TY - JOUR
AU1 - Yin, Wen
AU2 - Liu, L i
AU3 - Zhou, Yuxi
AU4 - Zhang, Yunchun
AU5 - Kong, Dexu
AU6 - Xu, Saihong
AU7 - Tang, Dan
AU8 - Huang, Dan
AU9 - Wen, Daxiang
AU1 - Jiao, Yingfu
AU1 - Fan, Yinghui
AU1 - Gao, Po
AU1 - Yu, Weifeng
AB - Abstract Peripheral inflammation is always accompanied by a noxious sensation, either pain or itch, providing a protective warning for the occurrence of pathological changes; however, the mechanisms determining whether pain, itch, or both will be elicited under certain inflammatory statuses are still far from clear. Complete Freund’s adjuvant (CFA) contains heat killed and dried Mycobacterium tuberculosis widely used to induce inflammatory pain models, but how CFA treatment affects itch sensation and the possible mechanisms are still unclear. In this study, using itch behavior testing and calcium imaging, we showed that both the behaviors and calcium responses associated with Transient Receptor Potential Vanilloid 1 (TRPV1)-mediated histamine-dependent itch and Transient Receptor Potential Ankyrin 1 (TRPA1)-mediated histamine-independent itch were significantly suppressed by CFA treatment. Furthermore, to explore the possible cellular mechanisms, high-throughput single-cell RNA sequencing and real-time PCR were used to detect CFA-induced changes of itch-related genes in dorsal root ganglion (DRG) neurons. Our results revealed that although both nociceptive Trpv1+ and Trpa1+ DRG neurons were increased after CFA treatment, most known pruriceptors, including Hrh1+, Mrgpra3+, Mrgprd+, Htr3a+, Htr1f+, IL31ra+, Osmr+, and Lpar3+ DRG neurons, were significantly decreased, which may explain that CFA treatment caused itch suppression. This study indicated that itch sensation was affected after CFA treatment, although negatively, and comprehensive but not specific suppression of different pruriceptors was observed after CFA treatment, suggesting that a unified adaptive change of increased pain and decreased itch will occur simultaneously under CFA-induced inflammatory conditions. complete Freund’s adjuvant, inflammation, itch, pruriceptor, dorsal root ganglion Introduction Noxious sensations, either pain or itch, are a cardinal sign accompanying inflammation [1,2], which are mediated by nociceptor or pruriceptor neurons, respectively, and cause severe distress in many patients with different kinds of inflammation [3,4]. However, it is still unknown under what circumstances inflammation will induce pain but not itch, itch but not pain, or both pain and itch. Generally, in the periphery, the depth of inflammation is considered to determine the occurrence of pain or itch: inflammation in the epidermis mainly induces itch sensation, while inflammation occurring under the epidermis elicits pain sensation. However, this classification based on the depth of inflammation challenged by specific diseases in the clinic, such as chronic inflammatory skin disease psoriasis, parts of which have been reported to have both pain and itch as co-symptoms [5]. Additionally, different causes of inflammation, the body’s general response to pathologic changes, were also considered to determine the occurrence of pain or itch. For example, among infections that cause inflammation, most bacterial infections, including Citrobacter rodentium, Porphyromonas gingivalis, and Streptococcus pneumoniae, cause pain sensation, whereas many parasitic infections, including Hookworm and Onchocerca volvulus, cause itch sensation, and some fungal infections, including Candida albicans, cause both pain and itch [6]. In addition to infections, most tumors and physical trauma–induced inflammation mainly cause pain sensation [7,8]. Complete Freund’s adjuvant (CFA) consists of heat-killed Mycobacterium tuberculosis in non-metabolizable oils (paraffin oil and mannide monooleate) and is a commonly used immunopotentiator for the initial immunization and construction of an inflammatory pain model; however, whether and how itch sensation is affected after CFA treatment has received less research attention. Usually, pain and itch sensations are generated by the activation of peripheral nociceptor and pruriceptor ganglion neurons, respectively, and pathological changes in these neurons result in abnormal pain or itch. In the dorsal root ganglia (DRGs, also trigeminal ganglia), traditionally either Transient Receptor Potential Vanilloid 1 (TRPV1+) or Transient Receptor Potential Ankyrin 1 (TRPA1+) neurons are considered to be the main nociceptors [9], while many different pruriceptor neurons were found in recent years, such as histamine receptor H1R+ (Hrh1) neurons that mediate histamine-dependent itch [10]; MrgprA3+ neurons that mediate chloroquine (CQ)-induced histamine-independent itch [11]; MrgprD+ neurons that mediate β-alanine-induced itch [12]; IL-31 receptor+ and Osmr+ neurons that mediate IL31-induced itch [13]; and receptor Htr1f+ and Htr3a+ neurons that mediate serotonin (5-HT)-induced itch [14,15] and lysophosphatidic acid receptor 3 (Lpar3)-mediated cholestatic itch [16]. It is critical to reveal the mechanisms of pathological pain and itch by focusing on how these nociceptive and pruriceptive neurons are affected under certain inflammatory circumstances. In the present study, we first tested the change in itch sensation after CFA treatment using behavior tests and calcium imaging and then explored the possible mechanisms by determining the changes in nociceptors and pruriceptors with single-cell RNA sequencing and real-time PCR. These experiments provide fundamental observations of CFA-induced changes in itch sensation. Materials and Methods Animals The animals used in this study were