TY - JOUR
AU - Horiuchi, Hisanori
AB - Abstract Open in new tabDownload slide Open in new tabDownload slide Ykt6 is an evolutionarily conserved SNARE protein regulating Golgi membrane fusion and other diverse membrane trafficking pathways. Unlike most SNARE proteins, Ykt6 lacks a transmembrane domain but instead has a tandem cysteine motif at the C-terminus. Recently, we have demonstrated that Ykt6 undergoes double prenylation at the C-terminal two cysteines first by farnesyltransferase and then by a newly identified protein prenyltransferase named geranylgeranyltransferase type-III (GGTase-III). GGTase-III consists of a novel α subunit prenyltransferase alpha subunit repeat containing 1 (PTAR1) and the β subunit of Rab geranylgeranyltransferase. PTAR1 knockout (KO) cells, where Ykt6 is singly prenylated with a farnesyl moiety, exhibit structural and functional abnormalities in the Golgi apparatus with delayed intra-Golgi trafficking and impaired protein glycosylation. It remains unclear whether the second prenylation of Ykt6 is required for proper trafficking of lysosomal hydrolases from Golgi to lysosomes. Here, we show that lysosomal hydrolases, cathepsin D and β-hexosaminidase, were missorted at the trans-Golgi network and secreted into the extracellular space in PTAR1 KO cells. Moreover, maturation of these hydrolases was disturbed. LC3B, an autophagy marker, was accumulated in PTAR1 KO cells, suggesting defects in cellular degradation pathways. Thus, doubly prenylated Ykt6, but not singly prenylated Ykt6, is critical for the efficient sorting and trafficking of acid hydrolases to lysosomes. Golgi apparatus, lysosomal hydrolase, protein prenylation, SNARE, Ykt6 Many proteins, including the Ras superfamily of small GTPases, undergo post-translational modification with farnesyl or geranylgeranyl isoprenoids. Early studies identified three classical types of protein prenyltransferases: farnesyltransferase (FTase), geranylgeranyltransferase type-I (GGTase-I) and Rab geranylgeranyltransferase (RabGGTase, also called GGTase-II). All these enzymes function as heterodimers consisting of α and β subunits (1–3). Recently, we identified a fourth type of protein prenyltransferase, termed geranylgeranyltransferase type-III (GGTase-III), which shares the same β subunit with RabGGTase but contains a novel α subunit prenyltransferase alpha subunit repeat containing 1 (PTAR1) (4). Although the classical protein prenyltransferases recognize multiple substrates, we have identified only Ykt6 as a substrate for GGTase-III so far (4). Ykt6 is an evolutionarily highly conserved SNARE protein that regulates Golgi membrane fusion (5, 6). Unlike other SNARE proteins, Ykt6 lacks a transmembrane domain but possesses a conserved tandem cysteine motif, C194C195AIM, at the C-terminus. The C-terminus of Ykt6 undergoes a series of modifications (4) (Fig. 1A). First, FTase transfers a farnesyl group to Cys195. Then Ras converting enzyme 1 (RCE1) cleaves the terminal AIM residues, and isoprenylcysteine methyltransferase (ICMT) methylates the newly exposed carboxy residue of Cys195. Finally, GGTase-III transfers a geranylgeranyl group to Cys194 by recognizing the Cys195-farnesylated form of Ykt6 as substrate. Previous studies have suggested that Cys194 of Ykt6 is reversibly palmitoylated and a palmitoylation/depalmitoylation cycle of Cys194 regulates the activity of Ykt6 (7). However, our biochemical and structural analyses have revised the previous model by demonstrating that Cys194 of Ykt6 is geranylgeranylated, but not palmitoylated. Since protein prenylation is irreversible, Ykt6 constitutively exists in the doubly prenylated form in cells. Despite having highly hydrophobic moieties, most Ykt6 exists in the cytosol possibly by intramolecular sequestration of prenyl groups and translocates to the Golgi membrane upon activation by an unknown mechanism (8). Fig. 1. Open in new tabDownload slide Loss of double prenylation of Ykt6 in PTAR1-deficient cells. (A) The scheme