TY - JOUR
AU - Zhang,, Huidong
AB - Abstract Abasic site as a common DNA lesion blocks DNA replication and is highly mutagenic. Protein interactions in T7 DNA replisome facilitate DNA replication and translesion DNA synthesis. However, bypass of an abasic site by T7 DNA replisome has never been investigated. In this work, we used T7 DNA replisome and T7 DNA polymerase alone as two models to study DNA replication on encountering an abasic site. Relative to unmodified DNA, abasic site strongly inhibited primer extension and completely blocked strand-displacement DNA synthesis, due to the decreased fraction of enzyme–DNA productive complex and the reduced average extension rates. Moreover, abasic site at DNA fork inhibited the binding of DNA polymerase or helicase onto fork and the binding between polymerase and helicase at fork. Notably and unexpectedly, we found DNA polymerase alone bypassed an abasic site on primer/template (P/T) substrate more efficiently than did polymerase and helicase complex bypass it at fork. The presence of gp2.5 further inhibited the abasic site bypass at DNA fork. Kinetic analysis showed that this inhibition at fork relative to that on P/T was due to the decreased fraction of productive complex instead of the average extension rates. Therefore, we found that protein interactions in T7 DNA replisome inhibited the bypass of DNA lesion, different from all the traditional concept that protein interactions or accessory proteins always promote DNA replication and DNA damage bypass, providing new insights in translesion DNA synthesis performed by DNA replisome. Introduction DNA replication is under constant threat from various DNA lesions within genome incurred by a multitude of endogenous and exogenous factors (1,2). Apurinic/apyrimidinic sites (abasic sites) are produced at a rate of ~50 000 abasic sites/cell/day (3,4). These abasic sites are very blocking and miscoding. Abasic sites preferentially code for dATP insertion (A-rule) (5), for dGTP incorporation (G-rule) (6) and for –1 frameshift deletions (7). Yeast and human DNA polmerase (Pol) η are very inefficient in both inserting and extending encountering an abasic site (8). The extension products by yeast DNA Pol η core show that 53% products are dGTP misincorporation, 33% are dATP misincorporation and 14% are –1 frameshift deletion (4). Abasic site also blocks DNA replication by DNA polymerase of Pseudomonas aeruginosa phage 1 (PaP1) with preferential dATP incorporation (9). T7 DNA replisome contains DNA polymerase (gp5/trx), gene 4 helicase-primase (gp4) and gene 2.5 single-stranded DNA (ssDNA) binding protein (gp2.5) (10,11). The C-terminal tail of helicase interacts with the front basic patch (Fbp) and the trx-binding domain basic patch (TBDbp) of DNA polymerase (gp5/trx), and the non-tail region of gp4 also interacts with gp5/trx (10–12). The primase domain of gp4 synthesises RNA primers to initiate the lagging-strand DNA synthesis (13). Gp2.5 coats ssDNA to remove its secondary structures and also physically interacts with gp5/trx (14). These protein interactions maintain the coordinated and efficient DNA replication. All the reported results show that protein interactions in T7 DNA replisome facilitate the bypass of nick (15,16), cyclobutane pyrimidine dimer (CPD) (17), 7,8-dihydro-8-oxo-2’-deoxyguanosine (8-oxoG) or O6-methylguanine (O6-MeG) (18) and consecutive multiple ribonucleoside monophosphates (rNMPs) (19). Whether T7 protein interactions could also promote the bypass of a natural abasic site is unknown. In this work, we investigated how T7 DNA replisome bypass an abasic site at a synthetic DNA replication fork. Unexpectedly, we found that protein interactions in T7 DNA replisome inhibit the bypass of an abasic site by DNA polymerase, different from all the traditional concept that protein interactions or accessory proteins always promote DNA replication or translesion DNA synthesis. Materials and Methods Materials T4 polynucleotide kinase and dNTPs were purchased from New England Biolabs (Beverly, MA, USA). Non-hydrolyzable β,γ-CH2-dTTP was a gift from Richardson’s Lab at Harvard Medical School. [γ-32P] ATP was from PerkinElmer Life Sciences (Boston, MA, USA). Oligodeoxynucleotides (Table 1) were synthesised and purified by high-performance liquid chromatography (Takara Bio, Kyoto, Japan). T7 exonuclease-deficient DNA polymerase (gp5 exo–), gp4, Escherichia coli trx and gp2.5 were overproduced and purified as described previously (11,12,20). For simplicity, we denote gp5 exo–/trx (1:20 molar ratio) as DNA polymerase or gp5/trx. DNA primer was labelled with [γ-32P] ATP. Primer/template (P/T) substrate was prepared by annealing 5′-end 32P-labeled 27-mer primer (P) and 62-mer template (T) at molar ratio of 1:1.2. DNA replication fork (Fork) and surface plasmon resonance (SPR) fork were prepared by annealing 5′-end 32P-labeled 27-mer primer or 30-mer primer (P), 63-mer ssDNA flap containing a 29 T-tail at its 5′-end (F) and 62-mer template (T) at molar ratio of 1:1.5:1.2. DNA substrates and their corresponding structures were confirmed by non-denaturing 10% polyacrylamide gel electrophoresis (PAGE). Other reagents were of the highest quality commercially available. Table 1. Oligodeoxynucleotides used in this study Oligonucleotide . . Sequence (5′ to 3′) . 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA P/T 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA 30-mer (P) Biotin-TTTGCTACAGAGTTATGGTGACGATACGTCdd SPR Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*GACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA Oligonucleotide . . Sequence (5′ to 3′) . 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA P/T 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA 30-mer (P) Biotin-TTTGCTACAGAGTTATGGTGACGATACGTCdd SPR Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*GACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA G*: dG, AP. Open in new tab Table 1. Oligodeoxynucleotides used in this study Oligonucleotide . . Sequence (5′ to 3′) . 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA P/T 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA 30-mer (P) Biotin-TTTGCTACAGAGTTATGGTGACGATACGTCdd SPR Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*GACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA Oligonucleotide . . Sequence (5′ to 3′) . 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA P/T 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 27-mer (P) GCTACAGAGTTATGGTGACGATACGTA Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*TACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA 30-mer (P) Biotin-TTTGCTACAGAGTTATGGTGACGATACGTCdd SPR Fork 62-mer (T) TGAATTCTAATGTAGTATAGTAATACTCTCTATCG*GACGTATCGTCACCATAACTCTGTAGC 63-mer (F) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATAGAGAGTATTACTATACTACATTAGAATTCA G*: dG, AP. Open in new tab Primer extension or strand-displacement DNA synthesis across an abasic site Rapid quench experiments were performed using a model RQF-3 KinTek Quench Flow Apparatus (KinTek Corp., Austin, TX, USA) with 50-mM Tris-HCl buffer (pH 7.5) in both drive syringes and 0.5-M EDTA solution in the middle quench syringe (2,21). Primer extension was initiated by rapidly mixing 60-nM gp5/trx and 40-nM 32P-labeled 27-mer/62-mer P/T DNA substrate containing G or abasic site mixture with 300 μM each of four dNTPs in reaction buffer B [40-mM Tris-HCl (pH 7.5 at 37°C), 10-mM MgCl2, 10-mM dithiothreitol and 50-mM potassium glutamate] at 37°C. Strand-displacement DNA synthesis was initiated by rapidly mixing 40-nM 32P-labeled 27-mer/63-mer/62-mer fork DNA substrate containing G or abasic site, 60-nM gp5/trx, 2.16-μM gp4 and 0- or 24-μM gp2.5 mixture with 300 μM each of four dNTPs in buffer B at 37°C. After indicated time, the reactions were rapid quenched by 0.5-M EDTA. The mixture containing DNA substrate, gp5/trx, gp4 and gp2.5 in buffer B but no four dNTPs was considered as reaction at time zero point. Substrate and products were separated by electrophoresis on a 20% polyacrylamide gel (w/v)/7-M urea gel. The products were visualised using phosphorimaging and quantified by Quantity One™ software (2,22). The 27-mer, 28-mer, 29-mer and 62-mer products were used as markers to identify the product positions. The concentrations of all the bypass products from 28-mer to 62-mer were summed, plotted against time and fitted to the following equation: y=A(1−ekt) (1) where y is the concentration of the total bypass products (nM); A is the fraction of productive enzyme–DNA complex that could extend primer past G or abasic site (nM); k is the average extension rate for bypass of G or abasic (min−1); and t is time (min). The standard errors were derived by fitting using Prism. Statistically significant differences were detected by one-way analysis of variance with Newman–Keuls test, and the results were considered statistically significant when P < 0.05. Binding of DNA polymerase and helicase onto DNA fork containing G or abasic site determined by SPR Binding of DNA polymerase and helicase at DNA fork containing an abasic site was determined by SPR using a Biacore 3000 instrument (Uppsala, Sweden) (11,12). DNA replication fork (30-mer/63-mer/62-mer, 300 RU) containing G or abasic site was coupled to an streptavidin (SA) chip. The 30-mer primer contained a biotin at its 5′ terminus for coupling DNA onto chip and a Cdd (double deoxycytidine) at its 3′-end for blockage of DNA polymerisation. Gp4 (2 μM, monomer concentration) in buffer B containing 1-mM non-hydrolyzable β, γ-methylene dTTP was flowed over the chip at 10 μl/min at room temperature to form stably locked helicase–fork complex (23). Subsequently, DNA polymerase (1 μM) was injected in buffer B containing 1 mM dCTP and 1 mM β, γ-methylene dTTP. In control, the same DNA fork was immobilised without gp4 to compensate for background. The binding curves of polymerase to helicase–fork complex were recorded. Similarly, DNA polymerase (600 nM) in buffer B containing 1-mM dCTP was flowed over the chip to form stable polymerase–fork complex. Subsequently, gp4 (4 μM, monomer concentration) was injected in buffer B containing 1 mM dCTP and 1-mM β, γ-methylene dTTP. In control, the same fork was immobilised onto chip without polymerase to compensate for background. The binding curves of helicase to polymerase–fork complex were recorded. The chip surface was regenerated by injection of 150 µl of 1-M NaCl at a flow rate