male C57BL/6 mice (8–10 weeks old) obtained from Shanghai SLAC Laboratory Animals (Shanghai, China). Mice were housed in a temperature-controlled room (22°C –25°C) with a 12/12-h light/dark cycle and free access to food and water. All experimental procedures for the care and use of animals were approved by the Institutional Animal Care and Use Committee of Shanghai Jiaotong University School of Medicine and implemented in accordance with the relevant regulations of the Experimental Animal Center of Shanghai Jiaotong University School of Medicine. Behavioral testing of chemical-evoked itch A murine calf model was used for the experiments as described previously [17]. Inflammatory status was induced by injecting 20 μl CFA (Sigma, St Louis, USA) into the plantar surface of the hind paw, using a 26-gauge needle. Then, the mice were put inside a clear plexiglass chamber in a quiet room for 1 h for three consecutive days to acclimate them to the chamber. On the fifth day after CFA injection, the mice were acclimated for 30 min before the itch behavior test, and then, the CFA-injected mice and naive mice were both received intradermal injection of 20 μl histamine (400 µg per 20 µl) or CQ (200 µg per 20 µl) into the ipsilateral calf, respectively. After the intradermal injection, licking/biting behaviors directed toward the injection site were videotaped for 30 min at 5-min intervals. Biting behavior is thought to be an itch-related behavior and is characterized by movement of the jaw similar to that of a human bite (~15 Hz). Licking behavior is considered as a pain-related behavior, which involves a series of prolonged beats and head swings (~4 Hz), and sometimes, the tongue can be seen moving against the skin. DRG neuron culture Cell culture was performed as described previously [18]. Briefly, L4–L6 DRGs from adult mice (8 weeks) were collected in cold complete saline solution (CSS; 137 mM NaCl, 5.3 mM KCl, MgCl2, 25 mM sorbitol, 10 mM 2-[4-(2-Hydroxyethyl)-1-piperazinyl]-ethanesulfonic acid (HEPES), 3 mM CaCl2, pH 7.2) and then incubated in an enzyme solution composed of 0.35 U/ml Liberase TM (Roche, Basel, Switzerland) and 0.6 mM EDTA TM in CSS at 37°C for 20 min, followed by incubation at 37°C for 10 min in CSS containing 0.35 U/ml Liberase TL (Roche), 0.6 mM EDTA, and 30 U/ml papain (Worthington Biochemical, Freehold, USA). Enzymatic digestion was stopped by addition of 1 ml DRG media supplemented with 1.5 mg/ml BSA (Sigma) and 1.5 mg/ml trypsin inhibitor (Sigma). After gentle trituration with a 1-ml pipette, DRG neurons were centrifuged at 75 g for 2–3 min and resuspended in 1 ml DH10 solution (90% DMEM/F-12, 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin; Gibco, Carlsbad, USA). The DRG neurons were plated on glass coverslips coated with poly-D-lysine (0.1 mg/ml; Sigma) and laminin (5 μg/ml; Sigma) for calcium imaging within 24 h. Calcium imaging The adherent neurons were gently washed twice with Hank’s balanced salt solution (Life Technologies Corporation, New York, USA) and then incubated with the fluorescent indicator fura-2-AM (Invitrogen, Carlsbad, USA) at 5 μM supplemented with 0.01% F-127 for 30 min at 37°C in the dark. The glass coverslip was then transferred into a chamber after three times of wash with and continuously perfused at a rate of 3.0 ml/min with extracellular solution (pH 7.2) containing the following: 10 mM HEPES, 145 mM NaCl, 3 mM KCl, 2 mM MgCl2, 1 mM CaCl2, and 10 mM glucose. The intracellular Ca2+ changes were measured by excitation at F340/F380 using an inverted fluorescence microscope system (DMI8; Leica, Wetzlar, Germany). The ratio values were measured every 2 s using PCI software (LAX B; Leica). The compounds were applied via an N2 pressure-driven eight-channel microperfusion delivery system (ALA-VM8, Farmingdale, USA). Electrophysiological recordings from DRG neurons TRPA1- or TRPV1-mediated currents were recorded from neurons dissociated from L4–L6 DRGs of naive and CFA mice. The glass coverslip was transferred into a chamber after DRG neurons were cultured for 4 h and continuously perfused at a rate of 3.0 ml/min with extracellular solution (pH 7.2) containing the following: 10 mM HEPES, 145 mM NaCl, 3 mM KCl, 2 mM MgCl2, 1 mM CaCl2, and 10 mM glucose. Whole-cell patch-clamp recordings were performed at room temperature (22°C–24°C) using a MultiClamp-700B amplifier and a Digidata-1550B A/D converter (Molecular Devices, Sunnyvale, USA). The recording pipettes were pulled using a Sutter P-1000 puller (Sutter Instruments, Novato, USA). The resistance of the recording pipettes was 4–6 MΩ after filling with internal HEPES-Tris buffer (pH 7.3), which contained the following: 10 mM HEPES, 120 mM K-gluconate, 10 mM KCl, 5 mM NaCl, 1 mM CaCl2, 2 mM MgCl2, 11 mM EGTA, 2 mM Mg-ATP, and 1 mM Li-GTP. The series resistance was routinely compensated at 60%–80%. The resting membrane potential (RMP) of each neuron was recorded after stabilization (within 5 min), and only neurons with an RMP more negative than −45 mV were included in the study. The membrane potential was held at −60 mV when recording the allyl-isothiocyanate (AITC)- or capsaicin-induced TRPA1 or TRPV1 currents. AITC (100 µM) and capsaicin (1 µM) were applied for 10 and 30 s, respectively, via a 150-μm-diameter-tip perfusion pipette controlled by a DAD-12 superfusion system (ALA Scientific Instruments Inc., Farmingdale, USA), followed by washout with the extracellular solution. The signals were filtered at 2 kHz and digitized at 5 kHz, and data acquisition was performed using pClamp 10.4 software (Molecular Devices). Immunohistochemistry (IHC) Adult male mice were anesthetized