of Ykt6 modifications and related enzymes is shown. (B, C) The cell lysates of WT, PTAR1 KO and rescued (KO + PTAR1) HAP1 and HeLa cells were analysed by western blotting using anti-PTAR1 antibody (B) and anti-Ykt6 antibody (C). Typical photos of immunoblots are shown. The bands of PTAR1 and Ykt6 are pointed by arrowheads. Note that the molecular weight markers in DOC–PAGE do not reflect the molecular weight of a protein. Fig. 1. Open in new tabDownload slide Loss of double prenylation of Ykt6 in PTAR1-deficient cells. (A) The scheme of Ykt6 modifications and related enzymes is shown. (B, C) The cell lysates of WT, PTAR1 KO and rescued (KO + PTAR1) HAP1 and HeLa cells were analysed by western blotting using anti-PTAR1 antibody (B) and anti-Ykt6 antibody (C). Typical photos of immunoblots are shown. The bands of PTAR1 and Ykt6 are pointed by arrowheads. Note that the molecular weight markers in DOC–PAGE do not reflect the molecular weight of a protein. In PTAR1 knockout (KO) cells, Ykt6 remains in the mono-farnesylated form (4) due to the loss of GGTase-III activity, and cannot form a SNARE complex efficiently with its partner Golgi SNAREs: syntaxin 5, GS28 and GS15 (9, 10). Consequently, PTAR1 KO cells exhibit structural disorganization of the Golgi apparatus, resulting in delayed intra-Golgi trafficking and impaired protein glycosylation. Double prenylation of Ykt6 is essential for the maintenance of Golgi function and singly prenylated Ykt6 cannot exert its function in the Golgi membrane fusion. Recent studies have shown that Ykt6 is involved in the progression of breast cancer (11) and Parkinson’s disease (12) suggesting that dysregulation of Golgi function could play a role in the pathogenesis of these diseases. Lysosomes are membrane-bound organelles dedicated to disposal and recycling of cellar macromolecules. Lysosomes contain many types of acid hydrolases such as proteases, nucleases, lipases and glycosidases. Newly synthesized lysosomal hydrolases are sorted at the trans-Golgi network (TGN) and selectively transported to endosomes and finally delivered to lysosomes (13). Most lysosomal hydrolases require modification with mannose 6-phosphate groups on their N-glycans, which occurs in the Golgi apparatus, for the sorting and trafficking to lysosomes (14). In this study, we investigated the role of doubly prenylated Ykt6 in the sorting and trafficking of lysosomal hydrolases using PTAR1-deficient cells. Our results indicate that double prenylation of Ykt6 is required for efficient trafficking of acid hydrolases from Golgi to lysosomes. Experimental Procedures Antibodies The antibodies used in this study were as follows: recombinant rabbit anti-cathepsin D (CTSD) antibody (EPR305Y) from Abcam; mouse anti-Ykt6 antibody (E-2) and mouse HEXB antibody (D-9) from Santa Cruz Biotechnology; rabbit anti-LC3B antibody (D11) from Cell Signaling Technology; Horseradish peroxidase-conjugated secondary antibodies from Jackson ImmunoResearch; Alexa Fluor 488-labelled fluorescent secondary antibody from Molecular Probes. Anti-PTAR1 antibody was described previously (4). Cell culture PTAR1-deficient HAP1 and HeLa cell lines were prepared in our previous study (4). These cells were cultured in Iscove’s modified Dulbecco’s medium and high glucose Dulbecco’s modified Eagle medium, respectively, both of which were supplemented with 10% (v/v) foetal bovine serum (Gibco), 100 units/ml penicillin (Wako) and 100 μg/ml of streptomycin (Wako). Western blotting For western blot analysis, cells were lysed in lysis buffer (50 mM HEPES/KOH pH 7.4, 78 mM KCl, 4 mM MgCl2, 2 mM EGTA, 0.2 mM CaCl2, 1 mM dithiothreitol and 1% Triton X-100) containing phosphatase inhibitors (10 mM β-glycerophosphate, 10 mM sodium fluoride and 1 mM vanadate) and protease inhibitors (cOmplete Protease Inhibitor Cocktail from Roche). After centrifugation at 20,000 × g for 10 min at 4°C, the supernatants were analysed as the cell lysate by sodium dodecyl sulphate (SDS)–polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose membrane (GE Healthcare Life Science). The total protein concentration of the cell lysates was determined by the Bradford assay using bovine serum albumin as a standard. Deoxycholate (DOC)–PAGE was performed as previously described (4). Western blotting was performed with a standard method using antibodies listed above and ImmunoStar Zeta (Wako) as a chemiluminescence reagent. Images were analysed using Image J software (version v1.52i). In some experiments, cells were cultured in serum-free medium for 24 h, and the comparable amounts of the conditioned media and cell lysates were analysed. To analyse CTSD phosphorylation, SuperSep Phos-tag Gels (Wako) were used. Real-time quantitative PCR (RT-qPCR) RNA was purified from cells using RNeasy Mini kit (QIAGEN) and reverse transcribed using ReverTra Ace qPCR Master Mix (TOYOBO). qPCR was performed using TB Green Premix Ex Taq II (TaKaRa). The expression level of each gene was analysed by ΔΔCt method using human β-actin gene (ACTB) as an internal control. The sequences of DNA primers used in RT-qPCR were: ACTB forward, GATAGCACAGCCTGGATAGCA; ACTB reverse, AACTGGGACGACATGGAGAAAA; CTSD forward, GTACTACGGGGAGATTGGCATC; CTSD reverse, TGGATGTCAAACGAGGTACCATT; HEXB forward, GATGTTGGCGCTGCTGACTC; HEXB reverse, GCTGATGTAGAAGTTCTCCGGG; LC3B forward, AGCAGCTTCCTGTTCTGGATAAA; LC3B reverse, ATACACCTCTGAGATTGGTGTGG. Immunofluorescence Cells were seeded in 8-well glass bottom chamber (MATSUNAMI glass) treated with poly-L-lysin (Sigma). Subconfluent cells were fixed with 4% paraformaldehyde phosphate-buffered solution (PBS; Wako), permeabilized with PBS containing 0.1% Triton X-100 and blocked with PBS containing 7.5% goat serum. After incubation with anti-LC3B antibody (200×, in PBS containing 7.5% goat serum), the cells were incubated with Alexa Fluor 488-labelled anti-mouse IgG secondary antibody (200×, in PBS containing 7.5% goat serum) and stained with by 4ʹ,6-diamidino-2-phenylindole (DAPI, DOJINDO). Microscopy analysis was performed using a confocal microscopy TSC SP8 (Leica). Statistics Data were analysed using one-way analysis of variance and Student’s t-test. A P-value <0.05 was considered significant. *P < 0.05. Data are shown in mean ± standard error of the mean. Results Double prenylation of Ykt6 is impaired in PTAR1 KO cells Figure 1A shows a schematic diagram of post-translational modification of Ykt6. In this study, we studied the trafficking of lysosomal hydrolases using PTAR1 KO HAP1 and HeLa cells generated in our previous study (4). Western blot analysis confirmed the absence of PTAR1 in the KO cell lines used here (Fig. 1B). To distinguish between singly prenylated and doubly prenylated forms of Ykt6, we previously developed a modified gel electrophoresis method utilizing DOC as a substitute for SDS (4). As shown previously, DOC–PAGE analysis clearly showed that Ykt6 existed in a singly prenylated form in the PTAR1 KO cell lines, but in a doubly prenylated form in the parental cell lines (Fig. 1C). Lentivirus-mediated exogenous expression of PTAR1 in the KO cell lines completely rescued the band shift. Using these cell lines, we examined the role of Ykt6 double prenylation in the sorting and trafficking of lysosomal hydrolases. PTAR1 deficiency causes missorting of CTSD CTSD is a major aspartic protease in lysosomes and used as a model to study the trafficking and maturation of lysosomal enzymes. CTSD is synthesized as an inactive 44 kDa precursor and activated by proteolytic cleavage of N-terminal propeptide in the post-Golgi endolysosomal compartments. The N-terminally cleaved intermediate form is further processed by cathepsin L or B in lysosomes (15) to become a disulphide-linked mature enzyme consisting of an N-terminal 14 kDa light chain and a C-terminal ∼30 kDa heavy chain. We first examined the maturation status of CTSD in wild-type (WT) and PTAR1 KO cells using a monoclonal antibody that recognizes a C-terminal epitope of the enzyme. Western blot analysis showed that both mature and immature forms of CTSD were greatly decreased in PTAR1 KO HAP1 cells compared with WT cells (Fig. 2A). In HeLa cells, the mature form of CTSD was decreased upon PTAR1 KO as observed in HAP1 cells, whereas the intermediate form was slightly increased. Exogenous expression of PTAR1 in the KO cell lines rescued these phenotypes. There was no significant difference in the CTSD mRNA expression between these cell lines (Fig. 2B). Fig. 2. Open in new tabDownload slide Impaired trafficking of CTSD in PTAR1-deficient cells. (A) The cell lysates of WT, PTAR1 KO and rescued (KO + PTAR1) HAP1 cells and HeLa cells were subjected to western blotting using anti-CTSD antibody. The same amount of total proteins was loaded in each line. Typical photos of immunoblots are shown. The bands of each form are pointed by arrowheads. The amount of mature CTSD was calculated by densitometry analysis. (B) The mRNA level of CTSD was measured by RT-qPCR. (C) The whole cell lysates (cell) and their conditioned media (medium) were subjected to western blotting. Typical photos of immunoblots are shown. The ratios of immature CTSD in medium to whole cell were calculated by densitometry analysis (n = 3–6). Fig. 2. Open in new tabDownload slide Impaired trafficking of CTSD in PTAR1-deficient cells. (A) The cell lysates of WT, PTAR1 KO and rescued (KO + PTAR1) HAP1 cells and HeLa cells were subjected to western blotting using anti-CTSD antibody. The same amount of total proteins was loaded in each line. Typical photos of immunoblots are shown. The bands of each form are pointed by arrowheads. The amount of mature CTSD was calculated by densitometry analysis. (B) The mRNA level of CTSD was measured by RT-qPCR. (C) The whole cell lysates (cell) and their conditioned media (medium) were subjected to western blotting. Typical photos of immunoblots are shown. The ratios of immature CTSD in medium to whole cell were calculated by densitometry analysis (n = 3–6). Since lysosomal hydrolases that are not sorted into the endolysosomal pathway are secreted into the extracellular space via the constitutive secretion pathway, we next examined the localization of CTSD. We cultured cells in serum-free media for 24 h and analysed the amount of CTSD in the conditioned media and cell lysates by western blotting (Fig. 2C). Although WT HAP1 cells secreted only a small amount of CTSD. PTAR1 KO HAP1 cells secreted a large amount of CTSD in its precursor form. PTAR1 KO HeLa cells also secreted an increased amount of CTSD compared with WT cells, albeit to a lesser extent than HAP1 cells. Unlike HeLa cells, we observed no accumulation of immature CTSD in PTAR1 KO HAP1 cells (Fig. 2A). This is probably because the effect of PTAR1 KO was more pronounced in HAP1 cells and the precursor form of CTSD was mostly secreted in PTAR1 KO HAP1 cells (Fig. 2C). Collectively, these results show that PTAR1-deficiency causes missorting and secretion of CTSD. Trafficking of β-hexosaminidase is disturbed by PTAR1 deficiency Next, we examined the maturation and trafficking of β-hexosaminidase, a lysosomal acidic glycosidase. β-hexosaminidase has two structurally similar subunits, HEXA and HEXB, and forms homo- or heterodimers. Both subunits are proteolytically processed in lysosomes to become ∼50 kDa intermediate forms. Although not required for activity (16), the intermediate form of HEXB is additionally cleaved by a lysosomal endoprotease to become a disulphide-linked mature form. In HeLa cells, the fully processed 22–25 kDa chain of mature HEXB tended to decrease upon PTAR1 KO, whereas the precursor form was slightly increased (Fig. 3A). In HAP1 cells, we could not detect the fully processed form of HEXB, possibly due to a lack of the cleavage enzyme in the cell line. However, the ∼50 kDa intermediate form of HEXB was greatly decreased in PTAR1 KO HAP1 cells compared with the parental cells (Fig. 3A). Exogenous expression of PTAR1 completely rescued the reduction of cellular HEXB both in HeLa and HAP1 cells (Fig. 3A). We observed no significant difference in the mRNA expression of HEXB in these cell lines (Fig. 3B). Fig. 3. Open in new tabDownload slide Trafficking defect of HEXB in PTAR1-deficient cells. (A) The cell lysates of HAP1 and HeLa cells were subjected to western blotting using anti-HEXB antibody. The same amount of total proteins was loaded in each line. Typical photos of immunoblots are shown. The bands of each form are pointed by arrowheads. (B) The mRNA level of HEXB was analysed by RT-qPCR. (C) The whole cell lysates (cell) and their conditioned media (medium) were subjected to western blotting. Typical photos of immunoblots are shown. The ratios of precursor HEXB in medium to whole cell were calculated from densitometry analysis (n = 6). Fig. 3. Open in new tabDownload slide Trafficking defect of HEXB in PTAR1-deficient cells. (A) The cell lysates of HAP1 and HeLa cells were subjected to western blotting using anti-HEXB antibody. The same amount of total proteins was loaded in each line. Typical photos of immunoblots are shown. The bands of each form are pointed by arrowheads. (B) The mRNA level of HEXB was analysed by RT-qPCR. (C) The whole cell lysates (cell) and their conditioned media (medium) were subjected to western blotting. Typical photos of immunoblots are shown. The ratios of precursor HEXB in medium to whole cell were calculated from densitometry analysis (n = 6). To examine sorting and trafficking of β-hexosaminidase, we analysed HEXB in the media and cell lysates. WT HAP1 cells secreted only a small amount of HEXB in the medium. In contrast, PTAR1 KO HAP1 cells secreted a large amount of HEXB into the medium. Re-expression of PTAR1 in the KO cell line decreased the amount of secreted HEXB to the same level as in the parental cell line (Fig. 3C). In HeLa cells, most of HEXB was secreted into media irrespective of PTAR1 KO, so we could not detect the effect of PTAR1 KO using HeLa cells (Fig. 3C). These results indicate that maturation and trafficking of β-hexosaminidase are disturbed in PTAR1-deficient cells, as observed for CTSD. PTAR1 deficiency affects the phosphorylation status of CTSD Most lysosomal hydrolases, including CTSD, require the modification with mannose 6-phosphate for selective transport to lysosomes (13). We examined the phosphorylation status of CTSD by Phos-tag PAGE (Fig. 4). Although conventional SDS–PAGE analysis showed no difference in electrophoretic mobility of secreted precursor CTSD between WT cells and PTAR1 KO cells (Fig. 2B), Phos-tag gel analysis revealed a slightly slower mobility of secreted CTSD in WT cells compared with PTAR1 KO cells (Fig. 4). This result suggests that phosphorylation status of CTSD, most likely mannose 6-phosphorylation, is affected in PTAR1 KO cells. Fig. 4. Open in new tabDownload slide Phosphorylation status of extracellular CTSD. CTSD in media of HeLa cells was analysed by Phos-tag PAGE followed by western blotting. Two bands with different migration speeds are indicated by arrowheads. The upper and lower arrowheads are supposed to indicate CTSD with or without mannose 6-phosphorylation, respectively. Fig. 4. Open in new tabDownload slide Phosphorylation status of extracellular CTSD. CTSD in media of HeLa cells was analysed by Phos-tag PAGE followed by western blotting. Two bands with different migration speeds are indicated by arrowheads. The upper and lower arrowheads are supposed to indicate CTSD with or without mannose 6-phosphorylation, respectively. PTAR1 deficiency accumulates autophagy marker LC3B Since lysosomal hydrolases play a critical role in autophagy, we analysed the amount of LC3B, an autophagy marker protein. Western blot analysis showed that LC3B was accumulated in PTAR1 KO HeLa cells (Fig. 5A). Immunofluorescence staining revealed that PTAR1 KO HeLa cells had more LC3B puncta compared to WT cells, which was rescued by PTAR1 re-expression (Fig. 5B). There was no significant difference in the mRNA expression of LC3B between these cell lines (Fig. 5C). These results suggest that the lysosomal degradation system may be impaired in PTAR1 KO cells. Fig. 5. Open in new tabDownload slide LC3B accumulation in PTAR1-deficient cells. (A) The cell lysates of WT, PTAR1 KO and rescued (KO + PTAR1) HeLa cells were subjected to western blotting using anti-LC3B antibody. In HeLa cells, we detected only LC3-II but not LC3-I. (B) The HeLa cells were analysed by immunofluorescence using anti-LC3B antibody. Typical pictures are shown. Green: LC3B, blue: DAPI. Scale bar; 10 μm. (C) The mRNA level of LC3B was analysed by RT-qPCR (n = 4). Fig. 5. Open in new tabDownload slide LC3B accumulation in PTAR1-deficient cells. (A) The cell lysates of WT, PTAR1 KO and rescued (KO + PTAR1) HeLa cells were subjected to western blotting using anti-LC3B antibody. In HeLa cells, we detected only LC3-II but not LC3-I. (B) The HeLa cells were analysed by immunofluorescence using anti-LC3B antibody. Typical pictures are shown. Green: LC3B, blue: DAPI. Scale bar; 10 μm. (C) The mRNA level of LC3B was analysed by RT-qPCR (n = 4). Discussion In this study, we revealed that PTAR1, the α subunit of GGTase-III, is required for the maturation and trafficking of two lysosomal hydrolases, CTSD and β-hexosaminidase. We previously showed that double prenylation of Ykt6 by GGTase-III plays an important role in the structural and functional maintenance of the Golgi apparatus (4). In PTAR1 KO cells, the Golgi apparatus is structurally disorganized with dilated and unstacked cisternae, exhibiting delayed intra-Golgi traffic and severe defects in protein glycosylation (4). This study extends the findings of the previous study and demonstrates the importance of double prenylation of Ykt6 in the sorting and trafficking of lysosomal hydrolases from Golgi to lysosomes. Most lysosomal hydrolases are modified by mannose 6-phosphate groups at their N-glycans in the Golgi apparatus (14). Mannose 6-phosphorylation occurs in a highly ordered fashion involving the transfer of GlcNAc phosphate in the cis-Golgi compartment and subsequent removal of the GlcNAc residue in the trans-Golgi compartment (13). Since PTAR1 KO cells exhibit a severe glycosylation defect in N-glycan sialylation of LAMP1 (4), mannose 6-phosphorylation may also be disturbed in PTAR1 KO cells. Our Phos-tag PAGE analysis showed a slight difference in the gel mobility of CTSD between WT cells and PTAR1 KO cells, suggesting that the difference in the phosphorylation state underlies the missorting of CTSD at the TGN. It is also possible that the structure of the TGN with proper sorting and budding machinery may not be maintained in PTAR1 KO cells. In addition to the sorting defect, we also observed impaired maturation of CTSD and HEXB in PTAR1 KO HeLa cells (Figs 2A and 3A). Since maturation of CTSD and HEXB depends on cleavage by other lysosomal hydrolases (15, 17), the observed defective maturation of CTSD and HEXB suggests that a broader range of lysosomal hydrolases are missorted in PTAR1 KO cells. Although the primary function of Ykt6 is the regulation of intra-Golgi membrane fusion (6), many studies suggest that Ykt6 also regulates other membrane fusion pathways, such as exosomal Wnt secretion (18, 19) and membrane fusion between autophagosome and lysosome (20–23). These studies raise the question of whether double prenylation is also required for the function of Ykt6 in these membrane fusion pathways. As shown in Fig. 5A, we observed LC3 accumulation in PTAR1 KO HeLa cells, suggesting a requirement for Ykt6 double prenylation in the autophagic membrane fusion. However, since autophagy requires normal lysosomal activity, the observed accumulation of LC3 may not be due to inhibition of autophagic membrane fusion, but rather due to impaired transport of lysosomal hydrolases. Further investigation is needed to determine whether double prenylation is required for the activity of Ykt6 in these membrane fusion pathways. Although classical protein prenyltransferases have multiple substrate proteins, our previous screening identified Ykt6 as the sole substrate for GGTase-III (4). Therefore, we consider that the missorting of lysosomal hydrolases in PTAR1 KO cells was caused by the defect in Ykt6 double prenylation, although we cannot rule out the possibility that a currently unknown GGTase-III substrate(s) is also involved in the sorting function of the Golgi apparatus and/or lysosomal hydrolase trafficking. In summary, we showed that cells deficient for doubly prenylated Ykt6 exhibit defects in the sorting and maturation of lysosomal acid hydrolases. These results highlight the importance of functionally organized Golgi apparatus for the maintenance of cellular degradation pathways. Conflict of Interest None declared. References 1 Reiss Y. , Goldstein J.L. , Seabra M.C. , Casey P.J. , Brown M.S. ( 1990 ) Inhibition of purified p21ras farnesyl: protein transferase by Cys-AAX tetrapeptides . Cell 62 , 81 – 88 Google Scholar Crossref Search ADS PubMed WorldCat 2 Seabra M.C. , Reiss Y. , Casey P.J. , Brown M.S. , Goldstein J.L. ( 1991 ) Protein farnesyltransferase and geranylgeranyltransferase share a common alpha subunit . Cell 65 , 429 – 434 Google Scholar Crossref Search ADS PubMed WorldCat 3 Seabra M.C. , Brown M.S. , Slaughter C.A. , Sudhof T.C. , Goldstein J.L. ( 1992 ) Purification of component A of Rab geranylgeranyl transferase: possible identity with the choroideremia gene product . Cell 70 , 1049 – 1057 Google Scholar Crossref Search ADS PubMed WorldCat 4 Shirakawa R. , Goto-Ito S. , Goto K. , Wakayama S. , Kubo H. , Sakata N. , Trinh D.A. , Yamagata A. , Sato Y. , Masumoto H. , Cheng J. , Fujimoto T. , Fukai S. , Horiuchi H. ( 2020 ) A SNARE geranylgeranyltransferase essential for the organization of the Golgi apparatus . EMBO J . 39 , e104120 Google Scholar Crossref Search ADS PubMed WorldCat 5 McNew J.A. , Sogaard M. , Lampen N.M. , Machida S. , Ye R.R. , Lacomis L. , Tempst P. , Rothman J.E. , Sollner T.H. ( 1997 ) Ykt6p, a prenylated SNARE essential for endoplasmic reticulum-Golgi transport . J. Biol. Chem . 272 , 17776 – 17783 Google Scholar Crossref Search ADS PubMed WorldCat 6 Malsam J. , Sollner T.H. ( 2011 ) Organization of SNAREs within the Golgi stack . Cold Spring Harb. Perspect. Biol . 3 , a005249 Google Scholar Crossref Search ADS PubMed WorldCat 7 Fukasawa M. , Varlamov O. , Eng W.S. , Sollner T.H. , Rothman J.E. ( 2004 ) Localization and activity of the SNARE Ykt6 determined by its regulatory domain and palmitoylation . Proc. Natl. Acad. Sci. USA 101 , 4815 – 4820 Google Scholar Crossref Search ADS WorldCat 8 Roth A.F. , Davis N.G. ( 2020 ) Geranylgeranyl generosity: a new prenyl-transferase gives a fat to a SNARE protein . EMBO J . 39 , e104744 Google Scholar Crossref Search ADS PubMed WorldCat 9 Parlati F. , Varlamov O. , Paz K. , McNew J.A. , Hurtado D. , Sollner T.H. , Rothman J.E. ( 2002 ) Distinct SNARE complexes mediating membrane fusion in Golgi transport based on combinatorial specificity . Proc. Natl. Acad. Sci. USA 99 , 5424 – 5429 Google Scholar Crossref Search ADS WorldCat 10 Xu Y. , Martin S. , James D.E. , Hong W. ( 2002 ) GS15 forms a SNARE complex with syntaxin 5, GS28, and Ykt6 and is implicated in traffic in the early cisternae of the Golgi apparatus . Mol. Biol. Cell 13 , 3493 – 3507 Google Scholar Crossref Search ADS PubMed WorldCat 11 Saito Y. , Li L. , Coyaud E. , Luna A. , Sander C. , Raught B. , Asara J.M. , Brown M. , Muthuswamy S.K. ( 2019 ) LLGL2 rescues nutrient stress by promoting leucine uptake in ER(+) breast cancer . Nature 569 , 275 – 279 Google Scholar Crossref Search ADS PubMed WorldCat 12 Cuddy L.K. , Wani W.Y. , Morella M.L. , Pitcairn C. , Tsutsumi K. , Fredriksen K. , Justman C.J. , Grammatopoulos T.N. , Belur N.R. , Zunke F. , Subramanian A. , Affaneh A. , Lansbury P.T. Jr., , Mazzulli J.R. ( 2019 ) Stress-induced cellular clearance is mediated by the SNARE protein ykt6 and disrupted by alpha-synuclein . Neuron 104 , 869 – 884.e811 Google Scholar Crossref Search ADS PubMed WorldCat 13 Braulke T. , Bonifacino J.S. ( 2009 ) Sorting of lysosomal proteins . Biochim. Biophys. Acta 1793 , 605 – 614 Google Scholar Crossref Search ADS PubMed WorldCat 14 Coutinho M.F. , Prata M.J. , Alves S. ( 2012 ) Mannose-6-phosphate pathway: a review on its role in lysosomal function and dysfunction . Mol. Genet. Metab . 105 , 542 – 550 Google Scholar Crossref Search ADS PubMed WorldCat 15 Laurent-Matha V. , Derocq D. , Prebois C. , Katunuma N. , Liaudet-Coopman E. ( 2006 ) Processing of human cathepsin D is independent of its catalytic function and auto-activation: involvement of cathepsins L and B . J. Biochem . 139 , 363 – 371 Google Scholar Crossref Search ADS PubMed WorldCat 16 Kitakaze K. , Mizutani Y. , Sugiyama E. , Tasaki C. , Tsuji D. , Maita N. , Hirokawa T. , Asanuma D. , Kamiya M. , Sato K. , Setou M. , Urano Y. , Togawa T. , Otaka A. , Sakuraba H. , Itoh K. ( 2016 ) Protease-resistant modified human beta-hexosaminidase B ameliorates symptoms in GM2 gangliosidosis model . J. Clin. Invest . 126 , 1691 – 1703 Google Scholar Crossref Search ADS PubMed WorldCat 17 Schuette C.G. , Weisgerber J. , Sandhoff K. ( 2001 ) Complete analysis of the glycosylation and disulfide bond pattern of human beta-hexosaminidase B by MALDI-MS . Glycobiology 11 , 549 – 556 Google Scholar Crossref Search ADS PubMed WorldCat 18 Gross J.C. , Chaudhary V. , Bartscherer K. , Boutros M. ( 2012 ) Active Wnt proteins are secreted on exosomes . Nat. Cell Biol . 14 , 1036 – 1045 Google Scholar Crossref Search ADS PubMed WorldCat 19 Linnemannstons K. , Witte L. , Karuna P. , Kittel J. , Danieli A. , Muller D. , Nitsch L. , Honemann-Capito M. , Grawe F. , Wodarz A. , Gross J.C. ( 2020 ) Ykt6-dependent endosomal recycling is required for Wnt secretion in the Drosophila wing epithelium . Development 147 , dev185421 Google Scholar Crossref Search ADS PubMed WorldCat 20 Matsui T. , Jiang P. , Nakano S. , Sakamaki Y. , Yamamoto H. , Mizushima N. ( 2018 ) Autophagosomal YKT6 is required for fusion with lysosomes independently of syntaxin 17 . J. Cell Biol . 217 , 2633 – 2645 Google Scholar Crossref Search ADS PubMed WorldCat 21 Takáts S. , Glatz G. , Szenci G. , Boda A. , Horváth G.V. , Hegedűs K. , Kovács A.L. , Juhász G. ( 2018 ) Non-canonical role of the SNARE protein Ykt6 in autophagosome-lysosome fusion . PLoS Genet . 14 , e1007359 Google Scholar Crossref Search ADS PubMed WorldCat 22 Bas L. , Papinski D. , Licheva M. , Torggler R. , Rohringer S. , Schuschnig M. , Kraft C. ( 2018 ) Reconstitution reveals Ykt6 as the autophagosomal SNARE in autophagosome-vacuole fusion . J. Cell Biol . 217 , 3656 – 3669 Google Scholar Crossref Search ADS PubMed WorldCat 23 Gao J. , Reggiori F. , Ungermann C. ( 2018 ) A novel in vitro assay reveals SNARE topology and the role of Ykt6 in autophagosome fusion with vacuoles . J. Cell Biol . 217 , 3670 – 3682 Google Scholar Crossref Search ADS PubMed WorldCat Abbreviations Abbreviations CTSD cathepsin D; DAPI 4ʹ,6-diamidino-2-phenylindole; DOC deoxycholate; FTase farnesyltransferase; GGTase-I geranylgeranyltransferase type-I; GGTase-III geranylgeranyltransferase type-III; ICMT isoprenylcysteine methyltransferase; KO knockout; PAGE polyacrylamide gel electrophoresis; PBS phosphate-buffered saline; PTAR1 prenyltransferase alpha subunit repeat containing 1; RabGGTase Rab geranylgeranyltransferase; RCE1 Ras converting enzyme 1; RT-qPCR real-time quantitative PCR; SDS sodium dodecyl sulphate; TGN trans-Golgi network; WT wild-type. © The Author(s) 2020. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Double prenylation of SNARE protein Ykt6 is required for lysosomal hydrolase trafficking
JO - The Journal of Biochemistry
DO - 10.1093/jb/mvaa111
DA - 2020-10-09
UR - https://www.deepdyve.com/lp/oxford-university-press/double-prenylation-of-snare-protein-ykt6-is-required-for-lysosomal-NHLw1ADAwk
SP - 1
EP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -