TY - JOUR
AU1 - Sawada,, Hiroshi
AU2 - Takami,, Kenji
AU3 - Asahi,, Satoru
AB - Abstract Phospholipidosis is a lipid storage disorder in which excess phospholipids accumulate within cells. Some cationic amphiphilic compounds are known to have the potential to induce phospholipidosis. This study was undertaken to examine the molecular mechanisms that contribute to the development of phospholipidosis and to identify specific markers that might form the basis of an in vitro screening test. Specifically, we performed a large-scale gene expression analysis using DNA microarrays on human hepatoma HepG2 cells after they were treated with each of 12 compounds known to induce phospholipidosis. In electron microscopy, HepG2 cells developed lamellar myelin-like bodies in their lysosomes, the characteristic change of phospholipidosis, after treatment with these compounds for 72 h. DNA microarray analysis performed 6 and 24 h after treatment showed alterations in gene expression reflecting the inhibition of lysosomal phospholipase activity and lysosomal enzyme transport, and the induction of phospholipid and cholesterol biosynthesis. Seventeen genes that showed a similar expression profile following treatment were selected as candidate markers. Real-time PCR analysis confirmed that 12 gene markers showed significant concordance with lamellar myelin-like body formation. Furthermore, the average fold change values of these markers correlated well with the magnitude of this pathological change. In conclusion, microarray analysis revealed that factors such as alterations in lysosomal function and cholesterol metabolism were involved in the induction of phospholipidosis. Furthermore, comprehensive gene expression analysis enabled us to identify biomarkers of this condition that we then used to develop a rapid and sensitive in vitro screening test for drug-induced phospholipidosis. drug-induced phospholipidosis, DNA microarray, real-time PCR, HepG2 cells, toxicogenomics, in vitro screening test Phospholipidosis is a lipid storage disorder in which phospholipids accumulate in lysosomes. More than 50 cationic amphiphilic drugs (CADs), including antidepressants as well as antianginal, antimalarial, and cholesterol-lowering agents, have been reported to induce phospholipidosis (Lullmann et al., 1978; Halliwell, 1997, Reasor, 1989). While CADs are thought to induce phospholipidosis by inhibiting lysosomal phospholipase activity, the mechanism by which this occurs has not been extensively studied and is not well understood (Hostetler and Matsuzawa, 1981; Joshi et al., 1988; Reasor and Kacew, 2001; Xia et al., 2000). Electron microscopy has been the most reliable method for identifying phospholipidotic cell damage (Drenckhahn et al., 1976), but because it is a time-consuming and expensive procedure, its use is impractical as a rapid screening tool. It was recently reported that phospholipidotic cell damage could be rapidly assessed in a human monocyte-derived U937 cell line using a Nile red fluorescent stain with a high affinity for lipids (Casartelli et al., 2003). DNA microarray technology enables investigators to monitor and quantify the expression of thousands of genes simultaneously. Use of this technology in combination with conventional tools is rapidly contributing to our understanding of the mechanisms underlying cellular toxicity, and has emerged as the field of “toxicogenomics” (Aardema and MacGregor, 2002). DNA microarray technology has the potential to more comprehensively contribute to our understanding of toxicity than any available traditional approach, since toxic changes in cells generally result from alterations not just in a single or few molecules, but in many molecular cascades. It may also help to identify early, sensitive biomarkers of toxicity, since alterations in cellular molecules are thought to precede the toxic outcome. These markers could then be used to develop screening tests to predict the toxicity of particular compounds. In pharmaceutical research, such tests are an invaluable tool for cost-effectively selecting candidate drugs, prioritization and compound modification, especially in the early stages of their development. The present study was undertaken to examine the molecular mechanisms that contribute to the development of phospholipidosis and to identify specific markers that might form the basis of an in vitro screening test. Specifically, we performed a large-scale gene expression analysis using DNA microarrays on human hepatoma HepG2 cells after they were treated with one of the following 12 compounds known to induce phospholipidosis: amiodarone (Lewis et al., 1990; Martin and Standing, 1988; Reasor, 1989), amitriptyline (Drenckhahn et al., 1976), AY-9944 (Sakuragawa et al., 1977), chlorcyclizine (Lullmann-Rauch and Stoermer, 1982), chlorpromazine (Drenckhahn et al., 1976; Lullmann-Rauch, 1974), clomipramine (Lullmann-Rauch, 1974; Lullmann-Rauch and Scheid, 1975; Xia et al., 2000), fluoxetine (Gonzalez-Rothi et al., 1995), imipramine (Lullmann-Rauch, 1974; Lullmann-Rauch and Scheid, 1975), perhexiline (Hauw et al., 1980; Pessayre et al., 1979), tamoxifen (Drenckhahn et al., 1983; Lullmann and Lullmann-Rauch, 1981), thioridazine (Lullmann-Rauch, 1974), and zimelidine (Bockhardt and Lullmann-Rauch, 1980). HepG2 cells were used because they are widely accepted as a good model for in vitro toxicology studies. In vitro phospholipidosis was confirmed by electron microscopic observation of lamellar myelin-like bodies in the lysosomes of these cells. MATERIALS AND METHODS Materials. The following compounds were purchased from the following vendors: amiodarone and clozapine from ICN Biomedicals (Irvine, CA); imipramine, clarithromycin, disopyramide, erythromycin, haloperidol, ketoconazole, quinidine, sertraline, and sulfamethoxazole from Wako Pure Chemicals (Osaka, Japan); amitriptyline, AY-9944, chlorcyclizine, chlorpromazine, clomipramine, fluoxetine, perhexiline, tamoxifen, thioridazine, zimelidine, acetaminophen, flecainide, ofloxacin, and sotalol from Sigma (St. Louis, MO); levofloxacin from Apin Chemicals (Abingdon, U.K.); loratadine and sumatriptan from KEMPROTEC (Middlesbrough, U.K.); pentamidine from Toronto Research Chemicals (North York, Canada), and procainamide from Aldrich Chemical (Milwaukee, WI). All other chemicals and solvents were of the highest grade commercially available. Cell culture and drug treatment. The human hepatocellular carcinoma cell line (HepG2) was purchased from the American Type Culture Collection (ATCC, Manassas, VA). Cells in their log growth-phase were seeded (2 × 105 cells) in 24-well plates and incubated with 8.3 or 25 μmol/l of a particular compound in 0.25% dimethylsulfoxide (vehicle) in Dulbecco's modified Eagle's medium (DMEM; Gibco BRL, Grand Island, NY) supplemented with 5% heat-inactivated fetal calf serum (FCS; Bio Whittaker, Walkersville, MD), 100 U/ml penicillin, and 100 g/ml streptomycin (Gibco BRL). Cells were incubated in a 37°C incubator in an atmosphere of 5% CO2 and 95% air, and were cultured for 72 h, 6 and 24 h, or 24 h, depending on whether they were being used for electron microscopy, DNA microarray analysis, or real-time PCR, respectively. Transmission electron microscopy. Following incubation, cells were fixed in 1% glutaraldehyde for 2 h after which they were washed with sodium phosphate buffer and post-fixed with 2% osmium tetroxide for 2 h. They were then dehydrated in increasing concentrations of ethanol and embedded in epoxy resin (Quetol 812). Ultrathin sections (80 nm) were cut using an ultramicrotome (LKB-8800 Ultrotome), double stained with uranyl acetate and lead acetate, and observed in an electron microscope (H-300; Hitachi, Tokyo, Japan). The pathological changes indicative of phospholipidosis (formation of lamellar myelin-like bodies in lysosomes) were scored on a scale of 0 to 3 (− = none, + = slight, ++ = moderate, and +++ = severe) in a blinded fashion. RNA preparation. Following incubation with a test compound, cells were harvested and stored at −80°C until their RNA was extracted using an RNeasy Mini Kit (QIAGEN, Hilden, Germany). For the microarray analysis, RNA was extracted from similarly treated cells that were harvested from six wells and pooled. The concentration and purity of their total RNA were determined by measuring absorbance at 260 and 280 nm with an Ultrospec 2000 spectrophotometer (Amersham Biosciences, Piscataway, NJ). The integrity of the purified total RNA was confirmed using an RNA 6000 Nano Assay kit and Agilent 2100 Bioanalyzer (Agilent Technologies, Berlin, Germany). RNA samples were stored at −80°C until assayed. Microarray experiments. Microarray analysis was carried out using the GeneChip System (Affymetrix, Santa Clara, CA). The targets of GeneChip analysis were prepared as described in the Expression Analysis Technical Manual. Briefly, total RNA (5 μg) was converted into double-stranded cDNA using a Super Script Choice cDNA synthesis kit (Invitrogen, Carlsbad, CA) with an oligo(dT)24 primer containing a T7 polymerase promoter site at its 3′ end (Amersham Biosciences). Biotin-labeled cRNA was generated from double-stranded cDNA using a BioArray HighYield RNA transcript labeling kit (Enzo Biochem, Farmingdale, NY) and was purified using a GeneChip Sample Cleanup Module (QIAGEN). Each cRNA sample (20 μg) was fragmented and hybridized with the Human Genome Array containing 22283 human specific probe sets (HG-U133A; Affymetrix, Santa Clara, CA) for 16 h at 45°C with rotation at 60 rpm. Each array was then washed and detected by consecutive exposure to phycoerythrin-streptavidin (Molecular Probes, Eugene, OR), biotinylated antibodies to streptavidin (Vector Laboratories, Burlingame, CA), and phycoerythrin-streptavidin, after which each array was washed again with a nonstringent wash buffer. All washing and staining procedures were performed with a Fluidics Station 400 (Affymetrix). The array was scanned using a confocal microscope scanner (Hewlett-Packard). To achieve wider signal dynamic range, each chip was scanned three times: before, after the first, and after the second signal amplification using an anti-streptavidin antibody. The output fluorescence was captured using Affymetrix Microarray Analysis Suite 5.0 software (Affymetrix). This software qualitatively rates the abundance of mRNA of genes (detection call) as present, marginal, or absent, and can also perform comparative analyses between vehicle and drug treated samples at each time point to provide a change call (increased, decreased, marginally increased, marginally decreased, no change) and to generate a signal log ratio (SLR), i.e., the change in expression level for a transcript. This SLR was expressed as the log 2 ratio. A SLR of 1 is the same as a fold change of 2. Probe sets that satisfied all of the following three conditions in two or three of the three scan data were extracted as up-regulated probe sets: (1) more than 0.6 in their SLR; (2) assigned as “increased”; and (3) determined as “present in the drug-treated data.” Similarly, probe sets that satisfied the following three conditions in two or three of the three scan data were extracted as down-regulated genes: (1) less than −0.6 in their SLR; (2) assigned as “decreased”; and (3) determined as “present in vehicle-treated data.” All probe sets representing genes of interest for this study were functionally annotated by the NetAffx database (Affymetrix) and HumanPSD (Incyte, Beverly, MA). Reverse transcription and real-time PCR analysis. Reverse transcription (RT) was performed using total RNA (1 μg) and oligo-dT oligonucleotide primer in 100 μl volumes using standard methods with MultiScribe Transcriptase in order to synthesize cDNA (TaqMan Reverse Transcription Reagent; Applied Biosystems). Primers and TaqMan probes (SigmaGenosys, Hokkaido, Japan) used in this study were designed with Primer Express version 1.5 software (PE Applied Biosystems, Foster City, CA). The mRNA sequences used to design the primer and probe sets were obtained from the Affymetrix database (NetAffx). The TaqMan probes had 6-carboxyfluorescein (6-FAM) as the reporter dye and 6-carboxytetramethylrhodamine (6-TAMRA) as the quencher dye at their 5′ and 3′ ends, respectively. The primer and TaqMan probe sequences used in this assay are listed in Table 1. TABLE 1 List of Candidate Markers for Phospholipidosis and Sequence of Forward Primers, Reverse Primers, and TaqMan Probes for Quantitative Real-Time PCR Analysis Gene symbol . Gene title . Forward primer . Reverse primer . TaqMan probe . ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ACCCTAAGGAAGTTGCTAACTTAAAAAA TCCACAAGTCTTTGACTTGTTTATTTACT CTGCATCCCACGTTCTGTTAATT MGC4171 Hypothetical protein MGC4171 CAGGTGGTCTTTTGGTGCCTTA AGTGGCTCCCACGCTGAA TGAAGAGTCGGATTTTGAAGCAGC LSS Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) GTCCGGTGTCTACTTGAGAAACAG AGACCCCAGCAATGTTTTCCT CCCAATGGCGACTGGCCG NR0B2 Nuclear receptor subfamily 0, group B, member 2 CAGCACTTGGCTCCTTAGGAA ACTGTGTCCAAACCAAGGAAGTC AGCTCTTCACTCAGCCACACCCC PHYH Phytanoyl-CoA hydroxylase (Refsum disease) CCCAAGAAGAAGTGAATGATTTGG ATTGGTAGGGAATGGGTTTATCAG TTAGGGTATGTTTTGTATCCCCTT FABP1 Fatty acid binding protein 1, liver GAGTTTCTCCGGCAAGTACCAA CAGACCGATTGCCTTCATGA TGCAGAGCCAGGAAAACTTTGAAGC INHBE Activin beta E GGTGATGGTCCAGAGCAACAG TGTGGACACCCCTGAAAAGG TCTTCAAGTGTACTCTGTAGGCTTCTGGGAGGT P8 p8 protein (candidate of metastasis 1) CCTCTATAGCCTGGCCCATTC CTTCTCTCTTGGTGCGACCTTT TACCTCGGAGGTGGAGGCCG HPN Hepsin (transmembrane protease, serine 1) GAAACCAGATCAAGCCCAAGAT CCCTGGCAGGCATCAATG TTCTGTGCTGGCTACCCCGA SERPINA3 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 GAGGAGGGCACAGAAGCATCT CCTTGTCTCCACTAATGCAGAAAG TGCCACAGCAGTCAAAATCACCCT ASNS Asparagine synthetase CAAGTGGATCAATGCCACTGA CCTAAGCTTTGACAGCTGACTTGTA TCTGCCCGCACGCTGACC C10orf10 Chromosome 10 open reading frame 10 TGTGGTGGCATTGGGAGAGT TGGTAGCACTGAGTGGTACAGATTC CCCCCATGATGAGGGCCAAGAT FLJ10055 Hypothetical protein FLJ10055 GGAACATCTCTTTGAATTGTATTTCTTGTA AGCCACAGCCAAAAAAGACTTT TTACATACTTAGAGAGAGACTCTTTTAGCCAG FRCP1 Likely ortholog of mouse fibronectin type III repeat containing protein 1 GGTAATGCCACTCCCACAATCT CCTTCTGGCTCTGCTCACAGT AGGCCTGGTACCCATCCTCTTTC AP1S1 Adaptor-related protein complex 1, sigma 1 subunit GCCATCGAGGGCCAAGA TTTGTCTAAGAGCTCCACGTATCG TGAGCTCATCACACTGGAGCTGATCCA SLC2A3 Solute carrier family 2 (facilitated glucose transporter), member 3 GCTTGAAAAGGTGACCTTGCA TGCCTTACTGCCAACCTACTGTT TCATGTCAACTTTCTGGCTCCTC TAGLN Transgelin GAGCATAAGAGGGAATTCACAGAGA CTGTTGCTGCCCATCTGAAG AGCTGCAGGAGGGAAAGCATGTCATTG Gene symbol . Gene title . Forward primer . Reverse primer . TaqMan probe . ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ACCCTAAGGAAGTTGCTAACTTAAAAAA TCCACAAGTCTTTGACTTGTTTATTTACT CTGCATCCCACGTTCTGTTAATT MGC4171 Hypothetical protein MGC4171 CAGGTGGTCTTTTGGTGCCTTA AGTGGCTCCCACGCTGAA TGAAGAGTCGGATTTTGAAGCAGC LSS Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) GTCCGGTGTCTACTTGAGAAACAG AGACCCCAGCAATGTTTTCCT CCCAATGGCGACTGGCCG NR0B2 Nuclear receptor subfamily 0, group B, member 2 CAGCACTTGGCTCCTTAGGAA ACTGTGTCCAAACCAAGGAAGTC AGCTCTTCACTCAGCCACACCCC PHYH Phytanoyl-CoA hydroxylase (Refsum disease) CCCAAGAAGAAGTGAATGATTTGG ATTGGTAGGGAATGGGTTTATCAG TTAGGGTATGTTTTGTATCCCCTT FABP1 Fatty acid binding protein 1, liver GAGTTTCTCCGGCAAGTACCAA CAGACCGATTGCCTTCATGA TGCAGAGCCAGGAAAACTTTGAAGC INHBE Activin beta E GGTGATGGTCCAGAGCAACAG TGTGGACACCCCTGAAAAGG TCTTCAAGTGTACTCTGTAGGCTTCTGGGAGGT P8 p8 protein (candidate of metastasis 1) CCTCTATAGCCTGGCCCATTC CTTCTCTCTTGGTGCGACCTTT TACCTCGGAGGTGGAGGCCG HPN Hepsin (transmembrane protease, serine 1) GAAACCAGATCAAGCCCAAGAT CCCTGGCAGGCATCAATG TTCTGTGCTGGCTACCCCGA SERPINA3 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 GAGGAGGGCACAGAAGCATCT CCTTGTCTCCACTAATGCAGAAAG TGCCACAGCAGTCAAAATCACCCT ASNS Asparagine synthetase CAAGTGGATCAATGCCACTGA CCTAAGCTTTGACAGCTGACTTGTA TCTGCCCGCACGCTGACC C10orf10 Chromosome 10 open reading frame 10 TGTGGTGGCATTGGGAGAGT TGGTAGCACTGAGTGGTACAGATTC CCCCCATGATGAGGGCCAAGAT FLJ10055 Hypothetical protein FLJ10055 GGAACATCTCTTTGAATTGTATTTCTTGTA AGCCACAGCCAAAAAAGACTTT TTACATACTTAGAGAGAGACTCTTTTAGCCAG FRCP1 Likely ortholog of mouse fibronectin type III repeat containing protein 1 GGTAATGCCACTCCCACAATCT CCTTCTGGCTCTGCTCACAGT AGGCCTGGTACCCATCCTCTTTC AP1S1 Adaptor-related protein complex 1, sigma 1 subunit GCCATCGAGGGCCAAGA TTTGTCTAAGAGCTCCACGTATCG TGAGCTCATCACACTGGAGCTGATCCA SLC2A3 Solute carrier family 2 (facilitated glucose transporter), member 3 GCTTGAAAAGGTGACCTTGCA TGCCTTACTGCCAACCTACTGTT TCATGTCAACTTTCTGGCTCCTC TAGLN Transgelin GAGCATAAGAGGGAATTCACAGAGA CTGTTGCTGCCCATCTGAAG AGCTGCAGGAGGGAAAGCATGTCATTG Open in new tab TABLE 1 List of Candidate Markers for Phospholipidosis and Sequence of Forward Primers, Reverse Primers, and TaqMan Probes for Quantitative Real-Time PCR Analysis Gene symbol . Gene title . Forward primer . Reverse primer . TaqMan probe . ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ACCCTAAGGAAGTTGCTAACTTAAAAAA TCCACAAGTCTTTGACTTGTTTATTTACT CTGCATCCCACGTTCTGTTAATT MGC4171 Hypothetical protein MGC4171 CAGGTGGTCTTTTGGTGCCTTA AGTGGCTCCCACGCTGAA TGAAGAGTCGGATTTTGAAGCAGC LSS Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) GTCCGGTGTCTACTTGAGAAACAG AGACCCCAGCAATGTTTTCCT CCCAATGGCGACTGGCCG NR0B2 Nuclear receptor subfamily 0, group B, member 2 CAGCACTTGGCTCCTTAGGAA ACTGTGTCCAAACCAAGGAAGTC AGCTCTTCACTCAGCCACACCCC PHYH Phytanoyl-CoA hydroxylase (Refsum disease) CCCAAGAAGAAGTGAATGATTTGG ATTGGTAGGGAATGGGTTTATCAG TTAGGGTATGTTTTGTATCCCCTT FABP1 Fatty acid binding protein 1, liver GAGTTTCTCCGGCAAGTACCAA CAGACCGATTGCCTTCATGA TGCAGAGCCAGGAAAACTTTGAAGC INHBE Activin beta E GGTGATGGTCCAGAGCAACAG TGTGGACACCCCTGAAAAGG TCTTCAAGTGTACTCTGTAGGCTTCTGGGAGGT P8 p8 protein (candidate of metastasis 1) CCTCTATAGCCTGGCCCATTC CTTCTCTCTTGGTGCGACCTTT TACCTCGGAGGTGGAGGCCG HPN Hepsin (transmembrane protease, serine 1) GAAACCAGATCAAGCCCAAGAT CCCTGGCAGGCATCAATG TTCTGTGCTGGCTACCCCGA SERPINA3 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 GAGGAGGGCACAGAAGCATCT CCTTGTCTCCACTAATGCAGAAAG TGCCACAGCAGTCAAAATCACCCT ASNS Asparagine synthetase CAAGTGGATCAATGCCACTGA CCTAAGCTTTGACAGCTGACTTGTA TCTGCCCGCACGCTGACC C10orf10 Chromosome 10 open reading frame 10 TGTGGTGGCATTGGGAGAGT TGGTAGCACTGAGTGGTACAGATTC CCCCCATGATGAGGGCCAAGAT FLJ10055 Hypothetical protein FLJ10055 GGAACATCTCTTTGAATTGTATTTCTTGTA AGCCACAGCCAAAAAAGACTTT TTACATACTTAGAGAGAGACTCTTTTAGCCAG FRCP1 Likely ortholog of mouse fibronectin type III repeat containing protein 1 GGTAATGCCACTCCCACAATCT CCTTCTGGCTCTGCTCACAGT AGGCCTGGTACCCATCCTCTTTC AP1S1 Adaptor-related protein complex 1, sigma 1 subunit GCCATCGAGGGCCAAGA TTTGTCTAAGAGCTCCACGTATCG TGAGCTCATCACACTGGAGCTGATCCA SLC2A3 Solute carrier family 2 (facilitated glucose transporter), member 3 GCTTGAAAAGGTGACCTTGCA TGCCTTACTGCCAACCTACTGTT TCATGTCAACTTTCTGGCTCCTC TAGLN Transgelin GAGCATAAGAGGGAATTCACAGAGA CTGTTGCTGCCCATCTGAAG AGCTGCAGGAGGGAAAGCATGTCATTG Gene symbol . Gene title . Forward primer . Reverse primer . TaqMan probe . ASAH1 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ACCCTAAGGAAGTTGCTAACTTAAAAAA TCCACAAGTCTTTGACTTGTTTATTTACT CTGCATCCCACGTTCTGTTAATT MGC4171 Hypothetical protein MGC4171 CAGGTGGTCTTTTGGTGCCTTA AGTGGCTCCCACGCTGAA TGAAGAGTCGGATTTTGAAGCAGC LSS Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) GTCCGGTGTCTACTTGAGAAACAG AGACCCCAGCAATGTTTTCCT CCCAATGGCGACTGGCCG NR0B2 Nuclear receptor subfamily 0, group B, member 2 CAGCACTTGGCTCCTTAGGAA ACTGTGTCCAAACCAAGGAAGTC AGCTCTTCACTCAGCCACACCCC PHYH Phytanoyl-CoA hydroxylase (Refsum disease) CCCAAGAAGAAGTGAATGATTTGG ATTGGTAGGGAATGGGTTTATCAG TTAGGGTATGTTTTGTATCCCCTT FABP1 Fatty acid binding protein 1, liver GAGTTTCTCCGGCAAGTACCAA CAGACCGATTGCCTTCATGA TGCAGAGCCAGGAAAACTTTGAAGC INHBE Activin beta E GGTGATGGTCCAGAGCAACAG TGTGGACACCCCTGAAAAGG TCTTCAAGTGTACTCTGTAGGCTTCTGGGAGGT P8 p8 protein (candidate of metastasis 1) CCTCTATAGCCTGGCCCATTC CTTCTCTCTTGGTGCGACCTTT TACCTCGGAGGTGGAGGCCG HPN Hepsin (transmembrane protease, serine 1) GAAACCAGATCAAGCCCAAGAT CCCTGGCAGGCATCAATG TTCTGTGCTGGCTACCCCGA SERPINA3 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 GAGGAGGGCACAGAAGCATCT CCTTGTCTCCACTAATGCAGAAAG TGCCACAGCAGTCAAAATCACCCT ASNS Asparagine synthetase CAAGTGGATCAATGCCACTGA CCTAAGCTTTGACAGCTGACTTGTA TCTGCCCGCACGCTGACC C10orf10 Chromosome 10 open reading frame 10 TGTGGTGGCATTGGGAGAGT TGGTAGCACTGAGTGGTACAGATTC CCCCCATGATGAGGGCCAAGAT FLJ10055 Hypothetical protein FLJ10055 GGAACATCTCTTTGAATTGTATTTCTTGTA AGCCACAGCCAAAAAAGACTTT TTACATACTTAGAGAGAGACTCTTTTAGCCAG FRCP1 Likely ortholog of mouse fibronectin type III repeat containing protein 1 GGTAATGCCACTCCCACAATCT CCTTCTGGCTCTGCTCACAGT AGGCCTGGTACCCATCCTCTTTC AP1S1 Adaptor-related protein complex 1, sigma 1 subunit GCCATCGAGGGCCAAGA TTTGTCTAAGAGCTCCACGTATCG TGAGCTCATCACACTGGAGCTGATCCA SLC2A3 Solute carrier family 2 (facilitated glucose transporter), member 3 GCTTGAAAAGGTGACCTTGCA TGCCTTACTGCCAACCTACTGTT TCATGTCAACTTTCTGGCTCCTC TAGLN Transgelin GAGCATAAGAGGGAATTCACAGAGA CTGTTGCTGCCCATCTGAAG AGCTGCAGGAGGGAAAGCATGTCATTG Open in new tab Quantitative real-time PCR was performed using 5 μl of the cDNA solution, 1× TaqMan Universal PCR Master Mix, and 200 nM of primer/probe set or 1× TaqMan GAPDH control reagents (PE Applied Biosystems) in an ABI PRISM 7000 Sequence Detection System with the following schedule: 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of denaturation for 15 s at 95°C, and annealing and elongation for 1 min at 60°C in a final volume of 50 μl. Relative gene expression levels were normalized to the expression of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and calculated using the comparative Ct method, described in User Bulletin #2 that was provided with the ABI PRISM 7700 Sequence Detection System. The expression data represent the average values from three replicates in a given experiment. RESULTS Electron Microscopy The ability of thirty compounds to induce phospholipidosis in HepG2 cells was evaluated by electron microscopy. Ultrastructural analysis of cells treated with vehicle revealed an extensive endoplasmic reticulum, numerous mitochondria and glycogen granules, and a few small lysosomes with an internal structure that consisted of thin, parallel, concentric lamellae. No lysosomal abnormalities were found in, and only a few lipid droplets were seen in the cytoplasm of, cells that were treated with vehicle or each of 13 of our test compounds (Fig. 1A). However, treatment with 17 compounds, including all of the 12 compounds used in the DNA microarray analysis portion of the study, resulted in an increased number and size of abnormal lysosomes that contained electron-dense deposits and membraneous structures arranged in whorled arrays (myelin figures) suggestive of lysosomal phospholipidosis (Figs. 1B and 1C). The phospholipidotic pathology scores for these compounds are listed in Table 2. FIG. 1. Open in new tabDownload slide Electron micrographs of HepG2 cells that were treated with vehicle (A), 8.3 μmol/l amiodarone (B), or 25 μmol/l amitriptyline (C) for 72 h. Arrows indicate abnormal lysosomes containing electron-dense deposits and membraneous structures arranged in whorled arrays (myelin figures), which are pathological changes that are characteristic of phospholipidosis (panels B, C). Bar = 5 μM. FIG. 1. Open in new tabDownload slide Electron micrographs of HepG2 cells that were treated with vehicle (A), 8.3 μmol/l amiodarone (B), or 25 μmol/l amitriptyline (C) for 72 h. Arrows indicate abnormal lysosomes containing electron-dense deposits and membraneous structures arranged in whorled arrays (myelin figures), which are pathological changes that are characteristic of phospholipidosis (panels B, C). Bar = 5 μM. TABLE 2 List of Compounds and Their Respective Phospholipidotic Pathology Scores . . . Use in . . Compound . Dose (μmol/l) . Phospholipidotic Pathology Scores . DNA microarray analysis . Real time PCR analysis . Amiodarone 8.3 ++ Yes Yes Amitriptyline 25 +++ Yes Yes AY-9944 8.3 ++ Yes Yes Chlorcyclizine 25 +++ Yes Yes Chlorpromazine 8.3 ++ Yes Yes Clomipramine 8.3 + Yes Yes Fluoxetine 8.3 +++ Yes Yes Imipramine 25 ++ Yes Yes Perhexiline 8.3 ++ Yes Yes Tamoxifen 8.3 ++ Yes Yes Thioridazine 8.3 + Yes Yes Zimelidine 25 + Yes Yes Acetaminophen 25 − No Yes Clarithromycin 25 − No Yes Clozapine 25 ++ No Yes Disopyramide 25 − No Yes Erythromycin 25 − No Yes Flecainide 25 − No Yes Haloperidol 8.3 − No Yes Ketoconazole 8.3 + No Yes Levofloxacin 25 − No Yes Loratadine 8.3 + No Yes Ofloxacin 25 − No Yes Pentamidine 8.3 + No Yes Procainamide 25 − No Yes Quinidine 25 − No Yes Sertraline 8.3 ++ No Yes Sotalol 25 − No Yes Sulfamethoxazole 25 − No Yes Sumatriptan 25 − No Yes . . . Use in . . Compound . Dose (μmol/l) . Phospholipidotic Pathology Scores . DNA microarray analysis . Real time PCR analysis . Amiodarone 8.3 ++ Yes Yes Amitriptyline 25 +++ Yes Yes AY-9944 8.3 ++ Yes Yes Chlorcyclizine 25 +++ Yes Yes Chlorpromazine 8.3 ++ Yes Yes Clomipramine 8.3 + Yes Yes Fluoxetine 8.3 +++ Yes Yes Imipramine 25 ++ Yes Yes Perhexiline 8.3 ++ Yes Yes Tamoxifen 8.3 ++ Yes Yes Thioridazine 8.3 + Yes Yes Zimelidine 25 + Yes Yes Acetaminophen 25 − No Yes Clarithromycin 25 − No Yes Clozapine 25 ++ No Yes Disopyramide 25 − No Yes Erythromycin 25 − No Yes Flecainide 25 − No Yes Haloperidol 8.3 − No Yes Ketoconazole 8.3 + No Yes Levofloxacin 25 − No Yes Loratadine 8.3 + No Yes Ofloxacin 25 − No Yes Pentamidine 8.3 + No Yes Procainamide 25 − No Yes Quinidine 25 − No Yes Sertraline 8.3 ++ No Yes Sotalol 25 − No Yes Sulfamethoxazole 25 − No Yes Sumatriptan 25 − No Yes Note. Pathological changes in HepG2 cells (formation of lamellar myelin-like bodies in lysosomes) were scored on a scale of 0 to 3 (− = no presence, + = slight, ++ = moderate, and +++ = severe) by electron microscopy, 72 h after treatment. The two columns on the right indicate whether a particular compound was used for DNA microarray or real-time PCR analysis. Open in new tab TABLE 2 List of Compounds and Their Respective Phospholipidotic Pathology Scores . . . Use in . . Compound . Dose (μmol/l) . Phospholipidotic Pathology Scores . DNA microarray analysis . Real time PCR analysis . Amiodarone 8.3 ++ Yes Yes Amitriptyline 25 +++ Yes Yes AY-9944 8.3 ++ Yes Yes Chlorcyclizine 25 +++ Yes Yes Chlorpromazine 8.3 ++ Yes Yes Clomipramine 8.3 + Yes Yes Fluoxetine 8.3 +++ Yes Yes Imipramine 25 ++ Yes Yes Perhexiline 8.3 ++ Yes Yes Tamoxifen 8.3 ++ Yes Yes Thioridazine 8.3 + Yes Yes Zimelidine 25 + Yes Yes Acetaminophen 25 − No Yes Clarithromycin 25 − No Yes Clozapine 25 ++ No Yes Disopyramide 25 − No Yes Erythromycin 25 − No Yes Flecainide 25 − No Yes Haloperidol 8.3 − No Yes Ketoconazole 8.3 + No Yes Levofloxacin 25 − No Yes Loratadine 8.3 + No Yes Ofloxacin 25 − No Yes Pentamidine 8.3 + No Yes Procainamide 25 − No Yes Quinidine 25 − No Yes Sertraline 8.3 ++ No Yes Sotalol 25 − No Yes Sulfamethoxazole 25 − No Yes Sumatriptan 25 − No Yes . . . Use in . . Compound . Dose (μmol/l) . Phospholipidotic Pathology Scores . DNA microarray analysis . Real time PCR analysis . Amiodarone 8.3 ++ Yes Yes Amitriptyline 25 +++ Yes Yes AY-9944 8.3 ++ Yes Yes Chlorcyclizine 25 +++ Yes Yes Chlorpromazine 8.3 ++ Yes Yes Clomipramine 8.3 + Yes Yes Fluoxetine 8.3 +++ Yes Yes Imipramine 25 ++ Yes Yes Perhexiline 8.3 ++ Yes Yes Tamoxifen 8.3 ++ Yes Yes Thioridazine 8.3 + Yes Yes Zimelidine 25 + Yes Yes Acetaminophen 25 − No Yes Clarithromycin 25 − No Yes Clozapine 25 ++ No Yes Disopyramide 25 − No Yes Erythromycin 25 − No Yes Flecainide 25 − No Yes Haloperidol 8.3 − No Yes Ketoconazole 8.3 + No Yes Levofloxacin 25 − No Yes Loratadine 8.3 + No Yes Ofloxacin 25 − No Yes Pentamidine 8.3 + No Yes Procainamide 25 − No Yes Quinidine 25 − No Yes Sertraline 8.3 ++ No Yes Sotalol 25 − No Yes Sulfamethoxazole 25 − No Yes Sumatriptan 25 − No Yes Note. Pathological changes in HepG2 cells (formation of lamellar myelin-like bodies in lysosomes) were scored on a scale of 0 to 3 (− = no presence, + = slight, ++ = moderate, and +++ = severe) by electron microscopy, 72 h after treatment. The two columns on the right indicate whether a particular compound was used for DNA microarray or real-time PCR analysis. Open in new tab Large-Scale DNA Microarray Gene Expression Analysis and Nomination of Candidate Markers for Phospholipidosis Probe sets that were up- or down-regulated by the 12 test compounds that induced phospholipidosis in HepG2 cells were determined based on the criteria described in Materials and Methods. The number of probe sets that were up- or down-regulated is listed in Table 3. TABLE 3 Number of Probe Sets that were Up- or Down-Regulated in HepG2 Cells by 12 Compounds Known to Induce Phospholipidosis, as Determined by DNA Microarray Analysis . 6 h . . 24 h . . Compound . Up-regulated . Down-regulated . Up-regulated . Down-regulated . Amiodarone 13 15 16 6 Amitriptyline 120 83 362 223 AY-9944 150 44 233 99 Chlorcyclizine 119 40 243 123 Chlorpromazine 58 15 119 22 Clomipramine 47 8 42 14 Fluoxetine 48 8 7 6 Imipramine 43 7 113 36 Perhexiline 82 50 397 192 Tamoxifen 158 23 16 11 Thioridazine 232 172 315 187 Zimelidine 12 11 94 16 . 6 h . . 24 h . . Compound . Up-regulated . Down-regulated . Up-regulated . Down-regulated . Amiodarone 13 15 16 6 Amitriptyline 120 83 362 223 AY-9944 150 44 233 99 Chlorcyclizine 119 40 243 123 Chlorpromazine 58 15 119 22 Clomipramine 47 8 42 14 Fluoxetine 48 8 7 6 Imipramine 43 7 113 36 Perhexiline 82 50 397 192 Tamoxifen 158 23 16 11 Thioridazine 232 172 315 187 Zimelidine 12 11 94 16 Note. Cells were treated with the test compounds for 6 or 24 h. Open in new tab TABLE 3 Number of Probe Sets that were Up- or Down-Regulated in HepG2 Cells by 12 Compounds Known to Induce Phospholipidosis, as Determined by DNA Microarray Analysis . 6 h . . 24 h . . Compound . Up-regulated . Down-regulated . Up-regulated . Down-regulated . Amiodarone 13 15 16 6 Amitriptyline 120 83 362 223 AY-9944 150 44 233 99 Chlorcyclizine 119 40 243 123 Chlorpromazine 58 15 119 22 Clomipramine 47 8 42 14 Fluoxetine 48 8 7 6 Imipramine 43 7 113 36 Perhexiline 82 50 397 192 Tamoxifen 158 23 16 11 Thioridazine 232 172 315 187 Zimelidine 12 11 94 16 . 6 h . . 24 h . . Compound . Up-regulated . Down-regulated . Up-regulated . Down-regulated . Amiodarone 13 15 16 6 Amitriptyline 120 83 362 223 AY-9944 150 44 233 99 Chlorcyclizine 119 40 243 123 Chlorpromazine 58 15 119 22 Clomipramine 47 8 42 14 Fluoxetine 48 8 7 6 Imipramine 43 7 113 36 Perhexiline 82 50 397 192 Tamoxifen 158 23 16 11 Thioridazine 232 172 315 187 Zimelidine 12 11 94 16 Note. Cells were treated with the test compounds for 6 or 24 h. Open in new tab Probe sets that were up- or down-regulated by more than 6 out of 12 compounds at each time point were identified as phospholipidosis-related genes; these probe sets are listed and categorized in Tables 4 and 5. Major functional categories included lipid metabolism, cell cycle/proliferation/death, transport, proteolysis and peptidolysis, and endopeptidase inhibition. Genes involved in lipid metabolism were particularly numerous and included those that mediated phospholipid degradation, and cholesterol and fatty acid biosynthesis. TABLE 4 Category/Function of Up-Regulated Phospholipidosis-Related Genes . . . . . Number of compounds that up-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Lipid metabolism/phospholipid degradation 210980_s_at U47674 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 6 213702_x_at AI934569 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 7 213624_at AA873600 Sphingomyelin phosphodiesterase, acid-like 3A SMPDL3A 3 6 219722_s_at NM_024307 Hypothetical protein MGC4171 MGC4171 0 7 Lipid metabolism/cholesterol biosynthesis 205822_s_at NM_002130 3-Hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 10 4 202539_s_at AL518627 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 9 4 202540_s_at NM_000859 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 11 5 213562_s_at BF979497 Squalene epoxidase SQLE 7 3 202245_at AW084510 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 4 6 211019_s_at D63807 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 3 6 201790_s_at AW150953 7-Dehydrocholesterol reductase DHCR7 4 6 201791_s_at NM_001360 7-Dehydrocholesterol reductase DHCR7 4 6 Lipid metabolism/regulation of cholesterol metabolism 206410_at NM_021969 Nuclear receptor subfamily 0, group B, member 2 NR0B2 0 8 Lipid metabolism/cholesterol metabolism 201847_at NM_000235 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA 0 6 Lipid metabolism/fatty acid biosynthesis 204256_at NM_024090 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 5 6 210868_s_at BC001305 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 4 6 211708_s_at BC005807 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 8 6 211162_x_at AF116616 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 7 7 Lipid metabolism/fatty acid alpha-oxidation 203335_at NM_006214 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH 0 9 Lipid metabolism/fatty acid transport 205892_s_at NM_001443 Fatty acid binding protein 1, liver FABP1 0 9 Lipid metabolism/lysosome enzyme 200742_s_at BG231932 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 0 6 Cell cycle, proliferation, death 221577_x_at AF003934 Prostate differentiation factor PLAB 2 9 210587_at BC005161 Activin beta E INHBE 5 8 209230_s_at AF135266 p8 protein (candidate of metastasis 1) P8 7 7 218145_at NM_021158 Chromosome 20 open reading frame 97 C20orf97 6 6 209101_at M92934 Connective tissue growth factor CTGF 0 6 200678_x_at NM_002087 Granulin GRN 0 6 216041_x_at AK023348 Granulin GRN 0 6 205302_at NM_000596 Insulin-like growth factor binding protein 1 IGFBP1 3 6 202074_s_at NM_021980 Optineurin OPTN 0 6 200921_s_at NM_001731 B-cell translocation gene 1, anti-proliferative BTG1 9 3 202769_at AW134535 Cyclin G2 CCNG2 8 3 202770_s_at NM_004354 Cyclin G2 CCNG2 6 1 Transport 209921_at AB040875 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 8 6 217678_at AA488687 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 7 4 222071_s_at BE552428 Solute carrier organic anion transporter family, member 4C1 SLCO4C1 4 6 209238_at BE966922 syntaxin 3A STX3A 1 7 219282_s_at NM_015930 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 1 6 209660_at AF162690 Transthyretin (prealbumin, amyloidosis type I) TTR 0 8 Proteolysis and peptidolysis 210944_s_at BC003169 Calpain 3, (p94) CAPN3 0 6 207300_s_at NM_000131 Coagulation factor VII (serum prothrombin conversion accelerator) F7 0 7 204934_s_at NM_002151 Hepsin (transmembrane protease, serine 1) HPN 0 10 202525_at NM_002773 Protease, serine, 8 (prostasin) PRSS8 1 7 Endopeptidase inhibition 205755_at NM_002217 Pre-alpha (globulin) inhibitor, H3 polypeptide ITIH3 0 7 202376_at NM_001085 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 SERPINA3 0 8 206239_s_at NM_003122 Serine protease inhibitor, Kazal type 1 SPINK1 0 7 Miscellaneous 205047_s_at NM_001673 Asparagine synthetase ASNS 0 8 207076_s_at NM_000050 Argininosuccinate synthetase ASS 0 7 217783_s_at NM_016061 Yippee protein CGI-127 2 7 206457_s_at NM_000792 Deiodinase, iodothyronine, type I DIO1 4 6 205945_at NM_000565 Interleukin 6 receptor IL6R 2 6 218976_at NM_021800 J domain containing protein 1 JDP1 3 6 212276_at D80010 Lipin 1 LPIN1 8 2 212272_at AA813260 Lipin 1 LPIN1 7 1 212274_at AV705559 Lipin 1 LPIN1 7 4 204351_at NM_005980 S100 calcium binding protein P S100P 0 6 218638_s_at NM_012445 Spondin 2, extracellular matrix protein SPON2 0 6 206292_s_at NM_003167 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 206293_at U08024 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 210130_s_at AF096304 Transmembrane 7 superfamily member 2 TM7SF2 0 6 Unknown/EST 205048_s_at NM_003832 — — 6 1 217188_s_at AC007182 — — 6 6 209182_s_at AI302100 Chromosome 10 open reading frame 10 C10orf10 4 9 209183_s_at AL136653 Chromosome 10 open reading frame 10 C10orf10 3 9 220675_s_at NM_025225 Chromosome 22 open reading frame 20 C22orf20 6 5 209560_s_at U15979 Delta-like 1 homolog (Drosophila) DLK1 0 6 213836_s_at AW052084 Hypothetical protein FLJ10055 FLJ10055 3 7 203827_at NM_017983 Hypothetical protein FLJ10055 FLJ10055 2 7 218843_at NM_022823 Likely ortholog of mouse fibronectin type III repeat containing protein 1 FRCP1 2 9 212942_s_at AB033025 KIAA1199 protein KIAA1199 0 6 220437_at NM_018687 Hepatocellular carcinoma-associated gene TD26 LOC55908 6 6 221864_at AW517464 Hypothetical protein MGC13024 MGC13024 2 7 204985_s_at NM_024108 Hypothetical protein MGC2650 MGC2650 0 7 202887_s_at NM_019058 HIF-1 responsive RTP801 RTP801 7 4 . . . . . Number of compounds that up-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Lipid metabolism/phospholipid degradation 210980_s_at U47674 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 6 213702_x_at AI934569 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 7 213624_at AA873600 Sphingomyelin phosphodiesterase, acid-like 3A SMPDL3A 3 6 219722_s_at NM_024307 Hypothetical protein MGC4171 MGC4171 0 7 Lipid metabolism/cholesterol biosynthesis 205822_s_at NM_002130 3-Hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 10 4 202539_s_at AL518627 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 9 4 202540_s_at NM_000859 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 11 5 213562_s_at BF979497 Squalene epoxidase SQLE 7 3 202245_at AW084510 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 4 6 211019_s_at D63807 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 3 6 201790_s_at AW150953 7-Dehydrocholesterol reductase DHCR7 4 6 201791_s_at NM_001360 7-Dehydrocholesterol reductase DHCR7 4 6 Lipid metabolism/regulation of cholesterol metabolism 206410_at NM_021969 Nuclear receptor subfamily 0, group B, member 2 NR0B2 0 8 Lipid metabolism/cholesterol metabolism 201847_at NM_000235 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA 0 6 Lipid metabolism/fatty acid biosynthesis 204256_at NM_024090 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 5 6 210868_s_at BC001305 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 4 6 211708_s_at BC005807 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 8 6 211162_x_at AF116616 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 7 7 Lipid metabolism/fatty acid alpha-oxidation 203335_at NM_006214 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH 0 9 Lipid metabolism/fatty acid transport 205892_s_at NM_001443 Fatty acid binding protein 1, liver FABP1 0 9 Lipid metabolism/lysosome enzyme 200742_s_at BG231932 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 0 6 Cell cycle, proliferation, death 221577_x_at AF003934 Prostate differentiation factor PLAB 2 9 210587_at BC005161 Activin beta E INHBE 5 8 209230_s_at AF135266 p8 protein (candidate of metastasis 1) P8 7 7 218145_at NM_021158 Chromosome 20 open reading frame 97 C20orf97 6 6 209101_at M92934 Connective tissue growth factor CTGF 0 6 200678_x_at NM_002087 Granulin GRN 0 6 216041_x_at AK023348 Granulin GRN 0 6 205302_at NM_000596 Insulin-like growth factor binding protein 1 IGFBP1 3 6 202074_s_at NM_021980 Optineurin OPTN 0 6 200921_s_at NM_001731 B-cell translocation gene 1, anti-proliferative BTG1 9 3 202769_at AW134535 Cyclin G2 CCNG2 8 3 202770_s_at NM_004354 Cyclin G2 CCNG2 6 1 Transport 209921_at AB040875 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 8 6 217678_at AA488687 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 7 4 222071_s_at BE552428 Solute carrier organic anion transporter family, member 4C1 SLCO4C1 4 6 209238_at BE966922 syntaxin 3A STX3A 1 7 219282_s_at NM_015930 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 1 6 209660_at AF162690 Transthyretin (prealbumin, amyloidosis type I) TTR 0 8 Proteolysis and peptidolysis 210944_s_at BC003169 Calpain 3, (p94) CAPN3 0 6 207300_s_at NM_000131 Coagulation factor VII (serum prothrombin conversion accelerator) F7 0 7 204934_s_at NM_002151 Hepsin (transmembrane protease, serine 1) HPN 0 10 202525_at NM_002773 Protease, serine, 8 (prostasin) PRSS8 1 7 Endopeptidase inhibition 205755_at NM_002217 Pre-alpha (globulin) inhibitor, H3 polypeptide ITIH3 0 7 202376_at NM_001085 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 SERPINA3 0 8 206239_s_at NM_003122 Serine protease inhibitor, Kazal type 1 SPINK1 0 7 Miscellaneous 205047_s_at NM_001673 Asparagine synthetase ASNS 0 8 207076_s_at NM_000050 Argininosuccinate synthetase ASS 0 7 217783_s_at NM_016061 Yippee protein CGI-127 2 7 206457_s_at NM_000792 Deiodinase, iodothyronine, type I DIO1 4 6 205945_at NM_000565 Interleukin 6 receptor IL6R 2 6 218976_at NM_021800 J domain containing protein 1 JDP1 3 6 212276_at D80010 Lipin 1 LPIN1 8 2 212272_at AA813260 Lipin 1 LPIN1 7 1 212274_at AV705559 Lipin 1 LPIN1 7 4 204351_at NM_005980 S100 calcium binding protein P S100P 0 6 218638_s_at NM_012445 Spondin 2, extracellular matrix protein SPON2 0 6 206292_s_at NM_003167 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 206293_at U08024 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 210130_s_at AF096304 Transmembrane 7 superfamily member 2 TM7SF2 0 6 Unknown/EST 205048_s_at NM_003832 — — 6 1 217188_s_at AC007182 — — 6 6 209182_s_at AI302100 Chromosome 10 open reading frame 10 C10orf10 4 9 209183_s_at AL136653 Chromosome 10 open reading frame 10 C10orf10 3 9 220675_s_at NM_025225 Chromosome 22 open reading frame 20 C22orf20 6 5 209560_s_at U15979 Delta-like 1 homolog (Drosophila) DLK1 0 6 213836_s_at AW052084 Hypothetical protein FLJ10055 FLJ10055 3 7 203827_at NM_017983 Hypothetical protein FLJ10055 FLJ10055 2 7 218843_at NM_022823 Likely ortholog of mouse fibronectin type III repeat containing protein 1 FRCP1 2 9 212942_s_at AB033025 KIAA1199 protein KIAA1199 0 6 220437_at NM_018687 Hepatocellular carcinoma-associated gene TD26 LOC55908 6 6 221864_at AW517464 Hypothetical protein MGC13024 MGC13024 2 7 204985_s_at NM_024108 Hypothetical protein MGC2650 MGC2650 0 7 202887_s_at NM_019058 HIF-1 responsive RTP801 RTP801 7 4 Note. The above probe sets were up-regulated by more than 6 out of 12 compounds that induced phospholipidosis. The category/function of each probe set was obtained from the NetAffx and HumanPSD databases. The two columns on the far right indicate the number of compounds out of 12 that up-regulated genes in HepG2 cells after 6 or 24 h of treatment. Open in new tab TABLE 4 Category/Function of Up-Regulated Phospholipidosis-Related Genes . . . . . Number of compounds that up-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Lipid metabolism/phospholipid degradation 210980_s_at U47674 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 6 213702_x_at AI934569 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 7 213624_at AA873600 Sphingomyelin phosphodiesterase, acid-like 3A SMPDL3A 3 6 219722_s_at NM_024307 Hypothetical protein MGC4171 MGC4171 0 7 Lipid metabolism/cholesterol biosynthesis 205822_s_at NM_002130 3-Hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 10 4 202539_s_at AL518627 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 9 4 202540_s_at NM_000859 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 11 5 213562_s_at BF979497 Squalene epoxidase SQLE 7 3 202245_at AW084510 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 4 6 211019_s_at D63807 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 3 6 201790_s_at AW150953 7-Dehydrocholesterol reductase DHCR7 4 6 201791_s_at NM_001360 7-Dehydrocholesterol reductase DHCR7 4 6 Lipid metabolism/regulation of cholesterol metabolism 206410_at NM_021969 Nuclear receptor subfamily 0, group B, member 2 NR0B2 0 8 Lipid metabolism/cholesterol metabolism 201847_at NM_000235 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA 0 6 Lipid metabolism/fatty acid biosynthesis 204256_at NM_024090 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 5 6 210868_s_at BC001305 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 4 6 211708_s_at BC005807 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 8 6 211162_x_at AF116616 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 7 7 Lipid metabolism/fatty acid alpha-oxidation 203335_at NM_006214 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH 0 9 Lipid metabolism/fatty acid transport 205892_s_at NM_001443 Fatty acid binding protein 1, liver FABP1 0 9 Lipid metabolism/lysosome enzyme 200742_s_at BG231932 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 0 6 Cell cycle, proliferation, death 221577_x_at AF003934 Prostate differentiation factor PLAB 2 9 210587_at BC005161 Activin beta E INHBE 5 8 209230_s_at AF135266 p8 protein (candidate of metastasis 1) P8 7 7 218145_at NM_021158 Chromosome 20 open reading frame 97 C20orf97 6 6 209101_at M92934 Connective tissue growth factor CTGF 0 6 200678_x_at NM_002087 Granulin GRN 0 6 216041_x_at AK023348 Granulin GRN 0 6 205302_at NM_000596 Insulin-like growth factor binding protein 1 IGFBP1 3 6 202074_s_at NM_021980 Optineurin OPTN 0 6 200921_s_at NM_001731 B-cell translocation gene 1, anti-proliferative BTG1 9 3 202769_at AW134535 Cyclin G2 CCNG2 8 3 202770_s_at NM_004354 Cyclin G2 CCNG2 6 1 Transport 209921_at AB040875 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 8 6 217678_at AA488687 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 7 4 222071_s_at BE552428 Solute carrier organic anion transporter family, member 4C1 SLCO4C1 4 6 209238_at BE966922 syntaxin 3A STX3A 1 7 219282_s_at NM_015930 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 1 6 209660_at AF162690 Transthyretin (prealbumin, amyloidosis type I) TTR 0 8 Proteolysis and peptidolysis 210944_s_at BC003169 Calpain 3, (p94) CAPN3 0 6 207300_s_at NM_000131 Coagulation factor VII (serum prothrombin conversion accelerator) F7 0 7 204934_s_at NM_002151 Hepsin (transmembrane protease, serine 1) HPN 0 10 202525_at NM_002773 Protease, serine, 8 (prostasin) PRSS8 1 7 Endopeptidase inhibition 205755_at NM_002217 Pre-alpha (globulin) inhibitor, H3 polypeptide ITIH3 0 7 202376_at NM_001085 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 SERPINA3 0 8 206239_s_at NM_003122 Serine protease inhibitor, Kazal type 1 SPINK1 0 7 Miscellaneous 205047_s_at NM_001673 Asparagine synthetase ASNS 0 8 207076_s_at NM_000050 Argininosuccinate synthetase ASS 0 7 217783_s_at NM_016061 Yippee protein CGI-127 2 7 206457_s_at NM_000792 Deiodinase, iodothyronine, type I DIO1 4 6 205945_at NM_000565 Interleukin 6 receptor IL6R 2 6 218976_at NM_021800 J domain containing protein 1 JDP1 3 6 212276_at D80010 Lipin 1 LPIN1 8 2 212272_at AA813260 Lipin 1 LPIN1 7 1 212274_at AV705559 Lipin 1 LPIN1 7 4 204351_at NM_005980 S100 calcium binding protein P S100P 0 6 218638_s_at NM_012445 Spondin 2, extracellular matrix protein SPON2 0 6 206292_s_at NM_003167 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 206293_at U08024 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 210130_s_at AF096304 Transmembrane 7 superfamily member 2 TM7SF2 0 6 Unknown/EST 205048_s_at NM_003832 — — 6 1 217188_s_at AC007182 — — 6 6 209182_s_at AI302100 Chromosome 10 open reading frame 10 C10orf10 4 9 209183_s_at AL136653 Chromosome 10 open reading frame 10 C10orf10 3 9 220675_s_at NM_025225 Chromosome 22 open reading frame 20 C22orf20 6 5 209560_s_at U15979 Delta-like 1 homolog (Drosophila) DLK1 0 6 213836_s_at AW052084 Hypothetical protein FLJ10055 FLJ10055 3 7 203827_at NM_017983 Hypothetical protein FLJ10055 FLJ10055 2 7 218843_at NM_022823 Likely ortholog of mouse fibronectin type III repeat containing protein 1 FRCP1 2 9 212942_s_at AB033025 KIAA1199 protein KIAA1199 0 6 220437_at NM_018687 Hepatocellular carcinoma-associated gene TD26 LOC55908 6 6 221864_at AW517464 Hypothetical protein MGC13024 MGC13024 2 7 204985_s_at NM_024108 Hypothetical protein MGC2650 MGC2650 0 7 202887_s_at NM_019058 HIF-1 responsive RTP801 RTP801 7 4 . . . . . Number of compounds that up-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Lipid metabolism/phospholipid degradation 210980_s_at U47674 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 6 213702_x_at AI934569 N-acylsphingosine amidohydrolase (acid ceramidase) 1 ASAH1 0 7 213624_at AA873600 Sphingomyelin phosphodiesterase, acid-like 3A SMPDL3A 3 6 219722_s_at NM_024307 Hypothetical protein MGC4171 MGC4171 0 7 Lipid metabolism/cholesterol biosynthesis 205822_s_at NM_002130 3-Hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble) HMGCS1 10 4 202539_s_at AL518627 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 9 4 202540_s_at NM_000859 3-Hydroxy-3-methylglutaryl-Coenzyme A reductase HMGCR 11 5 213562_s_at BF979497 Squalene epoxidase SQLE 7 3 202245_at AW084510 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 4 6 211019_s_at D63807 Lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase) LSS 3 6 201790_s_at AW150953 7-Dehydrocholesterol reductase DHCR7 4 6 201791_s_at NM_001360 7-Dehydrocholesterol reductase DHCR7 4 6 Lipid metabolism/regulation of cholesterol metabolism 206410_at NM_021969 Nuclear receptor subfamily 0, group B, member 2 NR0B2 0 8 Lipid metabolism/cholesterol metabolism 201847_at NM_000235 Lipase A, lysosomal acid, cholesterol esterase (Wolman disease) LIPA 0 6 Lipid metabolism/fatty acid biosynthesis 204256_at NM_024090 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 5 6 210868_s_at BC001305 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) ELOVL6 4 6 211708_s_at BC005807 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 8 6 211162_x_at AF116616 Stearoyl-CoA desaturase (delta-9-desaturase) SCD 7 7 Lipid metabolism/fatty acid alpha-oxidation 203335_at NM_006214 Phytanoyl-CoA hydroxylase (Refsum disease) PHYH 0 9 Lipid metabolism/fatty acid transport 205892_s_at NM_001443 Fatty acid binding protein 1, liver FABP1 0 9 Lipid metabolism/lysosome enzyme 200742_s_at BG231932 Ceroid-lipofuscinosis, neuronal 2, late infantile (Jansky-Bielschowsky disease) CLN2 0 6 Cell cycle, proliferation, death 221577_x_at AF003934 Prostate differentiation factor PLAB 2 9 210587_at BC005161 Activin beta E INHBE 5 8 209230_s_at AF135266 p8 protein (candidate of metastasis 1) P8 7 7 218145_at NM_021158 Chromosome 20 open reading frame 97 C20orf97 6 6 209101_at M92934 Connective tissue growth factor CTGF 0 6 200678_x_at NM_002087 Granulin GRN 0 6 216041_x_at AK023348 Granulin GRN 0 6 205302_at NM_000596 Insulin-like growth factor binding protein 1 IGFBP1 3 6 202074_s_at NM_021980 Optineurin OPTN 0 6 200921_s_at NM_001731 B-cell translocation gene 1, anti-proliferative BTG1 9 3 202769_at AW134535 Cyclin G2 CCNG2 8 3 202770_s_at NM_004354 Cyclin G2 CCNG2 6 1 Transport 209921_at AB040875 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 8 6 217678_at AA488687 Solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 SLC7A11 7 4 222071_s_at BE552428 Solute carrier organic anion transporter family, member 4C1 SLCO4C1 4 6 209238_at BE966922 syntaxin 3A STX3A 1 7 219282_s_at NM_015930 Transient receptor potential cation channel, subfamily V, member 2 TRPV2 1 6 209660_at AF162690 Transthyretin (prealbumin, amyloidosis type I) TTR 0 8 Proteolysis and peptidolysis 210944_s_at BC003169 Calpain 3, (p94) CAPN3 0 6 207300_s_at NM_000131 Coagulation factor VII (serum prothrombin conversion accelerator) F7 0 7 204934_s_at NM_002151 Hepsin (transmembrane protease, serine 1) HPN 0 10 202525_at NM_002773 Protease, serine, 8 (prostasin) PRSS8 1 7 Endopeptidase inhibition 205755_at NM_002217 Pre-alpha (globulin) inhibitor, H3 polypeptide ITIH3 0 7 202376_at NM_001085 Serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 SERPINA3 0 8 206239_s_at NM_003122 Serine protease inhibitor, Kazal type 1 SPINK1 0 7 Miscellaneous 205047_s_at NM_001673 Asparagine synthetase ASNS 0 8 207076_s_at NM_000050 Argininosuccinate synthetase ASS 0 7 217783_s_at NM_016061 Yippee protein CGI-127 2 7 206457_s_at NM_000792 Deiodinase, iodothyronine, type I DIO1 4 6 205945_at NM_000565 Interleukin 6 receptor IL6R 2 6 218976_at NM_021800 J domain containing protein 1 JDP1 3 6 212276_at D80010 Lipin 1 LPIN1 8 2 212272_at AA813260 Lipin 1 LPIN1 7 1 212274_at AV705559 Lipin 1 LPIN1 7 4 204351_at NM_005980 S100 calcium binding protein P S100P 0 6 218638_s_at NM_012445 Spondin 2, extracellular matrix protein SPON2 0 6 206292_s_at NM_003167 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 206293_at U08024 Sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA) -preferring, member 1 SULT2A1 0 7 210130_s_at AF096304 Transmembrane 7 superfamily member 2 TM7SF2 0 6 Unknown/EST 205048_s_at NM_003832 — — 6 1 217188_s_at AC007182 — — 6 6 209182_s_at AI302100 Chromosome 10 open reading frame 10 C10orf10 4 9 209183_s_at AL136653 Chromosome 10 open reading frame 10 C10orf10 3 9 220675_s_at NM_025225 Chromosome 22 open reading frame 20 C22orf20 6 5 209560_s_at U15979 Delta-like 1 homolog (Drosophila) DLK1 0 6 213836_s_at AW052084 Hypothetical protein FLJ10055 FLJ10055 3 7 203827_at NM_017983 Hypothetical protein FLJ10055 FLJ10055 2 7 218843_at NM_022823 Likely ortholog of mouse fibronectin type III repeat containing protein 1 FRCP1 2 9 212942_s_at AB033025 KIAA1199 protein KIAA1199 0 6 220437_at NM_018687 Hepatocellular carcinoma-associated gene TD26 LOC55908 6 6 221864_at AW517464 Hypothetical protein MGC13024 MGC13024 2 7 204985_s_at NM_024108 Hypothetical protein MGC2650 MGC2650 0 7 202887_s_at NM_019058 HIF-1 responsive RTP801 RTP801 7 4 Note. The above probe sets were up-regulated by more than 6 out of 12 compounds that induced phospholipidosis. The category/function of each probe set was obtained from the NetAffx and HumanPSD databases. The two columns on the far right indicate the number of compounds out of 12 that up-regulated genes in HepG2 cells after 6 or 24 h of treatment. Open in new tab TABLE 5 Category/Function of Down-Regulated Phospholipidosis-Related Genes . . . . . Number of compounds that down-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Transport 205196_s_at NM_001283 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 0 7 202497_x_at AI631159 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 11 202498_s_at BE550486 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 4 202499_s_at NM_006931 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 12 216236_s_at AL110298 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 8 11 222088_s_at AA778684 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 4 11 Cell cycle, proliferation, death 201631_s_at NM_003897 Immediate early response 3 IER3 6 3 204602_at NM_012242 Dickkopf homolog 1 (Xenopus laevis) DKK1 2 6 Miscellaneous 205547_s_at NM_003186 Transgelin TAGLN 2 7 204326_x_at NM_002450 Metallothionein 1X MT1X 0 6 218995_s_at NM_001955 Endothelin 1 EDN1 6 0 Unknown/EST 213349_at AI934469 KIAA0779 protein KIAA0779 0 8 . . . . . Number of compounds that down-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Transport 205196_s_at NM_001283 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 0 7 202497_x_at AI631159 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 11 202498_s_at BE550486 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 4 202499_s_at NM_006931 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 12 216236_s_at AL110298 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 8 11 222088_s_at AA778684 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 4 11 Cell cycle, proliferation, death 201631_s_at NM_003897 Immediate early response 3 IER3 6 3 204602_at NM_012242 Dickkopf homolog 1 (Xenopus laevis) DKK1 2 6 Miscellaneous 205547_s_at NM_003186 Transgelin TAGLN 2 7 204326_x_at NM_002450 Metallothionein 1X MT1X 0 6 218995_s_at NM_001955 Endothelin 1 EDN1 6 0 Unknown/EST 213349_at AI934469 KIAA0779 protein KIAA0779 0 8 Note. The above probe sets were down-regulated by more than 6 out of 12 compounds that induced phospholipidosis. The category/function of each probe set was obtained from the NetAffx and HumanPSD databases. The two columns on the far right indicate the number of compounds out of 12 that down-regulated genes in HepG2 cells after 6 or 24 h of treatment. Open in new tab TABLE 5 Category/Function of Down-Regulated Phospholipidosis-Related Genes . . . . . Number of compounds that down-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Transport 205196_s_at NM_001283 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 0 7 202497_x_at AI631159 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 11 202498_s_at BE550486 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 4 202499_s_at NM_006931 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 12 216236_s_at AL110298 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 8 11 222088_s_at AA778684 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 4 11 Cell cycle, proliferation, death 201631_s_at NM_003897 Immediate early response 3 IER3 6 3 204602_at NM_012242 Dickkopf homolog 1 (Xenopus laevis) DKK1 2 6 Miscellaneous 205547_s_at NM_003186 Transgelin TAGLN 2 7 204326_x_at NM_002450 Metallothionein 1X MT1X 0 6 218995_s_at NM_001955 Endothelin 1 EDN1 6 0 Unknown/EST 213349_at AI934469 KIAA0779 protein KIAA0779 0 8 . . . . . Number of compounds that down-regulated genes . . Category/function . Affymetrix no. . Accession no. . Gene title . Gene symbol . 6 h . 24 h . Transport 205196_s_at NM_001283 Adaptor-related protein complex 1, sigma 1 subunit AP1S1 0 7 202497_x_at AI631159 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 11 202498_s_at BE550486 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 4 202499_s_at NM_006931 Solute carrier family 2 (facilitated glucose transporter), member 3 SLC2A3 6 12 216236_s_at AL110298 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 8 11 222088_s_at AA778684 Solute carrier family 2 (facilitated glucose transporter), member 14 SLC2A14 4 11 Cell cycle, proliferation, death 201631_s_at NM_003897 Immediate early response 3 IER3 6 3 204602_at NM_012242 Dickkopf homolog 1 (Xenopus laevis) DKK1 2 6 Miscellaneous 205547_s_at NM_003186 Transgelin TAGLN 2 7 204326_x_at NM_002450 Metallothionein 1X MT1X 0 6 218995_s_at NM_001955 Endothelin 1 EDN1 6 0 Unknown/EST 213349_at AI934469 KIAA0779 protein KIAA0779 0 8 Note. The above probe sets were down-regulated by more than 6 out of 12 compounds that induced phospholipidosis. The category/function of each probe set was obtained from the NetAffx and HumanPSD databases. The two columns on the far right indicate the number of compounds out of 12 that down-regulated genes in HepG2 cells after 6 or 24 h of treatment. Open in new tab The number of phospholipidosis-related genes was greater in cells that were treated for 24 h, compared to those that were treated for only 6 h. Accordingly, 17 genes from various functional categories were nominated as candidate markers for phospholipidosis from the group of phospholipidosis-related genes that were identifiable after 24 h of treatment (Table 1). Real-Time PCR Analysis of Candidate Markers for Phospholipidosis and Selection of Phospholipidosis Markers The relative expression levels of the candidate markers for phospholipidosis are shown in Table 6. The expression of five genes (PHYH; phytanoyl-CoA hydroxylase [Refsum disease], INHBE; activin beta E, P8; p8 protein [candidate of metastasis 1], ASNS; asparagine synthetase, AP1S1; adaptor-related protein complex 1, sigma 1 subunit) did not correspond well to the pathology score of the HepG2 cells. On the other hand, the following 12 genes were selected as phospholipidosis markers: ASAH1—N-acylsphingosine amidohydrolase (acid ceramidase) 1; MGC4171—hypothetical protein MGC4171; LSS—lanosterol synthase (2,3-oxidosqualene-lanosterol cyclase); NR0B2—nuclear receptor subfamily 0, group B, member 2; FABP1—fatty acid binding protein 1, liver; HPN—hepsin (transmembrane protease, serine 1); SERPINA3—serine (or cysteine) proteinase inhibitor; clade A (alpha-1 antiproteinase, antitrypsin), member 3—C10orf10—chromosome 10 open reading frame 10; FLJ10055—hypothetical protein FLJ10055; FRCP1—likely ortholog of mouse fibronectin type III repeat containing protein 1; SLC2A3—solute carrier family 2 (facilitated glucose transporter) member 3; and TAGLN—transgelin. TABLE 6 Fold Change Values of Candidate Phospholipidosis Markers in HepG2 Cells Determined by Real-Time PCR and Pathological Analysis Note. Thirty compounds were sorted in descending order of their phospholipidotic pathological score (− = none, + = slight, ++ = moderate, and +++ = severe), which was obtained by electron microscopic analysis of HepG2 cells 72 h after treatment. Real-time PCR analysis was carried out after these cells were treated with the test compounds for 24 h. Fold changes in candidate markers of phospholipidosis, compared to vehicle, are color-coded in columns 3–19. Red and green represent relatively high and low expression, respectively. Data were standardized against GAPDH and represent the average values from three experiments. Open in new tab TABLE 6 Fold Change Values of Candidate Phospholipidosis Markers in HepG2 Cells Determined by Real-Time PCR and Pathological Analysis Note. Thirty compounds were sorted in descending order of their phospholipidotic pathological score (− = none, + = slight, ++ = moderate, and +++ = severe), which was obtained by electron microscopic analysis of HepG2 cells 72 h after treatment. Real-time PCR analysis was carried out after these cells were treated with the test compounds for 24 h. Fold changes in candidate markers of phospholipidosis, compared to vehicle, are color-coded in columns 3–19. Red and green represent relatively high and low expression, respectively. Data were standardized against GAPDH and represent the average values from three experiments. Open in new tab Establishment and Validation of an in Vitro Screening System In order to establish a representative value for phospholipidosis markers, we calculated average fold change values and referred to them as the phospholipidosis mRNA scores. There was a significant correlation between these mRNA scores and the pathological scores obtained from electron microscopic analysis of the HepG2 cells (Fig. 2). FIG. 2. Open in new tabDownload slide Correlation between phospholipidosis mRNA and pathology scores. The data from thirty compounds were sorted in descending order of their pathology scores (− = none, + = slight, ++ = moderate, and +++ = severe) by electron microscopic analysis of HepG2 cells after treatment for 72 h. Each bar represents the average fold change values of phospholipidosis markers as determined by real-time PCR analysis that was carried out in HepG2 cells after 24 h of treatment. FIG. 2. Open in new tabDownload slide Correlation between phospholipidosis mRNA and pathology scores. The data from thirty compounds were sorted in descending order of their pathology scores (− = none, + = slight, ++ = moderate, and +++ = severe) by electron microscopic analysis of HepG2 cells after treatment for 72 h. Each bar represents the average fold change values of phospholipidosis markers as determined by real-time PCR analysis that was carried out in HepG2 cells after 24 h of treatment. In order to validate these mRNA scores, we examined the mRNA and pathology scores twice more on another set of 14 compounds. Three of these compounds that had an mRNA score of <1.5 failed to induce pathology in the HepG2 cells, while the 11 compounds that had a score above 1.5 induced phospholipidotic changes in these cells. These results were highly reproducible (Fig. 3). FIG. 3. Open in new tabDownload slide Reproducibility of phospholipidosis mRNA scores. Fourteen compounds were examined twice to obtain this validation. The graph plots the average fold change values of phospholipidosis markers obtained by real-time PCR analysis in HepG2 cells after 24 h of treatment. FIG. 3. Open in new tabDownload slide Reproducibility of phospholipidosis mRNA scores. Fourteen compounds were examined twice to obtain this validation. The graph plots the average fold change values of phospholipidosis markers obtained by real-time PCR analysis in HepG2 cells after 24 h of treatment. DISCUSSION Ultrastructural analysis revealed lamellar myelin-like bodies in the lysosomes of HepG2 cells after they were treated with 12 compounds that were reported to cause phospholipidosis (Bockhardt and Lullmann-Rauch, 1980; Drenckhahn et al., 1976, 1983; Gonzalez-Rothi et al., 1995; Hauw et al., 1980; Lewis et al., 1990; Lullmann and Lullmann-Rauch, 1981; Lullmann-Rauch, 1974; Lullmann-Rauch and Scheid, 1975; Lullmann-Rauch and Stoermer, 1982; Martin and Standing, 1988; Pessayre et al., 1979; Reasor, 1989; Sakuragawa et al., 1977; Xia et al., 2000). These findings validated the use of these cells as an in vitro study model for the assessment of the phospholipidosis-inducing potential of various compounds. In this study, we examined the molecular mechanisms that contribute to the development of phospholipidosis and identified specific markers that might form the basis of an in vitro screening test. Specifically, we performed a large-scale gene expression analysis using DNA microarrays on human hepatoma HepG2 cells after they were treated with each of 12 compounds known to induce phospholipidosis. Probe sets that were up- or down-regulated by at least six compounds were identified as phospholipidosis-related genes, a large number of which were genes that played a role in lipid metabolism (Tables 4 and 5). Functional annotation and categorization of these genes suggested that the following four processes were involved in the induction of phospholipidosis (Fig. 4): (1) Inhibition of lysosomal phospholipase activity—this is generally regarded as the primary mechanism of induction, as confirmed by the up-regulation of phospholipid degradation-related genes such as N-acylsphingosine amidohydrolase 1 (ASAH1), sphingomyelin phosphodiesterase (SMPDL3A), and hypothetical protein MGC4171 (MGC4171). (2) Inhibition of lysosomal enzyme transport, as demonstrated by the down-regulation of genes involved in lysosomal enzyme transport such as adaptor-related protein complex 1 sigma 1 subunit (AP1S1). AP1S1 is responsible for the transport of newly synthesized lysosomal enzymes between the trans-golgi network and lysosomes (Zhu et al., 1999). (3) Enhanced phospholipid biosynthesis, which is supported by the up-regulation of fatty acid biosynthesis-related genes such as ELOVL family member 6 (ELOVL6) and stearoyl-CoA desaturase (SCD). (4) Enhanced cholesterol biosynthesis, as shown by the up-regulation of cholesterol biosynthesis-related genes such as 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (HMGCS1), 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR), squalene epoxidase (SQLE), lanosterol synthase (LSS), and 7-dehydrocholesterol reductase (DHCR7). FIG. 4. Open in new tabDownload slide Hypothetical mechanism of drug-induced phospholipidosis. Our data suggest that the inhibition of lysosomal phospholipase activity and enzyme transport, and promotion of phospholipid and cholesterol biosynthesis are involved in the induction of phospholipidosis. Cell proliferation and intracellular transport may be secondarily inhibited in this condition by increased intracellular phospholipid. FIG. 4. Open in new tabDownload slide Hypothetical mechanism of drug-induced phospholipidosis. Our data suggest that the inhibition of lysosomal phospholipase activity and enzyme transport, and promotion of phospholipid and cholesterol biosynthesis are involved in the induction of phospholipidosis. Cell proliferation and intracellular transport may be secondarily inhibited in this condition by increased intracellular phospholipid. Inhibition of lysosomal phospholipase activity and lysosomal enzyme transport, coupled with enhanced phospholipid biosynthesis could directly trigger phospholipidosis. Increased cholesterol biosynthesis is considered to be an indirect trigger for the following two reasons: (1) The accumulation of sphingomyelin occurs concurrently with the increase in cholesterol in visceral tissues (e.g., spleen) in patients with Niemann-Pick type C disease (NPC), which is caused by a genetic defect in the cholesterol trafficking protein NPC1 or, in far fewer patients, the sterol regulating protein HE1 (Blanchette-Mackie, 2000; Harzer et al., 2003; Vanier, 1983). (2) The induction of lamellar myelin-like bodies and the accumulation of free cholesterol occur in cultured mouse macrophages that have been incubated with acetylated low density lipoprotein or acyl-CoA:cholesterol acyltransferase inhibitor (McGookey and Anderson, 1983; Robenek and Schmitz, 1988). In addition, the up- or down-regulation of transporter genes (e.g., facilitated glucose transporter) and genes that control the cell cycle (e.g., cyclin G2) may also be involved, but modification of the expression of these genes likely reflects secondary changes that occur as a result of an increase in cellular phospholipids. An important, practical goal of our study was to identify phospholipidosis specific gene markers that could be used for the establishment of an in vitro screening test. Using DNA microarray and real-time PCR analyses, we identified 12 phospholipidosis marker genes. The average fold change values of these gene markers were calculated and termed their phospholipidosis mRNA scores, the latter of which correlated well with the cells' pathological scores. Since these phospholipidosis markers included genes whose functions included phospholipid degradation, cholesterol biosynthesis, fatty acid transport, proteolysis and peptidolysis, and endopeptidase inhibition, among others, by monitoring these 12 marker genes, we were able to also monitor multiple intracellular events that were involved in the induction of phospholipidosis. Our results showed that the mRNA score was a good index of phospholipidosis induction potential for a given compound and as such, we went ahead to establish a novel in vitro real-time PCR screening test. The in vitro screening test required a far lower amount of the test compound and shorter periods than did conventional in vivo toxicity studies, and was readily able to detect the phospholipidosis induction potential of multiple compounds. The assay also provided a more detailed ranking score than electron microscopy that can be useful in structure-activity relationship studies by sorting compounds in the order of their phospholipidosis induction potential. This rapid and sensitive system should facilitate the efficient screening of new compounds for their potential for inducing phospholipidosis at an early developmental stage. Finally, transferring our PCR-based screening system into a 96- or 384-well microplate-based mRNA measuring format such as Array Plate (High Throughput Genomics, Tucson, AZ) and QuantiGene branched DNA (Bayer Diagnostics, Tarrytown, NY), should improve its throughput and cost-efficiency. The toxicogenomics approach used in this study should be helpful in the examination of the mode of action and identification of gene markers for other toxic conditions as well. The hope is that in the near future new toxic gene markers will be identified that will allow for the testing of multiple drug toxicities simply by measuring gene expression. In conclusion, microarray analysis revealed that factors such as alterations in lysosomal function and cholesterol metabolism were involved in the induction of phospholipidosis. Furthermore, comprehensive gene expression analysis enabled us to identify biomarkers of this condition that we then used to develop a rapid and sensitive in vitro screening test for drug-induced phospholipidosis. We thank Dr. Yoshinobu Yoshimura, Dr. Kenji Okonogi, and Dr. Tetsuo Miwa for encouragement. We are grateful to our toxicogenomics and in vitro toxicology team members for their invaluable suggestions and helpful discussions. We would like to thank Mr. Kazuo Takabe for his excellent technical assistance. REFERENCES Aardema, M. J., and MacGregor, J. T. ( 2002 ). Toxicology and genetic toxicology in the new era of “toxicogenomics”: impact of “-omics” technologies. Mutat. Res. 499, 13 –25. Blanchette-Mackie, E. J. ( 2000 ). Intracellular cholesterol trafficking: Role of the NPC1 protein. Biochim. Biophys. Acta 1486, 171 –183. Bockhardt, H., and Lullmann-Rauch, R. ( 1980 ). Zimelidine-induced lipidosis in rats. Acta Pharmacol. Toxicol. (Copenh). 47, 45 –48. Casartelli, A., Bonato, M., Cristofori, P., Crivellente, F., Dal Negro, G., Masotto, I., Mutinelli, C., Valko, K., and Bonfante, V. ( 2003 ). A cell-based approach for the early assessment of the phospholipidogenic potential in pharmaceutical research and drug development. Cell Biol. Toxicol. 19, 161 –176. Drenckhahn, D., Jacobi, B., and Lullmann-Rauch, R. ( 1983 ). Corneal lipidosis in rats treated with amphiphilic cationic drugs. Arzneimittelforschung 33, 827 –831. Drenckhahn, D., Kleine, L., and Lullmann-Rauch, R. ( 1976 ). Lysosomal alterations in cultured macrophages exposed to anorexigenic and psychotropic drugs. Lab. Invest. 35, 116 –123. Gonzalez-Rothi, R. J., Zander, D. S., and Ros, P. R. ( 1995 ). Fluoxetine hydrochloride (Prozac)-induced pulmonary disease. Chest 107, 1763 –1765. Halliwell, W. H. ( 1997 ). Cationic amphiphilic drug-induced phospholipidosis. Toxicol. Pathol. 25, 53 –60. Harzer, K., Massenkeil, G., and Frohlich, E. ( 2003 ). Concurrent increase of cholesterol, sphingomyelin and glucosylceramide in the spleen from non-neurologic Niemann-Pick type C patients but also patients possibly affected with other lipid trafficking disorders. FEBS Lett. 537, 177 –181. Hauw, J. J., Boutry, J. M., Albouz, S., Harpin, M. L., Baudrimont, M., Escourolle, R., and Baumann, N. ( 1980 ). Perhexiline maleate-induced lipidosis in cultured human fibroblasts: cell kinetics, ultrastructural and biochemical studies. Virchows Arch. B. Cell Pathol. Incl. Mol. Pathol. 34, 239 –249. Hostetler, K. Y., and Matsuzawa, Y. ( 1981 ). Studies on the mechanism of drug-induced lipidosis. Cationic amphiphilic drug inhibition of lysosomal phospholipases A and C. Biochem. Pharmacol. 30, 1121 –1126. Joshi, U. M., Kodavanti, P. R., Coudert, B., Dwyer, T. M., and Mehendale, H. M. ( 1988 ). Types of interaction of amphiphilic drugs with phospholipid vesicles. J. Pharmacol. Exp. Ther. 246, 150 –157. Lewis, J. H., Mullick, F., Ishak, K. G., Ranard, R. C., Ragsdale, B., Perse, R. M., Rusnock, E. J., Wolke, A., Benjamin, S. B., Seeff, L. B., and et al. ( 1990 ). Histopathologic analysis of suspected amiodarone hepatotoxicity. Hum. Pathol. 21, 59 –67. Lullmann, H., and Lullmann-Rauch, R. ( 1981 ). Tamoxifen-induced generalized lipidosis in rats subchronically treated with high doses. Toxicol. Appl. Pharmacol. 61, 138 –146. Lullmann, H., Lullmann-Rauch, R., and Wassermann, O. ( 1978 ). Lipidosis induced by amphiphilic cationic drugs. Biochem. Pharmacol. 27, 1103 –1108. Lullmann-Rauch, R. ( 1974 ). Lipidosis-like ultrastructural alterations in rat lymph nodes after treatment with tricyclic antidepressants or neuroleptics. Naunyn. Schmiedebergs Arch. Pharmacol. 286, 165 –179. Lullmann-Rauch, R., and Scheid, D. ( 1975 ). Intraalveolar foam cells associated with lipidosis-like alterations in lung and liver of rats treated with tricyclic psychotropic drugs. Virchows Arch. B. Cell Pathol. 19, 255 –268. Lullmann-Rauch, R., and Stoermer, B. ( 1982 ). Generalized lipidosis in newborn rats and Guinea pigs induced during prenatal development by administration of amphiphilic drugs to pregnant animals. Virchows Arch. B. Cell Pathol. Incl. Mol. Pathol. 39, 59 –73. Martin, W. J., 2nd, and Standing, J. E. ( 1988 ). Amiodarone pulmonary toxicity: biochemical evidence for a cellular phospholipidosis in the bronchoalveolar lavage of human subjects. J. Pharmacol. Exp. Ther. 244, 774 –779. McGookey, D. J., and Anderson, R. G. ( 1983 ). Morphological characterization of the cholesteryl ester cycle in cultured mouse macrophage foam cells. J. Cell Biol. 97, 1156 –1168. Pessayre, D., Bichara, M., Degott, C., Potet, F., Benhamou, J. P., and Feldmann, G. ( 1979 ). Perhexiline maleate-induced cirrhosis. Gastroenterology 76, 170 –177. Reasor, M. J. ( 1989 ). A review of the biology and toxicologic implications of the induction of lysosomal lamellar bodies by drugs. Toxicol. Appl. Pharmacol. 97, 47 –56. Reasor, M. J., and Kacew, S. ( 2001 ). Drug-induced phospholipidosis: Are there functional consequences? Exp. Biol. Med. 226, 825 –830. Robenek, H., and Schmitz, G. ( 1988 ). Ca++ antagonists and ACAT inhibitors promote cholesterol efflux from macrophages by different mechanisms. II. Characterization of intracellular morphologic changes. Arteriosclerosis 8, 57 –67. Sakuragawa, N., Sakuragaw, M., Kuwabara, T., Pentchev, P. G., Barranger, J. A., and Brady, R. O. ( 1977 ). Niemann-Pick disease experimental model: Sphingomyelinase reduction induced by AY-9944. Science 196, 317 –319. Vanier, M. T. ( 1983 ). Biochemical studies in Niemann-Pick disease. I. Major sphingolipids of liver and spleen. Biochim. Biophys. Acta 750, 178 –184. Xia, Z., Ying, G., Hansson, A. L., Karlsson, H., Xie, Y., Bergstrand, A., DePierre, J. W., and Nassberger, L. ( 2000 ). Antidepressant-induced lipidosis with special reference to tricyclic compounds. Prog. Neurobiol. 60, 501 –512. Zhu, Y., Traub, L. M., and Kornfeld, S. ( 1999 ). High-affinity binding of the AP-1 adaptor complex to trans-golgi network membranes devoid of mannose 6-phosphate receptors. Mol. Biol. Cell 10, 537 –549. Author notes *Biomedical Research Laboratories, †Discovery Research Center, and ‡Development Research Center, Pharmaceutical Research Division, Takeda Pharmaceutical Company Limited, Osaka 532-8686, Japan Toxicological Sciences vol. 83 no. 2 © Society of Toxicology 2005; all rights reserved.
TI - A Toxicogenomic Approach to Drug-Induced Phospholipidosis: Analysis of Its Induction Mechanism and Establishment of a Novel in Vitro Screening System
JF - Toxicological Sciences
DO - 10.1093/toxsci/kfh264
DA - 2005-02-01
UR - https://www.deepdyve.com/lp/oxford-university-press/a-toxicogenomic-approach-to-drug-induced-phospholipidosis-analysis-of-SXqUcEjHCl
SP - 282
EP - 292
VL - 83
IS - 2
DP - DeepDyve
ER -