with sodium pentobarbital (50 mg/kg, i.p.) and perfused with saline followed by 4% paraformaldehyde in 0.1 M phosphate buffer (4°C). L4–L6 DRGs were dissected and postfixed in 4% paraformaldehyde at 4°C for 4 h and then dehydrated in 30% sucrose solution at 4°C overnight. The tissues were cut into 10-μm-thick sections and mounted on glass slides. The sections were blocked with 10% normal goat serum for 2 h at room temperature and then incubated with the following primary antibodies at 4°C overnight: rabbit anti-TRPA1 (1:500; Abcam, Cambridge, UK) and guinea pig anti-TRPV1 (1:800; Millipore, Billerica, USA). The sections were incubated with Alexa Fluor 594- or 405-conjugated secondary antibodies (1:1000; Abcam) for 2 h at room temperature. Fluorescence images were captured with a confocal laser-scanning microscope (FV3000, Olympus Corporation, Tokyo, Japan). Quantitative real-time PCR Quantitative real-time PCR was performed according to the standard manual. Briefly, total RNA was extracted using an EZ-press RNA Purification kit (EZBioscience, Roseville, USA). The first strand of cDNA was synthesized with 1 μg RNA using the PrimeScriptTM RT Reagent kit (TaKaRa, Dalian, China). Quantitative real-time PCR was performed on a LightCycler 480 Ⅱ (Roche) using SYBR Green PCR Mix (EZBioscience). β-Actin was used as an internal control. The primer sequences for RT-PCR are shown in Table 1. Table 1. Sequence of primers used for RT-PCR Gene . Primer sequence (5′→3′) . Lpar3 Forward: CAAGCGCATGGACTTTTTCTAC Reverse: GAAATCCGCAGCAGCTAAGTT MrgprD Forward: TTTTCAGTGACATTCCTCGCC Reverse: GCACATAGACACAGAAGGGAGA MrgprA3 Forward: AGAGGAATGGGAGAAAGCAACAC Reverse: GAGCCAGAACACAATCGCAT Osmr Forward: CATCCCGAAGCGAAGTCTTGG Reverse: GGCTGGGACAGTCCATTCTAAA IL31ra Forward: TCCTGATGTTCCCAACCCTG Reverse: TTAGGACCACGTCTTCTGTGT Htr3a Forward: CCTGGCTAACTACAAGAAGGGG Reverse: TGCAGAAACTCATCAGTCCAGTA Hrh1 Forward: CAAGATGTGTGAGGGGAACAG Reverse: CTACCGACAGGCTGACAATGT Htr1f Forward: ATCAACTCCCTCGTGATCGC Reverse: ACACGTACAACAGATGATGTCG TRPV1 Forward: CCGGCTTTTTGGGAAGGGT Reverse: GAGACAGGTAGGTCCATCCAC TRPA1 Forward: TTCTTCGTGTGAAGTGCTGAAT Reverse: TGGCCTTGTGCTCAGTCAAC β-Actin Forward: AGTGTGACGTTGACATCCGT Reverse: GCAGCTCAGTAACAGTCCGC Gene . Primer sequence (5′→3′) . Lpar3 Forward: CAAGCGCATGGACTTTTTCTAC Reverse: GAAATCCGCAGCAGCTAAGTT MrgprD Forward: TTTTCAGTGACATTCCTCGCC Reverse: GCACATAGACACAGAAGGGAGA MrgprA3 Forward: AGAGGAATGGGAGAAAGCAACAC Reverse: GAGCCAGAACACAATCGCAT Osmr Forward: CATCCCGAAGCGAAGTCTTGG Reverse: GGCTGGGACAGTCCATTCTAAA IL31ra Forward: TCCTGATGTTCCCAACCCTG Reverse: TTAGGACCACGTCTTCTGTGT Htr3a Forward: CCTGGCTAACTACAAGAAGGGG Reverse: TGCAGAAACTCATCAGTCCAGTA Hrh1 Forward: CAAGATGTGTGAGGGGAACAG Reverse: CTACCGACAGGCTGACAATGT Htr1f Forward: ATCAACTCCCTCGTGATCGC Reverse: ACACGTACAACAGATGATGTCG TRPV1 Forward: CCGGCTTTTTGGGAAGGGT Reverse: GAGACAGGTAGGTCCATCCAC TRPA1 Forward: TTCTTCGTGTGAAGTGCTGAAT Reverse: TGGCCTTGTGCTCAGTCAAC β-Actin Forward: AGTGTGACGTTGACATCCGT Reverse: GCAGCTCAGTAACAGTCCGC Open in new tab Table 1. Sequence of primers used for RT-PCR Gene . Primer sequence (5′→3′) . Lpar3 Forward: CAAGCGCATGGACTTTTTCTAC Reverse: GAAATCCGCAGCAGCTAAGTT MrgprD Forward: TTTTCAGTGACATTCCTCGCC Reverse: GCACATAGACACAGAAGGGAGA MrgprA3 Forward: AGAGGAATGGGAGAAAGCAACAC Reverse: GAGCCAGAACACAATCGCAT Osmr Forward: CATCCCGAAGCGAAGTCTTGG Reverse: GGCTGGGACAGTCCATTCTAAA IL31ra Forward: TCCTGATGTTCCCAACCCTG Reverse: TTAGGACCACGTCTTCTGTGT Htr3a Forward: CCTGGCTAACTACAAGAAGGGG Reverse: TGCAGAAACTCATCAGTCCAGTA Hrh1 Forward: CAAGATGTGTGAGGGGAACAG Reverse: CTACCGACAGGCTGACAATGT Htr1f Forward: ATCAACTCCCTCGTGATCGC Reverse: ACACGTACAACAGATGATGTCG TRPV1 Forward: CCGGCTTTTTGGGAAGGGT Reverse: GAGACAGGTAGGTCCATCCAC TRPA1 Forward: TTCTTCGTGTGAAGTGCTGAAT Reverse: TGGCCTTGTGCTCAGTCAAC β-Actin Forward: AGTGTGACGTTGACATCCGT Reverse: GCAGCTCAGTAACAGTCCGC Gene . Primer sequence (5′→3′) . Lpar3 Forward: CAAGCGCATGGACTTTTTCTAC Reverse: GAAATCCGCAGCAGCTAAGTT MrgprD Forward: TTTTCAGTGACATTCCTCGCC Reverse: GCACATAGACACAGAAGGGAGA MrgprA3 Forward: AGAGGAATGGGAGAAAGCAACAC Reverse: GAGCCAGAACACAATCGCAT Osmr Forward: CATCCCGAAGCGAAGTCTTGG Reverse: GGCTGGGACAGTCCATTCTAAA IL31ra Forward: TCCTGATGTTCCCAACCCTG Reverse: TTAGGACCACGTCTTCTGTGT Htr3a Forward: CCTGGCTAACTACAAGAAGGGG Reverse: TGCAGAAACTCATCAGTCCAGTA Hrh1 Forward: CAAGATGTGTGAGGGGAACAG Reverse: CTACCGACAGGCTGACAATGT Htr1f Forward: ATCAACTCCCTCGTGATCGC Reverse: ACACGTACAACAGATGATGTCG TRPV1 Forward: CCGGCTTTTTGGGAAGGGT Reverse: GAGACAGGTAGGTCCATCCAC TRPA1 Forward: TTCTTCGTGTGAAGTGCTGAAT Reverse: TGGCCTTGTGCTCAGTCAAC β-Actin Forward: AGTGTGACGTTGACATCCGT Reverse: GCAGCTCAGTAACAGTCCGC Open in new tab Single-cell isolation, cDNA amplification and library construction for 10× single-cell RNA-seq Single cells from L4–L6 DRGs were isolated as described above with some modifications. Briefly, after a single cell suspension was obtained, the cells were filtered through a 70-μm filter to remove impurities, centrifuged, and resuspended in neurobasal medium with serum at the desired concentrations (700∼1200 cells/μl). The cells were loaded into the 10× chromium single-cell platform (10× Genomics) for a target recovery of 6000–10,000 cells. Single-cell capture, reverse transcription, cell lysis, and library preparation were performed according to the manufacturer’s protocols. Samples were sequenced on an Illumina Nova6000 platform (San Diego, USA) using 150-base-pair paired-end reads. Data analysis of 10× single-cell RNA-seq Sequencing data were processed using 10× Genomics CellRanger software with the default parameters (version 3.0.2) and were mapped to the GRCh38 human genome with transcriptome annotation from the Ensembl database. Cells with a gene number greater than or equal to 200 and a unique molecular identifier count attributable to mitochondrial genes less than or equal to 10% were retained for downstream analysis. The data analysis was performed with the R package Seurat. Neurons were identified from the two samples (n=6 mice per sample) based on the cluster of high expression of the marker gene Rbfox3 for further analysis. Genes with FDR ≤0.05 and |log2 fold change| ≥1.5 were considered significantly differentially expressed. Statistical analysis Data are presented as the mean±SEM. Statistical analysis was performed using GraphPad Prism 7 (GraphPad Software Inc., Chicago, USA). Behavioral data were analyzed using two-way repeated-measures analysis of variance (ANOVA), followed by the Bonferroni post hoc test. Unpaired two-tailed Student’s t test was used to examine the differences between two groups. Differences were considered statistically significant when a P value was less than 0.05. Results Itch behaviors induced by either histamine or CQ are both significantly attenuated in CFA-induced chronic inflammatory mice To investigate itch sensation under chronic inflammatory conditions, we assessed histamine- and CQ-elicited itch behaviors by measuring site-directed biting on the calf (itch-like behaviors) in naive and CFA-treated mice. The biting behaviors were recorded within 30 min after histamine or CQ injection. In CFA-treated mice, both histamine- and CQ-induced itch behaviors were significantly decreased, and the CFA-treated mice showed lower peak itch responses in the first 5-min interval than those in the naive mice (Fig. 1A,C). Similarly, the cumulative duration of spontaneous biting behavior induced by histamine or CQ in the CFA-treated mice was shorter than that in the naive mice throughout the entire 30-min recording period (Fig. 1B,D). Figure 1. Open in new tabDownload slide Itch sensation is attenuated in CFA-induced chronic inflammatory status (A,C) Time course of biting induced by histamine (400 µg per 20 µl) or CQ (200 µg per 20 µl) in naive mice (blue, n=6 or 8, respectively) and CFA-treated mice (red, n=7 per group) at 5-min intervals. (B,D) The cumulative duration of biting induced by histamine or CQ within 30 min. **P < 0.01; ***P <0.001; ****P <0.0001; n.s., not significant. Figure 1. Open in new tabDownload slide Itch sensation is attenuated in CFA-induced chronic inflammatory status (A,C) Time course of biting induced by histamine (400 µg per 20 µl) or CQ (200 µg per 20 µl) in naive mice (blue, n=6 or 8, respectively) and CFA-treated mice (red, n=7 per group) at 5-min intervals. (B,D) The cumulative duration of biting induced by histamine or CQ within 30 min. **P < 0.01; ***P <0.001; ****P <0.0001; n.s., not significant. The intracellular calcium responses of DRG neurons elicited by histamine and CQ are both decreased while those elicited by capsaicin and AITC are both increased in CFA-treated mice The decrease in itch behaviors in CFA-treated mice prompted us to investigate the response of peripheral sensory neurons (DRG neurons) to histamine and CQ. The intracellular calcium changes were analyzed in dissociated DRG neurons following histamine or CQ stimulation by calcium imaging. Histamine- and CQ-evoked calcium influx was observed in the DRG neurons of naive and CFA mice (Fig. 2A,B). The percentage of histamine- or CQ-responsive DRG neurons was significantly decreased in the CFA-treated mice (histamine, 20.09%±0.81% naive vs 10.46%±2.08% CFA, n=6 per group; CQ, 7.56%±1.67% naive vs 5.31%±1.52% CFA, n=6 and 5, respectively) (Fig. 2C). The cell area analysis revealed that the percentage of histamine-responsive DRG neurons in the CFA-treated mice was strikingly decreased in the subgroup of small-diameter neurons with a cross-sectional area of 100–199 μm2 (49.74%±5.80% naive vs 27.24%±6.68% CFA) (Fig. 2D) compared with that in the naive mice. However, there were no significant differences in the proportion of CQ-responsive DRG neurons with different diameters between the naive and CFA-treated mice (Fig. 2E). Additionally, exposure to histamine induced significantly lower Ca2+ responses in the DRG neurons of CFA-treated mice than those in naive mice (0.48±0.30 naive vs 0.31±0.26 CFA) (Fig. 2F,G). However, there were no significant differences in the intensity of intracellular calcium responses of DRG neurons to CQ between the naive and CFA-treated mice (0.21±0.19 naive vs 0.24±0.21 CFA) (Fig. 2H,I). Histamine and CQ mediate itch sensation in TRPV1- and TRPA1-dependent manners, respectively. Interestingly, we found that the percentages of TRPA1 agonist AITC- and TRPV1 agonist capsaicin-responsive neurons in the CFA-treated mice were both significantly increased compared with those in the naive mice (AITC, 32.19%±2.89% naive vs 44.32%±1.79% CFA, n=5 per group; capsaicin, 25.34%±1.50% naive vs 36.32%±2.80% CFA, n=6 per group) (Fig. 2J), and a similar trend was observed in the intensities of intracellular calcium responses of DRG neurons to AITC and capsaicin (AITC, 0.42±0.02 naive vs 0.54±0.01 CFA, n=5 per group; capsaicin, 0.75±0.02 naive vs 0.81±0.02 CFA, n=6 per group) (Fig. 2K,L). Furthermore, the electrophysiological recordings showed that the inward currents elicited by AITC and capsaicin in the CFA-treated mice were both higher than those in the naive mice (AITC, −132.17±25.27 pA naive vs −287.65±67.17 pA CFA; capsaicin, −687.75±113.54 pA naive vs −1689.40±421.52 pA CFA) (Fig. 2M–P). Figure 2. Open in new tabDownload slide Intracellular calcium responses of cultured DRG neurons to histamine, CQ, AITC, and capsaicin (A,B) Fluorescent images of intracellular calcium influx following acute application of histamine (100 µM) or CQ (1 mM). Arrows: histamine-responsive DRG neurons (yellow) or CQ-responsive DRG neurons (white) in naive and CFA-treated mice. Scale bar, 50 µm. (C) Percentages of DRG neurons responsive to histamine and CQ in naive (blue) and CFA-treated (red) mice (histamine, n=6 per group; CQ, naive, n=6; CFA, n=5). (D,E) Size-frequency histogram illustrating distribution of histamine- and CQ-responsive DRG neurons (histamine, n=6 per group; CQ, naive, n=6; CFA, n=5). (F,H) Representative traces of the intracellular calcium responses of cultured DRG neurons in naive (blue) and CFA-treated (red) mice to acute application of histamine and CQ, respectively. (G,I) The fluorescence intensities of histamine- and CQ-induced Ca2+ responses in DRG neurons of naive and CFA-treated mice (n=6 per group), respectively. (J) Percentages of DRG neurons responsive to AITC and capsaicin in naive (blue) and CFA-treated (red) mice (AITC, n=5 per group; capsaicin, n=6 per group). (K,L) The fluorescence intensities of AITC- and capsaicin -induced Ca2+ responses in DRG neurons of naive and CFA-treated mice (AITC, n=5 mice per group; capsaicin, n=6 mice per group), respectively. (M,O) Representative traces of AITC- and capsaicin-elicited currents obtained from DRG neurons of naive and CFA-treated mice, respectively. (N,P) Statistical analysis of AITC- and capsaicin-elicited currents (IAITC and ICapsaicin) in naive and CFA-treated mice (AITC, naive, n=18 neurons from four mice; CFA, n=11 neurons from three mice; capsaicin, naive, n=11 neurons from three mice; CFA, n=13 neurons from three mice). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s., not significant. Figure 2. Open in new tabDownload slide Intracellular calcium responses of cultured DRG neurons to histamine, CQ, AITC, and capsaicin (A,B) Fluorescent images of intracellular calcium influx following acute application of histamine (100 µM) or CQ (1 mM). Arrows: histamine-responsive DRG neurons (yellow) or CQ-responsive DRG neurons (white) in naive and CFA-treated mice. Scale bar, 50 µm. (C) Percentages of DRG neurons responsive to histamine and CQ in naive (blue) and CFA-treated (red) mice (histamine, n=6 per group; CQ, naive, n=6; CFA, n=5). (D,E) Size-frequency histogram illustrating distribution of histamine- and CQ-responsive DRG neurons (histamine, n=6 per group; CQ, naive, n=6; CFA, n=5). (F,H) Representative traces of the intracellular calcium responses of cultured DRG neurons in naive (blue) and CFA-treated (red) mice to acute application of histamine and CQ, respectively. (G,I) The fluorescence intensities of histamine- and CQ-induced Ca2+ responses in DRG neurons of naive and CFA-treated mice (n=6 per group), respectively. (J) Percentages of DRG neurons responsive to AITC and capsaicin in naive (blue) and CFA-treated (red) mice (AITC, n=5 per group; capsaicin, n=6 per group). (K,L) The fluorescence intensities of AITC- and capsaicin -induced Ca2+ responses in DRG neurons of naive and CFA-treated mice (AITC, n=5 mice per group; capsaicin, n=6 mice per group), respectively. (M,O) Representative traces of AITC- and capsaicin-elicited currents obtained from DRG neurons of naive and CFA-treated mice, respectively. (N,P) Statistical analysis of AITC- and capsaicin-elicited currents (IAITC and ICapsaicin) in naive and CFA-treated mice (AITC, naive, n=18 neurons from four mice; CFA, n=11 neurons from three mice; capsaicin, naive, n=11 neurons from three mice; CFA, n=13 neurons from three mice). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s., not significant. The expressions of itch-related genes are decreased in CFA-treated mice To further investigate the mechanisms of CFA-induced itch suppression, high-throughput single-cell RNA sequencing (scRNA-seq) was performed to analyze the transcriptomes of itch-related genes in DRG neurons. It was found that the expressions of most itch-related genes were decreased in the CFA-treated mice (Table 2). In contrast, the expressions of both Trpa1 and Trpv1, which to our knowledge mediate both pain and itch sensation, were increased in the CFA-treated mice (Table 2). Table 2. The transcript profiles of itch-related genes in DRG of naive and CFA-treated mice by scRNA-seq Symbol . Pruritogens . Transcript reads . Naive . CFA . Log2 fold change . Adj. P values . Regulation . Hrh1 Histamine 0.0280 0.0228 −0.0073 3.22E-07 Down Mrgpra3 CQ 0.2378 0.1897 −0.0572 1.40E-08 Down Mrgprd β-Alanine 0.5351 0.3125 −0.2261 1.98E-24 Down Htr3a Serotonin 0.6712 0.5777 −0.0831 1.69E-12 Down Htr1f 0.1807 0.1201 −0.0760 0.0009 Down IL31ra IL31 0.1393 0.0604 −0.1036 1.81E-09 Down Osmr 0.6335 0.4055 −0.2168 1.79E-24 Down Lpar3 LPA 0.8171 0.5819 −0.2000 2.13E-19 Down Trpv1 0.9424 1.4539 0.3372 1.71E-44 Up Trpa1 　 0.4624 0.4950 0.0318 4.94E-46 Up Symbol . Pruritogens . Transcript reads . Naive . CFA . Log2 fold change . Adj. P values . Regulation . Hrh1 Histamine 0.0280 0.0228 −0.0073 3.22E-07 Down Mrgpra3 CQ 0.2378 0.1897 −0.0572 1.40E-08 Down Mrgprd β-Alanine 0.5351 0.3125 −0.2261 1.98E-24 Down Htr3a Serotonin 0.6712 0.5777 −0.0831 1.69E-12 Down Htr1f 0.1807 0.1201 −0.0760 0.0009 Down IL31ra IL31 0.1393 0.0604 −0.1036 1.81E-09 Down Osmr 0.6335 0.4055 −0.2168 1.79E-24 Down Lpar3 LPA 0.8171 0.5819 −0.2000 2.13E-19 Down Trpv1 0.9424 1.4539 0.3372 1.71E-44 Up Trpa1 　 0.4624 0.4950 0.0318 4.94E-46 Up The itch-related genes are listed. The transcript reads were represented as one sample from naive and CFA-treated mice (n=6 per sample). Fold changes were computed by (meanCFA+1)/(meannaive+1). Open in new tab Table 2. The transcript profiles of itch-related genes in DRG of naive and CFA-treated mice by scRNA-seq Symbol . Pruritogens . Transcript reads . Naive . CFA . Log2 fold change . Adj. P values . Regulation . Hrh1 Histamine 0.0280 0.0228 −0.0073 3.22E-07 Down Mrgpra3 CQ 0.2378 0.1897 −0.0572 1.40E-08 Down Mrgprd β-Alanine 0.5351 0.3125 −0.2261 1.98E-24 Down Htr3a Serotonin 0.6712 0.5777 −0.0831 1.69E-12 Down Htr1f 0.1807 0.1201 −0.0760 0.0009 Down IL31ra IL31 0.1393 0.0604 −0.1036 1.81E-09 Down Osmr 0.6335 0.4055 −0.2168 1.79E-24 Down Lpar3 LPA 0.8171 0.5819 −0.2000 2.13E-19 Down Trpv1 0.9424 1.4539 0.3372 1.71E-44 Up Trpa1 　 0.4624 0.4950 0.0318 4.94E-46 Up Symbol . Pruritogens . Transcript reads . Naive . CFA . Log2 fold change . Adj. P values . Regulation . Hrh1 Histamine 0.0280 0.0228 −0.0073 3.22E-07 Down Mrgpra3 CQ 0.2378 0.1897 −0.0572 1.40E-08 Down Mrgprd β-Alanine 0.5351 0.3125 −0.2261 1.98E-24 Down Htr3a Serotonin 0.6712 0.5777 −0.0831 1.69E-12 Down Htr1f 0.1807 0.1201 −0.0760 0.0009 Down IL31ra IL31 0.1393 0.0604 −0.1036 1.81E-09 Down Osmr 0.6335 0.4055 −0.2168 1.79E-24 Down Lpar3 LPA 0.8171 0.5819 −0.2000 2.13E-19 Down Trpv1 0.9424 1.4539 0.3372 1.71E-44 Up Trpa1 　 0.4624 0.4950 0.0318 4.94E-46 Up The itch-related genes are listed. The transcript reads were represented as one sample from naive and CFA-treated mice (n=6 per sample). Fold changes were computed by (meanCFA+1)/(meannaive+1). Open in new tab In addition, RT-PCR analysis was performed to confirm the scRNA-seq results. It was found that consistent with the scRNA-seq results, the mRNA expressions of itch-related genes, except Trpa1 and Trpv1, were decreased in the DRG of the CFA-treated mice (Fig. 3A,B). Consistent with these results, compared with those of the naive mice, the proportions of both TRPV1+ and TRPA1+ neurons were increased in the DRGs of the CFA-treated mice (Fig. 3C–F). Figure 3. Open in new tabDownload slide Different kinds of DRG pruriceptor neurons are decreased in CFA-treated mice (A,B) RT-PCR analysis of itch-related gene expressions in DRGs of naive and CFA-treated mice. (C) Representative IHC images showing the distribution of TRPA1+ neurons in the DRGs of naive and CFA-treated mice. Scale bar, 100 μm. (D) The percentages of TRPA1+ neurons in DRGs of naive and CFA-treated mice (n=4 per group). (E) Representative IHC images showing the distribution of TRPV1+ neurons in the DRGs of naive and CFA-treated mice. Scale bar, 100 μm. (F) The percentages of TRPV1+ neurons in DRGs of naive and CFA-treated mice (n=4 per group). *P < 0.05; **P < 0.01. Figure 3. Open in new tabDownload slide Different kinds of DRG pruriceptor neurons are decreased in CFA-treated mice (A,B) RT-PCR analysis of itch-related gene expressions in DRGs of naive and CFA-treated mice. (C) Representative IHC images showing the distribution of TRPA1+ neurons in the DRGs of naive and CFA-treated mice. Scale bar, 100 μm. (D) The percentages of TRPA1+ neurons in DRGs of naive and CFA-treated mice (n=4 per group). (E) Representative IHC images showing the distribution of TRPV1+ neurons in the DRGs of naive and CFA-treated mice. Scale bar, 100 μm. (F) The percentages of TRPV1+ neurons in DRGs of naive and CFA-treated mice (n=4 per group). *P < 0.05; **P < 0.01. Furthermore, compared with the itch-related-protein-positive neurons (regarded as pruriceptors) in the naive mice, the single-cell RNA sequencing data showed that the percentages of different kinds of DRG pruriceptor neurons were all decreased in the CFA-treated mice (Fig. 4). These findings suggest that CFA-induced chronic inflammatory status can inhibit itch sensation through suppression of various pruriceptors in the DRG. Figure 4. Open in new tabDownload slide The percentage of DRG pruriceptor neurons are declined in CFA-treated mice (A) Distributions of eight itch-related marker genes (Hrh1, Mrgpra3, IL31ra, Osmr, Mrgprd, Htr1f, Lpar3, and Htr3a) and two both pain- and itch-related marker genes (Trpa1 and Trpv1) were color coded (orange) on t-Distributed Stochastic Neighbor Embedding (t-SNE) plots in naive (n=3914 DRG neurons) and CFA-treated (n=1906 DRG neurons) mice. One dot represents one neuron. (B) Relative percentages of itch-related DRG neurons in naive and CFA-treated mice. Figure 4. Open in new tabDownload slide The percentage of DRG pruriceptor neurons are declined in CFA-treated mice (A) Distributions of eight itch-related marker genes (Hrh1, Mrgpra3, IL31ra, Osmr, Mrgprd, Htr1f, Lpar3, and Htr3a) and two both pain- and itch-related marker genes (Trpa1 and Trpv1) were color coded (orange) on t-Distributed Stochastic Neighbor Embedding (t-SNE) plots in naive (n=3914 DRG neurons) and CFA-treated (n=1906 DRG neurons) mice. One dot represents one neuron. (B) Relative percentages of itch-related DRG neurons in naive and CFA-treated mice. Discussion In the present study, we found that itch behaviors induced by either histamine or CQ were both significantly attenuated after CFA treatment, indicating that CFA-induced inflammation suppresses itch sensation. Furthermore, according to the single-cell RNA sequencing results, the proportions of different known pruriceptor neurons in the DRG were all decreased, and the function of histamine-responsive neurons was inhibited after CFA treatment. Our results indicated that CFA-induced inflammation could also suppress itch sensation simultaneously, except facilitating nociceptive sensitization, which might be through systematically inhibiting the expression and function of pruriceptor neurons after CFA treatment. It has been widely accepted that pain sensation can suppress itch sensation, which is indicated by the phenomenon that itch is relieved by the application of noxious heat and scratching induced pain [19,20]. Previous reports have suggested that inhibition of itch by painful stimuli is dependent on some inhibitory interneurons [21,22]. For example, genetic ablation of glycinergic interneurons expressing vesicular glutamate transporter 2 impaired the perception of pain but led to enhanced itch behavior [23]. Mice lacking a population of Bhlhb5-expressing inhibitory interneurons showed a greatly sensitized scratching response to pruritic chemicals [24]. After CFA treatment, long-lasting inflammatory pain is induced, so CFA-induced itch suppression may be achieved through elicited pain sensation, which has also been reported in neuropathic pain, as patients suffering from neuropathic hyperalgesia showed a significantly decreased itch sensation in response to pruritogen stimuli such as histamine [25]. CFA is also an immunopotentiator, as it is effective in stimulating cell-mediated immunity, leading to potentiation of T helper cells and stimulating the production of TNF [26]. In addition to pain-induced itch suppression, inflammatory status after CFA treatment can also decrease pruriceptor expression and result in itch response attenuation [27]. Primary sensory neurons located in the DRG play an essential role in encoding itch by detecting pruritogenic stimuli and relaying the information to postsynaptic neurons in the dorsal spinal cord. Itch-related receptors or ion channels on the DRG present increased expression and function in some chronic skin inflammation diseases, such as allergic contact dermatitis [28], atopic dermatitis (eczema) [2], and idiopathic urticarial [29], which are characterized by itch sensation abnormalities. In the present study, we observed that the expressions and function of Hrh1 and Mrgpra3 as well as most itch-related genes in DRG neurons were decreased in CFA-induced inflammation compared to wild-type inflammation. Meanwhile, both TRPA1+ and TRPV1+ nociceptors were significantly increased during this process. These results suggested that CFA treatment induced a consistent trend at the cellular level of decreased pruriceptors and increased nociceptors, which occurred coincidently and resulted in itch suppression and pain potentiation, but the regulatory mechanisms by which CFA induces consistent cellular changes need further investigation. In summary, we observed that itch sensitivity evoked by experimental pruritogens was significantly attenuated under chronic CFA-induced inflammation conditions; moreover, at the cellular level, pruriceptors and nociceptors in the DRG showed the bidirectional changes during this process. These findings may improve our knowledge of how CFA-induced inflammation affects noxious sensation, both pain and itch, and help us further clarify the relationship between inflammation and noxious sensation. Funding This work was supported by the grants from the Shanghai Pudong New Area Municipal Commission of Health and Family Planning Funding (no. PW2015D-3 and PWZXQ2017-06 to W.F.Y.), Shanghai Municipal Key Clinical Specialty (no. shslczdzk03601 to W.F.Y.), Innovation Program of Shanghai Municipal Education Commission (no. 2019-01-07-00-01-E00074 to W.F.Y.), the National Natural Science Foundation of China (no. 81970478 to D.X.W., no. 81800748 to P.G., and no. 81701358 to D.H.), and Innovation Training Fund for Clinical Research of Renji Hospital Affiliated to School of Medicine Shanghai Jiaotong University (no. PYI-17-007 to Y.H.F.). Conflict of Interest The authors declare that they have no conflict of interest. References 1. Matsuda M , Huh Y, Ji RR. Roles of inflammation, neurogenic inflammation, and neuroinflammation in pain . J Anesth 2019 , 33 : 131 – 139 . doi: 10.1007/s00540-018-2579-4 Google Scholar Crossref Search ADS PubMed WorldCat 2. Kido-Nakahara M , Furue M, Ulzii D, Nakahara T. Itch in atopic dermatitis . Immunol Allergy Clin North Am 2017 , 37 : 113 – 122 . doi: 10.1016/j.iac.2016.08.007 Google Scholar Crossref Search ADS PubMed WorldCat 3. Luo J , Feng J, Liu S, Walters ET, Hu H. Molecular and cellular mechanisms that initiate pain and itch . Cell Mol Life Sci 2015 , 72 : 3201 – 3223 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Gupta K , Harvima IT. Mast cell-neural interactions contribute to pain and itch . Immunol Rev 2018 , 282 : 168 – 187 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Ljosaa TM , Bondevik H, Halvorsen JA, Carr E, Wahl AK. The complex experience of psoriasis related skin pain: a qualitative study . Scand J Pain 2020 , 20 : 491 – 498 . doi: 10.1515/sjpain-2019-0158 Google Scholar Crossref Search ADS PubMed WorldCat 6. Chiu IM . Infection, pain, and itch . Neurosci Bull 2018 , 34 : 109 – 119 . doi: 10.1007/s12264-017-0098-1 Google Scholar Crossref Search ADS PubMed WorldCat 7. Van Den Beuken-van Everdingen MH , Hochstenbach LM, Joosten EA, Tjan-Heijnen VC, Janssen DJ. Update on prevalence of pain in patients with cancer: systematic review and meta-analysis . J Pain Symptom Manage 2016 , 51 : 1070 – 1090 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Herrera-Escobar JP , Apoj M, Weed C, Harlow AF, Al Rafai SS, Lilley E, Kasotakis G, et al. Association of pain after trauma with long-term functional and mental health outcomes . J Trauma Acute Care Surg 2018 , 85 : 773 – 779 . doi: 10.1097/TA.0000000000002017 Google Scholar Crossref Search ADS PubMed WorldCat 9. Dai Y . TRPs and pain . Semin Immunopathol 2016 , 38 : 277 – 291 . doi: 10.1007/s00281-015-0526-0 Google Scholar Crossref Search ADS PubMed WorldCat 10. Rossbach K , Nassenstein C, Gschwandtner M, Schnell D, Sander K, Seifert R, Stark H, et al. Histamine H1, H3 and H4 receptors are involved in pruritus . Neuroscience 2011 , 190 : 89 – 102 . doi: 10.1016/j.neuroscience.2011.06.002 Google Scholar Crossref Search ADS PubMed WorldCat 11. Liu Q , Tang Z, Surdenikova L, Kim S, Patel KN, Kim A, Ru F, et al. Sensory neuron-specific GPCR Mrgprs are itch receptors mediating chloroquine-induced pruritus . Cell 2009 , 139 : 1353 – 1365 . doi: 10.1016/j.cell.2009.11.034 Google Scholar Crossref Search ADS PubMed WorldCat 12. Liu Q , Sikand P, Ma C, Tang Z, Han L, Li Z, Sun S, et al. Mechanisms of itch evoked by beta-alanine . J Neurosci 2012 , 32 : 14532 – 14537 . doi: 10.1523/JNEUROSCI.3509-12.2012 Google Scholar Crossref Search ADS PubMed WorldCat 13. Nocchi L , Roy N, D’Attilia M, Dhandapani R, Maffei M, Traista A, Castaldi L, et al. Interleukin-31-mediated photoablation of pruritogenic epidermal neurons reduces itch-associated behaviours in mice . Nat Biomed Eng 2019 , 3 : 114 – 125 . doi: 10.1038/s41551-018-0328-5 Google Scholar Crossref Search ADS PubMed WorldCat 14. Ostadhadi S , Kordjazy N, Haj-Mirzaian A, Mansouri P, Dehpour AR. 5-HT3 receptors antagonists reduce serotonin-induced scratching in mice . Fundam Clin Pharmacol 2015 , 29 : 310 – 315 . doi: 10.1111/fcp.12112 Google Scholar Crossref Search ADS PubMed WorldCat 15. Usoskin D , Furlan A, Islam S, Abdo H, Lonnerberg P, Lou D, Hjerling-Leffler J, et al. Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing . Nat Neurosci 2015 , 18 : 145 – 153 . doi: 10.1038/nn.3881 Google Scholar Crossref Search ADS PubMed WorldCat 16. Kremer AE , Martens JJ, Kulik W, Rueff F, Kuiper EM, Van Buuren HR, Van Erpecum KJ, et al. Lysophosphatidic acid is a potential mediator of cholestatic pruritus . Gastroenterology 2010 , 139 : 1008 – 1018 . doi: 10.1053/j.gastro.2010.05.009 Google Scholar Crossref Search ADS PubMed WorldCat 17. LaMotte RH , Shimada SG, Sikand P. Mouse models of acute, chemical itch and pain in humans . Exp Dermatol 2011 , 20 : 778 – 782 . doi: 10.1111/j.1600-0625.2011.01367.x Google Scholar Crossref Search ADS PubMed WorldCat 18. Dib-Hajj SD , Choi JS, Macala LJ, Tyrrell L, Black JA, Cummins TR, Waxman SG. Transfection of rat or mouse neurons by biolistics or electroporation . Nat Protoc 2009 , 4 : 1118 – 1126 . doi: 10.1038/nprot.2009.90 Google Scholar Crossref Search ADS PubMed WorldCat 19. Yosipovitch G , Fast K, Bernhard JD. Noxious heat and scratching decrease histamine-induced itch and skin blood flow . J Invest Dermatol 2005 , 125 : 1268 – 1272 . doi: 10.1111/j.0022-202X.2005.23942.x Google Scholar Crossref Search ADS PubMed WorldCat 20. Akiyama T , Iodi Carstens M, Carstens E. Transmitters and pathways mediating inhibition of spinal itch-signaling neurons by scratching and other counterstimuli . PLoS One 2011 , 6 : e22665. doi: 10.1371/journal.pone.0022665 Google Scholar OpenURL Placeholder Text WorldCat Crossref 21. Chen XJ , Sun YG. Central circuit mechanisms of itch . Nat Commun 2020 , 11 : 3052. doi: 10.1038/s41467-020-16859-5 Google Scholar OpenURL Placeholder Text WorldCat Crossref 22. Dong X , Dong X. Peripheral and central mechanisms of itch . Neuron 2018 , 98 : 482 – 494 . doi: 10.1016/j.neuron.2018.03.023 Google Scholar Crossref Search ADS PubMed WorldCat 23. Liu Y , Abdel Samad O, Zhang L, Duan B, Tong Q, Lopes C, Ji RR, et al. VGLUT2-dependent glutamate release from nociceptors is required to sense pain and suppress itch . Neuron 2010 , 68 : 543 – 556 . doi: 10.1016/j.neuron.2010.09.008 Google Scholar Crossref Search ADS PubMed WorldCat 24. Ross SE , Mardinly AR, McCord AE, Zurawski J, Cohen S, Jung C, Hu L, et al. Loss of inhibitory interneurons in the dorsal spinal cord and elevated itch in Bhlhb5 mutant mice . Neuron 2010 , 65 : 886 – 898 . doi: 10.1016/j.neuron.2010.02.025 Google Scholar Crossref Search ADS PubMed WorldCat 25. Baron R , Schwarz K, Kleinert A, Schattschneider J, Wasner G. Histamine-induced itch converts into pain in neuropathic hyperalgesia . Neuroreport 2001 , 12 : 3475 – 3478 . doi: 10.1097/00001756-200111160-00020 Google Scholar Crossref Search ADS PubMed WorldCat 26. Billiau A , Matthys P. Modes of action of Freund’s adjuvants in experimental models of autoimmune diseases . J Leukoc Biol 2001 , 70 : 849 – 860 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 27. Trier AM , Mack MR, Kim BS. The neuroimmune axis in skin sensation, inflammation, and immunity . J Immunol 2019 , 202 : 2829 – 2835 . doi: 10.4049/jimmunol.1801473 Google Scholar Crossref Search ADS PubMed WorldCat 28. Lee MG , Dong X, Liu Q, Patel KN, Choi OH, Vonakis B, Undem BJ. Agonists of the MAS-related gene (Mrgs) orphan receptors as novel mediators of mast cell-sensory nerve interactions . J Immunol 2008 , 180 : 2251 – 2255 . doi: 10.4049/jimmunol.180.4.2251 Google Scholar Crossref Search ADS PubMed WorldCat 29. Patel OP , Giorno RC, Dibbern DA, Andrews KY, Durairaj S, Dreskin SC. Gene expression profiles in chronic idiopathic (spontaneous) urticaria . Allergy Rhinol (Providence) 2015 , 6 : 101 – 110 . doi: 10.2500/ar.2015.6.0124 Google Scholar PubMed OpenURL Placeholder Text WorldCat Author notes † Wen Yin and Li Liu contributed equally to this work. © The Author(s) 2021. Published by Oxford University Press on behalf of the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Complete Freund’s adjuvant–induced decrement of pruriceptor-mediated suppression of itch
JF - Acta Biochimica et Biophysica Sinica
DO - 10.1093/abbs/gmab027
DA - 2021-03-08
UR - https://www.deepdyve.com/lp/oxford-university-press/complete-freund-s-adjuvant-induced-decrement-of-pruriceptor-mediated-RT7xrvAj19
SP - 1
EP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -