TY - JOUR
AU - Roberts, R., Michael
AB - Abstract During early pregnancy in ruminants, a type I interferon (IFN-τ) signals from the conceptus to the mother to ensure the functional survival of the corpus luteum. IFN-τ operates through binding to the type I IFN receptor (IFNR). Here we have explored the possibility that IFNAR2, one of the two subunits of the receptor, might interact with hitherto unknown signal transduction factors in the uterus that link IFN action to pathways other than the well established Janus kinase-signal transducer and activator of transcription pathways. A yeast two-hybrid screen of an ovine (ov) endometrial cDNA library with the carboxyl-terminal 185 amino acids of ovIFNAR2 as bait identified stress-activated protein kinase-interacting protein 1 (ovSin1) as a protein that bound constitutively through its own carboxyl terminus to the receptor. ovSin1 is a little studied, 522-amino acid-long polypeptide (molecular weight, 59,200) that is highly conserved across vertebrates, but has identifiable orthologs in Drosophila and yeast. It appears to be expressed ubiquitously in mammals, although in low abundance, in a wide range of mammalian tissues in addition to endometrium. Sin1 mRNA occurs in at least two alternatively spliced forms, the smaller of which lacks a 108-bp internal exon. ovSin1, although not exhibiting features of a membrane-spanning protein, such as IFNAR2, is concentrated predominantly in luminal and glandular epithelial cells of the uterine endometrium. When ovSin1 and ovIFNAR2 are coexpressed, the two proteins can be coimmunoprecipitated and colocalized to the plasma membrane and to perinuclear structures. Sin1 provides a possible link among type I IFN action, stress-activated signaling pathways, and control of prostaglandin production. TYPE I INTERFERON (IFN-τ) has a primary role in conferring antiviral responses on its target cells, but tends to be pleiotropic in its action, directing a broad range of activities and outcomes depending upon the cell type it targets. All of the functions of type I IFN appear to be mediated through a cell surface receptor, which is composed of two subunits, IFNAR1 and IFNAR2 (1). The first and still the best characterized of the downstream signal transduction pathways to be activated after IFN binding to the receptor is the one involving the tyrosine kinases, tyrosine kinase 2 and Janus kinase 1 (Jak1), and signal transducer and activator of transcription 1 (STAT1) and STAT2, which leads to up-regulation of key IFN-stimulated genes implicated in antiviral and other responses (2). Although the Jak/STAT pathway has been assumed to direct most of the activities of type I IFN, it is now clear that STATs in addition to STAT1 and -2 can become phosphorylated in response to IFN (3–6), and that under some circumstances additional signal transduction pathways can be activated, including the phosphatidylinositol 3-kinase (7–9), the extracellular signal-regulated kinase/MAPK (10, 11), and the p38 MAPK pathways (12–17). In addition, cells lacking STAT1 are still able to up-regulate the activities of several IFN-stimulated genes (18–20). These and other observations (21) suggest that type I IFN can signal through more than a single pathway. Protein factors associated with the cytoplasmic domains of IFNAR1 and IFNAR2 are likely to provide insight into the type I IFN signaling pathways. Among the factors known to bind constitutively to the relatively short cytoplasmic domain of IFNAR1 are tyrosine kinase 2 (22–24) and arginine methyltransferase 1 (PRMT1) (25, 26). Some proteins may associate firmly with the cytoplasmic domain of IFNAR1 only after ligand binding; for example, STAT2 and STAT3 (27–32), the T cell receptor signaling components Lck and ZAP-70 (33), and the protein phosphatase PTP1D (34). Many protein factors may have to be appropriately phosphorylated or covalently modified in some other manner before they can bind to IFNAR1. IFNAR2, which was originally considered to be the ligand-binding subunit of the receptor because it is able to associate with type I IFN with relatively high affinity in the absence of IFNAR1 (1), has a much longer cytoplasmic domain than IFNAR1 (269 vs. 98 in sheep and 251 vs. 98 in humans) (35–37). Except for its ability to bind Jak1 (4) and STAT2 (31, 38, 39), little is known about the proteins that interact with this polypeptide. In particular, both highly conserved and potential specificity-conveying variable regions are found in the cytoplasmic domain of IFNAR2 (35, 36, 23, 40), even though their functions remain unknown. It seemed important to address the potential roles of these regions, particularly because type 1 IFN are able to target so many different cell types and have such broad pleiotropic activities. This laboratory’s interest in signal transduction pathways emanating from the type I IFNR relates to the role of type I IFN in reproduction. In ruminant ungulate species, a type 1 IFN, IFN-τ with potent antiviral activity, is the signal from the preimplantation embryo that is responsible for preventing regression of the maternal corpus luteum during early pregnancy (41, 42). IFN-τ targets IFN receptors in the mucosal lining of the maternal uterus and ultimately interferes with the release and/or production of the luteolytic hormone, prostaglandin F2α (PGF). Suspecting that a nonclassical signal transduction pathway might be associated with this novel activity of IFN-τ, we conducted a yeast two-hybrid screen of an ovine (ov) endometrial cDNA library using regions of the cytoplasmic domain of ovIFNAR2 as bait. Materials and Methods Animals Cross-bred ewes, 2–5 yr of age, were injected with PGF (two 5-mg injections given 3 h apart), and estrus was detected with teaser rams. Ewes were either bred to intact rams or allowed to progress to selected days of their estrous cycles. Endometrium was removed from uteri of ewes after slaughter (43) according to a protocol approved by the University of Missouri institutional animal care and use committee. Biological reagents Amino acids (aa) used for preparing synthetic dropout (SD) medium in the yeast two-hybrid assay were purchased from Sigma-Aldrich Corp. (St. Louis, MO). T4 ligase and AMV reverse transcriptase were obtained from Promega Corp. (Madison, WI). Restriction enzymes were purchased from either New England Biolabs (Beverly, MA) or Promega Corp. KlenTaq DNA polymerase was obtained from Invitrogen Life Technologies, Inc. (Gaithersburg, MD). Pfu DNA polymerase was purchased from Stratagene (La Jolla, CA). Sequenase and [α-35S]deoxy-ATP were obtained from Amersham Biosciences (Arlington Heights, IL). Glutathione beads used for glutathione-S-transferase (GST) fusion protein purification were obtained from Amersham Biosciences (Uppsala, Sweden). Other reagents were purchased from Fisher Scientific (Pittsburgh, PA). Oligonucleotides and their uses are listed in Table 1. TABLE 1 Oligonucleotides used as primers for either RT or PCRs Name Nucleotide sequence (5′–3′) Use R2SF ATCGAATTCACTTCCACCACTGCAGCCAG pAS1:ovIFNAR2SF;pAS1:ovIFNAR2MF R2SR ATCGGATCCTTACTGCCACAGAGTCCCTCT pAS1:ovIFNAR2SF R2LF ATCGAATTCAAACGGATTGGTTATATATG pAS1:ovIFNAR2LF R2LR ATCGGATCCTTAATTAAAATTTTTCAGAT pAS1:ovIFNAR2LF; pAS1:ovIFNAR2MF T17 TGCGAATTCTAGAGCTCTTTTTTTTTTTTTTTTT Reverse transcription pmaf CAGTGGAGACTGATATGCCTC PCR for Y2H positive clones pmar CGTTTTAAAACCTAAGAGTCA PCR for Y2H positive clones pgadf CTGCGTATAACGCGTTTGG PCR and Sequencing for Y2H positive clones pgadr GAGATGGTGCACGATGCAC PCR and Sequencing for Y2H positive clones 6502nstpcrf1 GATGGCAAGGG(C/T)CATGT(A/T)GGTAC Outer primer in Nested PCR for Sin11f1/3 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin11f1/3 6502nstpcrf2 GTCAGTGCCTACTGCCT(G/C)CAT Inner primer in Nested PCR for Sin11f1/3 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Inner primer in Nested PCR for Sin11f1/3 SIN1OUTFW CAATATGAAGAGGAGAAAATAG Outer primer in Nested PCR for Sin1 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin1 SIN1INFW ATGGGCTTCTTGGACAATCCAAC Inner primer in Nested PCR for Sin1 sinpsecr GCTGGATCCTCACTGCTGCCCTGATTT Inner primer in Nested PCR for Sin1 pgadsin1f3fw AATGAATTCGTCAGTGCCTACTGCCTGC pGEX-4T-1:ovSin11f3 pgadsin1f3rv AATCTCGAGTCACTGCTGCCCTGATTTC pGEX-4T-1:ovSin11f3 R2MFFW ATGGATCCACTTCCACCACTGCAGCC pGEX-2T-1:ovIFNAR2MF R2T2RV ATGAATTCTTAATTAAAATTTTTCAGATTC pGEX-2T-1:ovIFNAR2MF pcmvsin1fw ATGAATTCTGGGCTTCTTGGACAATCC pCMV-Myc:ovSin1 pcmvsin1rv ATGGTACCTCACTGCTGCCCTGATTTC pCMV-Myc:ovSin1 pcmvr2cdfw ATGAATTCGGATTGGTTATATATGCTTAAG pFLAG-CMV-6b:ovIFNAR2CD pcmvr2cdrv ATGGTACCTTAATTAAAATTTTTCAGATTCAC pFLAG-CMV-6b:ovIFNAR2CD 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Nested PCR for Sin1 s25pet15bf CGTCTCGAGCCCAAGGACGACAAG PCR for RPS25 s25pet15br GCTGGATCCTCATGCATCTTCACCAGCAGC PCR for RPS25 Name Nucleotide sequence (5′–3′) Use R2SF ATCGAATTCACTTCCACCACTGCAGCCAG pAS1:ovIFNAR2SF;pAS1:ovIFNAR2MF R2SR ATCGGATCCTTACTGCCACAGAGTCCCTCT pAS1:ovIFNAR2SF R2LF ATCGAATTCAAACGGATTGGTTATATATG pAS1:ovIFNAR2LF R2LR ATCGGATCCTTAATTAAAATTTTTCAGAT pAS1:ovIFNAR2LF; pAS1:ovIFNAR2MF T17 TGCGAATTCTAGAGCTCTTTTTTTTTTTTTTTTT Reverse transcription pmaf CAGTGGAGACTGATATGCCTC PCR for Y2H positive clones pmar CGTTTTAAAACCTAAGAGTCA PCR for Y2H positive clones pgadf CTGCGTATAACGCGTTTGG PCR and Sequencing for Y2H positive clones pgadr GAGATGGTGCACGATGCAC PCR and Sequencing for Y2H positive clones 6502nstpcrf1 GATGGCAAGGG(C/T)CATGT(A/T)GGTAC Outer primer in Nested PCR for Sin11f1/3 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin11f1/3 6502nstpcrf2 GTCAGTGCCTACTGCCT(G/C)CAT Inner primer in Nested PCR for Sin11f1/3 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Inner primer in Nested PCR for Sin11f1/3 SIN1OUTFW CAATATGAAGAGGAGAAAATAG Outer primer in Nested PCR for Sin1 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin1 SIN1INFW ATGGGCTTCTTGGACAATCCAAC Inner primer in Nested PCR for Sin1 sinpsecr GCTGGATCCTCACTGCTGCCCTGATTT Inner primer in Nested PCR for Sin1 pgadsin1f3fw AATGAATTCGTCAGTGCCTACTGCCTGC pGEX-4T-1:ovSin11f3 pgadsin1f3rv AATCTCGAGTCACTGCTGCCCTGATTTC pGEX-4T-1:ovSin11f3 R2MFFW ATGGATCCACTTCCACCACTGCAGCC pGEX-2T-1:ovIFNAR2MF R2T2RV ATGAATTCTTAATTAAAATTTTTCAGATTC pGEX-2T-1:ovIFNAR2MF pcmvsin1fw ATGAATTCTGGGCTTCTTGGACAATCC pCMV-Myc:ovSin1 pcmvsin1rv ATGGTACCTCACTGCTGCCCTGATTTC pCMV-Myc:ovSin1 pcmvr2cdfw ATGAATTCGGATTGGTTATATATGCTTAAG pFLAG-CMV-6b:ovIFNAR2CD pcmvr2cdrv ATGGTACCTTAATTAAAATTTTTCAGATTCAC pFLAG-CMV-6b:ovIFNAR2CD 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Nested PCR for Sin1 s25pet15bf CGTCTCGAGCCCAAGGACGACAAG PCR for RPS25 s25pet15br GCTGGATCCTCATGCATCTTCACCAGCAGC PCR for RPS25 Open in new tab TABLE 1 Oligonucleotides used as primers for either RT or PCRs Name Nucleotide sequence (5′–3′) Use R2SF ATCGAATTCACTTCCACCACTGCAGCCAG pAS1:ovIFNAR2SF;pAS1:ovIFNAR2MF R2SR ATCGGATCCTTACTGCCACAGAGTCCCTCT pAS1:ovIFNAR2SF R2LF ATCGAATTCAAACGGATTGGTTATATATG pAS1:ovIFNAR2LF R2LR ATCGGATCCTTAATTAAAATTTTTCAGAT pAS1:ovIFNAR2LF; pAS1:ovIFNAR2MF T17 TGCGAATTCTAGAGCTCTTTTTTTTTTTTTTTTT Reverse transcription pmaf CAGTGGAGACTGATATGCCTC PCR for Y2H positive clones pmar CGTTTTAAAACCTAAGAGTCA PCR for Y2H positive clones pgadf CTGCGTATAACGCGTTTGG PCR and Sequencing for Y2H positive clones pgadr GAGATGGTGCACGATGCAC PCR and Sequencing for Y2H positive clones 6502nstpcrf1 GATGGCAAGGG(C/T)CATGT(A/T)GGTAC Outer primer in Nested PCR for Sin11f1/3 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin11f1/3 6502nstpcrf2 GTCAGTGCCTACTGCCT(G/C)CAT Inner primer in Nested PCR for Sin11f1/3 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Inner primer in Nested PCR for Sin11f1/3 SIN1OUTFW CAATATGAAGAGGAGAAAATAG Outer primer in Nested PCR for Sin1 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin1 SIN1INFW ATGGGCTTCTTGGACAATCCAAC Inner primer in Nested PCR for Sin1 sinpsecr GCTGGATCCTCACTGCTGCCCTGATTT Inner primer in Nested PCR for Sin1 pgadsin1f3fw AATGAATTCGTCAGTGCCTACTGCCTGC pGEX-4T-1:ovSin11f3 pgadsin1f3rv AATCTCGAGTCACTGCTGCCCTGATTTC pGEX-4T-1:ovSin11f3 R2MFFW ATGGATCCACTTCCACCACTGCAGCC pGEX-2T-1:ovIFNAR2MF R2T2RV ATGAATTCTTAATTAAAATTTTTCAGATTC pGEX-2T-1:ovIFNAR2MF pcmvsin1fw ATGAATTCTGGGCTTCTTGGACAATCC pCMV-Myc:ovSin1 pcmvsin1rv ATGGTACCTCACTGCTGCCCTGATTTC pCMV-Myc:ovSin1 pcmvr2cdfw ATGAATTCGGATTGGTTATATATGCTTAAG pFLAG-CMV-6b:ovIFNAR2CD pcmvr2cdrv ATGGTACCTTAATTAAAATTTTTCAGATTCAC pFLAG-CMV-6b:ovIFNAR2CD 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Nested PCR for Sin1 s25pet15bf CGTCTCGAGCCCAAGGACGACAAG PCR for RPS25 s25pet15br GCTGGATCCTCATGCATCTTCACCAGCAGC PCR for RPS25 Name Nucleotide sequence (5′–3′) Use R2SF ATCGAATTCACTTCCACCACTGCAGCCAG pAS1:ovIFNAR2SF;pAS1:ovIFNAR2MF R2SR ATCGGATCCTTACTGCCACAGAGTCCCTCT pAS1:ovIFNAR2SF R2LF ATCGAATTCAAACGGATTGGTTATATATG pAS1:ovIFNAR2LF R2LR ATCGGATCCTTAATTAAAATTTTTCAGAT pAS1:ovIFNAR2LF; pAS1:ovIFNAR2MF T17 TGCGAATTCTAGAGCTCTTTTTTTTTTTTTTTTT Reverse transcription pmaf CAGTGGAGACTGATATGCCTC PCR for Y2H positive clones pmar CGTTTTAAAACCTAAGAGTCA PCR for Y2H positive clones pgadf CTGCGTATAACGCGTTTGG PCR and Sequencing for Y2H positive clones pgadr GAGATGGTGCACGATGCAC PCR and Sequencing for Y2H positive clones 6502nstpcrf1 GATGGCAAGGG(C/T)CATGT(A/T)GGTAC Outer primer in Nested PCR for Sin11f1/3 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin11f1/3 6502nstpcrf2 GTCAGTGCCTACTGCCT(G/C)CAT Inner primer in Nested PCR for Sin11f1/3 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Inner primer in Nested PCR for Sin11f1/3 SIN1OUTFW CAATATGAAGAGGAGAAAATAG Outer primer in Nested PCR for Sin1 6502nstpcrr GGCTCTGAGCTCCGGCAACAGACTG Outer primer in Nested PCR for Sin1 SIN1INFW ATGGGCTTCTTGGACAATCCAAC Inner primer in Nested PCR for Sin1 sinpsecr GCTGGATCCTCACTGCTGCCCTGATTT Inner primer in Nested PCR for Sin1 pgadsin1f3fw AATGAATTCGTCAGTGCCTACTGCCTGC pGEX-4T-1:ovSin11f3 pgadsin1f3rv AATCTCGAGTCACTGCTGCCCTGATTTC pGEX-4T-1:ovSin11f3 R2MFFW ATGGATCCACTTCCACCACTGCAGCC pGEX-2T-1:ovIFNAR2MF R2T2RV ATGAATTCTTAATTAAAATTTTTCAGATTC pGEX-2T-1:ovIFNAR2MF pcmvsin1fw ATGAATTCTGGGCTTCTTGGACAATCC pCMV-Myc:ovSin1 pcmvsin1rv ATGGTACCTCACTGCTGCCCTGATTTC pCMV-Myc:ovSin1 pcmvr2cdfw ATGAATTCGGATTGGTTATATATGCTTAAG pFLAG-CMV-6b:ovIFNAR2CD pcmvr2cdrv ATGGTACCTTAATTAAAATTTTTCAGATTCAC pFLAG-CMV-6b:ovIFNAR2CD 6502pcdr GCTGAATTCTCACTGCTGCCCTGATTTC Nested PCR for Sin1 s25pet15bf CGTCTCGAGCCCAAGGACGACAAG PCR for RPS25 s25pet15br GCTGGATCCTCATGCATCTTCACCAGCAGC PCR for RPS25 Open in new tab Plasmids The bait, ovIFNAR2 medium fragment (ovIFNAR2MF), used to screen the cDNA library for potential IFNAR2-associating factors, was a 185-aa-long C-terminal peptide (T352-N536) that included the SLEDC tandem repeat, the most variable region, the conserved STAT2-binding subdomain, and the highly conserved C-terminal subdomain (36) (Fig. 1). DNA fragments were PCR-amplified from the full-length ovIFNAR2 cDNA with the primer pair R2 short fragment (R2SF) and R2LR (Table 1). The gel-purified PCR products were ligated into pGEM-T Easy plasmid and transformed into JM109 cells, and white colonies were randomly selected. Inserts were ligated into the pAS1 plasmid, amplified, and sequenced to confirm the identities of the junction regions and open reading frames. Fig. 1 Open in new tabDownload slide Diagram of ovine IFNAR2 and the three fragments used for the yeast two-hybrid screening. TM, Transmembrane domain; JBD, Jak1-binding subdomain; SBD, STAT2-binding subdomain; SLEDC, tandem repeat; Box1, box 1-like motif; A6, conserved acidic region; ovIFNAR2, ovIFNAR2 full-length subunit. Fig. 1 Open in new tabDownload slide Diagram of ovine IFNAR2 and the three fragments used for the yeast two-hybrid screening. TM, Transmembrane domain; JBD, Jak1-binding subdomain; SBD, STAT2-binding subdomain; SLEDC, tandem repeat; Box1, box 1-like motif; A6, conserved acidic region; ovIFNAR2, ovIFNAR2 full-length subunit. Two other ovIFNAR2 fragments, ovIFNAR2SF, a 66-aa-long peptide (T352-Q417), containing the SLEDC repeat; and ovIFNAR2 long fragment (ovIFNAR2LF), the full-length 269-aa-long cytoplasmic domain (K268-N536), were constructed identically to pAS1:ovIFNAR2MF, except different primers were used for bait amplification (Table 1). The positive control plasmids for the yeast two-hybrid screening or assay, pAS1:p53 and pAD-GAL4-2.1:simian virus 40 (SV40), were purchased from Stratagene (La Jolla, CA). The GST-stress-activated protein kinase (SAPK)-interacting protein 1 (Sin1lf3) expression vector pGEX 4T-1:ovSin1lf3 was constructed as follows. Sin1lf3 was a cDNA fragment encoding the C-terminal 296-aa-long peptide (residues V227-Q522) of ovSin1. It was PCR-amplified using pGEM-T-Easy:Sin1lf3 as template, and the forward primer (pgadsinlf3fw) and the reverse primer (pgadsinlf3rv) to provide EcoRI and XhoI restriction sites (Table 1). The amplified fragment was digested with EcoRI and XhoI and ligated into the same double-enzyme-digested linear plasmid pGEX 4T-1 (Amersham Biosciences). The GST-ovIFNAR2MF expression vector pGEX 2T-1:ovIFNAR2MF was constructed in essentially the same manner from IFNAR2MF with a cDNA fragment encoding a 185-aa-long C-terminal peptide (residues T352-N536) of ovIFNAR2, and two primers, forward (R2MFFW) and reverse (R2T2RV), which provided BamHI and EcoRI restriction sites, respectively (Table 1). To construct the mammalian expression vector pCMV-Myc:ovSin1 for producing epitope-tagged Myc-Sin1, the full-length ovSin1 cDNA was PCR amplified with primers pcmvsin1fw and pcmvsin1rv primers (Table 1). The amplified fragment was digested with EcoRI and KpnI, purified, and ligated into the plasmid pCMV-Myc (BD Clontech, Palo Alto, CA). The expression vector pFLAG-CMV-6b:ovIFNAR2CD was constructed from IFNAR2CD, the cDNA fragment encoding the cytoplasmic domain (residues K268-N536) of ovIFNAR2. The cDNA was PCR-amplified using pAS1:ovIFNAR2LF as template and two primers, pcmvr2cdfw and pcmvr2cdrv (Table 1). The amplified fragment was digested with EcoRI and KpnI and ligated into pFLAG-CMV-6b (Sigma-Aldrich Corp.). All constructs were verified by the corresponding double-restriction enzyme digestion and DNA sequencing. Construction of cDNA libraries Endometrial tissues were collected and homogenized, and total RNA was extracted using RNA STAT-60 (Tel-Test, Friendswood, TX). The purity and amount of RNA were estimated by absorbance at 260 and 280 nm. The RNA used to construct the library was obtained from ewes at several stages of the estrous cycle (d 7, 300 μg; d 8, 300 μg; d 10, 280 μg; d 13, 300 μg; d 15, 300 μg; d 16, 300 μg) and pregnancy (d 13, 300 μg; d 15, 300 μg; d 16, 300 μg; d 21, 300 μg). These samples of RNA were pooled, and provided to Stratagene (La Jolla, CA) as a source of polyadenylated RNA for construction of the HybriZAP-2.1 λ phage cDNA library. After first strand synthesis, an XhoI site was added at the 3′ end of the cDNA. An EcoRI site was added at the 5′ end of the cDNA by ligating an EcoRI adapter to the 5′ end of the double-stranded cDNA. The cDNA was then ligated into λ arms cut with EcoRI and XhoI. To amplify the primary λ phage library, XL1-Blue MRF′ host cells were grown to the log phase and diluted to an OD600 of 0.5 in 10 mm MgSO4. Cells (600 μl) were then mixed with approximately 5 × 104 plaque-forming units (pfu) of λ phage library and incubated for 15 min at 37 C. Infected bacteria were mixed with 6.5 ml melted casein hydrolysate/yeast extract (NZY) top agar (∼48 C) and spread onto a bacterial lawn on a 150-mm NZY agar plate, which was incubated at 37 C for 6–8 h, at which time the plaques reached 1–2 mm in diameter. Suspension medium (SM) buffer (8 ml) was added to each plate and incubated at 4 C overnight. After removal of cell debris, the λ phage suspension was either stored at 4 C with chloroform (0.3%, vol/vol) or at −80 C with dimethylsulfoxide (7%, vol/vol). This procedure was repeated 20 times to provide a large stable quantity of high titer stock representing 106 pfu of the primary library. Freshly grown XL1-Blue MRF′ cells (5.4 × 108 cells in 200 μl) were infected with the amplified λ phage library (5.4 × 107 pfu in 20 μl, representing 106 independent clones) at a multiplicity of infection of 1:10 λ phage to cell ratio. ExAssist helper phage (2 × 109 pfu in 200 μl) was then added at a 10:1 helper phage to cell ratio. Cells were incubated for 15 min at 37 C, and 20 ml Luria Bertoni medium were added. After incubation at 37 C for 3 h, cells were treated at 70 C for 20 min to release the phagemid. Cell debris was removed by centrifugation, and supernatant was collected and stored at 4 C. Freshly prepared XLOLR cells were used to determine the titer of excised phagemid. The excised phagemid library was amplified in XLOLR competent cells, and plasmids were prepared by using a Maxi-Prep kit from Promega Corp. Yeast two-hybrid screening The yeast cell line YRG2 (genotype Matα ura3–52 his3–200 ade2–101 lys2–801 trp1–901 leu2–3 112 gal4–542 gal80–538 LYS2::USAGAL1-TATAGAL1HIS3URA::UASGAL4 17mers(×3)-TATACYC1-lacZ; Stratagene) was used for the yeast two-hybrid screen. The reporter genes were lacZ and HIS3, and the transformation markers were leu2 and trp1. Yeast cells were grown in rich medium YPD (yeast extract/peptone/dextrose) at 30 C according to the Clontech Matchmaker Manual (BD Clontech, Palo Alto, CA). After transformation, yeast cells were plated onto glucose-based SD medium without Trp (SD/−Trp), Leu (SD/−Leu), Trp/Leu (SD/−Trp-Leu), or Trp/Leu/His (SD/−Trp-Leu-His). To prevent basal activation, SD/−Trp-Leu-His media were supplemented with 15 mm 3-aminotriazole (3-AT). Before the baits were used for the library screening, their basal activation and toxicity were determined. Basal activation was measured by estimating the growth rate of the yeast transformants with pAS1:ovIFNAR2MF (or the other two baits) on the synthetic dropout medium SD/−Trp-His and 15 mm 3-AT at 30 C. The β-galactosidase (LacZ) activity of the yeast transformant was also measured using colony lift assay. The toxicity of the bait was determined by measuring and comparing the growth rate of the yeast transformant with pAS1:ovIFNAR2MF with that of the positive control YRG2/pAS1:p53 /pAD-GAL4-2.1:SV40 in the liquid SD/−Trp and SD/−Trp-Leu, respectively. For library screening, yeast YRG2 cells were simultaneously cotransformed with the pAS1:ovIFNAR2 plasmid and the cDNA library plasmids by the lithium acetate method (BD Clontech). Positive clones that showed rapid growth on the medium SD/−Trp-Leu-His and 15 mm 3-AT were selected and then assayed for LacZ. Double-positive colonies, His3+LacZ+, were restreaked onto SD/−Trp-Leu-His and 15 mm 3-AT medium and retested for positive phenotypes. To confirm a protein-protein interaction, two plasmids, pAS1:bait and pAD-GAL4-2.1:prey, recovered as described below, were simultaneously cotransformed into competent yeast cells by the lithium acetate method, and selection was performed as described above. To recover plasmids from the yeast, cells from single colonies were grown on SD/−Trp-Leu-His liquid medium. After harvest, cells were lysed in 2% Triton X-100, 1% sodium dodecyl sulfate, 100 mm NaCl, 10 mm Tris-HCl (pH 8.0), 1 mm EDTA, and DNA was collected after phenol/chloroform/isoamyl alcohol (25:24:1; 0.2 ml) extraction. The plasmid DNA was resuspended in 20 μl 1× TE buffer (10 mm Tris-HCl and 1 mm EDTA). Sequencing and computer-assisted sequence analysis Inserts in the yeast plasmids were PCR-amplified with the pAD vector-specific primers (pgadf and pgadr; Table 1). PCR amplification of the bait fragments with the same templates and the pAS1 vector-specific primers (pmaf and pmar; Table 1) provided the positive control. The PCR products were gel-purified with a Qiagen kit (Qiagen, Hilden, Germany) and were used as templates for the subsequent sequencing analysis. Sequencing was performed using the standard dideoxynucleotide chain termination method with activation domain (AD) vector-specific forward and the reverse primers (pgadf and pgadr; Table 1). The beginning of the insert sequences was inferred from the preceding GAL4-AD sequence. Editing and formatting of DNA and protein sequences were performed by GCG sequence analysis software (Genetics Computing Group, Madison, WI). The identities of the inserts were determined by searching the databases at the National Center for Biotechnology Information website. RT and nested PCR RNA was extracted from various ovine tissues, and RT was performed on approximately 2 μg total RNA. Nested PCR used two rounds of PCR. In the first, the RT product was used as template with two oligonucleotides as outer primers (6502nstpcrf1and 6502nstpcrr; Table 1) under the following conditions: one pretreatment cycle of 95 C for 5 min; 35 cycles of 1 min at 95 C, 1 min at 56 C, and 1 min at 72 C; and one cycle of 72 C at 5 min. The PCR product from the first round of PCR, which was not visible on the 2% agarose gel, was used as template in the second round of PCR, with two other oligonucleotides as inner primers (6502nstpcrf2 and 65201pcdr; Table 1). The thermal cycles were one cycle of 95 C for 5 min for pretreatment; 35 cycles 1 min at 95 C, 1 min at 60 C, and 1 min at 72 C; and one cycle of 72 C for 5 min. The amount of DNA generated from the second PCR was sufficient for subsequent cloning and sequencing. Ovine ribosomal protein S25 was used as the internal control and was amplified for only one round of PCR (primers s25pet15bf and s25pet15br; Table 1). Water was used as the negative control. Preparation and purification of rabbit anti-Sin1lf3 and anti-ovIFNAR2MF antisera BL21 (DE3) pLyS/pGEX 4T-1:ovSin1lf3 cells were grown at 37 C until the OD600 was about 1.0 and were induced by addition of 5 mm isopropyl-β-d-thiogalactopyranoside. After 4–6 h, cells were collected, washed, and lysed using a French pressure cell press (SLM-Aminco, Urbana, IL). GST fusion protein was purified from the supernatant solution by affinity chromatography on glutathione beads according to the manufacturer recommendation (Amersham Biosciences). Purity was assessed by SDS-PAGE gels, and the protein was sterilized by filtering through 0.22-μm pore size filters (Nalgene-Nunc, Rochester, NY). Antiserum was raised in New Zealand White rabbits (44). The first immunization involved 250 μg Sin1 in Freund’s complete adjuvant. Subsequent booster immunizations with 150 μg in incomplete adjuvant were performed at approximately monthly intervals for 6 months. Serum was collected from an ear vein. The antiserum was cleared of GST-reactive antibodies by passing through GST beads. A portion was then applied to a GST-Sin1lf3 affinity column to remove immunoglobulins that bound Sin1. The flow-through was used as a reagent for negative controls. GST-ovIFNAR2MF was prepared as described above, and rabbits were immunized using an identical procedure. IgG was purified after adsorption (binding buffer: 3.2 m NaCl and 1.6 m glycine, pH 9.0) to an Affi-Prep protein A Matrix (Bio-Rad Laboratories, Hercules, CA) and eluting with 100 mm sodium citrate, pH 3.0. The solution was neutralized with 1 m Tris-HCl (pH 8.0). GST-reactive immunoglobulin was purified and processed as described above. Mammalian cell lines COS-1 cells were maintained in DMEM supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin at 37 C under an atmosphere of 5% CO2 and air. The mouse fibroblast cell line L929, including the cells stably transfected with ovIFNAR2 (45), were maintained in RPMI 1640 supplemented with 10% fetal bovine serum and 1% penicillin and streptomycin at 37 C under 5% CO2 and air. Before transfection, the medium was changed to DMEM with the same supplements. Immunohistochemistry Immunohistochemistry was performed on 4.5-μm sections from d 14 pregnant sheep endometrium (44). Sections were exposed to rabbit anti-ovSin1lf3 antiserum in 1× Tris-buffered saline/Tween 20 (dilution, 1:1000) at 4 C overnight. After washing, the secondary antibody (biotinylated antimouse and antirabbit IgG, Dako LSAB2 system, Dako-Cytomation, Carpinteria, CA) was added without dilution at room temperature for 30 min. Slides were washed and exposed to undiluted streptavidin-coupled horseradish peroxidase (Dako LSAB2 system). Color development was performed by incubating the slides with diaminobenzidine substrate solution according to the instructions of the manufacturer. Sections were counterstained with hematoxylin for 30 sec. Preimmune and adsorbed antisera were used as negative controls. Sections were viewed under a Provis AX70 microscope (Olympus Corp., New Hyde Park, NY). Transfection, coimmunoprecipitation, and immunoblotting COS-1 cells (6.5 × 105/dish) were grown overnight to about 60% confluence in 60-mm culture dishes, then transiently transfected with 20 μg each of pCMV-Myc:Sin1 and pFLAG-CMV-6b:IFNAR2CD using the standard calcium phosphate precipitation method (46). Cells were washed 6 h after transfection and incubated in fresh DMEM with appropriate supplements. Whole cell lysates were prepared 48 h after transfection using 1× passive lysis buffer (Promega Corp.) supplemented with a protease inhibitor cocktail (1:200; Sigma-Aldrich Corp.). For immunoprecipitation, 600 μg cell lysate protein were incubated with 30 μg mouse anti-FLAG mAb in 1× immunoprecipitation buffer [50 mm Tris-HCl (pH 7.5), 15 mm EGTA, 100 mm NaCl, 0.1% (wt/vol) Triton X-100, 1× protease inhibitor mixture, 1 mm dithiothreitol, and 1 mm phenylmethylsulfonylfluoride] at 4 C for 4 h. The antigen-antibody complex was collected by adding 40 μl (bed volume) protein A/G Plus-Agarose (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and incubating at 4 C for 2 h. After three washes, the complex-bound resin was suspended in 1× sodium dodecyl sulfate buffer and boiled, and proteins were resolved on 12.5% SDS-PAGE gels. After Western blotting, proteins carrying the Myc epitope tag were detected with mouse anti-Myc mAb (BD Clontech) using chemiluminescence with the Western-Star kit (Tropix, Bedford, MA) according to the instructions of the manufacturer. Immunofluorescence To determine the distribution of Sin1 in COS-1 cells, cells were transiently transfected with the mammalian expression construct pCMV-Myc:ovSin1 using the calcium phosphate precipitation method. COS-1 cells were inoculated into six-well plates, each well containing a glass coverslip. Cells were grown for 24 h to 40–60% confluence (∼7.5× 105 cells) and transfected with 10 μg plasmid. After 36 h, the coverslips were washed twice with 1× PBS and exposed to 2% (wt/vol) paraformaldehyde containing 0.1% Triton X-100 in 1× PBS for 30 min at 4 C. They were then incubated with 50% goat serum at room temperature for 2 h, washed with 1× PBST (1× PBS buffer with 0.1% Tween 20), and incubated with mouse anti-Myc mAb (dilution, 1:1000) at 4 C overnight. After washing three times with 1× PBST, the coverslips were incubated with Alexa Fluor 488 F(ab′)2 of goat antimouse IgG (dilution, 1:1000) at room temperature for 2 h, followed by three washes with 1× PBST. Nuclei were stained with 4′,6-diamido-2-phenylindole hydrochloride (DAPI; 1 μg/ml; Sigma-Aldrich Corp.) in 1× PBS at room temperature for 15 min. After an additional washes with 1× PBS, coverslips were mounted on glass slides with one drop of VectaShield (Vector Laboratories, Inc., Burlingame, CA) and sealed with nail polish. Fluorescence analysis was performed on an Eclipse E800 microscope (Nikon, Melville, NY). Mock-transfected cells were used as negative controls. To colocalize transfected Myc-Sin1 in L929 cells stably expressing IFNAR2 (L929/ovIFNAR2 cells), cells were again grown in six-well plates on coverslips. When they reached 90–95% confluence (1 × 106 cells/well), the RPMI 1640 medium was replaced with DMEM, and cells were transfected with pCMV-Myc:ovSin1 by the Lipofectamine method (LipofectAmine2000 reagent, Invitrogen Life Technologies). A volume of 15 μl LF2000 and 15 μg plasmid were added to each well. Cells were treated as described above for COS-1 cells, except that they were incubated with mouse anti-Myc mAb (dilution, 1:1000). Bound mouse IgG was detected with Alexa Fluor 488 F(ab′)2 of goat antimouse IgG (dilution, 1:1000). To detect ovIFNAR2, coverslips were incubated with purified rabbit anti-ovIFNAR2 polyclonal antiserum (1:200; 1 μg/ml) at 4 C overnight. After washing, coverslips were exposed to Alexa Fluor 568 F(ab′)2 of goat antirabbit IgG (H+L) (dilution, 1:2000), at room temperature for 1 h, and nuclei were stained with DAPI. Cells were viewed on a Nikon Eclipse E800 microscope. Mock-transfected cells were used as a negative control. L929 cells not expressing ovIFNAR2 provided a second negative control. The third negative control employed the rabbit preimmune serum instead of IFNAR2 antiserum. Results Identification of Sin1 as a protein that interacts with IFNAR2 in the yeast two-hybrid screen To screen for proteins that bound to the cytoplasmic domain of IFNAR2, three baits were designed (Fig. 1). The first consisted of the entire cytoplasmic domain (ovIFNAR2LF). The second (ovIFNAR2MF) encoded the C-terminal region of the cytoplasmic domain ovIFNAR2, a 185-aa-long peptide that included SLEDC motifs, which are not present in either the murine (41) or human polypeptides (35, 36, 47), but are repeated three times in the ovine protein and twice in the bovine protein (36) (Fig. 1). The MF bait also contained the established STAT2 binding domain, five conserved acidic regions (A2-A6), and the conserved C-terminal domain. The third bait constructed was a short fragment (Thr352-Gln417; ovIFNAR2SF) that contained the SLEDC repeats at its amino terminus and represented the first third of the MF bait. Here we describe the outcome of a screen performed with ovIFNAR2MF. Yeast colonies transformed with pAS1:ovIFNAR2MF and selected for growth on the SD/−Trp medium grew at only about one quarter the rate as controls on SD medium. To minimize this problem, yeast cells were transformed simultaneously with the bait vector and the library vector. To reduce the background growth on the selective SD/−Trp-Leu-His medium, it was necessary to add 15 mm 3-AT. Approximately 6.5 × 106 yeast colonies were screened. Eighty His+LacZ+-positive clones were selected randomly for further analysis. Of them, 74 contained both the AD and DNA binding domain vectors and had inserts ranging in size from 20–1320 bp. Thirty of these clones had open reading frames and no frame shift, and could be placed into two groups (Table 2). The first group of 25 comprised five ribosomal proteins (RPS26, RPS23, RPL26, RPL12, and RPS25) and two ubiquitin-ribosomal protein fusion proteins (Ubq-L40 and Ubq-S27a). Because the bait was acidic (pH 4.0) and the proteins were basic, the interaction of these proteins with IFNAR2 was considered likely to be nonspecific, although a true interaction could not be ruled out. The second group consisted of five hypothetical polypeptides between 50 and 100 aa in length, which could not be matched functionally with other known proteins, and a 114-aa polypeptide corresponding to the C-terminus of a little studied protein previously named Sin1 (48–50). TABLE 2 Potential IFNAR2-interacting proteins obtained in the yeast two-hybrid screen with ovIFNAR2MF as bait Group 1 Group 2 Group 3 Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned ovUbq-L40 8 mf6715 2 ovSin1 1 (AY563026) (CK830668) (AY547378) ovRPS26 7 mf7112 1 mf6802 1 (AY563024) (CK830671) (CK830669) ovUbq-S27a 3 mf7501 1 mf6829 1 (AY566307) (CK830667) (CK830670) ovRPS23 2 (CK830675) ovRPL12 2 (CK830674) ovRPL26 2 (CK830673) ovRPS25 1 (AY563025) Group 1 Group 2 Group 3 Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned ovUbq-L40 8 mf6715 2 ovSin1 1 (AY563026) (CK830668) (AY547378) ovRPS26 7 mf7112 1 mf6802 1 (AY563024) (CK830671) (CK830669) ovUbq-S27a 3 mf7501 1 mf6829 1 (AY566307) (CK830667) (CK830670) ovRPS23 2 (CK830675) ovRPL12 2 (CK830674) ovRPL26 2 (CK830673) ovRPS25 1 (AY563025) Ubq-L40, Ubiquitin/L40 fusion protein; ubq-S27a, ubiquitin/S27a fusion protein; RPS, small subunit ribosomal protein; RPL, large subunit ribosomal protein; mf, positive clones obtained by using ovIFNAR2MF as bait. Open in new tab TABLE 2 Potential IFNAR2-interacting proteins obtained in the yeast two-hybrid screen with ovIFNAR2MF as bait Group 1 Group 2 Group 3 Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned ovUbq-L40 8 mf6715 2 ovSin1 1 (AY563026) (CK830668) (AY547378) ovRPS26 7 mf7112 1 mf6802 1 (AY563024) (CK830671) (CK830669) ovUbq-S27a 3 mf7501 1 mf6829 1 (AY566307) (CK830667) (CK830670) ovRPS23 2 (CK830675) ovRPL12 2 (CK830674) ovRPL26 2 (CK830673) ovRPS25 1 (AY563025) Group 1 Group 2 Group 3 Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned Proteins (GenBank accession no.) No. of times cloned ovUbq-L40 8 mf6715 2 ovSin1 1 (AY563026) (CK830668) (AY547378) ovRPS26 7 mf7112 1 mf6802 1 (AY563024) (CK830671) (CK830669) ovUbq-S27a 3 mf7501 1 mf6829 1 (AY566307) (CK830667) (CK830670) ovRPS23 2 (CK830675) ovRPL12 2 (CK830674) ovRPL26 2 (CK830673) ovRPS25 1 (AY563025) Ubq-L40, Ubiquitin/L40 fusion protein; ubq-S27a, ubiquitin/S27a fusion protein; RPS, small subunit ribosomal protein; RPL, large subunit ribosomal protein; mf, positive clones obtained by using ovIFNAR2MF as bait. Open in new tab The interaction between ovSin1SF (in the AD vector used as the prey) and pAS1:ovIFNAR2MF (as the bait) was confirmed by cotransformation in a separate two-hybrid assay in virgin yeast cells (data not shown). No positive colonies were obtained when the bait vector was transformed with an empty prey vector, or when the prey vector was transformed with an empty bait vector. As expected, the positive control (p53 and SV40 T antigen) provided the His3+/LacZ+ phenotype. The unique presence of the tandem SLEDC repeats in ovine and bovine IFNAR2 (36) suggested that they might play a unique role in IFN signal transduction in sheep and cattle, but not in mice or humans. The bait used for the yeast two-hybrid screening, ovIFNAR2MF, contained the SLEDC motifs at its N terminus. To determine whether this region of the bait mediated the interaction between ovIFNAR2MF and Sin1, the yeast-two hybrid assay was performed with the Sin1-AD vector and pAS1:ovIFNAR2SF (Fig. 1), which expressed a 65-aa polypeptide containing the three SLEDC repeats. The plasmid expressing the full-length cytoplasmic domain, pAS1:ovIFNAR2LF, was used as a positive control. As expected, ovIFNAR2LF provided the His3+/LacZ+ phenotype in presence of coexpressed Sin1, whereas ovIFNAR2SF did not (data not shown). Together these experiments suggest that the carboxyl end of ovine Sin1 binds within the 123-aa C-terminal region of IFNAR2 and that the SLEDC motifs are not involved in the interaction. Cloning of full-length ovSin1 cDNA The ovSin1 cDNA fragment identified above shared approximately 82% nucleotide sequence identity with chicken Sin1 cDNA (AF153127) and 94% with a human Sin1 cDNA fragment (BC002326) in their regions of overlap (data not shown). It was therefore assumed that a similar degree of similarity extended through the full-length transcripts. Two upstream forward primers were designed, one representing a sequence conserved within the 5′-untranslated region (5′UTR) of the human and chicken sequences, and the other a conserved sequence beginning at the start codon (Table 1). The two downstream primers were from within the 3′UTR of the ovSin1 cDNA obtained in the yeast two-hybrid screen. These pairs of primers were used as the inner and outer primers for the nested PCRs to clone an ovSin1 cDNA that included the entire open reading frame. The RT products from two randomly selected sheep tissues (kidney and pituitary) were used as template. A band of approximately 1500 bp was obtained in both reactions. Subsequent sequencing confirmed that the cloned cDNAs were identical and that both represented ovSin1. ovSin1 is 522 aa in length (Fig. 2), of theoretical molecular weight 59,200, and encoded by a 1569-nucleotide long open reading frame (GenBank accession no. AF153127). The cDNA shares 94.3% and 81.7% sequence identity at the nucleotide level with the sequences from human and chicken, respectively (data not shown). The inferred aa sequences are even more highly conserved (98.6% and 88.3%, respectively) (Fig. 2), and all three proteins are of identical length. The majority of the substitutions are conservative. A search of the Drosophila genome sequence reveals a single intronless gene of 569 codons that corresponds to Sin1 (Fig. 2). Its inferred aa sequence could be aligned quite closely with that of the full-length ovine, human, and chicken proteins after introducing several gaps. It demonstrated approximately 30% identity with the ovine, human, and chicken Sin1 sequences. Apparent orthologs of Sin1 can be detected in the genome sequences of human, mouse, rat, zebrafish, Caenorhabditis, Neurospora, Saccharomyces cerevisiae, and Schizosaccharomyces pombe (data not shown). In each species only a single gene appears to be present (50). In addition established sequence tag (EST) sequences from cow and pig could be assembled to provide full-length cDNA (data not shown). Fig. 2 Open in new tabDownload slide The deduced aa sequences of Sin1 from sheep, human, chicken, and fruit fly. Sin1 protein sequences from various species were aligned by using Pileup and Genedoc. Black shading indicates conserved aa. Oa, Ovis aries (GenBank accession no. AY547378). Hs, Homo sapiens (GenBank accession no. NM_024117 and BC002326); Gg, Gallus gallus (GenBank accession no. AF153127); Dm, Drosophila melanogaster (GenBank accession no. AE003814). The ovSin1 fragment identified in the yeast two-hybrid screen is underlined. Fig. 2 Open in new tabDownload slide The deduced aa sequences of Sin1 from sheep, human, chicken, and fruit fly. Sin1 protein sequences from various species were aligned by using Pileup and Genedoc. Black shading indicates conserved aa. Oa, Ovis aries (GenBank accession no. AY547378). Hs, Homo sapiens (GenBank accession no. NM_024117 and BC002326); Gg, Gallus gallus (GenBank accession no. AF153127); Dm, Drosophila melanogaster (GenBank accession no. AE003814). The ovSin1 fragment identified in the yeast two-hybrid screen is underlined. Expression of Sin1 transcripts across tissues and species To determine the expression pattern of ovSin1 mRNA in sheep tissues, nested PCR was performed with RT products as templates. The first round of PCR with 35 thermal cycles did not yield products visible on the agarose gels, presumably reflecting the low abundance of Sin1 mRNA. In contrast, the internal control, ovRPS25, could be easily amplified by this procedure (Fig. 3, lower panel). After a second round of PCR with the nested primers, bands of the anticipated sizes were noted for all tissues (d 15 conceptus, kidney, pituitary, liver, and endometrium; Fig. 3, upper panel). ovSin1 mRNA appears to be widely expressed, but may be present in low concentrations. Fig. 3 Open in new tabDownload slide The distribution of Sin1 mRNA in sheep. Reverse-transcribed RNA from tissues was used as the template. A Sin1 fragment (Sin1lf3, encoding residues V227-Q522; Fig. 2) was amplified using nested PCR. RPS25 was amplified using normal PCR. A, Upper panel, M, DNA marker; 1, water control; 2, conceptus; 3, endometrium; 4, kidney; 5, liver; 6, pituitary. Lower panel, ovRPS25 was used as the internal control. The pictures are negatives. Arrows show the positions of Sin1lf3 (891 bp) and RPS25 (378 bp). B, Alternatively spliced isoforms (Sin1a and Sin1b, denoted by arrowheads) of ovSin1 were detected in all tissues examined. Shown here is not the full-length ovSin1 cDNA but a fragment (Sin1a is 891 bp; Sin1b is 773 bp; determined by DNA sequencing.). Lane 1, endometrium; lane 2, kidney; lane 3, liver; lane 4, pituitary. Fig. 3 Open in new tabDownload slide The distribution of Sin1 mRNA in sheep. Reverse-transcribed RNA from tissues was used as the template. A Sin1 fragment (Sin1lf3, encoding residues V227-Q522; Fig. 2) was amplified using nested PCR. RPS25 was amplified using normal PCR. A, Upper panel, M, DNA marker; 1, water control; 2, conceptus; 3, endometrium; 4, kidney; 5, liver; 6, pituitary. Lower panel, ovRPS25 was used as the internal control. The pictures are negatives. Arrows show the positions of Sin1lf3 (891 bp) and RPS25 (378 bp). B, Alternatively spliced isoforms (Sin1a and Sin1b, denoted by arrowheads) of ovSin1 were detected in all tissues examined. Shown here is not the full-length ovSin1 cDNA but a fragment (Sin1a is 891 bp; Sin1b is 773 bp; determined by DNA sequencing.). Lane 1, endometrium; lane 2, kidney; lane 3, liver; lane 4, pituitary. The widespread distribution of the Sin1 transcript is supported by evidence from other species. A search of a bovine ESTs indicated the presence of Sin1 transcripts in bovine kidney, skin, d 20–40 embryos, and a pooled library made from testis, thymus, semitendonosus muscle, longissimus muscle, pancreas, adrenal, and endometrium (see Table 3 published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org.). Similarly, Sin1 sequences have been entered into EST data bases from at least 30 different human and numerous different mouse sources, as well as from multiple tissues of rat, pig, chicken, zebrafish, frog, and fruit fly (see supplemental data, Table 3). Together, this information shows that Sin1 is not only highly conserved, particularly within vertebrates, but also widely distributed across different organs, tissues, and cell types. Existence of alternatively spliced forms of ovSin1 mRNA During cloning of a C-terminal fragment of Sin1, the PCR-amplified Sin1 transcript was always found as two bands (Fig. 3), each of which represented Sin1. The upper band, Sin1a, was 891 bp long, whereas the lower band, Sin1b, lacked a 108-bp fragment (encoding a 36-residue peptide, aa 321–356; Fig. 2) in the middle of the full-length transcript. Densitometric comparisons indicated that Sin1b generally provided only about 5% of the total cDNA in the amplified samples. Both isoforms were present in all ovine tissues examined (Fig. 3B). To decide whether Sin1a and Sin1b represented different gene products or alternatively spliced forms of a single gene, alignment was performed between the Sin1 cDNA sequences and human genomic DNA sequences. Only a single human gene could be found, located on chromosome 9 (9q34.11–9q34.12; ∼240 kb). The human Sin1 gene has 11 exons (Fig. 4). ovSin1b lacks exon 7. Schroder et al. (50) reached essentially identical conclusions in a recent independent study of the human Sin1 gene (50). All introns of the human Sin1 gene have typical boundaries, i.e. 5′-GT-3′ at their 5′ ends and 5′-AG-3′ at their 3′ ends (data not shown). These results strongly suggest that Sin1a and Sin1b result from alternative splicing of transcripts from a single Sin1 gene. Fig. 4 Open in new tabDownload slide The gene structure of human Sin1. The human genome database was searched using BLASTn with the ovine Sin1 cDNA sequence including 5′- and 3′UTRs. Only a single Sin1 gene was found (on human chromosome 9; 9q34.11–9q34.12; ∼240 kb). The synteny map between humans and sheep suggests that the ovSin1 gene is located on sheep chromosome 3. The green box (exon 7; 112 bp) is not present in the alternatively spliced form Sin1b (represented as a folded line in the lower panel). Exon 7 encodes aa 320–356 (see Fig. 2). The start codon ATG begins at the 72nd base in exon 1. The stop codon TAG begins at the123rd base of exon 11. Fig. 4 Open in new tabDownload slide The gene structure of human Sin1. The human genome database was searched using BLASTn with the ovine Sin1 cDNA sequence including 5′- and 3′UTRs. Only a single Sin1 gene was found (on human chromosome 9; 9q34.11–9q34.12; ∼240 kb). The synteny map between humans and sheep suggests that the ovSin1 gene is located on sheep chromosome 3. The green box (exon 7; 112 bp) is not present in the alternatively spliced form Sin1b (represented as a folded line in the lower panel). Exon 7 encodes aa 320–356 (see Fig. 2). The start codon ATG begins at the 72nd base in exon 1. The stop codon TAG begins at the123rd base of exon 11. Identical alternative splicing for Sin1 appears to be conserved in the human. For example, the Sin1 cDNA cloned by Colicelli et al. (48) was Sin1a, whereas an EST encoding a hypothetical protein (MGC2754 mRNA, GenBank accession no. BC002326) corresponded to Sin1b and lacked exon 7. Localization of Sin1 in ovine endometrium To determine the expression pattern for Sin1 in endometrium, immunohistochemistry was performed on sections of d 14 pregnant sheep endometrium with rabbit anti-ovSin1 antiserum. The antigen was highly concentrated in the luminal epithelium and glandular epithelium, but was barely detectable in the stromal tissue (Fig. 5, A and B). An identical expression pattern was previously noted for ovIFNAR2 in ovine endometrium on d 14 of pregnancy (44). Accordingly, uterine epithelial cells are generally considered to be the target for conceptus-derived IFN-τ. Fig. 5 Open in new tabDownload slide The localization of Sin1 on d 14 sheep endometrium. Rabbit anti-Sin1 antiserum was used as the first antibody (1:1000). Biotinylated goat antirabbit Ig was used as the secondary antibody and was detected by streptavidin-coupled horseradish peroxidase (HRP), with diaminobenzidine as the substrate. A, Preimmune antiserum (negative control); B, antiserum absorbed with GST-Sin1lf3 (negative control); C, antiserum against Sin1. Bars, 100 μm. Fig. 5 Open in new tabDownload slide The localization of Sin1 on d 14 sheep endometrium. Rabbit anti-Sin1 antiserum was used as the first antibody (1:1000). Biotinylated goat antirabbit Ig was used as the secondary antibody and was detected by streptavidin-coupled horseradish peroxidase (HRP), with diaminobenzidine as the substrate. A, Preimmune antiserum (negative control); B, antiserum absorbed with GST-Sin1lf3 (negative control); C, antiserum against Sin1. Bars, 100 μm. Cellular distribution of ovSin1 in transiently transfected COS1 cells An in silico analysis (motif scan at http://hits.isb-sib.ch) (51) of Sin1 primary sequence was generally uninformative, but did reveal a weak match for a bipartite nuclear localization signal (R81RRSNTAQRLERLRKERQ98) of Sin1. However, fluorescence immunolocalization performed on nontransfected cells provided too equivocal a signal to judge whether Sin1 was, in fact, located in the nucleus. COS-1 cells were therefore transiently transfected with pCMV-Myc:ovSin1 and expressed antigen detected by the mouse monoclonal antibody α-Myc. Western blotting analysis revealed a single positive band of estimated molecular weight 70,000, which corresponded to the expected size of the epitope-tagged Sin1 fusion protein (Fig. 6, upper panel). The same antibody showed that the Myc-Sin1 antigen was present predominantly in the cytoplasm and not in the nucleus of transfected cells. Antigen appeared to be associated with the plasma membrane and internal cytoplasmic structures, rather than being distributed diffusely through the cytoplasm (Fig. 6, B and C). The same localization pattern, including lack of nuclear labeling, was observed whether transfected Myc-Sin1 was expressed at high or low levels (data not shown). Fig. 6 Open in new tabDownload slide Expression and subcellular localization of Sin1 in transfected COS-1 cells. COS-1 cells were transiently transfected with Myc-Sin1. The upper panel shows the Western blot for the detection of Myc-Sin1 in lysates of transfected cells. Detection was by mouse anti-Myc monoclonal antibody and enhanced chemiluminescence (ECL). Lane 1, Nontransfected control cells; lane 2, empty plasmid transfection; lane 3, Myc-Sin1 transfection. The arrowhead denotes the position of Myc-Sin1. Bars, 15 μm. For the images, cells were fixed and stained with DAPI to visualize nuclei (A). Epitope-tagged Myc-Sin1 was detected with mouse anti-Myc monoclonal antibody (1:1000) and Alexa Fluor 488 F(ab′)2 of goat antimouse IgG (dilution 1:1000; B). The bottom panel (C) shows the merged images. Fig. 6 Open in new tabDownload slide Expression and subcellular localization of Sin1 in transfected COS-1 cells. COS-1 cells were transiently transfected with Myc-Sin1. The upper panel shows the Western blot for the detection of Myc-Sin1 in lysates of transfected cells. Detection was by mouse anti-Myc monoclonal antibody and enhanced chemiluminescence (ECL). Lane 1, Nontransfected control cells; lane 2, empty plasmid transfection; lane 3, Myc-Sin1 transfection. The arrowhead denotes the position of Myc-Sin1. Bars, 15 μm. For the images, cells were fixed and stained with DAPI to visualize nuclei (A). Epitope-tagged Myc-Sin1 was detected with mouse anti-Myc monoclonal antibody (1:1000) and Alexa Fluor 488 F(ab′)2 of goat antimouse IgG (dilution 1:1000; B). The bottom panel (C) shows the merged images. Coimmunoprecipitation of ovSin1 and ovIFNAR2 To determine whether ovSin1 and ovIFNAR2 formed an association within cells, both proteins were expressed in COS-1 cells after transient transfection. Each protein was tagged with a different antigen (Myc and FLAG, respectively). Both Myc-Sin1 and FLAG-IFNAR2CD were readily detectable by Western blotting of the cell lysates (Fig. 7, B and C). When FLAG-IFNAR2CD from the cell extracts was collected as an immune complex using mouse anti-FLAG monoclonal antibody, Myc-Sin1 was found to be present in the complexes by Western blotting (Fig. 7D). The coassociation of Myc-Sin1 and FLAG-IFNAR2CD suggests that the two proteins interact with each other in vivo. Fig. 7 Open in new tabDownload slide Interaction between ovIFNAR2CD and ovSin1after coexpression in COS-1 cells. COS-1 cells were cotransfected with expression vectors for ovIFNAR2CD (tagged with FLAG) and ovSin1 (tagged with Myc). Whole cell lysates were collected 48 h after transfection. Immunoprecipitation was then performed with the mouse monoclonal antibody anti-FLAG (α-FLAG). Immunoprecipitates were resolved by 12.5% SDS-PAGE and blotted, and antigen was detected with the mouse monoclonal antibody anti-Myc (α-Myc). A, Expression vector used for transfection; B, expression of FLAG-ovIFNAR2CD in transfected cells, detected with α-FLAG; C, expression of Myc-ovSin1 in transfected cells detected with α-Myc. D, Presence of Myc-ovIFNAR2 in the α-FLAG immunoprecipitates detected with α-Myc. IB, antiserum used for immunoblotting; IP, antiserum used for immunoprecipitation. Lane 1, Mock vector transfection; lane 2, cotransfection with expression vectors for IFNAR2CD and Sin1; lane 3, transfection with expression vector for Sin1; lane 4, transfection with expression vector for IFNAR2CD. Fig. 7 Open in new tabDownload slide Interaction between ovIFNAR2CD and ovSin1after coexpression in COS-1 cells. COS-1 cells were cotransfected with expression vectors for ovIFNAR2CD (tagged with FLAG) and ovSin1 (tagged with Myc). Whole cell lysates were collected 48 h after transfection. Immunoprecipitation was then performed with the mouse monoclonal antibody anti-FLAG (α-FLAG). Immunoprecipitates were resolved by 12.5% SDS-PAGE and blotted, and antigen was detected with the mouse monoclonal antibody anti-Myc (α-Myc). A, Expression vector used for transfection; B, expression of FLAG-ovIFNAR2CD in transfected cells, detected with α-FLAG; C, expression of Myc-ovSin1 in transfected cells detected with α-Myc. D, Presence of Myc-ovIFNAR2 in the α-FLAG immunoprecipitates detected with α-Myc. IB, antiserum used for immunoblotting; IP, antiserum used for immunoprecipitation. Lane 1, Mock vector transfection; lane 2, cotransfection with expression vectors for IFNAR2CD and Sin1; lane 3, transfection with expression vector for Sin1; lane 4, transfection with expression vector for IFNAR2CD. Colocalization of ovSin1 and ovIFNAR2 in transfected L929 cells To determine whether Sin1 colocalized with ovIFNAR2, the mouse cell line L929/ovIFNAR2 (45), which stably expresses ovIFNAR2, was transiently transfected with pCMV-Myc:ovSin1. Dual color immunofluorescence was then employed to compare the localization of the two antigens (Fig. 8). IFNAR2 was strongly expressed in approximately 40% of these stably transfected cells (Fig. 8B). Staining was absent in the nucleus, but was associated with the plasma membrane and cytoplasmic structures, particularly in the perinuclear region of those cells where overall expression appeared to be high. Sin1 expression varied considerably between cells, presumably reflecting inconsistencies in the transfection efficiency of different cells. Only about 1% of the cells showed strong staining equivalent to that exhibited by IFNAR2 (Fig. 8C). In such cells, Sin1 staining generally mirrored, but was not exactly coincident with, that of IFNAR2, with a particularly high concentration of antigen present in the perinuclear region (Fig. 8D). These results are consistent with the view that Sin1 is predominantly associated with cellular membranes, but not exclusively with IFNAR2. Fig. 8 Open in new tabDownload slide Colocalization of Sin1 and IFNAR2 in L929 cells. Stably transfected L929/ovIFNAR2 cells were transiently transfected with the expression vector for Sin1 (tagged with Myc). Cells were fixed, and immunofluorescence was per-formed after treating permeabilized, fixed cells with the rabbit polyclonal anti-ovIFNAR2 (α-R2), followed by goat antirabbit IgG fluorescent conjugate. A similar method was used to detect the location of Myc-Sin1 using mouse monoclonal antibody anti-Myc (α-Myc), followed by goat antimouse immunoglobulin G fluorescent conjugate. Nuclei were stained with DAPI. A, Nuclear staining (purple); B, ovIFNAR2 staining (red); C, Myc-ovSin1 staining (green); D, merged image of A–C. Bars, 15 μm. Arrows indicate the regions of apparent colocalization (yellow) in two cells that showed elevated expression of transfected ovSin1. Fig. 8 Open in new tabDownload slide Colocalization of Sin1 and IFNAR2 in L929 cells. Stably transfected L929/ovIFNAR2 cells were transiently transfected with the expression vector for Sin1 (tagged with Myc). Cells were fixed, and immunofluorescence was per-formed after treating permeabilized, fixed cells with the rabbit polyclonal anti-ovIFNAR2 (α-R2), followed by goat antirabbit IgG fluorescent conjugate. A similar method was used to detect the location of Myc-Sin1 using mouse monoclonal antibody anti-Myc (α-Myc), followed by goat antimouse immunoglobulin G fluorescent conjugate. Nuclei were stained with DAPI. A, Nuclear staining (purple); B, ovIFNAR2 staining (red); C, Myc-ovSin1 staining (green); D, merged image of A–C. Bars, 15 μm. Arrows indicate the regions of apparent colocalization (yellow) in two cells that showed elevated expression of transfected ovSin1. Discussion Sin1 was first identified in a search for human proteins that were capable of suppressing a RAS2 mutant (a constitutively active form of RAS) expressed in the budding yeast (S. cerevisae) (48). Among other abnormalities, the RAS2 mutant demonstrates high levels of activated adenylate cyclase, resulting in an elevated intracellular concentration of cAMP. Such cells are highly susceptible to a variety of environmental stresses, including heat shock. They also proliferate poorly. A transfected human Sin1 cDNA fragment was able to rescue this phenotype. Hence, the gene product was originally called a RAS suppressor (48). Some years later, a two-hybrid screen of a cDNA library from the fission yeast, S. pombe, in which the yeast SAPK, Sty1/Spc1, was used as the bait, led to the discovery of a gene product that interacted with Sty1/Sp1. As a result, the protein, which had sequence similarity to those identified previously in S. cerevisae and human, was called SAPK-interacting protein 1, hence the current name Sin1 (49). The absence of Sin1 in S. pombe provided a phenotype similar to that obtained when Sty1/Spc1 was deleted, namely sensitivity to environmental stressors, sterility, and slow proliferation (49). In yeast, Sin1 protein is phosphorylated constitutively, although phosphorylation becomes enhanced after stress, but not, curiously, as the result of Sty1/Spc1 kinase activity, nor is Sin1 required for Sty1/Spc1 activation. Rather, Sin1 is required to enhance the phosphorylation of Atf1 by Sty1/Spc1 and for effective transcription via the AP-1-like factor, Pap1, in response to environmental stress (49). Taken together, the data from yeast suggests that Sin1 is likely to be involved in either facilitating or altering stress responses through modulating the activity of the SAPK signaling pathway. Its exact placement in that pathway is unclear, nor are there motifs in the Sin1 aa sequence that give any clue to its functional activity. It carries no obvious signatures either of an enzyme activity or of docking sites for other proteins (51). Type I IFNs have been known for several years to regulate the activity of the p38 SAPK pathway in some mammalian cells (12–17, 52), but the relationship has been obscure. Given the interaction between ovIFNAR2 and ovSin1, the data suggest that Sin1 may provide a link between the two pathways. Conceivably, Sin1, constitutively bound to the carboxyl end of IFNAR2, becomes phosphorylated or otherwise activated after IFN binding to the receptor and in this form is able to bind p38 SAPK and direct downstream signaling events, including transcription of selected genes involved in stress responses. Full-length vertebrate Sin1 is 522 aa in length (Fig. 2). Residues 341–522 of the chicken protein, when expressed in S. pombe, are sufficient to provide partial rescue of yeast Sin1 function in stress responses (49), but no other functional studies have been reported since then. The interaction with IFNAR2 also appears to reside close to the carboxyl end of the molecule and specifically within the terminal 114 residues. Accordingly, it is interesting to compare Sin1 sequences among species that have a functional IFN system (vertebrates) with species that appear to lack one, e.g. insects (Fig. 2). Conservation between vertebrates and Drosophila over this stretch of primary structure is relatively poor, but includes several vertebrate sequences, such as HDYKHLYFESDA (aa 458–469) and QKEKKSG (514–521), which have no obvious similarity with the aligned insect sequence. Additional experiments are needed to determine whether these motifs participate in binding to IFNAR2. The results of the two-hybrid screen performed in yeast, which indicated a possible association between Sin1 and IFNAR2, were backed up by experiments performed on mammalian cells. For example, when IFNAR2 and Sin1 were overexpressed in COS-1 cells, the two could be collected together in immune complexes. Sin1 showed a similar distribution to IFNAR2 in uterine endometrium, with a high concentration of expression in the surface and glandular epithelium. Finally, the subcellular localizations of IFNAR2 and Sin1 were comparable when the two were coexpressed in cultured cells. In stably transfected 3T3 cells, ovIFNAR2, an integral membrane protein, was associated with the plasma membrane and with the perinuclear region of the cytoplasm, where membranes in transit to the surface are expected to reside. ovSin1, whose open reading frame lacks both a signal sequence and an obviously hydrophobic membrane-spanning domain, showed a very similar distribution when expressed in these cells (Fig. 8). In some instances the images portraying Sin1 and IFNAR2 localization converged, suggesting that Sin1 resides predominantly close to membrane surfaces, possibly in association with the cytoplasmic regions of receptors, which would include IFNAR2. The fact that Sin1 was identified in a yeast two-hybrid screen with IFNAR2 as bait suggests that the two proteins interact constitutively, most likely without a dependence on covalent modification. The experiments described in this paper, which led to the discovery of Sin1 as a protein that associated with IFNAR2, were initiated on the premise that in sheep endometrium, where a type 1 IFN, IFN-τ, has an unusual function, namely, signaling from the conceptus to the mother during early pregnancy, a nonclassical signal transduction pathway for IFN might be operative. In addition, the epithelial lining of the ovine uterus is particularly rich in IFNRs and presumably in its ability to respond to IFN (43, 44). IFN-τ from the conceptus suppresses the oxytocin-induced secretion of PGF by the endometrium, thereby protecting the corpus luteum from regression and maintaining the pregnancy (53–55). In experiments performed with primary bovine endometrial epithelial cells and an established cell line (BEND), IFN-τ reduced the production of PGF, down-regulated the amount of cyclooxygenase-2 (COX-2; prostaglandin H synthase-2) protein (56–59) and, through a transcription-dependent mechanism, rapidly destabilized COX-2 mRNA (60), although others have reported contrasting results (61, 62). Because IFN-τ stimulates tyrosine phosphorylation, homo- and heterodimer formation of nuclear translocation, and DNA binding of STAT1, -2, and -3 in such cells (63), it has generally been assumed that this pathway must be the one relevant to IFN-τ effects on prostaglandin metabolism. The p38 MAPK pathway might provide an alternative means for this cytokine to manifest its protective effects on the corpus luteum. Because Sin1 modulates the effects of activated Ras in yeast by acting downstream of the SAPK Sty1/Spc (49), there is a possibility that it has an analogous role in uterine endometrial cells. Conceivably, Sin1 is able to redirect or otherwise constrain the activated p38 MAPK pathway when IFN-τ targets the IFNR on the uterine epithelium, such that the half-life of COX-2 mRNA is not extended, PGF production is reduced, and inflammatory responses to the conceptus are minimized. Because the effect of IFN-τ on COX-2 expression and PGF production is concentration dependent, inhibiting at low concentrations and promoting at high concentrations (64), it will be interesting to determine whether these dose-dependent effects correlate with the activity of the p38 MAPK pathway as well as with the subcellular location and phosphorylation status of Sin1. Acknowledgments We thank Dr. Chun-Sheng Han for providing the ovIFNAR2 cDNA and the L929/ovIFNAR2 cells. Mr. James Bixby assisted with application of the GCG software. Drs. Cheryl Rosenfeld and Peter Sutovsky were invaluable as instructors in immunocytochemistry and immunofluorescence experiments, respectively. We thank Wei Zhou for the COS-1 cells, Tina Parks and Anindita Chakrabarty for help in raising and purifying rabbit antibodies, and Dr. Wayne Schroder (Queensland Institute for Medical Research, Brisbane, Australia) for providing a copy of his manuscript (50) ahead of publication. Drs. Toshihiko Ezashi, Mark Hannink, and John Cannon provided critical input throughout the project. This work was supported by National Institutes of Health Grant HD-R01 21896. Current address of S.-Z.W.: Center for Developmental Biology, University of Texas Southwestern Medical Center, 6000 Harry Hines Boulevard, Dallas, Texas 75390. Abbreviations: aa, Amino acid; AD, activation domain; 3-AT, 3-aminotriazole; COX-2, cyclooxygenase-2; DAPI, 4′,6-diamido-2-phenylindole hydrochloride; EST, expressed sequence tag; GST, glutathione-S-transferase; IFN, interferon; IFNR, interferon receptor; Jak, Janus kinase; ov, ovine; pfu, plaque-forming unit; PGF, prostaglandin F2α; SAPK, stress-activated protein kinase; SD, synthetic dropout; Sin1, stress-activated protein kinase-interacting protein 1; STAT, signal transducer and activator of transcription; SV40, simian virus 40; UTR, untranslated region. 1 Uze G , Lutfalla G , Mogensen K 1995 α and β interferons and their receptor and their friends and relations. J Interferon Cytokine Res 15 : 3 – 26 Google Scholar Crossref Search ADS PubMed WorldCat 2 Darnell Jr JE , Kerr IM , Stark GR 1994 Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264 : 1415 – 1421 Google Scholar Crossref Search ADS PubMed WorldCat 3 Cho SS , Bacon CM , Sudarshan C , Rees RC , Finbloom D , Pine R , O’Shea JJ 1996 Activation of STAT4 by IL-12 and IFN. J Immunol 157 : 4781 – 4789 Google Scholar PubMed WorldCat 4 Domanski P , Fish E , Nadeau OW , Witte M , Platanias LC , Yan H , Krolewski J , Pitha P , Colamonici OR 1997 A region of the β subunit of the interferon α receptor different from Box-1 interacts with Jak1 and is sufficient to activate the Jak-Stat pathway and induce an antiviral state. J Biol Chem 272 : 26388 – 26393 Google Scholar Crossref Search ADS PubMed WorldCat 5 Fasler-Kan E , Panskey A , Wiederkerhr M , Battegay M , Heim MH 1998 Interferon-α activates signal transducers and activators of transcription 5 and 6 in Daudi cells. Eur J Biochem 254 : 514 – 519 Google Scholar Crossref Search ADS PubMed WorldCat 6 Fish EN , Uddin S , Korkmaz M , Majchrzak B , Druker BJ , Platanias LC 1999 Activation of a CrkL-stat5 signaling complex by type I interferons. J Biol Chem 274 : 571 – 573 Google Scholar Crossref Search ADS PubMed WorldCat 7 Yang C-H , Shi W , Basu L , Murti A , Constantinescu SN , Blatt L , Croze E , Mullersman JE , Pfeffer LM 1996 Direct association of STAT3 with the IFNAR1 chain of the human type I interferon receptor. J Biol Chem 271 : 8057 – 8061 Google Scholar Crossref Search ADS PubMed WorldCat 8 Pfeffer LM , Mullersman JE , Pfeffer SR , Murti A , Shi W , Yang CH 1997 STAT3 as an adaptor to couple phosphatidylinositol 3-kinase to the IFNAR1 chain of the type I interferon receptor. Science 276 : 1418 – 1420 Google Scholar Crossref Search ADS PubMed WorldCat 9 Uddin S , Majchrzak B , Wang PC , Modi S , Khan MK , Fish EN , Platanias LC 2000 Interferon-dependent activation of the serine kinase PI 3′-kinase requires engagement of the IRS pathway but not the Stat pathway. Biochem Biophys Res Commun 270 : 158 – 162 Google Scholar Crossref Search ADS PubMed WorldCat 10 David M , Petricoin III E , Benjamin C , Pine R , Weber MJ , Larner AC 1995 Requirement for MAP kinase (ERK2) activity in interferon α- and interferon β-stimulated gene expression through STAT proteins. Science 269 : 1721 – 1723 Google Scholar Crossref Search ADS PubMed WorldCat 11 Nguyen VA , Chen J , Hong F , Ishac EJ , Gao B 2000 Interferons activate the p42/44 mitogen-activated protein kinase and JAK-STAT (Janus kinase-signal transducer and activator transcription factor) signaling pathways in hepatocytes: differential regulation by acute ethanol via a protein kinase C-dependent mechanism. Biochem J 349 : 427 – 434 Google Scholar Crossref Search ADS PubMed WorldCat 12 Uddin S , Majchrzak B , Woodson J , Arunkumar P , Alsayed Y , Pine R , Young PR , Fish EN , Platanias LC 1999 Activation of the p38 mitogen-activated protein kinase by type I interferons. J Biol Chem 274 : 30127 – 30131 Google Scholar Crossref Search ADS PubMed WorldCat 13 Goh KC , Haque SJ , Williams BR 1999 p38 MAP kinase is required for STAT1 serine phosphorylation and transcriptional activation induced by interferons. EMBO J 18 : 5601 – 5608 Google Scholar Crossref Search ADS PubMed WorldCat 14 Sanceau J , Hiscott J , Delattre O , Wietzerbin J 2000 IFN-β induces serine phosphorylation of Stat-1 in Ewing’s sarcoma cells and mediates apoptosis via induction of IRF-1 and activation of caspase-7. Oncogene 19 : 3372 – 3383 Google Scholar Crossref Search ADS PubMed WorldCat 15 Uddin S , Lekmine F , Sharma N , Majchrzak B , Mayer I , Young PR , Bokoch GM , Fish EN , Platanias LC 2000 The Rac1/p38 mitogen-activated protein kinase pathway is required for interferon α-dependent transcriptional activation but not serine phosphorylation of Stat proteins. J Biol Chem 275 : 27634 – 27640 Google Scholar PubMed WorldCat 16 Mayer IA , Verma A , Grumbach IM , Uddin S , Lekmine F , Ravandi F , Majchrzak B , Fujita S , Fish EN , Platanias LC 2001 The p38 MAPK pathway mediates the growth inhibitory effects of interferon-α in BCR-ABL-expressing cells. J Biol Chem 276 : 28570 – 28577 Google Scholar Crossref Search ADS PubMed WorldCat 17 Verma A , Deb DK , Sassano A , Uddin S , Varga J , Wickrema A , Platanias LC 2002 Activation of the p38 mitogen-activated protein kinase mediates the suppressive effects of type I interferons and transforming growth factor-β on normal hematopoiesis. J Biol Chem 277 : 7726 – 7735 Google Scholar Crossref Search ADS PubMed WorldCat 18 Ramana CV , Gil MP , Han Y , Ransohoff RM , Schreiber RD , Stark GR 2001 Stat1-independent regulation of gene expression in response to IFN-γ. Proc Natl Acad Sci USA 98 : 6674 – 6679 Google Scholar Crossref Search ADS PubMed WorldCat 19 Gil MP , Bohn E , O’Guin AK , Ramana CV , Levine B , Stark GR , Virgin HW , Schreiber RD 2001 Biologic consequences of Stat1-independent IFN signaling. Proc Natl Acad Sci USA 98 : 6680 – 6685 Google Scholar Crossref Search ADS PubMed WorldCat 20 Kim S , Choi Y , Bazer FW , Spencer TE 2003 Identification of genes in the ovine endometrium regulated by interferon τ independent of signal transducer and activator of transcription 1. Endocrinology 144 : 5203 – 5214 Google Scholar Crossref Search ADS PubMed WorldCat 21 Kalvakolanu DV 2003 Alternate interferon signaling pathways. Pharmacol Theriogenol 100 : 1 – 29 Google Scholar Crossref Search ADS WorldCat 22 Colamonici OR , Domanski P , Yan H , Krolewski JJ 1994 p135tyk2, an interferon-α-activated tyrosine kinase, is physically associated with an interferon-α receptor. J Biol Chem 269 : 3518 – 3522 Google Scholar PubMed WorldCat 23 Novick D , Cohen B , Rubinstein M 1994 The human interferon α/β receptor: characterization and molecular cloning. Cell 77 : 391 – 400 Google Scholar Crossref Search ADS PubMed WorldCat 24 Yan H , Krishnan K , Lim JTE , Contillo LG , Krolewski JJ 1996 Molecular characterization of an α interferon receptor 1 subunit (IFNAR1) domain required for TYK2 binding and signal transduction. Mol Cell Biol 16 : 2074 – 2082 Google Scholar Crossref Search ADS PubMed WorldCat 25 Abramovich C , Yakobson B , Chebath J , Revel M 1997 A protein-arginine methyltransferase binds to the intracytoplasmic domain of the IFNAR1 chain in the type I interferon receptor. EMBO J 16 : 260 – 266 Google Scholar Crossref Search ADS PubMed WorldCat 26 Altschuler L , Wook JO , Durari D , Chebath J , Revel M 1999 Involvement of receptor-bound protein methyltransferase PRMT1 in antiviral and antiproliferative effects of type I interferons. J Interferon Cytokine Res 19 : 189 – 195 Google Scholar Crossref Search ADS PubMed WorldCat 27 Abramovich C , Chebath J , Revel M 1994T he human interferon α-receptor protein confers differential responses to human interferon-β versus interferon-α subtypes in mouse and hamster cell transfectants. Cytokine 6 : 414 – 424 Crossref Search ADS PubMed 28 Constantinescu SN , Croze E , Wang C , Murti A , Basu L , Mullersman JE , Pfeffer LM 1994 Role of interferon α-β receptor chain 1 in the structure and transmembrane signaling of the interferon α-β receptor complex. Proc Natl Acad Sci USA 91 : 9602 – 9606 Google Scholar Crossref Search ADS PubMed WorldCat 29 Mullersman JE , Pfeffer LM 1994 A novel cytoplasmic homology domain in interferon receptors. Trends Biochem Sci 20 : 55 – 56 Google Scholar Crossref Search ADS WorldCat 30 Yan H , Krishnan K , Greenlund AC , Gupta S , Lim JT , Schreiber RD , Schindler CW , Krolewski JJ 1996 phosphorylated interferon-α receptor 1 subunit (IFNαR1) acts as a docking site for the latent form of the 113 kDa STAT2 protein. EMBO J 15 : 1064 – 1074 Google Scholar PubMed WorldCat 31 Li X , Leung S , Kerr IM , Stark GR 1997 Functional subdomains of STAT2 required for preassociation with the α interferon receptor and for signaling. Mol Cell Biol 17 : 2048 – 2056 Google Scholar Crossref Search ADS PubMed WorldCat 32 Krishnan K , Singh B , Krolewski JJ 1998 Identification of amino acid residues critical for the Src-homology 2 domain-dependent docking of Stat2 to the interferon-α receptor. J Biol Chem 273 : 19495 – 19501 Google Scholar Crossref Search ADS PubMed WorldCat 33 Petricoin III EF , Ito S , Williams BL , Audet S , Stancato LF , Gamero A , Clouse K , Grimley P , Weiss A , Beeler J , Finbloom DS , Shores EW , Abraham R , Larner AC 1997 Antiproliferative action of interferon-α requires components of T-cell-receptor signalling. Nature 390 : 629 – 632 Google Scholar Crossref Search ADS PubMed WorldCat 34 David M , Zhou G , Pine R , Dixon JE , Larner AC 1996 The SH2 domain-containing tyrosine phosphatase PTP1D is required for interferon α/β-induced gene expression. J Biol Chem 271 : 15862 – 15865 Google Scholar Crossref Search ADS PubMed WorldCat 35 Domanski P , Witte M , Kellum M , Rubinstein M , Hackett R , Pitha P , Colamonic OR 1995 Cloning and expression of a long form of the β-subunit of the interferon receptor that is required for signaling. J Biol Chem 270 : 21606 – 21611 Google Scholar Crossref Search ADS PubMed WorldCat 36 Han CS , Mathialagan N , Klemann SW , Roberts RM 1997 Molecular cloning of ovine and bovine type I interferon receptor subunits from uteri, and endometrial expression of messenger ribonucleic acid for ovine receptors during the estrous cycle and pregnancy. Endocrinology 138 : 4757 – 4767 Google Scholar PubMed WorldCat 37 Pestka S 2000 The human interferon α species and receptors. Biopolymers 55 : 254 – 287 Google Scholar Crossref Search ADS PubMed WorldCat 38 Kotenko SK , Izotova LS , Mirochnitchenko OV , Lee C , Pestka S 1999 The intracellular domain of interferon-α receptor 2c (IFN-αR2c) chain is responsible for Stat activation. Proc Natl Acad Sci USA 96 : 5007 – 5012 Google Scholar Crossref Search ADS PubMed WorldCat 39 Nadeau OW , Domanski P , Usacheva A , Uddin S , Platanias LC , Pitha P , Raz R , Levy D , Majchrzak B , Fish E , Colamonici OR 1999 The proximal tyrosines of the cytoplasmic domain of the β chain of the type I interferon receptor are essential for signal transducer and activator of transcription (Stat) 2 activation. J Biol Chem 274 : 4045 – 4052 Google Scholar Crossref Search ADS PubMed WorldCat 40 Owczarek C , Hwang SY , Holland KA , Gulluyan LM , Tavarian M , Weavers B , Reich NC , Kola I , Hertzog PJ 1997 Cloning and characterization of soluble and transmembrane isoforms of a novel component of the murine type I interferon receptor, IFNAR2. J Biol Chem 272 : 23865 – 23870 Google Scholar Crossref Search ADS PubMed WorldCat 41 Martal JL , Chene NM , Huynh LP , L’Haridon RM , Reinaud PB , Guillomot MW , Charlier MA , Charpigny SY 1998 IFN-τ: a novel subtype I IFN1 structural characteristics, non-ubiquitous expression, structure-function relationships, a pregnancy hormonal embryonic signal and cross-species therapeutic potentialities. Biochimie 80 : 755 – 777 Google Scholar Crossref Search ADS PubMed WorldCat 42 Roberts RM , Ealy AD , Alexenko AP , Han CS , Ezashi, T 1999 Trophoblast interferons. Placenta 20 : 259 – 264 Google Scholar Crossref Search ADS PubMed WorldCat 43 Godkin JD , Bazer FW , Roberts RM 1984 Ovine trophoblast protein 1, an early secreted blastocyst protein, binds specifically to uterine endometrium and affects protein synthesis. Endocrinology 114 : 120 – 130 Google Scholar Crossref Search ADS PubMed WorldCat 44 Rosenfeld CS , Han CS , Alexenko AP , Spencer TE , Roberts RM 2002 Expression of interferon receptor subunits, IFNAR1 and IFNAR2, in the ovine uterus. Biol Reprod 67 : 847 – 853 Google Scholar Crossref Search ADS PubMed WorldCat 45 Han C , Chen Y , Roberts RM 2001 Antiviral activities of the soluble extracellular domains of type 1 interferon receptors. Proc Natl Acad Sci USA 98 : 6138 – 6143 Google Scholar Crossref Search ADS PubMed WorldCat 46 Kingston RE 2002 Introduction of DNA into mammalian cells. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, eds. Short protocols in molecular biology. 5th ed. New York: Wiley, vol 1, sect 9 : 1 – 11 WorldCat 47 Kim SH , Cohen B , Novick D , Rubinstein M 1997 Mammalian type I interferon receptors consist of two subunits: IFNαR1 and IFNαR2. Gene 196 : 279 – 286 Google Scholar Crossref Search ADS PubMed WorldCat 48 Colicelli J , Nicolette C , Birchmeier C , Rodgers L , Riggs M , Wigler M 1991 Expression of three mammalian cDNAs that interfere with RAS function in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 88 : 2913 – 2917 Google Scholar Crossref Search ADS PubMed WorldCat 49 Wilkinson MG , Pino TS , Tournier S , Buck V , Martin H , Christiansen J , Wilkinson DG , Millar JBA 1999 Sin1: an evolutionarily conserved component of the eukaryotic SAPK pathway. EMBO J 18 : 4210 – 4221 Google Scholar Crossref Search ADS PubMed WorldCat 50 Schroder W , Cloonan N , Bushell G , Sculley T 2004 Alternative polyadenylation and splicing of mRNA transcribed from the human Sin 1 gene. Gene 339 : 17 – 23 Google Scholar Crossref Search ADS PubMed WorldCat 51 Falquet L , Pagni M , Bucher P , Hulo N , Sigrist CJ , Hofmann K , Bairoch A 2002 The PROSITE database, its status in 2002. Nucleic Acids Res 30 : 235 – 238 Google Scholar Crossref Search ADS PubMed WorldCat 52 Doualla-Bell F , Koromilas AE 2001 Induction of PG G/H synthase-2 in bovine myometrial cells by interferon-τ requires the activation of the p38 MAPK pathway. Endocrinology 142 : 5107 – 5115 Google Scholar PubMed WorldCat 53 Thatcher WW , Meyer MD , Danet-Desnoyers G 1995 Maternal recognition of pregnancy. J Reprod Fertil Suppl 49 : 15 – 28 Google Scholar PubMed WorldCat 54 Demmers K , Derecka K , Flint A 2001 Trophoblast interferon and pregnancy. Reproduction 121 : 41 – 49 Google Scholar Crossref Search ADS PubMed WorldCat 55 Spencer TE , Becker WC , George P , Mirando MA , Ogle TF , Bazer FW 1995 Ovine interferon-τ regulates expression of endometrial receptors for estrogen and oxytocin but not progesterone. Biol Reprod 53 : 732 – 745 Google Scholar Crossref Search ADS PubMed WorldCat 56 Danet-Desnoyers G , Wetzels C , Thatcher WW 1994 Natural and recombinant bovine interferon τ regulate basal and oxytocin-induced secretion of prostaglandins F2α and E2 by epithelial cells and stromal cells in the endometrium. Reprod Fertil Dev 6 : 193 – 202 Google Scholar Crossref Search ADS PubMed WorldCat 57 Xiao CW , Murphy BD , Sirois J , Goff AK 1999 Down-regulation of oxytocin-induced cyclooxygenase-2 and prostaglandin F synthase expression by interferon-τ in bovine endometrial cells. Biol Reprod 60 : 656 – 663 Google Scholar Crossref Search ADS PubMed WorldCat 58 Binelli M , Guzeloglu A , Badinga L , Arnold DR , Sirois J , Hansen TR , Thatcher WW 2000 Interferon-τ modulates phorbol ester-induced production of prostaglandin and expression of cyclooxygenase-2 and phospholipase-A2 from bovine endometrial cells. Biol Reprod 63 : 417 – 424 Google Scholar Crossref Search ADS PubMed WorldCat 59 Pru JK , Rueda BR , Austin KJ , Thatcher WW , Guzeloglu A , Hansen TR 2001 Interferon-τ suppresses prostaglandin F2α secretion independently of the mitogen-activated protein kinase and nuclear factor κB pathways. Biol Reprod 64 : 965 – 973 Google Scholar Crossref Search ADS PubMed WorldCat 60 Guzeloglu A , Subramaniam P , Michel F , Thatcher WW 2004 Interferon-τ induces degradation of prostaglandin H synthase-2 messenger RNA in bovine endometrial cells through a transcription-dependent mechanism. Biol Reprod 71 : 170 – 176 Google Scholar Crossref Search ADS PubMed WorldCat 61 Asselin E , Lacroix D , Fortier MA 1997 IFN-τ increases PGE2 production and COX-2 gene expression in the bovine endometrium in vitro. Mol Cell Endocrinol 132 : 117 – 126 Google Scholar Crossref Search ADS PubMed WorldCat 62 Asselin E , Drolet P , Fortier MA 1997 Cellular mechanisms involved during oxytocin-induced prostaglandin F2α production in endometrial epithelial cells in vitro: role of cyclooxygenase-2. Endocrinology 138 : 4798 – 4805 Google Scholar PubMed WorldCat 63 Binelli M , Subramaniam P , Diaz T , Johnson GA , Hansen TR , Badinga L , Thatcher WW 2001 Bovine interferon-τ stimulates the Janus kinase-signal transducer and activator of transcription pathway in bovine endometrial epithelial cells. Biol Reprod 64 : 654 – 665 Google Scholar Crossref Search ADS PubMed WorldCat 64 Parent J , Villeneuve C , Alexenko AP , Ealy AD , Fortier MA 2003 Influence of different isoforms of recombinant trophoblastic interferons on prostaglandin production in cultured bovine endometrial cells. Biol Reprod 68 : 1035 – 1043 Google Scholar Crossref Search ADS PubMed WorldCat Copyright © 2004 by The Endocrine Society
TI - Interaction of Stress-Activated Protein Kinase-Interacting Protein-1 with the Interferon Receptor Subunit IFNAR2 in Uterine Endometrium
JF - Endocrinology
DO - 10.1210/en.2004-0991
DA - 2004-12-01
UR - https://www.deepdyve.com/lp/oxford-university-press/interaction-of-stress-activated-protein-kinase-interacting-protein-1-NfscJfB0c0
SP - 5820
VL - 145
IS - 12
DP - DeepDyve
ER -