TY - JOUR
AU - Huang, K.
AB - Abstract This study aimed to evaluate the effects of feeding glycerol-enriched yeast culture (GY) on feed intake, lactation performance, blood metabolites, and expression of some key hepatic gluconeogenic enzymes in dairy cows during the transition period. Forty-four multiparous transition Holstein cows were blocked by parity, previous 305-d mature equivalent milk yield, and expected calving date and randomly allocated to 4 dietary treatments: Control (no additive), 2 L/d of GY (75.8 g/L glycerol and 15.3 g/L yeast), 150 g/d of glycerol (G; 0.998 g/g glycerol), and 1 L/d of yeast culture (Y; 31.1 g/L yeast). All additives were top-dressed and hand mixed into the upper one-third of the total mixed ration in the morning from −14 to +28 d relative to calving. Results indicated that the DMI, NE intake, change of BCS, and milk yields were not affected by the treatments (P > 0.05). Supplementation of GY or Y increased milk fat percentages, milk protein percentages, and milk protein yields relative to the Control or G group (P < 0.05). Cows fed GY or G had higher glucose levels and lower β-hydroxybutyric acid (BHBA) and NEFA levels in plasma than cows fed the Control (P < 0.05) and had lower NEFA levels than cows fed Y (P < 0.05). On 14 d postpartum, cows fed GY or G had higher enzyme activities, mRNA, and protein expression of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C; P < 0.05); higher enzyme activities (P < 0.05) and a tendency toward higher mRNA expression (P < 0.10) of glycerol kinase (GK); and a tendency toward higher enzyme activities of pyruvate carboxylase (PC) in the liver (P < 0.10) when compared with cows fed Control or Y. The enzyme activities, mRNA, and protein expression of PEPCK-C, PC, and GK did not differ between cows fed GY and G (P > 0.10). In conclusion, dietary GY or Y supplementation increased the milk fat and protein content of the cows in early lactation and GY or G supplementation improved the energy status as indicated by greater plasma glucose and lower plasma BHBA and NEFA concentrations and upregulated the hepatic gluconeogenic enzymes of dairy cows during the transition period. Feeding cows with a GY mixture in the peripartum period combined the effects of yeast on lactation performance and the effects of glycerol on energy status in dairy cows. INTRODUCTION During the peripartum period, high-producing dairy cows usually enter a state of negative energy balance (NEB), due to the decreased DMI and the increased energy demand for lactation (Bertics et al., 1992). Therefore, the cows start to increase mobilization of their body fat to compensate for the energy deficiency, resulting in elevated plasma NEFA concentration, which can further lead to ketosis and fatty liver (McSherry et al., 1960; Yameogo et al., 2008). Given the difficulty in achieving maximum feed intake around calving, producers often feed glucogenic precursors to cows to improve gluconeogenesis. Glycerol, as a glucogenic precursor, has been proved to effectively alleviate the NEB status of cows via oral administration (Chung et al., 2007; Wang et al., 2009). However, the majority of glycerol presently given to cows originates from biodiesel production and usually contains many deleterious impurities such as heavy metals and methanol (Hippen et al., 2008). A high-purity glycerol product is needed, but currently the high cost limits its application in the dairy cow industry. Considering the safety and cost, our laboratory has developed a glycerol-enriched yeast culture (GY) via fermentation of yeast that has been proved to improve feed efficiency, DMI, and lactation performance of dairy cows (Bruno et al., 2009; Kalmus et al., 2009). Our previous study demonstrated that feeding GY to cows alleviated the negative effects of heat stress on lactation performance as evidenced by greater milk yield and improved milk composition and improved the energy status as evidenced by greater plasma glucose and lower plasma NEFA level of the cows (Liu et al., 2014). In addition, it was hypothesized that dietary supplementation of GY to dairy cows during the transition period will have the combined improvement effects of glycerol on energy status and of yeast culture on lactation performance. Therefore, this study aimed to evaluate the effects of feeding GY, glycerol, and yeast culture to dairy cows from 14 d prepartum to 28 d postpartum on DMI, NE intake, milk yield and composition, blood metabolites, and expression of some key hepatic gluconeogenic enzymes. MATERIALS AND METHODS Glycerol-Enriched Yeast Culture and Yeast Culture The GY and yeast culture were provided by our own institute at Nanjing Agricultural University (Nanjing, Jiangsu, China). Glycerol is voluntarily produced by the yeast and serves as a compatible solute at high extracellular osmolarity to protect the cells against lysis. Based on the physiological characteristics of the yeast cell, GY was produced via fermentation of Saccharomyces cerevisiae (a direct-fed microbe permitted by the U.S. Food and Drug Administration) in a hyperosmotic medium (Ye et al., 2014), contained 75.8 g/L G and 15.3 g/L yeast (2.27 × 109 cfu/mL) after fed batch fermentation, and was free of methanol. The glycerol and yeast were not extracted from the culture broth. The yeast culture was just a culture of S. cerevisiae grown in a common medium (containing 2% glucose, 1% yeast extract, and 2% peptone) and contained 31.1 g/L yeast (5.11 × 109 cfu/mL). Animals and Experimental Design This experimental protocol was approved by the Animal Care and Use Committee of the Nanjing Agricultural University with the approved ethical number SYXK (Su) 2011-0036. Forty-four healthy multiparous Holstein dairy cows were selected and blocked by parity, previous 305-d mature equivalent milk yield, and expected calving date in a commercial dairy farm of 900 milking cows. Cows were housed in a tie-stall facility and had free access to clean water during the study. Feeding areas for each cow were physically separated from one another by wooden boards to allow individual DMI measurements. Cows were milked thrice daily at 0700, 1400, and 2100 h using a tie-stall milk line system and individually fed a total mixed ration (TMR) after each milking in sufficient amounts to ensure a 10% feed refusal. The cows were randomly allocated to 4 dietary treatments according to a randomized complete block design: Control (no additive), 2 L/d of GY (75.8 g/L glycerol and 15.3 g/L yeast), 150 g/d of glycerol (G, 0.998g/g glycerol), and 1L/d of yeast culture (Y, 31.1 g/L yeast). Characteristics of the cows used in each group are presented in Table 1. All additives were top-dressed and hand mixed into the upper one-third of the TMR in the morning feeding from −14 to +28 d relative to calving. The basal diet fed to the transition dairy cows was formulated based on the NRC (2001) guidelines for a 650-kg Holstein dairy cow (Table 2). Table 1. Parity, previous 305-d mature equivalent milk yield, BW, BCS, and initial plasma concentrations of β-hydroxybutyric acid (BHBA) and NEFA of cows fed Control, GY, G, or Y1   Treatment    P-value  Item  Control  GY  G  Y  SEM  Treatment  Cows, no.  11  11  11  10      Parity  3.70  3.73  3.64  3.73  0.29  0.99  Previous 305-d mature equivalent milk yield, kg  8,032  7,957  7,970  8,005  60.4  0.60  BW,2 kg  672  676  683  665  11.4  0.48  BCS2  3.55  3.52  3.61  3.50  0.08  0.54  NEFA concentration,3 µEq/L  256.9  264.8  254.3  274.3  12.5  0.40  BHBA concentration,3 mmol/L  0.44  0.39  0.44  0.41  0.06  0.79    Treatment    P-value  Item  Control  GY  G  Y  SEM  Treatment  Cows, no.  11  11  11  10      Parity  3.70  3.73  3.64  3.73  0.29  0.99  Previous 305-d mature equivalent milk yield, kg  8,032  7,957  7,970  8,005  60.4  0.60  BW,2 kg  672  676  683  665  11.4  0.48  BCS2  3.55  3.52  3.61  3.50  0.08  0.54  NEFA concentration,3 µEq/L  256.9  264.8  254.3  274.3  12.5  0.40  BHBA concentration,3 mmol/L  0.44  0.39  0.44  0.41  0.06  0.79  1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Collected on 14 d before expected calving. 3The plasma samples were separated from the whole blood samples collected on 14 d before expected calving. View Large Table 1. Parity, previous 305-d mature equivalent milk yield, BW, BCS, and initial plasma concentrations of β-hydroxybutyric acid (BHBA) and NEFA of cows fed Control, GY, G, or Y1   Treatment    P-value  Item  Control  GY  G  Y  SEM  Treatment  Cows, no.  11  11  11  10      Parity  3.70  3.73  3.64  3.73  0.29  0.99  Previous 305-d mature equivalent milk yield, kg  8,032  7,957  7,970  8,005  60.4  0.60  BW,2 kg  672  676  683  665  11.4  0.48  BCS2  3.55  3.52  3.61  3.50  0.08  0.54  NEFA concentration,3 µEq/L  256.9  264.8  254.3  274.3  12.5  0.40  BHBA concentration,3 mmol/L  0.44  0.39  0.44  0.41  0.06  0.79    Treatment    P-value  Item  Control  GY  G  Y  SEM  Treatment  Cows, no.  11  11  11  10      Parity  3.70  3.73  3.64  3.73  0.29  0.99  Previous 305-d mature equivalent milk yield, kg  8,032  7,957  7,970  8,005  60.4  0.60  BW,2 kg  672  676  683  665  11.4  0.48  BCS2  3.55  3.52  3.61  3.50  0.08  0.54  NEFA concentration,3 µEq/L  256.9  264.8  254.3  274.3  12.5  0.40  BHBA concentration,3 mmol/L  0.44  0.39  0.44  0.41  0.06  0.79  1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Collected on 14 d before expected calving. 3The plasma samples were separated from the whole blood samples collected on 14 d before expected calving. View Large Table 2. Ingredient and nutrient composition of the pre- and postpartum experimental diets (% of DM) Item  Prepartum  Postpartum  Ingredient      Corn silage  35.0  26.3      Alfalfa hay  14.0  17.4      Oats hay  11.5  –      Corn grain  6.4  16.2      Wheat grain  12.1  2.9      Soybean meal  11.2  7.0      Full-fat soybeans  5.2  4.1      Beet meal  –  9.1      Cottonseed whole seeds with lint  –  6.1      Rapeseed meal  –  5.8      Dried distillers' grains with solubles  2.8  3.1      Dicalcium phosphate  0.5  0.44      Salt  0.3  0.2      Sodium bicarbonate  0.2  0.46      Premix1  0.8  0.9  Nutrient composition      CP  16.43  18.21      NDF  36.84  32.15      ADF  22.7  20.44      Ash  5.57  5.36      NEl,2 Mcal/kg  1.56  1.68      Ca  1.21  1.03      P  0.41  0.45      Mg  0.35  0.39      K  1.35  1.27      Na  0.26  0.43  Item  Prepartum  Postpartum  Ingredient      Corn silage  35.0  26.3      Alfalfa hay  14.0  17.4      Oats hay  11.5  –      Corn grain  6.4  16.2      Wheat grain  12.1  2.9      Soybean meal  11.2  7.0      Full-fat soybeans  5.2  4.1      Beet meal  –  9.1      Cottonseed whole seeds with lint  –  6.1      Rapeseed meal  –  5.8      Dried distillers' grains with solubles  2.8  3.1      Dicalcium phosphate  0.5  0.44      Salt  0.3  0.2      Sodium bicarbonate  0.2  0.46      Premix1  0.8  0.9  Nutrient composition      CP  16.43  18.21      NDF  36.84  32.15      ADF  22.7  20.44      Ash  5.57  5.36      NEl,2 Mcal/kg  1.56  1.68      Ca  1.21  1.03      P  0.41  0.45      Mg  0.35  0.39      K  1.35  1.27      Na  0.26  0.43  1Supplied, per kilogram of premix, 1,250,000 IU vitamin A, 400,000 IU vitamin D, 7,800 IU vitamin E, 1,500 mg Fe, 400 mg Cu, 2,500 mg Mn, 1,600 mg Zn, 35 mg Co, 82 mg I, and 20 mg Se. 2Estimates from NRC (2001). View Large Table 2. Ingredient and nutrient composition of the pre- and postpartum experimental diets (% of DM) Item  Prepartum  Postpartum  Ingredient      Corn silage  35.0  26.3      Alfalfa hay  14.0  17.4      Oats hay  11.5  –      Corn grain  6.4  16.2      Wheat grain  12.1  2.9      Soybean meal  11.2  7.0      Full-fat soybeans  5.2  4.1      Beet meal  –  9.1      Cottonseed whole seeds with lint  –  6.1      Rapeseed meal  –  5.8      Dried distillers' grains with solubles  2.8  3.1      Dicalcium phosphate  0.5  0.44      Salt  0.3  0.2      Sodium bicarbonate  0.2  0.46      Premix1  0.8  0.9  Nutrient composition      CP  16.43  18.21      NDF  36.84  32.15      ADF  22.7  20.44      Ash  5.57  5.36      NEl,2 Mcal/kg  1.56  1.68      Ca  1.21  1.03      P  0.41  0.45      Mg  0.35  0.39      K  1.35  1.27      Na  0.26  0.43  Item  Prepartum  Postpartum  Ingredient      Corn silage  35.0  26.3      Alfalfa hay  14.0  17.4      Oats hay  11.5  –      Corn grain  6.4  16.2      Wheat grain  12.1  2.9      Soybean meal  11.2  7.0      Full-fat soybeans  5.2  4.1      Beet meal  –  9.1      Cottonseed whole seeds with lint  –  6.1      Rapeseed meal  –  5.8      Dried distillers' grains with solubles  2.8  3.1      Dicalcium phosphate  0.5  0.44      Salt  0.3  0.2      Sodium bicarbonate  0.2  0.46      Premix1  0.8  0.9  Nutrient composition      CP  16.43  18.21      NDF  36.84  32.15      ADF  22.7  20.44      Ash  5.57  5.36      NEl,2 Mcal/kg  1.56  1.68      Ca  1.21  1.03      P  0.41  0.45      Mg  0.35  0.39      K  1.35  1.27      Na  0.26  0.43  1Supplied, per kilogram of premix, 1,250,000 IU vitamin A, 400,000 IU vitamin D, 7,800 IU vitamin E, 1,500 mg Fe, 400 mg Cu, 2,500 mg Mn, 1,600 mg Zn, 35 mg Co, 82 mg I, and 20 mg Se. 2Estimates from NRC (2001). View Large Sample Collection Feeds offered and residuals were measured and recorded daily for each cow to calculate DMI throughout the experimental period. The TMR samples were collected weekly and stored at −20°C for later chemical analyses. Body weight and BCS were obtained on −14 d of expected calving and +28 d of calving. Body condition was scored by 2 individuals using a 5-point scale (1 to 5 in 0.25 increments; Wildman et al., 1982) and scores were averaged for each cow within 1 d of observation. Milk yields were recorded daily from parturition to 28 d postpartum. Milk samples were collected weekly from each cow at 3 consecutive milkings at the ratio of 4:3:3 within a day and stored at 4°C with 2-bromo-2-nitropropane-1,3-diol as preservative until composition analysis. Blood samples were collected on −14, −7, and −2 d of expected calving and 7, 14, 21, and 28 d in milk. The actual days of sampling before calving were −14.28 (SD 2.58), −7.28 (SD 2.58), and −2.51 (SD 2.26), respectively. Approximately 3 h after the morning feeding, blood was sampled from the coccygeal vein into a 10-mL tube with potassium oxalate and 4% of sodium fluoride for glucose analysis and another 10-mL tube with sodium heparin for analyses of β-hydroxybutyric acid (BHBA) and NEFA. Plasma was then immediately separated from the whole blood by centrifuging at 1,000 × g at 4°C for 10 min. All plasma samples were stored frozen at −20°C until analyses of glucose, BHBA, and NEFA. Liver tissue samples were collected using biopsy instruments on 14 d after calving. Briefly, after local anesthetization with 2% lidocaine hydrochloride, biopsy instruments were inserted between the 11th and 12th rib on a line between the olecranon and the tuber coxae on the right side of dairy cow. After collection, approximate 150 mg of sample was immediately washed in ice-cold 0.9% saline solution to remove any residual blood and then split into 3 equal aliquots in a ribonuclease (RNase)-free plate with liquid nitrogen and placed into cryovials. The cryovials were immediately submerged into liquid nitrogen and transported to a laboratory where they were frozen at −70°C until analysis of the activity, mRNA abundance, and protein level of pyruvate carboxylase (PC), cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C), and glycerol kinase (GK). Sample Analysis Samples of TMR and orts were dried at 55°C for 48 h in a forced-air oven and ground in a mill (FZ102; Shanghai Hongji Instrument Co., Ltd., Shanghai, China) to pass a 1-mm screen for chemical analysis. Processed samples were analyzed for CP (method 976.05), ADF (method 973.18), and ash (method 942.05) by wet chemistry following AOAC (2000) procedures. Processed samples were also analyzed for NDF following the method of Goering and Van Soest (1970). Milk samples were analyzed for fat, protein, lactose, and urea N using infrared spectrophotometry (Foss 120 Milko-Scan; Foss Electric, Hillerød, Denmark) according to an AOAC (1997) procedure (method 975.16). Glucose concentrations in plasma were determined using an automatic biochemical analyzer (Mindray BS-300; Mindray Medical International Ltd., Shenzhen, China). Concentrations of plasma NEFA and BHBA were determined by using colorimetric assays (NEFA Assay Kit A042 and BHBA Assay Kit H169; Nanjing Jiancheng Institute of Bioengineering, Nanjing, China) according to the manufacturer's instructions. Protein Extraction and Determination of Enzyme Activity. Approximate 50 mg of liver sample was homogenized at 4°C in radioimmunoprecipitation assay buffer with protease inhibitors (0.5 mM phenylmethane sulfonyl fluoride). The homogenate was centrifuged at 12,000 × g at 4°C for 15 min, and total protein concentrations were determined using the bicinchoninic acid protein assay. Pyruvate carboxylase activity was spectrophotometrically assayed. Pyruvate was converted to oxaloacetate by PC, and then the oxaloacetate was mixed with acetyl-CoA in the presence of citrate synthase to form citrate and CoA. The CoA then reacted with 5,5′-dithiobis-(2-nitrobenzoic acid) to form a compound that absorbs light at 412 nm (Crabtree et al., 1972). The PC activity was expressed as nanomoles of oxaloacetate formed per milligram protein per minute. Phosphoenolpyruvate carboxykinase (PEPCK) activity was determined by using deoxyguanosine-5′-diphosphate as a substrate. Phosphoenolpyruvate was converted to oxaloacetate by PEPCK, which was reduced with malate dehydrogenase and NADH. The concomitant loss of NADH absorbance was monitored at 340 nm (Petrescu et al., 1979). Phosphoenolpyruvate carboxykinase activity was expressed as nanomoles of oxaloacetate formed per milligram protein per minute. Glycerol kinase activity was determined by a spectrophotometric assay, which uses glycerol-3-phosphate dehydrogenase and NAD+ for converting glycerol-3-phosphate to dihydroxyacetone phosphate and NADH after glycerol is converted to glycerol-3-phosphate by GK. The concentration of the NADH generated in the reaction was monitored at 340 nm in the spectrophotometer (Westergaard et al., 1998). The GK activity was expressed as nanomoles of glycerol-3-phosphate formed per milligram protein per minute. Real-Time PCR. Expressions of PC, PEPCK-C, and GK mRNA were quantitatively determined by real-time PCR. Total RNA was prepared from approximate 50 mg of fragmented frozen liver tissue using the RNAiso Plus reagent (9109; TaKaRa Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's instruction. The isolated RNA pellets were resuspended in 10 μL of diethylpyrocarbonate-treated water. Its concentrations and quality were measured by BioPhotometer Plus (Eppendorf AG, Hamburg, Germany). If the optical density (OD) absorption ratio OD 260:OD 280 nm was >1.8, samples were adjusted to a final concentration of 0.2 μg/μL. Total RNA (1 μg) was reverse transcribed to cDNA using PrimeScript RT Master Mix kit (RR036A; TaKaRa Biotechnology Co., Ltd., Dalian, China). Reverse transcriptions were performed in a 20-μL reaction mixture containing 4 μL of 5x PrimeScript RT Master Mix, 5 μL of total RNA, and 11 μL of RNase-free water and were performed at 37°C for 15 min followed by 85°C for 5 s and 4°C for more than 5 min. The resulting first-strand cDNA was stored at −20°C until use for real-time PCR. Primer Premier Software (Premier Biosoft International, Palo Alto, CA) was used to design specific primers for β-actin, PC, PEPCK-C, and GK based on the known sequences (Table 3). Reactions were performed in a 25-μL reaction mixture containing 12.5 μL of 2x UltraSYBR Mixture (CW0956; CWBio Co., Ltd. Beijing, China), 1 μL of cDNA, 0.5 μL of each primer (10 μM), and 10.5 μL of RNase-free water. Reactions were conducted in an ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Inc., Carlsbad, CA) consisting of a 95°C step for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 1 min, and 60°C for 15 s. A dissociation curve was performed for each plate to confirm the production of a single product, whereas the no-template control served as negative control. The relative mRNA levels of the PC, PEPCK-C, and GK in liver tissue were determined using the Δ cycle threshold (ΔCt) method as outlined in the protocol of Applied Biosystems. The result was applied to each gene by calculating the expression of 2−ΔΔCT. Table 3. Primers used for real-time PCR analysis Gene  Accession no.  Primer sequence (5′–3′)  Product, bp  β-actin  AY141970.1  Forward: GCAGGTCATCACCATCGG  158  Reverse: CCGTGTTGGCGTAGAGGT  PC  AY185596.1  Forward: CCCTGCTGTGACCTGCTT  146  Reverse: TTCTTGATGGGCTTGTACTCC  PEPCK-C  AY145503  Forward: GGGTCGCACCATGTATGT  178  Reverse: GTGGAGGCACTTGACGAA  GK  BC122692.1  Forward: GAGGGATCATCTGTGGGC  140  Reverse: CTGCAAATGGCTGAGTGG  Gene  Accession no.  Primer sequence (5′–3′)  Product, bp  β-actin  AY141970.1  Forward: GCAGGTCATCACCATCGG  158  Reverse: CCGTGTTGGCGTAGAGGT  PC  AY185596.1  Forward: CCCTGCTGTGACCTGCTT  146  Reverse: TTCTTGATGGGCTTGTACTCC  PEPCK-C  AY145503  Forward: GGGTCGCACCATGTATGT  178  Reverse: GTGGAGGCACTTGACGAA  GK  BC122692.1  Forward: GAGGGATCATCTGTGGGC  140  Reverse: CTGCAAATGGCTGAGTGG  View Large Table 3. Primers used for real-time PCR analysis Gene  Accession no.  Primer sequence (5′–3′)  Product, bp  β-actin  AY141970.1  Forward: GCAGGTCATCACCATCGG  158  Reverse: CCGTGTTGGCGTAGAGGT  PC  AY185596.1  Forward: CCCTGCTGTGACCTGCTT  146  Reverse: TTCTTGATGGGCTTGTACTCC  PEPCK-C  AY145503  Forward: GGGTCGCACCATGTATGT  178  Reverse: GTGGAGGCACTTGACGAA  GK  BC122692.1  Forward: GAGGGATCATCTGTGGGC  140  Reverse: CTGCAAATGGCTGAGTGG  Gene  Accession no.  Primer sequence (5′–3′)  Product, bp  β-actin  AY141970.1  Forward: GCAGGTCATCACCATCGG  158  Reverse: CCGTGTTGGCGTAGAGGT  PC  AY185596.1  Forward: CCCTGCTGTGACCTGCTT  146  Reverse: TTCTTGATGGGCTTGTACTCC  PEPCK-C  AY145503  Forward: GGGTCGCACCATGTATGT  178  Reverse: GTGGAGGCACTTGACGAA  GK  BC122692.1  Forward: GAGGGATCATCTGTGGGC  140  Reverse: CTGCAAATGGCTGAGTGG  View Large Western Blot. The relative abundance of PC, PEPCK-C, and GK protein in liver samples were determined by western blot. Extraction and quantitation of protein in liver samples were described in the procedure of enzyme activity determination. Equal amounts of protein in a loading buffer were denatured by heating at 95°C for 5 min and then separated by SDS-PAGE on a 4 to 12% Bis-Tris gel and transferred onto polyvinylidene fluoride membranes (Bio-Rad Laboratories, Inc., Berkeley, CA). After transfer, the membranes were blocked in 5% BSA for 40 min at room temperature and then individually incubated overnight at 4°C with the primary antibody (anti-PC from Santa Cruz Biotechnology, Inc., Santa Cruz, CA, diluted 1:1,000; anti-PEPCK-C from Santa Cruz Biotechnology, diluted 1:800; anti-GK from Abcam, Cambridge, UK, diluted 1:800; and anti-β-actin from Cell Signaling Technology, Inc., Danvers, MA, diluted 1:1,000). After 3 washes in Tris-buffered saline-Tween 20, the membranes were incubated with the secondary antibody (polyclonal anti-rabbit–horseradish peroxidase from Sigma Chemical Co., St. Louis, MO, diluted 1:15,000) at room temperature for 40 min. The washes were repeated and membranes were developed using a BU-Western Blot Detection System (Biouniquer Technology Co., Ltd., Nanjing, China). Proteins were visualized using a Bio-Imaging Analyzer (LAS-3000; Fujifilm Life Science, Tokyo, Japan), and band intensity was quantified with the ImageQuant TL software (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). Calculations and Statistical Analyses Net energy intake (MJ/d) was calculated by multiplying the DM intake by the NEl of the diet (Feng et al., 2000). The energy (NEl) of dry glycerol, assumed to be 9.7 MJ/kg (Schröder and Südekum, 1999), was included in the NE intake. Forty-three cows were used in the study. One cow from the Y group was removed because of an unsuccessful recovery from health complications unrelated to the treatment. Before statistical analyses, daily measurements of DMI, NE intake, and milk yield were calculated to weekly averages for each cow. Data of DMI, NE intake, and blood metabolites were analyzed separately for the prepartum and postpartum period. Data were analyzed as repeated measures by using the PROC MIXED procedure of SAS (SAS Inst., Inc., Cary, NC). The model included treatment (Control, GY, G, or Y) and sampling time (week) as fixed effects. The 2-way interaction was treatment × sampling time. The random effect was the cow nested within treatment. The residual terms were assumed to be normally, independently, and identically distributed with variance σ2e. Degrees of freedom were estimated by using the Kenward–Roger option in the MODEL statement (Kenward and Roger, 1997). Time of sampling (week) was used in the REPEATED statement. Time-series covariance structure was modeled by using the options of autoregressive order one, compound symmetry, and unstructured and spatial power law. The best time-series covariance structure was selected based on the lowest Akaike and Bayesian information criteria (Littell et al., 1998). The PDIFF option was used for multiple comparison tests. The activities and the mRNA and protein expression of the enzymes were analyzed statistically by using SPSS 18.0 for Windows (Statistical Product and Service Solutions, Inc., Chicago, IL) with one-way ANOVA. Treatment differences were determined by Duncan contrasts. Means were considered different if P ≤ 0.05 and tendency to be different if 0.05 < P < 0.10. Values reported are least squares means and associated SE. RESULTS The DMI, NE intake, and BCS change of the cows during the experiment period are shown in Table 4. Dietary treatments did not affect the DMI and NE intake in the final 2 wk before calving and the first 4 wk after calving and the BCS change during the whole experiment period (P > 0.10). Table 4. Average DMI, NE intake, and BCS change of cows fed Control, GY, G, or Y1 during the experiment period   Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  DMI,3 kg/d      Prepartum  13.3  13.2  13.6  12.9  0.30  0.15  <0.05  0.71      Postpartum  18.7  18.9  18.3  18.5  0.28  0.18  <0.05  0.89  NE intake,4 Mcal/d      Prepartum  20.7  21.0  21.5  20.2  0.20  0.20  <0.05  0.65      vPostpartum  31.4  32.1  31.1  31.1  0.31  0.29  <0.05  0.74  BCS5 change  −0.22  −0.18  −0.24  −0.19  0.03  0.23        Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  DMI,3 kg/d      Prepartum  13.3  13.2  13.6  12.9  0.30  0.15  <0.05  0.71      Postpartum  18.7  18.9  18.3  18.5  0.28  0.18  <0.05  0.89  NE intake,4 Mcal/d      Prepartum  20.7  21.0  21.5  20.2  0.20  0.20  <0.05  0.65      vPostpartum  31.4  32.1  31.1  31.1  0.31  0.29  <0.05  0.74  BCS5 change  −0.22  −0.18  −0.24  −0.19  0.03  0.23      1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Trt = treatment. 3Prepartum, data collected for 2 wk before expected calving; postpartum, data collected for 4 wk after calving. 4Net energy intake (Mcal/d) was calculated by multiplying the DM intake by the NEl of the diet. The energy (NEl) of dry glycerol, assumed to be 9.7 MJ/kg, was included in NE intake. 5Cows were weighed and scored on d −14 and +28 of calving. Values represent average change from d −14 to +28 of calving. View Large Table 4. Average DMI, NE intake, and BCS change of cows fed Control, GY, G, or Y1 during the experiment period   Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  DMI,3 kg/d      Prepartum  13.3  13.2  13.6  12.9  0.30  0.15  <0.05  0.71      Postpartum  18.7  18.9  18.3  18.5  0.28  0.18  <0.05  0.89  NE intake,4 Mcal/d      Prepartum  20.7  21.0  21.5  20.2  0.20  0.20  <0.05  0.65      vPostpartum  31.4  32.1  31.1  31.1  0.31  0.29  <0.05  0.74  BCS5 change  −0.22  −0.18  −0.24  −0.19  0.03  0.23        Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  DMI,3 kg/d      Prepartum  13.3  13.2  13.6  12.9  0.30  0.15  <0.05  0.71      Postpartum  18.7  18.9  18.3  18.5  0.28  0.18  <0.05  0.89  NE intake,4 Mcal/d      Prepartum  20.7  21.0  21.5  20.2  0.20  0.20  <0.05  0.65      vPostpartum  31.4  32.1  31.1  31.1  0.31  0.29  <0.05  0.74  BCS5 change  −0.22  −0.18  −0.24  −0.19  0.03  0.23      1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Trt = treatment. 3Prepartum, data collected for 2 wk before expected calving; postpartum, data collected for 4 wk after calving. 4Net energy intake (Mcal/d) was calculated by multiplying the DM intake by the NEl of the diet. The energy (NEl) of dry glycerol, assumed to be 9.7 MJ/kg, was included in NE intake. 5Cows were weighed and scored on d −14 and +28 of calving. Values represent average change from d −14 to +28 of calving. View Large The average milk yield and 4% fat-corrected milk yield did not differ among the treatments (Table 5; P > 0.10). Cows fed GY or Y had higher milk fat percentage and milk protein percentage and protein yield than those fed Control or G (P < 0.05). Relative to cows fed Control and G, cows fed GY or Y had a tendency toward higher milk fat yield (1.08 and 1.07 vs. 1.03 and 1.01 kg/d, respectively; P = 0.06). Milk lactose and milk urea nitrogen were similar among the treatments (P > 0.10). There was no significant interaction of treatment × week. Table 5. Average milk yield and milk composition of cows fed Control, GY, G, or Y from parturition to 28 d postpartum1   Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Milk yield, kg/d  29.3  29.8  28.8  29.5  0.44  0.24  <0.05  0.65      4% FCM,3 kg/d  27.2  28.1  26.7  27.9  0.43  0.16  <0.05  0.47      Fat, %  3.53b  3.62a  3.51b  3.63a  0.03  <0.05  <0.05  0.37      Fat, kg/d  1.03  1.08  1.01  1.07  0.02  0.06  <0.05  0.15      Protein, %  3.02b  3.14a  3.04b  3.16a  0.04  <0.05  <0.05  0.43      Protein, kg/d  0.89b  0.94a  0.87b  0.93a  0.02  <0.05  0.14  0.29      Lactose, %  4.85  4.82  4.87  4.90  0.06  0.63  0.20  0.32      Lactose, kg/d  1.42  1.44  1.41  1.45  0.03  0.43  0.15  0.31      Urea N, mg/dL  11.34  11.57  11.77  12.01  0.47  0.52  0.13  0.82    Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Milk yield, kg/d  29.3  29.8  28.8  29.5  0.44  0.24  <0.05  0.65      4% FCM,3 kg/d  27.2  28.1  26.7  27.9  0.43  0.16  <0.05  0.47      Fat, %  3.53b  3.62a  3.51b  3.63a  0.03  <0.05  <0.05  0.37      Fat, kg/d  1.03  1.08  1.01  1.07  0.02  0.06  <0.05  0.15      Protein, %  3.02b  3.14a  3.04b  3.16a  0.04  <0.05  <0.05  0.43      Protein, kg/d  0.89b  0.94a  0.87b  0.93a  0.02  <0.05  0.14  0.29      Lactose, %  4.85  4.82  4.87  4.90  0.06  0.63  0.20  0.32      Lactose, kg/d  1.42  1.44  1.41  1.45  0.03  0.43  0.15  0.31      Urea N, mg/dL  11.34  11.57  11.77  12.01  0.47  0.52  0.13  0.82  a,bMeans within a row with different superscripts differ (P < 0.05). 1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Trt = treatment. 3FCM = fat-corrected milk. 4% FCM = (0.4 × milk yield) + (0.15 × % fat × milk yield). View Large Table 5. Average milk yield and milk composition of cows fed Control, GY, G, or Y from parturition to 28 d postpartum1   Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Milk yield, kg/d  29.3  29.8  28.8  29.5  0.44  0.24  <0.05  0.65      4% FCM,3 kg/d  27.2  28.1  26.7  27.9  0.43  0.16  <0.05  0.47      Fat, %  3.53b  3.62a  3.51b  3.63a  0.03  <0.05  <0.05  0.37      Fat, kg/d  1.03  1.08  1.01  1.07  0.02  0.06  <0.05  0.15      Protein, %  3.02b  3.14a  3.04b  3.16a  0.04  <0.05  <0.05  0.43      Protein, kg/d  0.89b  0.94a  0.87b  0.93a  0.02  <0.05  0.14  0.29      Lactose, %  4.85  4.82  4.87  4.90  0.06  0.63  0.20  0.32      Lactose, kg/d  1.42  1.44  1.41  1.45  0.03  0.43  0.15  0.31      Urea N, mg/dL  11.34  11.57  11.77  12.01  0.47  0.52  0.13  0.82    Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Milk yield, kg/d  29.3  29.8  28.8  29.5  0.44  0.24  <0.05  0.65      4% FCM,3 kg/d  27.2  28.1  26.7  27.9  0.43  0.16  <0.05  0.47      Fat, %  3.53b  3.62a  3.51b  3.63a  0.03  <0.05  <0.05  0.37      Fat, kg/d  1.03  1.08  1.01  1.07  0.02  0.06  <0.05  0.15      Protein, %  3.02b  3.14a  3.04b  3.16a  0.04  <0.05  <0.05  0.43      Protein, kg/d  0.89b  0.94a  0.87b  0.93a  0.02  <0.05  0.14  0.29      Lactose, %  4.85  4.82  4.87  4.90  0.06  0.63  0.20  0.32      Lactose, kg/d  1.42  1.44  1.41  1.45  0.03  0.43  0.15  0.31      Urea N, mg/dL  11.34  11.57  11.77  12.01  0.47  0.52  0.13  0.82  a,bMeans within a row with different superscripts differ (P < 0.05). 1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Trt = treatment. 3FCM = fat-corrected milk. 4% FCM = (0.4 × milk yield) + (0.15 × % fat × milk yield). View Large Prepartum concentrations of plasma glucose and BHBA did not differ among the treatments (Table 6; Fig. 1). During the postpartum period, cows fed GY or G had higher plasma glucose concentrations and lower plasma BHBA concentrations than cows fed Control (P < 0.05). Concentrations of plasma NEFA were lower in cows fed GY or G relative to cows fed Control or Y in both the prepartum and the postpartum period (P < 0.05). The dietary supplementation of G and GY reduced the plasma NEFA, and there was a treatment × week interaction (P < 0.05), so at the end of 4 wk, the dietary supplementation of GY further reduced the plasma NEFA (P < 0.05) during the postpartum period (Fig. 1). Table 6. Average concentrations of plasma glucose, β-hydroxybutyric acid (BHBA), and NEFA of cows fed Control, GY, G, or Y1 during the experiment period   Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Glucose, mmol/L      Prepartum3  3.55  3.62  3.59  3.56  0.08  0.79  <0.05  0.53      Postpartum4  2.80b  3.11a  3.04a  2.89ab  0.08  <0.05  0.23  0.97  BHBA, mmol/L      Prepartum  0.47  0.40  0.42  0.43  0.04  0.33  0.46  0.93      Postpartum  0.84a  0.72b  0.75b  0.78ab  0.03  <0.05  <0.05  0.96  NEFA, µEq/L      Prepartum  277.2a  259.4b  254.5b  279.1a  7.6  <0.05  <0.05  0.17      Postpartum  476.4a  444.5b  456.6b  465.4a  8.0  <0.05  <0.05  <0.05    Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Glucose, mmol/L      Prepartum3  3.55  3.62  3.59  3.56  0.08  0.79  <0.05  0.53      Postpartum4  2.80b  3.11a  3.04a  2.89ab  0.08  <0.05  0.23  0.97  BHBA, mmol/L      Prepartum  0.47  0.40  0.42  0.43  0.04  0.33  0.46  0.93      Postpartum  0.84a  0.72b  0.75b  0.78ab  0.03  <0.05  <0.05  0.96  NEFA, µEq/L      Prepartum  277.2a  259.4b  254.5b  279.1a  7.6  <0.05  <0.05  0.17      Postpartum  476.4a  444.5b  456.6b  465.4a  8.0  <0.05  <0.05  <0.05  a,bMeans within a row with different superscripts differ (P < 0.05). 1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Trt = treatment. 3Prepartum, data collected for 2 wk before expected calving. 4Postpartum, data collected for 4 wk after calving. View Large Table 6. Average concentrations of plasma glucose, β-hydroxybutyric acid (BHBA), and NEFA of cows fed Control, GY, G, or Y1 during the experiment period   Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Glucose, mmol/L      Prepartum3  3.55  3.62  3.59  3.56  0.08  0.79  <0.05  0.53      Postpartum4  2.80b  3.11a  3.04a  2.89ab  0.08  <0.05  0.23  0.97  BHBA, mmol/L      Prepartum  0.47  0.40  0.42  0.43  0.04  0.33  0.46  0.93      Postpartum  0.84a  0.72b  0.75b  0.78ab  0.03  <0.05  <0.05  0.96  NEFA, µEq/L      Prepartum  277.2a  259.4b  254.5b  279.1a  7.6  <0.05  <0.05  0.17      Postpartum  476.4a  444.5b  456.6b  465.4a  8.0  <0.05  <0.05  <0.05    Treatment    P-value  Item  Control  GY  G  Y  SEM  Trt2  Week  Trt × week  Glucose, mmol/L      Prepartum3  3.55  3.62  3.59  3.56  0.08  0.79  <0.05  0.53      Postpartum4  2.80b  3.11a  3.04a  2.89ab  0.08  <0.05  0.23  0.97  BHBA, mmol/L      Prepartum  0.47  0.40  0.42  0.43  0.04  0.33  0.46  0.93      Postpartum  0.84a  0.72b  0.75b  0.78ab  0.03  <0.05  <0.05  0.96  NEFA, µEq/L      Prepartum  277.2a  259.4b  254.5b  279.1a  7.6  <0.05  <0.05  0.17      Postpartum  476.4a  444.5b  456.6b  465.4a  8.0  <0.05  <0.05  <0.05  a,bMeans within a row with different superscripts differ (P < 0.05). 1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). 2Trt = treatment. 3Prepartum, data collected for 2 wk before expected calving. 4Postpartum, data collected for 4 wk after calving. View Large Figure 1. View largeDownload slide Concentrations of plasma glucose, β-hydroxybutyric acid (BHBA), and NEFA (pooled SEM = 0.06, pooled SEM = 0.02, and pooled SEM = 5.6, respectively) for cows fed no additive (Control), 2 L/d glycerol-enriched yeast culture (GY), 150 g/d glycerol (G), and 1 L/d yeast culture (Y). Figure 1. View largeDownload slide Concentrations of plasma glucose, β-hydroxybutyric acid (BHBA), and NEFA (pooled SEM = 0.06, pooled SEM = 0.02, and pooled SEM = 5.6, respectively) for cows fed no additive (Control), 2 L/d glycerol-enriched yeast culture (GY), 150 g/d glycerol (G), and 1 L/d yeast culture (Y). Table 7 presented the activities of key gluconeogenic enzymes in the liver at 14 d postpartum. Cows fed GY, G, or Y had a tendency toward higher activities of PC in the liver than the cows fed Control (P = 0.088). Compared with the Control or Y group, cows fed GY or G had higher activities of PEPCK-C and GK (P < 0.05). The enzyme activities of PEPCK-C, PC, and GK did not differ between cows fed GY and G (P > 0.10). Table 7. The activities of pyruvate carboxylase (PC), cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C), and glycerol kinase (GK) in the liver of transition cows fed Control, GY, G, or Y1 on 14 d after calving   Treatment      Item  Control  GY  G  Y  SE  Treatment effect (P-value)  PC activity, nmol·min−1·mg protein−1  48.05  53.41  51.45  50.98  0.765  0.088  PEPCK-C activity, nmol·min−1·mg protein−1  31.48b  38.70a  37.66a  32.34b  0.650  <0.05  GK activity, nmol·min−1·mg protein−1  8.06b  13.93a  14.85a  7.55b  0.533  <0.05    Treatment      Item  Control  GY  G  Y  SE  Treatment effect (P-value)  PC activity, nmol·min−1·mg protein−1  48.05  53.41  51.45  50.98  0.765  0.088  PEPCK-C activity, nmol·min−1·mg protein−1  31.48b  38.70a  37.66a  32.34b  0.650  <0.05  GK activity, nmol·min−1·mg protein−1  8.06b  13.93a  14.85a  7.55b  0.533  <0.05  a,bMeans within a row with different superscripts differ (P < 0.05). 1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). View Large Table 7. The activities of pyruvate carboxylase (PC), cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C), and glycerol kinase (GK) in the liver of transition cows fed Control, GY, G, or Y1 on 14 d after calving   Treatment      Item  Control  GY  G  Y  SE  Treatment effect (P-value)  PC activity, nmol·min−1·mg protein−1  48.05  53.41  51.45  50.98  0.765  0.088  PEPCK-C activity, nmol·min−1·mg protein−1  31.48b  38.70a  37.66a  32.34b  0.650  <0.05  GK activity, nmol·min−1·mg protein−1  8.06b  13.93a  14.85a  7.55b  0.533  <0.05    Treatment      Item  Control  GY  G  Y  SE  Treatment effect (P-value)  PC activity, nmol·min−1·mg protein−1  48.05  53.41  51.45  50.98  0.765  0.088  PEPCK-C activity, nmol·min−1·mg protein−1  31.48b  38.70a  37.66a  32.34b  0.650  <0.05  GK activity, nmol·min−1·mg protein−1  8.06b  13.93a  14.85a  7.55b  0.533  <0.05  a,bMeans within a row with different superscripts differ (P < 0.05). 1Control = no additive; GY = glycerol-enriched yeast culture (at 2 L/d); G = glycerol (at 150 g/d); Y = yeast culture (at 1 L/d). View Large The expression of mRNA and protein of key gluconeogenic enzymes in the liver at 14 d postpartum are shown in Fig. 2. The treatments did not affect the expression of mRNA and protein of PC in the liver (P > 0.10). Compared with the Control or Y group, supplement of GY or G for cows significantly increased the expression of mRNA and protein of PEPCK-C in the liver (P < 0.05). Cows fed GY or G had a tendency toward a higher mRNA expression of GK (P < 0.10). The mRNA and protein expression of PEPCK-C, PC, and GK were similar in cows fed GY and G (P > 0.10). Figure 2. View largeDownload slide The expression of mRNA (A) and protein (B) of key gluconeogenic enzymes in the liver on 14 d postpartum for cows fed no additive (Control), 2 L/d glycerol-enriched yeast culture (GY), 150 g/d glycerol (G), and 1 L/d yeast culture (Y). The mRNA and protein abundance was normalized against β-actin in each sample. PC = pyruvate carboxylase; PEPCK-C = cytosolic phosphoenolpyruvate carboxykinase; GK = glycerol kinase. Figure 2. View largeDownload slide The expression of mRNA (A) and protein (B) of key gluconeogenic enzymes in the liver on 14 d postpartum for cows fed no additive (Control), 2 L/d glycerol-enriched yeast culture (GY), 150 g/d glycerol (G), and 1 L/d yeast culture (Y). The mRNA and protein abundance was normalized against β-actin in each sample. PC = pyruvate carboxylase; PEPCK-C = cytosolic phosphoenolpyruvate carboxykinase; GK = glycerol kinase. DISCUSSION Glycerol is rapidly and mainly fermented to propionate in the rumen (Garton et al., 1961; Dasari, 2007), and it can also be directly absorbed via the rumen wall and converted into glucose via gluconeogenesis in the liver (Krehbiel, 2008). Therefore, as a glucogenic precursor, it is potentially more beneficial for energy status and metabolic health of cows (especially the cows in NEB) than other energy-dense nutrients (e.g., lipogenic nutrients). It can improve the energy status of dairy cows, as evidenced by the decreased NEFA and BHBA levels as well as the increased blood glucose levels (Chung et al., 2007; Wang et al., 2009). Yeasts as a direct-fed microbial can improve the milk yield or milk composition of dairy cows by increasing ammonia uptake and microbial protein production (Harris and Webb, 1990; Erasmus et al., 1992; Miller-Webster et al., 2002) as well as by enhancing diet digestibility (Dawson et al., 1990). Coincidentally, glycerol can be produced by fermentation of S. cerevisiae in a hyperosmotic medium. Its final fermentation broth was rich in glycerol and yeast and free of deleterious impurities. The fermentation broth should have the effects both of glycerol on the energy status and of yeast on the lactation performance for dairy cows and could be used as a new feed additive to alleviate the NEB status in dairy cows. Previous studies focused solely on glycerol to improve the energy status or on yeast to improve the lactation performance of dairy cows (Chung et al., 2007; Kalmus et al., 2009; Wang et al., 2009). In this present study, the effects of glycerol and yeast combination on energy status, lactation performance, and expression of key liver gluconeogenic enzymes of dairy cows during the transition period were investigated. The dietary treatments (feeding glycerol, yeast, or GY) did not affect DMI during the peripartum period, similar to the previous studies that fed refined glycerol (99.5%) up to 11.5% of the ration DM or fed 1.2 × 1010 cfu/d of live yeast to dairy cows (Bagheri et al., 2009; Carvalho et al., 2011). DeFrain et al. (2004) reported that feeding 800 g/d of impure glycerol (corresponding to 690 g/d of pure glycerol) to transition dairy cows led to DMI depression during the prepartum period, and this was probably due to the impurities of their glycerol product that included up to 11.5% salt and 1.3% methanol. These impurities probably can influence the palatability of the glycerol product (Chung et al., 2007). The 690 g/d of pure glycerol should not affect the DMI, as evidenced by the research that supplement with refined glycerol (99.5%, United States Pharmacopeia–grade glycerin) up to 11.5% of the ration DM also had no effect on the DMI during the prepartum and postpartum period (Carvalho et al., 2011). Besides, the similar DMI among treatments were also responsible for no difference in NE intake among treatments in this study, despite the addition of glycerol. Milk yield and 4% fat-corrected milk yield were not affected by feeding GY, G, or Y in this study, which is in agreement with some previous (Fisher et al., 1973; Harris and Webb, 1990) and recent (Kalmus et al., 2009; Carvalho et al., 2011) studies wherein glycerol or yeast was fed to transition or lactation dairy cows. This may be explained by the almost equal NE intake among the treatment groups. No response was observed in milk composition by feeding glycerol, which is in agreement with other previous studies focusing on glycerol (Wang et al., 2009; Carvalho et al., 2011). It has been demonstrated that feeding with 10 g yeast cells (Kalmus et al., 2009) or 1 × 1010 cfu live yeast cells (Guedes et al., 2008) could increase milk fat and milk protein percentage. Similar effects were also observed in GY and Y groups (cows fed with the culture containing approximately 30 g yeast cells or 5 × 1012 cfu live yeast cells) during the early lactation period in this study. This could be explained by the reason that yeast included in GY and Y increased the digestibility of NDF in diets (Guedes et al., 2008). As Kalmus et al. (2009) suggested that an effective digestion of fiber, in the form of NDF, would increase the number of cellulolytic bacteria in the rumen (Dawson et al., 1990) and thus influence milk fat content. For example, yeast supplementation had a significant effect on milk fat content when NDF in the ration was 21% compared with 17% (Wang et al., 2001). In addition, the higher milk protein percentage in the GY or Y group than in the Control or G group might be attributed to the well-known effect of yeast on rumen fermentation and nutrient digestibility, which increased microbial protein production (Erasmus et al., 1992; Dolezal et al., 2005). In the present study, despite the similar NE intake among the treatment groups during the transition period, a more positive energy status (higher plasma glucose level and lower plasma BHBA and NEFA levels) was observed in either the GY or G group compared with the Control or Y group. This is consistent with previous studies in which cows were fed 250 g/d of dry glycerin (corresponding to 162.5 g/d pure glycerol) or 100 to 300 g/d food-grade glycerol (0.998 g/g glycerol; Chung et al., 2007; Wang et al., 2009). These results were probably due to the inclusion of glycerol and could be interpreted as a well-known glucogenic effect of glycerol. A portion of the ingested glycerol is absorbed directly via the rumen wall and converted into glucose via gluconeogenesis in the liver (Krehbiel, 2008). The remaining glycerol is fermented to propionate in the rumen (Hobson and Mann, 1961), which serves as a glucogenic precursor in the liver and increases the glucose synthesis of dairy cows. In ruminants, propionate derived from the microbial fermentation supplies 32 to 73% of the glucose synthesis requirement (Seal and Reynolds, 1993). Therefore, higher plasma glucose concentrations were observed in the G or GY group. The higher plasma glucose level would conduce to depress adipose tissue mobilization, consequently decreasing the production of NEFA and BHBA. Feeding GY or G to cows increased the activities and expressions of PEPCK-C and the activities of GK but had little influence on PC. In ruminants, the majority of ingested carbohydrates are converted to short-chain fatty acids in the forestomach, which implies limited availability of glucose for absorption and makes the hepatic gluconeogenesis as an especially important pathway for ruminants to maintain an adequate glucose level (Al-Trad et al., 2010). Pyruvate carboxylase and PEPCK-C are both the 2 main rate-limiting enzymes of gluconeogenesis in animals (Al-Trad et al., 2010). Pyruvate carboxylase usually catalyzes the pyruvate, being converted from lactate or glucogenic AA as the dominating glucogenic precursors, to form oxaloacetate (Bradford and Allen, 2005; Al-Trad et al., 2010). However, propionate, not the lactate or glucogenic AA, is the dominating glucogenic precursors in ruminants and is initially converted to oxaloacetate by propionyl-CoA carboxylase and then enters the gluconeogenic pathway under PEPCK-C catalysis. Cytosolic phosphoenolpyruvate carboxykinase has been identified as a main rate-limiting enzyme involved in glucose production from propionate in dairy cows (Greenfield et al., 2000). Therefore, the supplement of glycerol included in GY and G increased the propionate in rumen and then upregulated the activities and expressions of liver PEPCK-C. Therefore, increasing the entry of propionate by oral administration of glycerol has become a successful strategy to support dairy cows in periods of glucose shortage, especially in the critical postpartum period. Cows fed GY or G had higher enzyme activities and a tendency toward higher mRNA expressions of GK than cows fed Control or Y, which might be mediated by the portion of glycerol absorbed directly through rumen wall. The absorbed glycerol was converted to glycerol-3-phosphate under the catalysis of GK in the liver and then entered the tricarboxylic acid cycle for oxidization or gluconeogenesis to produce glucose. In conclusion, supplementation of GY to transition dairy cows did not affect the DMI, NE intake, BCS change, and milk yield but it increased the milk fat and protein content in early lactation, improved the energy status, and increased the enzyme activities and expression of key enzymes (PEPCK-C and GK) in the liver. It was suggested that the GY combined the effects of glycerol on energy status and the effects of yeast on lactation performance of the dairy cows and could be used as a new feed additive to alleviate the NEB status of dairy cows. LITERATURE CITED Al-Trad B. Wittek T. Penner G. B. Reisberg K. Gabel G. Furll M. Aschenbach J. R. 2010. Expression and activity of key hepatic gluconeogenesis enzymes in response to increasing intravenous infusions of glucose in dairy cows. J. Anim. Sci.  88: 2998– 3008. doi: https://doi.org/10.2527/jas.2009-2463 Google Scholar CrossRef Search ADS PubMed  AOAC 1997. Official methods of analysis. 16th ed. AOAC Int., Gaithersburg, MD. AOAC 2000. Official methods of analysis. 17th ed. AOAC Int., Gaithersburg, MD. Bagheri M. Ghorbani G. R. Rahmani H. R. Khorvash M. Nili N. Suedekum K.-H. 2009. Effect of live yeast and mannan-oligosaccharides on performance of early-lactation Holstein dairy cows. Asian-Australas. J. Anim. Sci.  22: 812– 818. doi: https://doi.org/10.5713/ajas.2009.80561 Bertics S. J. Grummer R. R. Cadorniga-Valino C. Stoddard E. E. 1992. Effect of prepartum dry matter intake on liver triglyceride concentration and early lactation. J. Dairy Sci.  75: 1914– 1922. doi: https://doi.org/10.3168/jds.S0022-0302(92)77951-X Google Scholar CrossRef Search ADS PubMed  Bradford B. J. Allen M. S. 2005. Phlorizin administration increases hepatic gluconeogenic enzyme mRNA abundance but not feed intake in late-lactation dairy cows. J. Nutr.  135: 2206– 2211. Google Scholar CrossRef Search ADS PubMed  Bruno R. G. S. Rutigliano H. M. Cerri R. L. Robinson P. H. Santos J. E. P. 2009. Effect of feeding Saccharomyces cerevisiae on performance of dairy cows during summer heat stress. Anim. Feed Sci. Technol.  150: 175– 186. doi: https://doi.org/10.1016/j.anifeedsci.2008.09.001 Google Scholar CrossRef Search ADS   Carvalho E. R. Schmelz-Roberts N. S. White H. M. Doane P. H. Donkin S. S. 2011. Replacing corn with glycerol in diets for transition dairy cows. J. Dairy Sci.  94: 908– 916. doi: https://doi.org/10.3168/jds.2010-3581 Google Scholar CrossRef Search ADS PubMed  Chung Y. H. Rico D. E. Martinez C. M. Cassidy T. W. Noirot V. Ames A. Varga G. A. 2007. Effects of feeding dry glycerin to early postpartum Holstein dairy cows on lactational performance and metabolic profiles. J. Dairy Sci.  90: 5682– 5691. doi: https://doi.org/10.3168/jds.2007-0426 Google Scholar CrossRef Search ADS PubMed  Crabtree B. Higgins S. J. Newsholme E. A. 1972. The activities of pyruvate carboxylase, phosphoenolpyruvate carboxylase and fructose diphosphatase in muscles from vertebrates and invertebrates. Biochem. J.  130: 391– 396. doi: https://doi.org/10.1042/bj1300391 Google Scholar CrossRef Search ADS PubMed  Dasari M. 2007. Crude glycerol potential described. Feedstuffs  79: 1– 3. Dawson K. A. Newman K. E. Boling J. A. 1990. Effects of microbial supplements containing yeast and lactobacilli on roughage-fed ruminal microbial activities. J. Anim. Sci.  68: 3392– 3398. Google Scholar CrossRef Search ADS PubMed  DeFrain J. M. Hippen A. R. Kalscheur K. F. Jardon P. W. 2004. Feeding glycerol to transition dairy cows: Effects on blood metabolites and lactation performance. J. Dairy Sci.  87: 4195– 4206. doi: https://doi.org/10.3168/jds.S0022-0302(04)73564-X Google Scholar CrossRef Search ADS PubMed  Dolezal P. Dolezal J. Trinacty J. 2005. The effect of Saccharomyces cerevisiae on ruminal fermentation in dairy cows. Czech J. Anim. Sci.  50: 503– 510. Erasmus L. J. Botha P. M. Kistner A. 1992. Effect of yeast culture supplement on production, rumen fermentation, and duodenal nitrogen flow in dairy cows. J. Dairy Sci.  75: 3056– 3065. doi: https://doi.org/10.3168/jds.S0022-0302(92)78069-2 Google Scholar CrossRef Search ADS PubMed  Feng Y. L. Mo F. Lu Z. N. 2000. Nutrient requirements of dairy cattle. Chinese Agriculture Univ. Press, Beijing, China. p. 14– 15. Fisher L. J. Erfle J. D. Lodge G. A. Sauer F. D. 1973. Effects of propylene glycol or glycerol supplementation of the diet of dairy cows on feed intake, milk yield and composition, and incidence of ketosis. Can. J. Anim. Sci.  53: 289– 296. doi: https://doi.org/10.4141/cjas73-045 Google Scholar CrossRef Search ADS   Garton G. A. Lough A. K. Vioque E. 1961. Glyceride hydrolysis and glycerol fermentation by sheep rumen contents. J. Gen. Microbiol.  25: 215– 225. doi: https://doi.org/10.1099/00221287-25-2-215 Google Scholar CrossRef Search ADS PubMed  Goering H. K. Van Soest P. J. 1970. Forage fiber analyses (apparatus, reagents, procedures, and some applications). Agricultural Handbook No. 379, USDA, Washington DC. p. 1– 19. Greenfield R. B. Cecava M. J. Donkin S. S. 2000. Changes in mRNA expression for gluconeogenic enzymes in liver of dairy cattle during the transition to lactation. J. Dairy Sci.  83: 1228– 1236. doi: https://doi.org/10.3168/jds.S0022-0302(00)74989-7 Google Scholar CrossRef Search ADS PubMed  Guedes C. M. Gonçalves D. Rodrigues M. A. M. Dias-da-Silva A. 2008. Effects of a Saccharomyces cerevisiae yeast on ruminal fermentation and fibre degradation of maize silages in cows. Anim. Feed Sci. Technol.  145: 27– 40. doi: https://doi.org/10.1016/j.anifeedsci.2007.06.037 Google Scholar CrossRef Search ADS   Harris B. J. Webb D. W. 1990. The effect of feeding a concentrated yeast culture product to lactating dairy cows. J. Dairy Sci.  73: 266. Hippen A. R. DeFrain J. M. Linke P. L. 2008. Glycerol and other energy sources for metabolism and production of transition dairy cows. Proc. 19th Ruminant Nutrition Symposium. University of Florida, Gainesville, Florida. p. 1– 16. Hobson P. N. Mann S. O. 1961. The isolation of glycerol-fermenting and lipolytic bacteria from the rumen of the sheep. J. Gen. Microbiol.  25: 227– 240. doi: https://doi.org/10.1099/00221287-25-2-227 Google Scholar CrossRef Search ADS PubMed  Kalmus P. Orro T. Waldmann A. Lindjaerv R. Kask K. 2009. Effect of yeast culture on milk production and metabolic and reproductive performance of early lactation dairy cows. Acta Vet. Scand.  51: 32. doi: https://doi.org/10.1186/1751-0147-51-32 Google Scholar CrossRef Search ADS PubMed  Kenward M. G. Roger J. H. 1997. Small sample inference for fixed effects from restricted maximum likelihood. Biometrics  53: 983– 997. doi: https://doi.org/10.2307/2533558 Google Scholar CrossRef Search ADS PubMed  Krehbiel C. R. 2008. Ruminal and physiological metabolism of glycerin. J. Anim. Sci.  86( E-Suppl. 2): 392. Littell R. C. Henry P. R. Ammerman C. B. 1998. Statistical analysis of repeated measures data using SAS procedures. J. Anim. Sci.  76: 1216– 1231. Google Scholar CrossRef Search ADS PubMed  Liu J. Ye G. Zhou Y. Liu Y. Zhao L. Chen X. Huang D. Liao S. F. Huang K. 2014. Feeding glycerol-enriched yeast culture improves performance, energy status, and heat shock protein gene expression of lactating Holstein cows under heat stress. J. Anim. Sci.  92: 2494– 2502. doi: https://doi.org/10.2527/jas.2013-7152 Google Scholar CrossRef Search ADS PubMed  McSherry B. J. Maplesden D. C. Branion H. D. 1960. Ketosis in cattle – A review. Can. Vet. J.  1: 208– 213. Google Scholar PubMed  Miller-Webster T. Hoover W. H. Holt M. Nocek J. E. 2002. Influence of yeast culture on ruminal microbial metabolism in continuous culture. J. Dairy Sci.  85: 2009– 2014. doi: https://doi.org/10.3168/jds.S0022-0302(02)74277-X Google Scholar CrossRef Search ADS PubMed  NRC 2001. Nutrient requirements of dairy cattle. 7th rev. ed. Natl. Acad. Sci. Washington, DC. Petrescu I. Bojan O. Saied M. Barzu O. Schmidt F. Kuhnle H. F. 1979. Determination of phosphoenolpyruvate carboxykinase activity with deoxyguanosine 5'-diphosphate as nucleotide substrate. Anal. Biochem.  96: 279– 281. doi: https://doi.org/10.1016/0003-2697(79)90582-7 Google Scholar CrossRef Search ADS PubMed  Schröder A. Südekum K. 1999. Glycerol as a by-product of biodiesel production in diets for ruminants. In: New Horizons for an Old Crop. Proc. 10th Int. Rapeseed Congr., Canberra, Australia. p. 241. Seal C. J. Reynolds C. K. 1993. Nutritional implications of gastrointestinal and liver metabolism in ruminants. Nutr. Res. Rev.  6: 185– 208. doi: https://doi.org/10.1079/NRR19930012 Google Scholar CrossRef Search ADS PubMed  Wang C. Liu Q. Yang W. Z. Huo W. J. Dong K. H. Huang Y. X. Yang X. M. He D. C. 2009. Effects of glycerol on lactation performance, energy balance and metabolites in early lactation Holstein dairy cows. Anim. Feed Sci. Technol.  151: 12– 20. doi: https://doi.org/10.1016/j.anifeedsci.2008.10.009 Google Scholar CrossRef Search ADS   Wang Z. Eastridge M. L. Qiu X. 2001. Effects of forage neutral detergent fiber and yeast culture on performance of cows during early lactation. J. Dairy Sci.  84: 204– 212. doi: https://doi.org/10.3168/jds.S0022-0302(01)74470-0 Google Scholar CrossRef Search ADS PubMed  Westergaard N. Madsen P. Lundgren K. 1998. Characterization of glycerol uptake and glycerol kinase activity in rat hepatocytes cultured under different hormonal conditions. Biochim. Biophys. Acta  1402: 261– 268. doi: https://doi.org/10.1016/S0167-4889(98)00016-0 Google Scholar CrossRef Search ADS PubMed  Wildman E. E. Jones G. M. Wagner P. E. Boman R. L. Troutt H. F.Jr Lesch T. N. 1982. A dairy cow body condition scoring system and its relationship to selected production characteristics. J. Dairy Sci.  65: 495– 501. doi: https://doi.org/10.3168/jds.S0022-0302(82)82223-6 Google Scholar CrossRef Search ADS   Yameogo N. Ouedraogo G. A. Kanyandekwe C. Sawadogo G. J. 2008. Relationship between ketosis and dairy cows' blood metabolites in intensive production farms of the periurban area of Dakar. Trop. Anim. Health Prod.  40: 483– 490. doi: https://doi.org/10.1007/s11250-007-9124-z Google Scholar CrossRef Search ADS PubMed  Ye G. Zhu Y. Liu J. Chen X. Huang K. 2014. Preparation of glycerol-enriched yeast culture and its effect on blood metabolites and ruminal fermentation in goats. PLoS ONE  9: E94410. doi: https://doi.org/10.1371/journal.pone.0094410 Google Scholar CrossRef Search ADS PubMed  Footnotes 1 The project was supported by a science and technology support plan project of Jiangsu Province (grant number BE2011364), the Research Fund for Doctoral Program of Higher Education in China (20110097110014 and 20120097130002), the Priority Academic Program Development of Jiangsu Higher Education Institutions, and a research fund from Mississippi Agricultural and Forestry Experiment Station (grant number 027100351060). American Society of Animal Science
TI - Feeding glycerol-enriched yeast culture improves lactation performance, energy status, and hepatic gluconeogenic enzyme expression of dairy cows during the transition period
JF - Journal of Animal Science
DO - 10.2527/jas.2015-0021
DA - 2016-06-01
UR - https://www.deepdyve.com/lp/oxford-university-press/feeding-glycerol-enriched-yeast-culture-improves-lactation-performance-K0h1K8vrzR
SP - 2441
EP - 2450
VL - 94
IS - 6
DP - DeepDyve
ER -