of 100 µl/min (11,12). Results Abasic site strongly inhibited primer extension and completely blocked strand-displacement DNA synthesis DNA replisome inevitably encounters various DNA damage during DNA replication (24). Primer extension assays were performed by rapid mixing DNA polymerase (gp5/trx) and 27-mer/62-mer P/T DNA substrate containing G or abasic site at the first incorporation position (28 position on template) (18,19,25). The substrate (primer) and products (the bands above the primer) were separated and visualised. The primer could be fully extended to 62-mer product for unmodified G but was strongly inhibited for abasic site (Figure 1A and B). The major extension products were 28-mer product (one nucleotide incorporation) and 29-mer product (two nucleotide incorporation) for abasic site (Figure 1B). Figure 1. Open in new tabDownload slide Abasic site strongly inhibited primer extension and completely blocked strand-displacement DNA synthesis. Primer extension was performed by rapidly mixing 60 nM gp5/trx and 40 nM 32P-labeled 27-mer/62-mer P/T DNA substrate containing unmodified G (A) or abasic site (B) mixture with 300 μM each of four dNTPs in reaction buffer B at 37°C. Strand-displacement DNA synthesis was initiated by rapidly mixing 40-nM 32P-labeled 27-mer/63-mer/62-mer fork DNA substrate containing G (C) or abasic site (D), 60-nM gp5/trx, 2.16-μM gp4 and 0- or 24-μM gp2.5 (E for unmodified G and F for abasic site) mixture with 300 μM each of four dNTPs in buffer B at 37°C. The substrate and products were separated and visualised. Lane 1 is the reaction at time zero point, in which all components (DNA substrate, gp5/trx, gp4 and gp2.5 in buffer B) except for four dNTPs were added. Representative data from three independent repetitions are illustrated. Asterisks show the location of G or abasic site. Figure 1. Open in new tabDownload slide Abasic site strongly inhibited primer extension and completely blocked strand-displacement DNA synthesis. Primer extension was performed by rapidly mixing 60 nM gp5/trx and 40 nM 32P-labeled 27-mer/62-mer P/T DNA substrate containing unmodified G (A) or abasic site (B) mixture with 300 μM each of four dNTPs in reaction buffer B at 37°C. Strand-displacement DNA synthesis was initiated by rapidly mixing 40-nM 32P-labeled 27-mer/63-mer/62-mer fork DNA substrate containing G (C) or abasic site (D), 60-nM gp5/trx, 2.16-μM gp4 and 0- or 24-μM gp2.5 (E for unmodified G and F for abasic site) mixture with 300 μM each of four dNTPs in buffer B at 37°C. The substrate and products were separated and visualised. Lane 1 is the reaction at time zero point, in which all components (DNA substrate, gp5/trx, gp4 and gp2.5 in buffer B) except for four dNTPs were added. Representative data from three independent repetitions are illustrated. Asterisks show the location of G or abasic site. Strand-displacement DNA synthesis was performed by DNA polymerase (gp5/trx) and helicase (gp4) using 27-mer/63-mer/62-mer fork DNA substrate. The correct formation of these substrates was confirmed by non-denaturing PAGE. DNA polymerase was located at the 3′-end of primer and hexameric helicase encircled the 29 T-tail of the fork (11,18,19,25,26). Gp4 helicase unwinds double-strand DNA (dsDNA) substrate to produce two ssDNA templates for DNA polymerases (11). DNA polymerase alone cannot perform strand-displacement DNA synthesis on the DNA fork substrate without the aid of gp4 (25). Strand-displacement DNA synthesis could be well performed in the presence of gp4 for unmodified fork substrate (Figure 1C) but was completely blocked by abasic site (Figure 1D). Only 28-mer and a little 29-mer products were produced for abasic site substrate. T7 DNA polymerase cannot extend the primer in the absence of template. Therefore, the 28-mer and 29-mer products were template-dependent extensions rather than the simple non-specific terminal additions. Gp2.5 is an important component in T7 DNA replisome, which can interact with ssDNA region and maintain the coordinated leading- and lagging-strand DNA synthesis (1,27). Both gp2.5 and gp4 can interact with DNA polymerase (11) but their interaction sites are independent (28). Strand-displacement DNA synthesis was further performed in the presence of saturated gp2.5 (Figure 1E and F). The presence of gp2.5 promoted the strand-displacement DNA synthesis at the unmodified fork (Figure 1E), similar to the previous results (28). However, the presence of gp2.5 inhibited the bypass of abasic site, as observed less 28-mer and 29-mer products (Figure 1F). Abasic site inhibited the formation of productive enzyme–DNA complex DNA synthesis contains multiple steps. To simplify this synthesis process, these steps can be summarised into two steps: (i) the binding step, DNA polymerase (and helicase and/or gp2.5) binds DNA substrate to form productive enzyme–DNA complex; and (ii) the extension step, the productive complex extends the primer past DNA lesion. In some cases, only a fraction of DNA polymerase and DNA could form the productive complex to perform DNA synthesis, due to the formation of non-productive complex as observed previously (29,30). The abasic site in DNA substrate may affect the productive complex fraction and its average extension rate. The identical molar amount of P/T or fork DNA substrate and molar excessive DNA polymerase and helicase relative to DNA substrate were used in these assays to ensure that all DNA substrates were associated with proteins. T7 DNA polymerase has high processivity in primer extension (31). Polymerase–helicase complex also shows high processivity in strand-displacement DNA synthesis (26). During one binding event, polymerase incorporates hundreds to thousands of dNMPs into DNA before its dissociation from DNA. The fraction of productive enzyme–DNA complex (A) and average extension rate (k) could be estimated using Eq. (1) as described previously (18,19). As no full-length products were produced for strand-displacement DNA synthesis across this abasic site, all the bypass products (the sum from 28-mer to 62-mer) were quantified, plotted against the reaction time and fitted to Eq. (1) to estimate the A and k values (Figure 2A). Figure 2. Open in new tabDownload slide Kinetic analysis of primer extension and strand-displacement DNA synthesis across an unmodified G or abasic site in Figure 1. The concentrations of all the bypass products from 28-mer to 62-mer were summed, plotted against time (A), and fit to single exponential Eq. (1) to estimate the fraction of productive enzyme–DNA complex (A values) and the average extension rates (k values) (B). (C) The fraction of productive complex (A values) and average extension rates (k values) were plotted. The standard errors were derived by fitting from Prism. Asterisks indicate the statistically significant difference (P < 0.05). Figure 2. Open in new tabDownload slide Kinetic analysis of primer extension and strand-displacement DNA synthesis across an unmodified G or abasic site in Figure 1. The concentrations of all the bypass products from 28-mer to 62-mer were summed, plotted against time (A), and fit to single exponential Eq. (1) to estimate the fraction of productive enzyme–DNA complex (A values) and the average extension rates (k values) (B). (C) The fraction of productive complex (A values) and average extension rates (k values) were plotted. The standard errors were derived by fitting from Prism. Asterisks indicate the statistically significant difference (P < 0.05). Abasic site inhibited both primer extension and strand-displacement DNA synthesis. Kinetic analysis showed that the fraction of productive complex (A values) and average extension rates (k values) were all reduced for abasic site compared with those for unmodified G (Figure 2B and C). The overall capability of DNA synthesis using unmodified DNA substrates was compared between DNA polymerase–P/T complex and polymerase–helicase–fork complex. The fraction of productive complex (A values) was similar for primer extension on P/T substrate and for strand-displacement DNA synthesis at fork (Figure 2B and C). The average extension rate (k value) was higher for P/T substrate than for fork, agreed with the previous results that T7 DNA polymerase provides driving force to accelerate helicase unwinding and to promote strand-displacement DNA synthesis (25). The presence of gp2.5 did not affect the formation of productive complex (A value) but did accelerate this extension rate (k value), similar to the previous results (28). The overall capability of translesion DNA synthesis across this abasic site was also compared between DNA polymerase–P/T complex and polymerase–helicase–fork complex. The A values were greatly reduced from P/T substrate to fork substrate without gp2.5, and then further reduced to fork with gp2.5 (Figure 2B and C), indicating that the presence of more proteins at fork seemed to inhibit the formation of productive complex. However, the k values were similar for the three assays (Figure 2B). Thus, abasic site inhibited strand-displacement DNA synthesis at DNA fork more severely than primer extension on P/T, which was mainly due to the inhibition in the formation of enzyme∙DNA productive complex (A value) instead of the changes in extension rate (k value). Abasic site weakened the binding of helicase or polymerase with DNA fork and their binding at fork The formation of productive enzyme–DNA complex is dependent on their binding among proteins and DNA substrate. Then, the binding among DNA polymerase, helicase and DNA fork was investigated by SPR. The identical molar amount of DNA fork (30-mer/63-mer/62-mer) containing G or abasic site (300 RU) was coupled to an SA chip. The 30-mer primer contained a biotin at its 5′ terminus for coupling DNA onto the chip and a Cdd (double deoxycytidine) at its 3′-end for blockage of DNA polymerisation. Because the unmodified DNA substrate contained a G at the incorporation position, dCTP was selected to pair with G or abasic site in the binding assays. DNA polymerase was flowed over the chip in the presence of dCTP. Helicase was then flowed over the chip in the presence of non-hydrolyzable-β, γ-methylene dTTP. Both dCTP and non-hydrolyzable dTTP cannot support helicase unwinding (32). Thus, helicase would be locked at DNA fork by non-hydrolyzable dTTP or possibly by dCTP. The binding of polymerase or helicase to DNA fork containing G or abasic site was measured. Helicase was flowed over the chip in the presence of non-hydrolyzable-β, γ-methylene dTTP to form stable helicase–fork complex. DNA polymerase was then flowed over the chip to measure the binding of DNA polymerase to helicase at fork (Figure 3A). DNA fork alone in the chip was used to compensate for the background. The Cdd at primer terminus blocked DNA polymerisation at the fork. Abasic site at DNA fork weakened the binding between helicase and fork and also significantly inhibited the subsequent binding of DNA polymerase to helicase–fork complex. In control flow cell, the identical DNA fork was immobilised and the binding of polymerase onto DNA fork had been deducted as background. Thus, the presence of abasic site at DNA fork inhibited the binding between DNA polymerase and helicase at DNA fork. Figure 3. Open in new tabDownload slide Abasic site at DNA fork inhibited the binding among DNA polymerase, helicase and DNA fork. The identical molar amount of DNA replication fork (30-mer/63-mer/62-mer, 300 RU) containing G or abasic site was coupled to an SA chip. (A) Helicase (2 μM, monomer concentration) in buffer B containing 1-mM non-hydrolyzable dTTP was flowed over the chip to form stably locked helicase–fork complex. Polymerase (1 μM) was injected in buffer B containing 1-mM non-hydrolyzable dTTP and 1-mM dCTP. The same DNA fork without helicase was used to compensate–for background. The arrows indicate the beginning and stop of injection. (B) Similarly, DNA polymerase (600 nM) in buffer B containing 1-mM non-hydrolyzable dTTP and 1-mM dCTP was flowed over the chip to form a stable polymerase–fork complex. Helicase (4 μM, monomer concentration) was injected in buffer B containing 1-mM non-hydrolyzable dTTP to study the binding of helicase to polymerase at DNA fork. Representative data from three independent repetitions are displayed. (C) The maximal response just before stop injection was normalised against the response value of the corresponding unmodified G and plotted against every binding event for DNA fork containing G or abasic site. The averages and standard errors were obtained from three independent assays by fitting using Prism. Figure 3. Open in new tabDownload slide Abasic site at DNA fork inhibited the binding among DNA polymerase, helicase and DNA fork. The identical molar amount of DNA replication fork (30-mer/63-mer/62-mer, 300 RU) containing G or abasic site was coupled to an SA chip. (A) Helicase (2 μM, monomer concentration) in buffer B containing 1-mM non-hydrolyzable dTTP was flowed over the chip to form stably locked helicase–fork complex. Polymerase (1 μM) was injected in buffer B containing 1-mM non-hydrolyzable dTTP and 1-mM dCTP. The same DNA fork without helicase was used to compensate–for background. The arrows indicate the beginning and stop of injection. (B) Similarly, DNA polymerase (600 nM) in buffer B containing 1-mM non-hydrolyzable dTTP and 1-mM dCTP was flowed over the chip to form a stable polymerase–fork complex. Helicase (4 μM, monomer concentration) was injected in buffer B containing 1-mM non-hydrolyzable dTTP to study the binding of helicase to polymerase at DNA fork. Representative data from three independent repetitions are displayed. (C) The maximal response just before stop injection was normalised against the response value of the corresponding unmodified G and plotted against every binding event for DNA fork containing G or abasic site. The averages and standard errors were obtained from three independent assays by fitting using Prism. Similarly, DNA polymerase was flowed over the chip to form a stable polymerase–fork complex (Figure 3B). Subsequently, helicase was flowed over the chip to measure the binding of helicase with polymerase at DNA fork. Abasic site at DNA fork obviously inhibited the binding of polymerase onto fork and also weakened the subsequent binding of helicase onto polymerase at DNA fork. Therefore, all these results showed that abasic site at DNA fork inhibited the binding of DNA polymerase or helicase with DNA fork and also inhibited the binding between polymerase and helicase at fork. Discussion Strand-displacement DNA synthesis at DNA replication fork requires the movement of both DNA polymerase and helicase. Helicase could preferentially use dTTP as energy source to drive dsDNA unwinding (32,33). In the presence of four dNTPs, dTTP mainly provides the driving force for helicase unwinding and four dNTPs provide building blocks for DNA polymerisation. Relative to unmodified DNA, abasic site strongly inhibits primer extension on P/T substrate (Figure 1A and B) and completely blocks strand-displacement DNA synthesis at DNA fork (Figure 1C–F). Kinetic analysis shows that the inhibition in both primer extension and strand-displacement DNA synthesis is due to the reduced productive complex fraction (A values) and the decreased average extension rates (k values) (Figure 2). The DNA fork used in this work contains an abasic site at the incorporation position. Thus, the biochemical kinetic properties can be related and compared with the biophysical binding behaviours at this kind of DNA substrate. Binding assays show that the abasic site at DNA fork inhibits the binding of DNA polymerase or helicase onto DNA fork and also inhibits the binding between polymerase and helicase at fork (Figure 3). These results well explain that abasic site at DNA fork inhibits strand-displacement DNA synthesis relative to unmodified fork. Proofreading-proficient T7 DNA polymerase is unable to bypass an abasic site (34), but exonuclease-deficient T7 polymerase could partially bypass this abasic site and extend primer to 62-mer product on P/T substrate (Figure 1B). DNA polymerase and helicase complex could also partially bypass this lesion and forms 28-mer and 29-mer products at DNA fork (Figure 1D). Therefore, DNA polymerase alone bypasses this abasic site on P/T substrate more efficiently than does polymerase and helicase complex bypass it at DNA fork. The addition of gp2.5 further inhibits this lesion bypass at DNA fork (Figure 1F). Kinetic analysis shows that this inhibition is mainly due to the inhibition in the formation of enzyme∙DNA productive complex (A value) instead of the changes in extension rate (k value; Figure 2B and C). In T7 DNA replisome, the C-terminal tail of helicase interacts with the Fbp and TBDbp of DNA polymerase, whereas the non-tail region of helicase also interacts with DNA polymerase (10,11). These protein interactions maintain the coordinated and efficient DNA replication and also promote the bypass of nick (15,16), CPD (17), 8-oxoG, O6-MeG lesion (18) or consecutive multiple rNMPs (19). Gp2.5 could accelerate T7 primer extension and strand-displacement DNA synthesis at unmodified DNA fork or fork containing 8-oxoG or O6-MeG (18,28), suggesting that the interactions of polymerase with helicase or with ssDNA binding (SSB) protein facilitate DNA synthesis and DNA damage bypass. The presence of SSB proteins also stimulates strand-displacement DNA synthesis in T4 and E. coli replisome (35–37). The cycling of SSB on and off DNA enables the replisome to bypass a large number of dimer lesions produced by UV-irradiation (38). The E. coli replisome blocked by DNA lesions can be reinitiated by primase DnaG or by other translesion DNA polymerases (39,40). The T4 DNA holoenzyme cannot bypass a locked nucleic acid (lesion) but can overcome this lesion in cooperation with UvsW helicase through the formation of a four-way Holliday junction (41). In eukaryotic replisome, Mcm10 binds CMG helicase and greatly stimulates its helicase activity in vitro and enables CMG and the replisome to bypass dual SA blocks on the lagging DNA strand (42). All these results in T7 and in other DNA replisome show that protein interactions at DNA fork could promote strand-displacement DNA synthesis across DNA damage. However, in this work, protein interactions in T7 DNA replisome unexpectedly inhibit translesion DNA synthesis across an abasic site, mainly due to the inhibition in the formation of enzyme∙DNA productive complex. This phenomenon was also observed for E. coli DNA polymerase I, which reduces the capability to bypass aminofluorene-containing M13 DNA in the presence of SSB, because SSB binds downstream ssDNA and retards DNA replication (43). In summary, relative to unmodified DNA, abasic site strongly inhibits primer extension and completely blocks strand-displacement DNA synthesis. Abasic site at DNA fork inhibits the binding of DNA polymerase or helicase onto DNA fork and the binding between polymerase and helicase at DNA fork. DNA polymerase alone bypasses abasic site on P/T more efficiently than does polymerase and helicase complex bypass this lesion at DNA fork. The presence of gp2.5 further inhibits the abasic site bypass at fork. This inhibition is mainly due to the reduced fraction of enzyme–DNA productive complex. Different from all the reported results, it was the first time that we found DNA polymerase alone is more efficient in translesion DNA synthesis than its corresponding DNA replisome. Funding This work was financially support by the National Key Research and Development Program 2017YFC1002002, Fundamental Research Funds for the Central Universities, NSFC Nos. 31370793 and 81422041, and the Youth 1000 Talent Plan. Conflict of interest statement: None declared. References 1. Liu , B. , Xue , Q. , Tang , Y. , Cao , J. , Guengerich , F. P. and Zhang , H . ( 2016 ) Mechanisms of mutagenesis: DNA replication in the presence of DNA damage . Mutat. Res. Rev. Mutat. Res. , 768 , 53 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Gu , S. , Xiong , J. , Shi , Y. , You , J. , Zou , Z. , Liu , X. and Zhang , H . ( 2017 ) Error-prone bypass of O6-methylguanine by DNA polymerase of Pseudomonas aeruginosa phage PaP1 . DNA Repair , 57 , 35 – 44 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Lindahl , T . ( 1993 ) Instability and decay of the primary structure of DNA . Nature , 362 , 709 – 715 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Yang , J. , Wang , R. , Liu , B. , Xue , Q. , Zhong , M. , Zeng , H. and Zhang , H . ( 2015 ) Kinetic analysis of bypass of abasic site by the catalytic core of yeast DNA polymerase η . Mutat. Res. , 779 , 134 – 143 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Devadoss , B. , Lee , I. and Berdis , A. J . ( 2007 ) Enhancing the “A-rule” of translesion DNA synthesis: promutagenic DNA synthesis using modified nucleoside triphosphates . Biochemistry , 46 , 13752 – 13761 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Sagher , D. and Strauss , B . ( 1985 ) Abasic sites from cytosine as termination signals for DNA synthesis . Nucleic Acids Res. , 13 , 4285 – 4298 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Fiala , K. A. , Hypes , C. D. and Suo , Z . ( 2007 ) Mechanism of abasic lesion bypass catalyzed by a Y-family DNA polymerase . J. Biol. Chem. , 282 , 8188 – 8198 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Zhao , B. , Xie , Z. , Shen , H. and Wang , Z . ( 2004 ) Role of DNA polymerase η in the bypass of abasic sites in yeast cells . Nucleic Acids Res. , 32 , 3984 – 3994 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Liu , X. , Zou , X. , Li , H. , Zou , Z. , Yang , J. , Wang , C. , Wu , S. and Zhang , H . ( 2018 ) Bypass of an abasic site via the A-rule by DNA polymerase of Pseudomonas aeruginosa phage PaP1 . Chem. Res. Toxicol. , 31 , 58 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Zhang , H. , Lee , S. J. and Richardson , C. C . ( 2011 ) Essential protein interactions within the replisome regulate DNA replication . Cell Cycle , 10 , 3413 – 3414 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Zhang , H. , Lee , S. J. , Zhu , B. , Tran , N. Q. , Tabor , S. and Richardson , C. C . ( 2011 ) Helicase-DNA polymerase interaction is critical to initiate leading-strand DNA synthesis . Proc. Natl. Acad. Sci. U.S.A. , 108 , 9372 – 9377 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Zhang , H. , Tang , Y. , Lee , S. J. , Wei , Z. , Cao , J. and Richardson , C. C . ( 2016 ) Binding affinities among DNA helicase-primase, DNA polymerase, and replication intermediates in the replisome of bacteriophage T7 . J. Biol. Chem. , 291 , 1472 – 1480 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Zhang , H. , Lee , S. J. and Richardson , C. C . ( 2012 ) The roles of tryptophans in primer synthesis by the DNA primase of bacteriophage T7 . J. Biol. Chem. , 287 , 23644 – 23656 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Marintcheva , B. , Hamdan , S. M. , Lee , S. J. and Richardson , C. C . ( 2006 ) Essential residues in the C terminus of the bacteriophage T7 gene 2.5 single-stranded DNA-binding protein . J. Biol. Chem. , 281 , 25831 – 25840 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Zhu , B. , Lee , S. J. and Richardson , C. C . ( 2011 ) Bypass of a nick by the replisome of bacteriophage T7 . J. Biol. Chem. , 286 , 28488 – 28497 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Ghosh , S. , Marintcheva , B. , Takahashi , M. and Richardson , C. C . ( 2009 ) C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA . J. Biol. Chem. , 284 , 30339 – 30349 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Sun , B. , Pandey , M. , Inman , J. T. , Yang , Y. , Kashlev , M. , Patel , S. S. and Wang , M. D . ( 2015 ) T7 replisome directly overcomes DNA damage . Nat. Commun. , 6 , 10260 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Zou , Z. , Chen , Z. , Xue , Q. , Xu , Y. , Xiong , J. , Yang , P. , Le , S. , and Zhang , H . ( 2018 ) Protein interactions in T7 DNA replisome facilitate DNA damage bypass . ChemBioChem , 19 , 1740 – 1749 . Google Scholar Crossref Search ADS WorldCat 19. Zou , Z. , Chen , Z. , Cai , Y. , Yang , H. , Du , K. , Li , B. , Jiang , Y. and Zhang , H . ( 2018 ) Consecutive ribonucleoside monophosphates on template inhibit DNA replication by T7 DNA polymerase or by T7 polymerase and helicase complex . Biochimie , 151 , 128 – 138 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Zou , Z. , Wu , S. , Xiong , J. , Li , H. , Jiang , Y. and Zhang , H . ( 2018 ) ssDNA hybridization facilitated by T7 ssDNA binding protein (gp2.5) rapidly initiates from the strand terminus or internally followed by a slow zippering step . Biochimie , 147 , 1 – 12 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Gu , S. , Xue , Q. , Liu , Q. , Xiong , M. , Wang , W. , and Zhang , H . ( 2017 ) Error-free bypass of 7,8-dihydro-8-oxo-2’-deoxyguanosine by DNA polymerase of Pseudomonas aeruginosa Phage PaP1 . Genes , 8 , 18 . Google Scholar Crossref Search ADS WorldCat 22. Liu , B. , Xue , Q. , Gu , S. , Wang , W. , Chen , J. , Li , Y. , Wang , C. and Zhang , H . ( 2016 ) Kinetic analysis of bypass of O6-methylguanine by the catalytic core of yeast DNA polymerase η . Arch. Biochem. Biophys. , 596 , 99 – 107 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Zhang , H. , Lee , S. J. , Kulczyk , A. W. , Zhu , B. and Richardson , C. C . ( 2012 ) Heterohexamer of 56- and 63-kDa gene 4 helicase-primase of bacteriophage T7 in DNA replication . J. Biol. Chem. , 287 , 34273 – 34287 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Cox , M. M. , Goodman , M. F. , Kreuzer , K. N. , Sherratt , D. J. , Sandler , S. J. and Marians , K. J . ( 2000 ) The importance of repairing stalled replication forks . Nature , 404 , 37 – 41 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Stano , N. M. , Jeong , Y. J. , Donmez , I. , Tummalapalli , P. , Levin , M. K. and Patel , S. S . ( 2005 ) DNA synthesis provides the driving force to accelerate DNA unwinding by a helicase . Nature , 435 , 370 – 373 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Hamdan , S.M. , Johnson , D.E. , Tanner , N.A. , Lee , J.B. , Qimron , U. , Tabor , S. , van Oijen , A.M. , and Richardson , C.C. ( 2007 ) Dynamic DNA helicase-DNA polymerase interactions assure processive replication fork movement . Mol. cell , 27 , 539 – 549 . 27. Hamdan , S. M. and Richardson , C. C . ( 2009 ) Motors, switches, and contacts in the replisome . Annu. Rev. Biochem. , 78 , 205 – 243 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Ghosh , S. , Hamdan , S. M. and Richardson , C. C . ( 2010 ) Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex . J. Biol. Chem. , 285 , 18103 – 18112 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Zhang , H. , Eoff , R. L. , Kozekov , I. D. , Rizzo , C. J. , Egli , M. and Guengerich , F. P . ( 2009 ) Versatility of Y-family Sulfolobus solfataricus DNA polymerase Dpo4 in translesion synthesis past bulky N2-alkylguanine adducts . J. Biol. Chem. , 284 , 3563 – 3576 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Zhang , H. , Eoff , R. L. , Kozekov , I. D. , Rizzo , C. J. , Egli , M. and Guengerich , F. P . ( 2009 ) Structure-function relationships in miscoding by Sulfolobus solfataricus DNA polymerase Dpo4: guanine N2,N2-dimethyl substitution produces inactive and miscoding polymerase complexes . J. Biol. Chem. , 284 , 17687 – 17699 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Tabor , S. , Huber , H. E. and Richardson , C. C . ( 1987 ) Escherichia coli thioredoxin confers processivity on the DNA polymerase activity of the gene 5 protein of bacteriophage T7 . J. Biol. Chem. , 262 , 16212 – 16223 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 32. Satapathy , A. K. , Crampton , D. J. , Beauchamp , B. B. and Richardson , C. C . ( 2009 ) Promiscuous usage of nucleotides by the DNA helicase of bacteriophage T7: determinants of nucleotide specificity . J. Biol. Chem. , 284 , 14286 – 14295 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Matson , S. W. , and Richardson , C. C . ( 1983 ) DNA-dependent nucleoside 5’-triphosphatase activity of the gene 4 protein of bacteriophage T7 . J. Biol. Chem ., 258 , 4009 – 4016 . OpenURL Placeholder Text WorldCat 34. McCulloch , S. D. and Kunkel , T. A . ( 2006 ) Multiple solutions to inefficient lesion bypass by T7 DNA polymerase . DNA Repair (Amst). , 5 , 1373 – 1383 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Pandey , M. and Patel , S. S . ( 2014 ) Helicase and polymerase move together close to the fork junction and copy DNA in one-nucleotide steps . Cell Rep. , 6 , 1129 – 1138 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Yuan , Q. and McHenry , C. S . ( 2009 ) Strand displacement by DNA polymerase III occurs through a τ-ψ-χ link to single-stranded DNA-binding protein coating the lagging strand template . J. Biol. Chem. , 284 , 31672 – 31679 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Cha , T. A. and Alberts , B. M . ( 1989 ) The bacteriophage T4 DNA replication fork. Only DNA helicase is required for leading strand DNA synthesis by the DNA polymerase holoenzyme . J. Biol. Chem. , 264 , 12220 – 12225 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 38. Trovcević , Z. , Petranović , M. , Brcić-Kostić , K. , Petranović , D. , Lers , N. and Salaj-Smic , E . ( 1991 ) A possible interaction of single-strand binding protein and RecA protein during post-ultraviolet DNA synthesis . Biochimie , 73 , 515 – 517 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Yeeles , J. T. and Marians , K. J . ( 2011 ) The Escherichia coli replisome is inherently DNA damage tolerant . Science , 334 , 235 – 238 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Nevin , P. , Gabbai , C. C. and Marians , K. J . ( 2017 ) Replisome-mediated translesion synthesis by a cellular replicase . J. Biol. Chem. , 292 , 13833 – 13842 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Manosas , M. , Perumal , S. K. , Croquette , V. and Benkovic , S. J . ( 2012 ) Direct observation of stalled fork restart via fork regression in the T4 replication system . Science , 338 , 1217 – 1220 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Langston , L. D. , Mayle , R. , Schauer , G. D. , Yurieva , O. , Zhang , D. , Yao , N. Y. , Georgescu , R. E. , and O’Donnell , M. E . ( 2017 ) Mcm10 promotes rapid isomerization of CMG-DNA for replisome bypass of lagging strand DNA blocks . Elife , 6 , e29118 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Michaels , M. L. , Lee , M. S. and Romano , L. J . ( 1986 ) Contrasting effects of Escherichia coli single-stranded DNA binding protein on synthesis by T7 DNA polymerase and Escherichia coli DNA polymerase I (large fragment). Evidence that binding protein inhibits trans-lesion synthesis by polymerase I . J. Biol. Chem. , 261 , 4847 – 4854 . Google Scholar PubMed OpenURL Placeholder Text WorldCat © The Author(s) 2019. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Protein interactions in T7 DNA replisome inhibit the bypass of abasic site by DNA polymerase
JF - Mutagenesis
DO - 10.1093/mutage/gez013
DA - 2019-12-19
UR - https://www.deepdyve.com/lp/oxford-university-press/protein-interactions-in-t7-dna-replisome-inhibit-the-bypass-of-abasic-T3ll8sh8Ra
SP - 355
VL - 34
IS - 4
DP - DeepDyve
ER -