivity of the Δhfq strains to different stress conditions: 1.5% NaCl; pH 6.0 and 6.5 (adjusted using HCl); 1.25 mM H2O2; 4% ethanol; and cultivation at 42°C. Bacterial cultures with initial OD600 of 1.0 were serially diluted in PBS to 10−7, and 10 µL of each 10-fold dilution were applied on each selective stress agar in square plates (688 102; Greiner Bio-One). As control, cultures were similarly plated on BHI-NAD agar containing no stress agent. All plates were cultured at 37°C, except the temperature stress plate, which was incubated at 42°C. The growth of strains was compared between the control and test plates. Virulence in G. mellonella The Galleria mellonella larvae used in this study were reared in our laboratory, kept at 28°C in darkness and fed an artificial diet. On the day of the experiment, last-instar larvae, each weighing 250–300 mg, were selected and kept in the same environmental conditions until inoculation, following our previously described methods (Pereira et al. 2015; Pereira et al. 2018, Blanco et al. 2017). Briefly, A. pleuropneumoniae cultures were grown to mid-exponential phase and inocula consisting of 10 µl of serially diluted cell suspensions, varying from 103 to 107 CFU per larva (n = 10 larvae per dilution), were injected into the haemocoel of the first right pro-leg. The larvae were incubated at 37°C, in the dark, and analyzed according to survival at 24, 48, 72 and 96 h post infection. Larvae were considered as dead if they did not respond to touch stimuli. Survival curves were plotted using the Kaplan-Meier method (Goel, Khanna and Kishore 2010). For the evaluation of bacterial load, the larval haemolymph was collected at 0, 1, 2, 4 and 24 h after infection. Thereafter, the CFU/mL were determined. Larvae inoculated with PBS were used as negative controls for the assay. Statistical analysis Data from growth curves and adhesion to A549 cells and polystyrene microtiter plates were analyzed by Tukey's test used to compare means using R v.2.13.0. The differences in G. mellonella survival were calculated by using the log-rank test using R v.2.13.0. A P < 0.05 was considered to be statistically significant. All the assays were done in experimental and biologic triplicates. RESULTS Construction A. pleuropneumoniae hfq mutants As previously reported (Subashchandrabose et al. 2013), the hfq gene in A. pleuropneumoniae is located in the miaA-hfq-hflX locus, as it is in E. coli (Tsui, Leung and Winkler 1994). This locus is shown in Fig. 1A, with all detected promoters indicated, as well as locations of the priming sites used for PCR amplification of products used to construct the various plasmids. In order to determine the role of Hfq in A. pleuropneumoniae serovars 1, 8 and 15, we generated isogenic mutants lacking 220 nucleotides, leaving a truncated hfq gene having only 29 nucleotides in the 5′ region and 30 nucleotides in the 3′ region. Clean deletion mutants were generated for serovars 8 and 15, whereas counter selection was not successful with the serovar 1 mutant, leaving the catsacB insertion in place of the deleted 220 bases. In order to aid in evaluation of Hfq expression under stress conditions, we also generated isogenic strains where the native hfq was replaced with hfq additionally encoding a C-terminal 3XFLAG tag (followed by the cat gene in the serovar 1 strain). Absence of any polar effects on miaA and hflX expression in the ∆hfq mutants was confirmed by RT-PCR, with representative results for serovar 8 shown in Fig. 1B. Expression of Hfq by the serovar 1, 8 and 15 Hfq::3XFLAG strains during growth in broth culture was confirmed by Western blotting (Fig. 1C). Figure 1. Open in new tabDownload slide Generation and confirmation of hfq mutant strains. (A) Genomic organization of the miaA, hfq and hflX genes in A. pleuropneumoniae. Predicted promoter sequences are indicated by the bent arrows labelled P1 to P4, and a predicted transcriptional terminator is indicated by a stem-loop structure downstream of hfq. The primers used in mutant construction, cloning and RT-PCR, are represented by arrows bellow their targets, numbered according to their identification in Table 2. (B) RT-PCR analysis of possible polar effects due to deletion of hfq, showing representative results for MIDG2331. PCR was performed with the products of cDNA synthesis from RNA template of either the WT or ∆hfq strain (as indicated), both with (RT+) and without (RT-) the addition of reverse transcriptase. Note that the genomic DNA (gDNA) control used to confirm primer function and product size for each primer pair was from the WT strain only, thus a product for hfq amplification is seen as a comparison for the lack of amplification by RT-PCR from the ∆hfq strain. Amplification of the target sequences in hfq, miaA and hflX was achieved with the primer pairs 20/21, 18/19 and 16/17, respectively. M = molecular weight marker (DNA Marker Quick-load 100bp DNA ladder, Neb Biolabs). (C) Western blot showing the detection of the 14 kDa Hfq::3XFLAG protein. For each hfq::3XFLAG strain of A. pleuropneumoniae serovars 1 (Ap1), 8 (Ap8) and 15 (Ap15), ten micrograms of soluble protein from early stationary phase culture were separated by SDS-PAGE and transferred to nitrocellulose membrane for detection using an anti-Flag antibody. The molecular weight marker lane (M = SeeBlue Plus2; Invitrogen) from the corresponding stained gel is shown next to the blot. Figure 1. Open in new tabDownload slide Generation and confirmation of hfq mutant strains. (A) Genomic organization of the miaA, hfq and hflX genes in A. pleuropneumoniae. Predicted promoter sequences are indicated by the bent arrows labelled P1 to P4, and a predicted transcriptional terminator is indicated by a stem-loop structure downstream of hfq. The primers used in mutant construction, cloning and RT-PCR, are represented by arrows bellow their targets, numbered according to their identification in Table 2. (B) RT-PCR analysis of possible polar effects due to deletion of hfq, showing representative results for MIDG2331. PCR was performed with the products of cDNA synthesis from RNA template of either the WT or ∆hfq strain (as indicated), both with (RT+) and without (RT-) the addition of reverse transcriptase. Note that the genomic DNA (gDNA) control used to confirm primer function and product size for each primer pair was from the WT strain only, thus a product for hfq amplification is seen as a comparison for the lack of amplification by RT-PCR from the ∆hfq strain. Amplification of the target sequences in hfq, miaA and hflX was achieved with the primer pairs 20/21, 18/19 and 16/17, respectively. M = molecular weight marker (DNA Marker Quick-load 100bp DNA ladder, Neb Biolabs). (C) Western blot showing the detection of the 14 kDa Hfq::3XFLAG protein. For each hfq::3XFLAG strain of A. pleuropneumoniae serovars 1 (Ap1), 8 (Ap8) and 15 (Ap15), ten micrograms of soluble protein from early stationary phase culture were separated by SDS-PAGE and transferred to nitrocellulose membrane for detection using an anti-Flag antibody. The molecular weight marker lane (M = SeeBlue Plus2; Invitrogen) from the corresponding stained gel is shown next to the blot. Growth rate and Hfq expression Only the Ap1∆hfqstrain had a reduced growth rate in BHI-NAD, and the complemented Ap8∆hfqC strain had a prolonged lag phase, compared to its isogenic WT strain, which was significant using the Tukey's test (P < 0.05) (Fig. 2A). Western blot results for the FLAG-tagged mutants of each serovar showed that Hfq expression was detectable at all time points assayed (Fig. 2B), with apparent slight increase in Hfq expression for the Ap8hfq::3XFLAG and Ap15hfq::3XFLAG, but not Ap1hfq::3XFLAG strains over the time course. Figure 2. Open in new tabDownload slide Growth of A. pleuropneumoniae WT, hfq mutants and complemented strains. (A) Growth curve of A. pleuropneumoniae serovars 1, 8 and 15 strains. (B) Hfq::3XFLAG expression analysis during the growth curve of the A. pleuropneumoniae strains. WT, hfq::3XFLAG (strain that express Hfq::3XFLAG), Δhfq (hfq mutant), ΔhfqC (complemented strain). Error bars are shown for all points in the graphs, but may not be visible in some cases. Figure 2. Open in new tabDownload slide Growth of A. pleuropneumoniae WT, hfq mutants and complemented strains. (A) Growth curve of A. pleuropneumoniae serovars 1, 8 and 15 strains. (B) Hfq::3XFLAG expression analysis during the growth curve of the A. pleuropneumoniae strains. WT, hfq::3XFLAG (strain that express Hfq::3XFLAG), Δhfq (hfq mutant), ΔhfqC (complemented strain). Error bars are shown for all points in the graphs, but may not be visible in some cases. Bacterial adhesion The WT strains of the different serovars tested showed marked differences in adhesion to A549 epithelial cells, with serovar 8 being most, and serovar 15 least, adherent (Fig. 3A). Reduction of adherence was significant for the Ap1Δhfq and Ap15Δhfq strains (P < 0.05), but not Ap8Δhfq, relative to their isogenic WT strains (Fig. 3A). Instead of restoring WT levels, expression of hfq from the complementation vector further reduced adherence for all serovars (Fig. 3A), though the difference was only significant for Ap15ΔhfqC (P < 0.05). All Δhfq mutants had reduced adhesion to polystyrene compared to their WT strains (P < 0.05) (Fig. 3B), with the Ap8Δhfq strain showing the greatest reduction. In contrast to the assay using A549 epithelial cells, all of the complemented strains showed increased adhesion to polystyrene compared to their respective Δhfq mutants, however these increases were not significant and did not restore WT levels. The images of steel coupons obtained by electron microscopy indicated that all Δhfq strains had lower adherence capacity to this surface than their respective WT strains (Fig. 3C). This was particularly marked with Ap1Δhfq where there were, in contrast to WT, few adherent cells, with clear complementation in the Ap1ΔhfqC strain. Although adherence of the Ap8Δhfq and Ap15Δhfq mutants was not completely abolished, complementation did not restore WT levels (Fig. 3C). Figure 3. Open in new tabDownload slide Effect of Hfq on adherence of A. pleuropneumoniae serovars 1, 8 and 15 to biotic and abiotic surfaces. (A) The adherence to eukaryotic cells. (B) The adherence to polystyrene microplate was examined by crystal violet reading in OD600 and the adherence capacity was determined according to WT strains. (C) The adherence to steel coupons was examined by scanning electron microscopy. Bars: 10 µm. Different letters inside of the Fig represent statistical significance difference among the strains in relation the cell length. The statistical analysis was performed using Tukey's test with P < 0.05. All the assays were conducted in experimental and biological triplicates. WT, Δhfq (hfq mutant), ΔhfqC (complemented strain). Figure 3. Open in new tabDownload slide Effect of Hfq on adherence of A. pleuropneumoniae serovars 1, 8 and 15 to biotic and abiotic surfaces. (A) The adherence to eukaryotic cells. (B) The adherence to polystyrene microplate was examined by crystal violet reading in OD600 and the adherence capacity was determined according to WT strains. (C) The adherence to steel coupons was examined by scanning electron microscopy. Bars: 10 µm. Different letters inside of the Fig represent statistical significance difference among the strains in relation the cell length. The statistical analysis was performed using Tukey's test with P < 0.05. All the assays were conducted in experimental and biological triplicates. WT, Δhfq (hfq mutant), ΔhfqC (complemented strain). Stress tolerance We investigated the responses of A. pleuropneumoniae serovars 1, 8 and 15, and their respective Δhfq mutants, to a variety of stress inducing agents or physical stress (higher temperature) whilst growing on BHI-NAD-agar plates, as shown in Fig. 4. The WT strains of serovars 1, 8 and 15 showed different levels of resistance to the different stresses, with serovar 8 being more sensitive to NaCl, and serovar 15 being more resistant to ethanol, but more sensitive to elevated temperature (42°C) and pH 6.0, than the other serovars. Furthermore, the respective Δhfq mutants also showed differences. Unlike Ap8Δhfq, no growth of Ap1Δhfq and Ap15Δhfqwas found in the presence of 1.25 mM H2O2. Compared to the WT strains, all Δhfq mutants were more sensitive to 1.5% NaCl, although with differing degrees of growth reduction. Ap8Δhfq and Ap15Δhfq were sensitive to the presence of ethanol, whereas only Ap15Δhfq showed a slight reduction in growth at 42°C. Ap1Δhfq and Ap15Δhfq, in contrast to Ap8Δhfq, were more sensitive to growth at pH 6.5 than their WT strains. Except in the case of the serovar 8 WT and mutant strains grown in the presence of NaCl, restoration of WT levels of growth was achieved by complementation for all other conditions where deletion of hfq resulted in increased sensitivity. Figure 4. Open in new tabDownload slide Effect of Hfq on stress tolerance in A. pleuropneumoniae serovars 1, 8 and 15. Exponentially growing A. pleuropneumoniae strains (OD600 = 1.0; ̴ 108 cell/mL) were exposed to different stress conditions: oxidative (1.25 mM H2O2), osmotic (1.5% NaCl), alcoholic (4% ethanol), temperature (42°C) and pH (6.5 and 6.0). As control, the strains were grown in BHI-NAD-agar at 37°C, 5% CO2 and no stressor agent. The numbers 1, 2 and 3 indicate the WT, ∆hfq (hfq mutant) and ∆hfqC (complemented strain), respectively. Figure 4. Open in new tabDownload slide Effect of Hfq on stress tolerance in A. pleuropneumoniae serovars 1, 8 and 15. Exponentially growing A. pleuropneumoniae strains (OD600 = 1.0; ̴ 108 cell/mL) were exposed to different stress conditions: oxidative (1.25 mM H2O2), osmotic (1.5% NaCl), alcoholic (4% ethanol), temperature (42°C) and pH (6.5 and 6.0). As control, the strains were grown in BHI-NAD-agar at 37°C, 5% CO2 and no stressor agent. The numbers 1, 2 and 3 indicate the WT, ∆hfq (hfq mutant) and ∆hfqC (complemented strain), respectively. Virulence in G. mellonella The results of the virulence assay using the G. mellonella infection model are shown in Fig. 5. The concentration of 1.0 × 105 CFU per larva was chosen for graphic representation, as it was found to be the best dose to allow visualization of the differences in the virulence profiles between WT, Δhfq and ΔhfqC for each serovar. At 24 h, larvae inoculated with serovar 1 strains showed 4% survival for the WT, 22% for Δhfq and 25% for ΔhfqC indicating that the serovar 1 WT was highly virulent in this infection model, and the Δhfq mutant only slightly attenuated compared to the WT (P < 0.05), but complementation did not restore the WT level of virulence (Fig. 1A). Similar survival rates were found at 96 h. The serovar 8 WT strain was not as virulent as the serovar 1 WT, with survival of G. mellonella of 60% at 24 h, and 26% at 96 h (Fig. 1A). However, the Ap8Δhfq mutant was fully attenuated, with 100% survival of G. mellonella through the 96 h test period. Partial complementation was seen for Ap8ΔhfqC, with 51% survival of G. mellonella at 96 h. The serovar 15 WT did not appear to be virulent in the G. mellonella infection model (over 90% survival through 96 h), and no difference was seen for the AP15Δhfq and AP15ΔhfqC strains (Fig. 1A). Analysis of bacterial load also showed a similar decrease over time in the larvae infected with the serovar 15 WT, Δhfq and ΔhfqC strains (Fig. 5B). The Ap1Δhfq and Ap8Δhfq strains both showed a five-log decrease in the number of colonies per larva in the course of 24 h, and few bacterial (approximately 101) cells were observed in the haemolymph after of 24 h of the experiment (Fig. 5B). In contrast, larvae infected with the serovar 1 and 8 WT strains showed an increase of bacterial load between 1 and 4 h, followed by less than a two-log reduction by 24 h post-infection. In contrast to the results for the G. mellonella survival assay, the Ap1ΔhfqC showed partial, whereas the Ap8ΔhfqC showed no, complementation in regard to bacterial load. Figure 5. Open in new tabDownload slide Effect of Hfq on the virulence of A. pleuropneumoniae serovars 1, 8 and 15 in G. mellonella. (A) Killing was monitored after larval infection with 1 × 105 CFU of WT, Δhfq and ΔhfqC A. pleuropneumoniae strains from serovars 1, 8 and 15. The virulence attenuation was verified in the Δhfq strains of serovars 1 and 8 (P < 0,05). (B) Determining of the bacterial load in G. mellonella hemolymph at 0, 1, 2, 4 and 24 h of the assay of (A) in three biological replicates. Larvae inoculated with PBS 1X were used as negative control. WT, Δhfq (hfq mutant) and ΔhfqC (complemented strain). Figure 5. Open in new tabDownload slide Effect of Hfq on the virulence of A. pleuropneumoniae serovars 1, 8 and 15 in G. mellonella. (A) Killing was monitored after larval infection with 1 × 105 CFU of WT, Δhfq and ΔhfqC A. pleuropneumoniae strains from serovars 1, 8 and 15. The virulence attenuation was verified in the Δhfq strains of serovars 1 and 8 (P < 0,05). (B) Determining of the bacterial load in G. mellonella hemolymph at 0, 1, 2, 4 and 24 h of the assay of (A) in three biological replicates. Larvae inoculated with PBS 1X were used as negative control. WT, Δhfq (hfq mutant) and ΔhfqC (complemented strain). DISCUSSION The role of the RNA chaperone Hfq in different bacterial species can be variable. For example, Francisella novicida (Chambers and Bender 2011) and Cronobacter sakazakii (Kim et al. 2015) hfq mutants are less resistant to oxidative stress, by contrast Staphylococcus aureus mutants are more resistant to oxidative stress (Liu et al. 2010). Hfq mediates the interaction of many sRNAs with their target mRNAs, in some cases leading to repression and in others activation of target gene expression (Vogel and Luisi 2011; Feliciano et al. 2016). The distribution of specific genes and sRNAs involved in encoding and regulating expression of complex phenotypes such as growth, biofilm formation, stress resistance, and virulence can vary between different serovars/strains of the same species, so it is not surprising to find the effects of global regulators can be significantly strain as well as species dependent. In this study, we compared the effects of hfq mutation in serovars 1 (Shope 4074; reference strain), 8 (MIDG2331; clinical isolate) and 15 (HS143; reference strain) of A. pleuropneumoniae, an important swine pathogen for which there are 18 known serovars (Bossé et al. 2018) that can vary in their degree of virulence in pigs (Rogers et al. 1990; Sassu et al. 2018). Serovar 1 isolates, expressing Apx toxins I and II, are typically characterized by high virulence, whereas serovars 8 and 15, expressing ApxII and III, are characterized by moderate virulence (Frey 2011). In addition, factors other than RTX toxins, some of which are serovar specific, also contribute to virulence (Bossé et al. 2002; Chiers et al. 2010). Initially, our goal had been to characterize the influence of Hfq on several aspects of the physiology of A. pleuropneumoniae serovar 8, using MIDG2331 as a model, with serovar 1 and 15 strains used as controls for hfq mutation (Zhou et al. 2008; Subashchandrabose et al. 2013) and natural transformation (Bossé et al. 2009), respectively. However, as different phenotypes for the mutants became apparent, along with differences in the virulence profiles and other features of the WT strains, we shifted our efforts towards comparing the differential influence of the lack of Hfq in strains from these distinct serovars. A previous study by Subashchandrabose et al. (2013), characterizing an hfq mutant of a clinical serovar 1 strain (AP 93-9), showed a slight reduction in growth rate compared to the WT during cultivation in rich broth, which could be complemented by expression of hfq from a plasmid. In our current study, we found similar results for a Δhfq mutant of the serovar 1 reference strain (Shope 4074), however deletion of hfq in the serovar 8 and 15 strains tested had no effect on growth in rich broth, indicating a possible serovar-related effect. The majority of clinical isolates of A. pleuropneumoniae readily form biofilms, but this phenotype tends to be lost after passage in broth culture, suggesting repression in vitro (Kaplan and Mulks 2005). Of the twelve serovar reference strains tested, only the serovar 5b and 11 strains (L20 and 56 513, respectively) retained the ability to adhere to glass tubes or polystyrene plates, indicating possible serovar-related differences in regulation of this phenotype (Kaplan and Mulks 2005). Production of a poly-1,6-N-acetylglucosamine (PNAG) exopolysaccharide matrix has been shown to be the main contributor to A. pleuropneumoniae biofilm formation on abiotic surfaces (Kaplan et al. 2004; Izano et al. 2007), with the O-antigen component of LPS also shown to contribute (Hathroubi et al. 2015). Components of LPS, PNAG, pili, outer membrane proteins and glycoproteins have also been implicated in binding of A. pleuropneumoniae to various cell lines (Paradis et al. 1994; Rioux et al. 1999; Van Overbeke et al. 2002; Auger et al. 2009; Li et al. 2012; Liu et al. 2015; Cuccui et al. 2017; Liu et al. 2018), indicating a more complex phenotype than binding to abiotic surfaces. Deletion of hfq in the AP 93-9 clinical serovar 1 strain, a strong biofilm former, was shown to reduce expression of pgaC, encoding the glycosyltransferase involved in PNAG biosynthesis, and completely abrogated the ability to adhere to polystyrene (Subashchandrabose et al. 2013). In our study, we further investigated the contribution of Hfq to regulation of adherence of A. pleuropneumoniae to biotic and abiotic surfaces. We found that the serovar 1, 8 and 15 WT strains tested showed different levels of adhesion to various surfaces. The WT serovar 8 clinical isolate (MIDG2331) showed the highest level of adherence to the A549 human alveolar basal epithelial cell line, which we have previously used for A. pleuropneumoniae adhesion assays (Cuccui et al. 2017), as well as to polystyrene plates. Furthermore, the biofilm formed by the serovar 8 WT on steel coupons showed a more mature 3-D architecture, compared to those of the serovar 1 and 15 WT strains. Although the serovar 15 reference strain showed similar adherence to polystyrene and steel coupons when compared to the serovar 1 reference strain, it also showed the lowest level of adherence to A549 cells. Deletion of hfq resulted in varying degrees of adherence reduction to the different surfaces depending on the serovar. All three serovar Δhfq mutants showed slight, but significant (P < 0.05), reduction of adherence to polystyrene, with some restoration (not significant) of binding in each following expression of the hfq gene from the complementation vector. It is not clear why we did not see complete abrogation of binding to polystyrene with our hfq mutants, or full complementation, as was seen in the study by Subashchandrabose et al. (2013), but this may have been due to differences in the isolates and/or how the assays were performed. Results of the adhesion assay using steel coupons showed all Δhfq strains had lower adherence capacity to this surface than their respective WT strains, but restoration of the WT adherence phenotype was only seen with the Ap1ΔhfqC strain. In the assay using A549 cells, all three Δhfq mutants showed reduced adherence compared to their respective WT strains, but the level of reduction was only significant (P < 0.05) for the serovar 1 and 15 mutants. As opposed to no, or partial, complementation of the binding phenotypes, each of the three serovar Δhfq mutants expressing the plasmid encoded hfq gene showed even further reductions in binding to A549 cells, though this was only significant (P < 0.05) for the Ap15ΔhfqC strain. It is difficult to determine from the current studies whether the different in vitro adhesion phenotypes are due to serovar related differences in encoded adhesion genes, or to changes in gene regulation following passage of clinical isolates in the laboratory, or both. Clearly the clinical serovar 8 WT strain showed the greatest adherence to all of the surfaces tested compared to the WT serovar 1 and 15 reference strains, and deletion of hfq reduced adherence in all cases, but to different extents. These data support a role for Hfq in regulating at least some of the gene products contributing to adherence to the different surfaces in each of the serovar strains tested, but other regulators such as RpoE and H-NS (Bossé et al. 2010) and the two component systems CpxA/CpxR (Li et al. 2018) and QseA/QseB (Liu et al. 2015) have also been shown to be involved, and their relative contributions to regulating this complex phenotype are unresolved. The ability to respond to and repair damage caused by a variety of stresses is important for the survival of A. pleuropneumoniae within its host, especially during acute disease (Sheehan et al. 2003; Klitgaard et al. 2012). Numerous genes involved in stress response have been identified, and their expression has been shown to be regulated by factors including RpoE and (p)ppGpp (Bossé et al. 2010; Li et al. 2015). In the study by Subashchandrabose et al. (2013), Hfq was shown to contribute to resistance of their clinical serovar 1 isolate to oxidative stress, but other sources of stress were not investigated. Here we have shown that there was variation in the response of the three different serovar WT strains, as well as their Δhfq mutants, to different stressors. For example, the serovar 8 WT was more sensitive to NaCl stress, whereas the serovar 15 WT was more sensitive to heat stress at 42°C, but more resistant to ethanol stress, than the other two WT strains. The Δhfq mutants of serovars 1 and 15, but not serovar 8, were more sensitive to H2O2 and pH 6.5 compared to their WT parental strains. In contrast to the adhesion experiments, the stress susceptible phenotypes were complemented by expression of the plasmid-encoded hfq gene. Although Subashchandrabose et al. (2013) previously reported that deletion of hfq in A. pleuropneumoniae did not result in increased sensitivity to H2O2 or cumene hydroperoxide, it did increase sensitivity to methyl viologen and potassium tellurite—both known to generate superoxide radicals within bacterial cells. In their study, sensitivity to these agents was tested using a disk diffusion assay, and they used a strong biofilm forming clinical isolate of serovar 1 (AP 93-9) of A. pleuropneumoniae. Both of these factors could explain the differences in results found in our current study. Overall, the data indicate that, as for adhesion and biofilm formation, Hfq plays a role in stress resistance, but there are serovar- or even strain-dependent differences in regulation of this complex phenotype. Finally, we compared virulence of serovar 1, 8 and 15 A. pleuropneumoniae WT and Δhfq mutants in the G. mellonella infection model that we previously described (Pereira et al. 2015). As for the other phenotypes tested, there were variations between the different WT serovars and Δhfq mutant strains with regards to virulence in this model. Since the serovar 15 WT was avirulent under the conditions tested, no difference was seen following deletion of the hfq gene in this strain. The serovar 1 WT was the most virulent, but only showed a slight decrease, whereas the moderately virulent serovar 8 WT was completely attenuated following deletion of its hfq gene. Furthermore, complementation was not successful for the serovar 1 mutant expressing the plasmid-encoded hfq gene, but restored almost full WT level of virulence for the serovar 8 mutant, indicating possible differences in genes (and possible differences in gene regulation) contributing to virulence of these serovars in this infection model. Complementation of mutated phenotypes using cloned genes expressed from shuttle plasmids is always challenging, as factors including level of expression (due to copy number of plasmid and strength of promoter used for expression) and indirect effects of interaction of the expressed gene with regulatory network(s) can influence the overall success of restoring the WT phenotype. This is especially true for complementation of genes encoding global regulators, such as Hfq. We tried account for possible confounding issues by cloning the hfq gene into a low copy number plasmid (pMIDG100), with expression possible from the endogenous sigma 70 and/or sigma E promoters included in the upstream sequence. However, we still found that pMIDG_hfq was able to complement some, but not all of the Δhfq mutant phenotypes, and this was sometimes serovar-dependent. In the case of binding to A549 epithelial cells, expression of the plasmid copy of hfq resulted in further reductions rather than restoration of WT levels in adherence for all 3 serovar strains. Each of the phenotypes analyzed in this study are complex, and result from coordinated expression of different genes, some of which may be regulated by Hfq-dependent sRNAs and others not. Adding to this complex network, other regulators such as sigma factors and DNA binding proteins may also be involved, and the balance of these factors likely determines the resulting phenotype. Similar observations of partial complementation and/or exacerbation of phenotype have been made by others when expressing hfq on plasmids, either from its own promoter or an inducible one (Fantappiè et al. 2009; Schilling and Gericher 2009; Bai et al. 2010; Chambers and Bender 2011). It is possible that, even though we deliberately cloned the hfq gene along with three possible endogenous promoters, on a low copy number plasmid, the intracellular levels of Hfq were either lower or higher than those present in the WT strains, resulting in differential regulation of genes affecting the different phenotypes. In summary, we found that Hfq contributes to regulation of adhesion to biotic and abiotic surfaces, resistance to various stress conditions and virulence in a surrogate model of infection, to differing extents in the three serovars of A. pleuropneumoniae studied. The full set of genes and sRNAs contributing to each of these phenotypes, and how these differ between serovar/strains of A. pleuropneumoniae, remain to be determined. We conclude the need for caution in extrapolating the effects of deletion of global regulators, and hfq in particular, to other strains of the same species, especially regarding complex phenotypes. ACKNOWLEDGMENTS The authors thank to Acácio Rodrigues Salvador for helping with the figures. FUNDING The authors thank CNPq (201840/2011-1, 407849/2012-2, 142495/2014-0 and 141328/2018), FAPEMIG (CBB-APQ-02732-15), CAPES/PROEX (23038.019105/2016-86 and 23038.002486/2018-26), FINEP (Núcleo de Microscopia e Microanálise—UFV), BBSRC (BB/K021109/1, BB/G019177/1, BB/M023052/1, BB/S020543/1, BB/P001262/1, and BB/G018553) and CONFAP—the UK Academies (CBB- APQ-00689-16). Conflicts of Interest None declared. REFERENCES Auger E , Deslandes V, Ramjeet M et al. Host-pathogen interactions of Actinobacillus pleuropneumoniae with porcine lung and tracheal epithelial cells . Infect Immun . 2009 ; 77 : 1426 – 41 . Google Scholar Crossref Search ADS PubMed WorldCat Bai G , Golubov A, Smith EA et al. The importance of the small RNA chaperone Hfq for growth of epidemic Yersinia pestis, but not Yersinia pseudotuberculosis, with implications for plague biology . J Bacteriol . 2010 ; 192 : 4239 – 45 . Google Scholar Crossref Search ADS PubMed WorldCat Beddek AJ , Sheehan BJ, Bossé JT et al. Two TonB systems in Actinobacillus pleuropneumoniae: their roles in iron acquisition and virulence . Infect Immun . 2004 ; 72 : 701 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat Behera P , Kutty VHM, Kumar A et al. Changing the codon usage of hfq gene has profound effect on phenotype and pathogenicity of Salmonella Typhimurium . Curr Microbiol . 2016 ; 72 : 288 – 96 . Google Scholar Crossref Search ADS PubMed WorldCat Blackall PJ , Klaasen H, Van Den Bosch H et al. Proposal of a new serovar of Actinobacillus pleuropneumoniae: serovar 15 . Vet Microbiol . 2002 ; 84 : 47 – 52 . Google Scholar Crossref Search ADS PubMed WorldCat Blanco LAA , Crispim JS, Fernandes KM et al. Differential cellular immune response of Galleria mellonella to Actinobacillus pleuropneumoniae . Cell Tissue Res . 2017 ; 370 : 1 – 17 . Google Scholar Crossref Search ADS PubMed WorldCat Bossé JT , Chaudhuri RR, Li Y et al. Complete genome sequence of MIDG2331, a genetically tractable serovar 8 clinical isolate of Actinobacillus pleuropneumoniae . Genome Announc . 2016 ; 4 : e01667 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat Bossé JT , Durham AL, Rycroft AN et al. New plasmid tools for genetic analysis of Actinobacillus pleuropneumoniae and other Pasteurellaceae . Appl Environ Microbiol . 2009 ; 75 : 6124 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat Bossé JT , Janson H, Sheehan BJ et al. Actinobacillus pleuropneumoniae: pathobiology and pathogenesis of infection . Microbes Infect . 2002 ; 4 : 225 – 35 . Google Scholar Crossref Search ADS PubMed WorldCat Bossé JT , Li Y, Sárközi R et al. Proposal of serovars 17 and 18 of Actinobacillus pleuropneumoniae based on serological and genotypic analysis . Vet Microbiol . 2018 ; 217 : 1 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat Bossé JT , Sinha S, Li M-S et al. Regulation of pga operon expression and biofilm formation in Actinobacillus pleuropneumoniae by sigmaE and H-NS . J Bacteriol . 2010 ; 192 : 2414 – 23 . Google Scholar Crossref Search ADS PubMed WorldCat Bossé JT , Soares-Bazzolli DM, Li Y et al. The generation of successive unmarked mutations and chromosomal insertion of heterologous genes in Actinobacillus pleuropneumoniae using natural transformation . PLoS One . 2014 ; 9 : e111252 . Google Scholar Crossref Search ADS PubMed WorldCat Buettner FFR , Bendallah IM, Bossé JT et al. Analysis of the Actinobacillus pleuropneumoniae ArcA regulon identifies fumarate reductase as a determinant of virulence . Infect Immun . 2008 ; 76 : 2284 – 95 . Google Scholar Crossref Search ADS PubMed WorldCat Buettner FFR , Bendalla IM, Bossé JT et al. Analysis of the Actinobacillus pleuropneumoniae HlyX (FNR) regulon and identification of iron-regulated protein B as an essential virulence factor . Proteomics . 2009 ; 9 : 2383 – 98 . Google Scholar Crossref Search ADS PubMed WorldCat Chambers JR , Bender KS. The RNA chaperone Hfq is important for growth and stress tolerance in Francisella novicida . PLoS One . 2011 ; 6 : e19797 . Google Scholar Crossref Search ADS PubMed WorldCat Chiers K , De Waele T, Pasmans F et al. Virulence factors of Actinobacillus pleuropneumoniae involved in colonization, persistence and induction of lesions in its porcine host . Vet Res . 2010 ; 41 : 65 . Google Scholar Crossref Search ADS PubMed WorldCat Cuccui J , Terra VS, Bossé JT et al. The N-linking glycosylation system from Actinobacillus pleuropneumoniae is required for adhesion and has potential use in glycoengineering . Open Biol . 2017 ; 7 : 160212 . Google Scholar Crossref Search ADS PubMed WorldCat Cui M , Wang T, Xu J et al. Impact of Hfq on global gene expression and intracellular survival in Brucella melitensis . PLoS One . 2013 ; 8 : e71933 . Google Scholar Crossref Search ADS PubMed WorldCat Dos Santos RF , Arraiano CM, Andrade JM. New molecular interactions broaden the functions of the RNA chaperone Hfq . Curr Genet . 2019 ; 65 : 1313 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Fantappiè L , Metruccio MME, Seib KL et al. The RNA chaperone Hfq is involved in stress response and virulence in Neisseria meningitidis and is a pleiotropic regulator of protein expression . Infect Immun . 2009 ; 77 : 1842 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat Feliciano JR , Grilo AM, Guerreiro SI et al. Hfq: a multifaceted RNA chaperone involved in virulence . Future Microbiol . 2016 ; 11 : 137 – 51 . Google Scholar Crossref Search ADS PubMed WorldCat Ferrières L , Hémery G, Nham T et al. Silent mischief: bacteriophage Mu insertions contaminate products of Escherichia coli random mutagenesis performed using suicidal transposon delivery plasmids mobilized by broad-host-range RP4 conjugative machinery . J Bacteriol . 2010 ; 192 : 6418 – 27 . Google Scholar Crossref Search ADS PubMed WorldCat Franze de Fernandez MT , Hayward WS, August JT. Bacterial proteins required for replication of phage Q ribonucleic acid. Pruification and properties of host factor I, a ribonucleic acid-binding protein . J Biol Chem . 1972 ; 247 : 824 – 31 . Google Scholar PubMed OpenURL Placeholder Text WorldCat Frey J . The role of RTX toxins in host specificity of animal pathogenic Pasteurellaceae . Vet Microbiol . 2011 ; 153 : 51 – 58 . Google Scholar Crossref Search ADS PubMed WorldCat Goel MK , Khanna P, Kishore J. Understanding survival analysis: Kaplan-Meier estimate . Int J Ayurveda Res . 2010 ; 1 : 274 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat Hathroubi S , Hancock MA, Bossé JT et al. Surface polysaccharide mutants reveal that absence of O antigen reduces biofilm formation of Actinobacillus pleuropneumoniae . Infect Immun . 2015 ; 84 : 127 – 37 . Google Scholar Crossref Search ADS PubMed WorldCat Hayes JA , Surmann K, Lamberti Y et al. Hfq modulates global protein pattern and stress response in Bordetella pertussis . J Proteomics . 2020 ; 211 : 1035592 . Google Scholar OpenURL Placeholder Text WorldCat Hempel RJ , Morton DJ, Seale TW et al. The role of the RNA chaperone Hfq in Haemophilus influenzae pathogenesis . BMC Microbiol . 2013 ; 13 : 134 . Google Scholar Crossref Search ADS PubMed WorldCat Izano EA , Sadovskaya I, Vinogradov E et al. Poly-N-acetylglucosamine mediates biofilm formation and antibiotic resistance in Actinobacillus pleuropneumoniae . Microb Pathog . 2007 ; 43 : 1 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Kakoschke T , Kakoschke S, Magistro G et al. The RNA chaperone Hfq impacts growth, metabolism and production of virulence factors in Yersinia enterocolitica . PLoS One . 2014 ; 9 : e86113 . Google Scholar Crossref Search ADS PubMed WorldCat Kaplan JB , Mulks MH. Biofilm formation is prevalent among field isolates of Actinobacillus pleuropneumoniae . Vet Microbiol . 2005 ; 108 : 89 – 94 . Google Scholar Crossref Search ADS PubMed WorldCat Kaplan JB , Velliyagounder K, Ragunath C et al. Genes involved in the synthesis and degradation of matrix polysaccharide in Actinobacillus actinomycetemcomitans and Actinobacillus pleuropneumoniae biofilms . J Bacteriol . 2004 ; 186 : 8213 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat Kendall MM , Gruber CC, Rasko DA et al. Hfq virulence regulation in enterohemorrhagic Escherichia coli O157:H7 strain 86-24 . J Bacteriol . 2011 ; 193 : 6843 – 51 . Google Scholar Crossref Search ADS PubMed WorldCat Kim S , Hwang H, Kim K-P et al. hfq plays important roles in virulence and stress adaptation in Cronobacter sakazakii ATCC 29544 . Infect Immun . 2015 ; 83 : 2089 – 98 . Google Scholar Crossref Search ADS PubMed WorldCat Klitgaard K , Friis C, Jensen TK et al. Transcriptional portrait of Actinobacillus pleuropneumoniae during acute disease–potential strategies for survival and persistence in the host . PLoS One . 2012 ; 7 : e35549 . Google Scholar Crossref Search ADS PubMed WorldCat Lai J , Tang D, Liang Y et al. The RNA chaperone Hfq is important for the virulence, motility and stress tolerance in the phytopathogen Xanthomonas campestris . Environ Microbiol Rep . 2018 ; 10 : 542 – 54 . Google Scholar Crossref Search ADS PubMed WorldCat Li G , Xie F, Zhang Y et al. Role of (p)ppGpp in viability and biofilm formation of Actinobacillus pleuropneumoniae S8 . PLoS One . 2015 ; 10 : e0141501 . Google Scholar Crossref Search ADS PubMed WorldCat Li H , Liu F, Peng W et al. The CpxA/CpxR two-component system affects biofilm formation and virulence in Actinobacillus pleuropneumoniae . Front Cell Infect Microbiol . 2018 ; 8 : 2396 . Google Scholar OpenURL Placeholder Text WorldCat Li T , Xu Z, Zhang T et al. The genetic analysis of the flp locus of Actinobacillus pleuropneumoniae . Arch Microbiol . 2012 ; 194 : 167 – 76 . Google Scholar Crossref Search ADS PubMed WorldCat Liu J , Cao Y, Gao L et al. Outer membrane lipoprotein Lip40 modulates adherence, colonization, and virulence of Actinobacillus pleuropneumoniae . Front Microbiol . 2018 ; 9 : 1426 . Google Scholar Crossref Search ADS PubMed WorldCat Liu J , Hu L, Xu Z et al. Actinobacillus pleuropneumoniae two-component system QseB/QseC regulates the transcription of PilM, an important determinant of bacterial adherence and virulence . Vet Microbiol . 2015 ; 177 : 184 – 92 . Google Scholar Crossref Search ADS PubMed WorldCat Liu Y , Wu N, Dong J et al. Hfq is a global regulator that controls the pathogenicity of Staphylococcus aureus . PLoS One . 2010 ; 5 : e13069 . Google Scholar Crossref Search ADS PubMed WorldCat Mao F , Dam P, Chou J et al. DOOR: a database for prokaryotic operons . Nucleic Acids Res . 2009 ; 37 : D459 – 63 . Google Scholar Crossref Search ADS PubMed WorldCat Moen B , Røssvoll E, Måge I et al. Microbiota formed on attached stainless steel coupons correlates with the natural biofilm of the sink surface in domestic kitchens . Can J Microbiol . 2015 ; 62 : 148 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat Mégroz M , Kleifeld O, Wright A et al. The RNA-binding chaperone Hfq is an important global regulator of gene expression in Pasteurella multocida and plays a crucial role in production of a number of virulence factors, including hyaluronic acid capsule . Infect Immun . 2016 ; 84 : 1361 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat O'Dwyer CA , Reddin K, Martin D et al. Expression of heterologous antigens in commensal Neisseria spp.: preservation of conformational epitopes with vaccine potential . Infect Immun . 2004 ; 72 : 6511 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat Paradis SÉ , Dubreuil D, Rioux S et al. High-molecular-mass lipopolysaccharides are involved in Actinobacillus pleuropneumoniae adherence to porcine respiratory tract cells . Infect Immun . 1994 ; 62 : 3311 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat Pereira MF , Rossi CC, de Queiroz MV et al. Galleria mellonella is an effective model to study Actinobacillus pleuropneumoniae infection . Microbiology . 2015 ; 161 : 387 – 400 . Google Scholar Crossref Search ADS PubMed WorldCat Pereira MF , Rossi CC, Seide LE et al. Antimicrobial resistance, biofilm formation and virulence reveal Actinobacillus pleuropneumoniae strains' pathogenicity complexity . Res Vet Sci . 2018 ; 118 : 498 – 501 . Google Scholar Crossref Search ADS PubMed WorldCat Rioux S , Galarneau C, Harel J et al. Isolation and characterization of mini-Tn10 lipopolysaccharide mutants of Actinobacillus pleuropneumoniae serotype 1 . Can J Microbiol . 1999 ; 45 : 1017 – 26 . Google Scholar Crossref Search ADS PubMed WorldCat Rogers RJ , Eaves LE, Blackall PJ et al. The comparative pathogenicity of four serovars of Actinobacillus (Haemo philus) pleuropneumoniae . Aust Vet J . 1990 ; 67 : 9 – 12 . Google Scholar Crossref Search ADS PubMed WorldCat Sassu EL , Bossé JT, Tobias TJ et al. Update on Actinobacillus pleuropneumoniae—knowledge, gaps and challenges . Transbound Emerg Dis . 2018 ; 65 : 72 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat Schilling D , Gerischer U. The Acinetobacter baylyi hfq gene encodes a large protein with an unusual C terminus . J Bacteriol . 2009 ; 191 : 5553 – 62 . Google Scholar Crossref Search ADS PubMed WorldCat Sheehan BJ , Bossé JT, Beddek AJ et al. Identification of Actinobacillus pleuropneumoniae genes important for survival during infection in its natural host . Infect Immun . 2003 ; 71 : 3960 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat Sobrero P , Valverde C. The bacterial protein Hfq: much more than a mere RNA-binding factor . Crit Rev Microbiol . 2012 ; 38 : 276 – 99 . Google Scholar Crossref Search ADS PubMed WorldCat Solovyev VV , Shahmuradov IA, Salamov AA. Identification of promoter regions and regulatory sites . Methods Mol Biol . 2010 ; 674 : 57 – 83 . Google Scholar Crossref Search ADS PubMed WorldCat Subashchandrabose S , Leveque RM, Kirkwood RN et al. The RNA chaperone Hfq promotes fitness of Actinobacillus pleuropneumoniae during porcine pleuropneumonia . Infect Immun . 2013 ; 81 : 2952 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat Tsui HC , Leung HC, Winkler ME. Characterization of broadly pleiotropic phenotypes caused by an hfq insertion mutation in Escherichia coli K-12 . Mol Microbiol . 1994 ; 13 : 35 – 49 . Google Scholar Crossref Search ADS PubMed WorldCat Van Overbeke I , Chiers K, Charlier G et al. Characterization of the in vitro adhesion of Actinobacillus pleuropneumoniae to swine alveolar epithelial cells . Vet Microbiol . 2002 ; 88 : 59 – 74 . Google Scholar Crossref Search ADS PubMed WorldCat Vogel J , Luisi BF. Hfq and its constellation of RNA . Nat Rev Microbiol . 2011 ; 9 : 578 – 89 . Google Scholar Crossref Search ADS PubMed WorldCat Zhou L , Rycroft AN, Kroll JS et al. An Actinobacillus pleuropneumoniae (APP) hfq mutant is attenuated for virulence . Proceedings of the International Pasteurellaceae Society , Sorrento, Italy 2008 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC © The Author(s) 2020. Published by Oxford University Press on behalf of FEMS This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Serovar-dependent differences in Hfq-regulated phenotypes in Actinobacillus pleuropneumoniae
JO - Pathogens and Disease
DO - 10.1093/femspd/ftaa066
DA - 2020-12-09
UR - https://www.deepdyve.com/lp/oxford-university-press/serovar-dependent-differences-in-hfq-regulated-phenotypes-in-UXEkbt6wLn
VL - 78
IS - 9
DP - DeepDyve
ER -