TY - JOUR
AU - Gaskins, H. R.
AB - ABSTRACT Cultivation-independent microbial molecular ecology approaches were used to examine the effects of antibiotic growth promoters on the pig ileal microbiota. Five-week-old barrows were fitted with a simple T-cannula at the distal ileum. Three diets meeting or exceeding the minimum nutrient requirements were fed for 5 wk and supplemented as follows: 1) negative control (no antibiotic; n = 5), 2) continuous tylosin administration (n = 5), and 3) an antibiotic rotation sequence (wk 1, chlorotetracycline sulfathiazole penicillin; wk 2, bacitracin and roxarsone; wk 3, lincomycin; wk 4, carbadox; wk 5, virginiamycin; n = 5). Ileal luminal contents were collected for DNA isolation at the end of each of the 5 wk of the testing period. The V3 region of 16S rDNA was amplified by PCR and analyzed via denaturing gradient gel electrophoresis (DGGE) and quantitative polymerase chain reaction (qPCR). Resulting PCR-DGGE band numbers (bacterial species) were counted, and the banding patterns analyzed by calculating Sorenson's pairwise similarity coefficients (Cs), an index measuring bacterial species in common among samples. Band numbers and total bacterial DNA concentrations decreased (P < 0.05) temporally in antibiotic-treated pigs compared with controls. Comparisons between treatments yielded low intertreatment Cs indices, indicating treatment-dependent alterations in banding patterns, whereas intratreatment comparisons revealed increased homogeneity in antibiotic-treated vs. control pigs. Sequence analysis of treatment-specific bands identified three Lactobacillus, one Streptococcus, and one Bacillus species that were diminished with antibiotic rotation treatment, whereas tylosin selected for the presence of L. gasseri. Lactobacillus-specific qPCR was performed and analyzed as a percentage of total bacteria to further evaluate the effects of antibiotic administration on this genus. Total bacteria were decreased (P < 0.05) by tylosin and rotation treatments, whereas the percentage of lactobacilli increased (P < 0.05) by d 14 and through d 28 in tylosin-treated pigs. The decrease in total bacteria by antibiotics may reduce host-related intestinal or immune responses, which would divert energy that could otherwise be used for growth. Conversely, the ability of tylosin to improve animal growth may relate to its apparent selection for lactobacilli, commensals known to competitively exclude potentially pathogenic species from colonizing the intestine. Introduction The gastrointestinal tract of the pig harbors a dense and metabolically active microbiota comprised primarily of bacteria. The effect of the microbiota and its metabolic activities require special consideration when viewed in the context of pig production in which efficient animal growth is a primary objective. Pig intestinal microbiology research has focused on the colonic microbiota; however, the small intestine may deserve more attention due to its potential to compete with the pig for nutrients, its production of toxins, and by increasing the secretory demands placed on the intestine via enhanced mucus production (Gaskins, 2001). The therapeutic benefits of antibiotics via microbial inhibition are well known (Stokstad et al., 1949; Tollefson et al., 1997), and the beneficial effects of antibiotics on feed efficiency and growth rate have been demonstrated for all major livestock species (Hays, 1991). Four mechanisms have been suggested to underlie the effects of antibiotics on animal growth: 1) inhibition of subclinical infections, 2) reduction of growth-depressing microbial metabolites, 3) reduction of microbial use of nutrients, and 4) enhanced uptake of nutrients through a thinner intestinal wall (Francois, 1962; Visek, 1978; Anderson et al., 1999). Additional information on the effects of antimicrobial growth promoters on the pig intestinal microbiota is needed to distinguish the relative contribution of these mechanisms. The introduction of higher resolution molecular techniques has improved the analysis of complex microbial populations, such as the intestinal microbiota (Amann et al., 1995; Muyzer and Smalla, 1998; Muyzer et al., 1998; McCracken et al., 2001; Simpson et al., 1999). For example, 16S rDNA denaturing gradient gel electrophoresis (DGGE) is a PCR-based technique in which DNA is isolated from a mixed community sample and amplified using conserved 16S rDNA bacteria-domain primers. Here, PCR-DGGE and quantitative PCR (qPCR) of V3 16S rDNA were used to examine the in vivo effects of antibiotic treatment on the ileal microbiota of ileal-cannulated pigs. Materials and Methods Animals and Treatments. Fifteen crossbred pigs (BW = 13 ± 2 kg; PIC 326 sire line × C22 dams; PIC, Franklin, KY) surgically fitted with a simple T-cannula at the distal ileum according to procedures of Wubben et al. (2001) were housed in individual crates. Before use of halothane anesthesia, the pigs were sedated with an intramuscular mixture of TKX (telazol, tiletamine HCL, and zolazepan HCl; ketamine HCl; and xylazine HCl; all from Fort Dodge Animal Health, Fort Dodge, IA). All experimental procedures were approved by the University of Illinois Institutional Animal Care and Use Committee (Protocol No. 99373). After surgery, pigs were fed the control diet without antibiotic supplementation for 7 d before the initiation of the experiment. Pigs were initially fed on the basis of 0.09 × BW0.75, and the feeding level was increased 150 g in each subsequent week during the 5-wk experimental period. The pigs were fed twice daily (0800 and 2000; equal portions at each meal), one of three experimental diets (Table 1) over the 5-wk period. Water was provided for ad libitum consumption from a low-pressure drinking nipple. Table 1. Ingredient and chemical composition (%, as-fed basis) of the experimental diets   Treatment  Item  Control  Tylosin  Rotation  Ingredient, %  Corn  60.69  60.69  60.69  Soybean meal, 48%  24.75  24.75  24.75  Whey  3.00  3.00  3.00  Menhaden fish meal  2.50  2.50  2.50  Spray-dried blood cellsa  2.50  2.50  2.50  Fat  1.90  1.90  1.90  Sodium chloride  0.36  0.36  0.36  Dicalcium phosphate  1.45  1.45  1.45  Calcium carbonate  0.62  0.62  0.62  Trace mineral and vitamin premix  1.00  1.00  1.00  DL-Methionine  0.05  0.05  0.05  L-Lysine HCl  0.07  0.07  0.07  L-Threonine  0.04  0.04  0.04  Chromic oxide  0.30  0.30  0.30  Tylosinc  —  0.20  —  Rotational antibioticsd  —  —  0.50 to 0.75  Cornstarch  0.75  0.55  0 to 0.25  Analyzed composition, %      Dry matter  83.60  82.95  83.71      Nitrogen  3.36  3.40  3.38      Lysine  1.19  1.28  1.26      Threonine  0.81  0.84  0.82    Treatment  Item  Control  Tylosin  Rotation  Ingredient, %  Corn  60.69  60.69  60.69  Soybean meal, 48%  24.75  24.75  24.75  Whey  3.00  3.00  3.00  Menhaden fish meal  2.50  2.50  2.50  Spray-dried blood cellsa  2.50  2.50  2.50  Fat  1.90  1.90  1.90  Sodium chloride  0.36  0.36  0.36  Dicalcium phosphate  1.45  1.45  1.45  Calcium carbonate  0.62  0.62  0.62  Trace mineral and vitamin premix  1.00  1.00  1.00  DL-Methionine  0.05  0.05  0.05  L-Lysine HCl  0.07  0.07  0.07  L-Threonine  0.04  0.04  0.04  Chromic oxide  0.30  0.30  0.30  Tylosinc  —  0.20  —  Rotational antibioticsd  —  —  0.50 to 0.75  Cornstarch  0.75  0.55  0 to 0.25  Analyzed composition, %      Dry matter  83.60  82.95  83.71      Nitrogen  3.36  3.40  3.38      Lysine  1.19  1.28  1.26      Threonine  0.81  0.84  0.82  a AP-301, American Protein Corporation, Ames, IA. b Provided/kg diet: Cu, 235 mg; Mg, 284 mg; Zn, 150 mg; Fe, 150 mg; Mn, 50 mg; I, 1.2 mg; Se, 0.3 mg; vitamin A, 11,023 IU; vitamin E, 33 IU; vitamin D, 2,755 IU; vitamin K (menadione), 1.82 mg; vitamin B12, 33 μg; riboflavin, 6.6 mg; pantothenic acid, 26 mg; niacin, 88 mg; choline, 274 mg; thiamin, 2.2 mg; vitamin B6, 3.3 mg; folacin, 0.66 mg; and biotin, 110 μg. c Tylan-40, Elanco Animal Health, Indianapolis, IN. d Rotation pattern: 0.50% chloretetracycline sulfamethazine penicillin (CSP-250, Boehringer Ingelheim, St. Joseph, MO); 0.75% bacitracin-roxarsone (BMD/3-Nitro, Alpharma, Fort Lee, NJ); 0.75% lincomycin (Lincomycin 20, Upjohn, Kalamazoo, MI); 0.75% carbadox (Mecadox-10, Pfizer Animal Health, NY, NY); 0.75% virginiamycin (Stafac 20, Pfizer Animal Health, NY, NY). View Large Table 1. Ingredient and chemical composition (%, as-fed basis) of the experimental diets   Treatment  Item  Control  Tylosin  Rotation  Ingredient, %  Corn  60.69  60.69  60.69  Soybean meal, 48%  24.75  24.75  24.75  Whey  3.00  3.00  3.00  Menhaden fish meal  2.50  2.50  2.50  Spray-dried blood cellsa  2.50  2.50  2.50  Fat  1.90  1.90  1.90  Sodium chloride  0.36  0.36  0.36  Dicalcium phosphate  1.45  1.45  1.45  Calcium carbonate  0.62  0.62  0.62  Trace mineral and vitamin premix  1.00  1.00  1.00  DL-Methionine  0.05  0.05  0.05  L-Lysine HCl  0.07  0.07  0.07  L-Threonine  0.04  0.04  0.04  Chromic oxide  0.30  0.30  0.30  Tylosinc  —  0.20  —  Rotational antibioticsd  —  —  0.50 to 0.75  Cornstarch  0.75  0.55  0 to 0.25  Analyzed composition, %      Dry matter  83.60  82.95  83.71      Nitrogen  3.36  3.40  3.38      Lysine  1.19  1.28  1.26      Threonine  0.81  0.84  0.82    Treatment  Item  Control  Tylosin  Rotation  Ingredient, %  Corn  60.69  60.69  60.69  Soybean meal, 48%  24.75  24.75  24.75  Whey  3.00  3.00  3.00  Menhaden fish meal  2.50  2.50  2.50  Spray-dried blood cellsa  2.50  2.50  2.50  Fat  1.90  1.90  1.90  Sodium chloride  0.36  0.36  0.36  Dicalcium phosphate  1.45  1.45  1.45  Calcium carbonate  0.62  0.62  0.62  Trace mineral and vitamin premix  1.00  1.00  1.00  DL-Methionine  0.05  0.05  0.05  L-Lysine HCl  0.07  0.07  0.07  L-Threonine  0.04  0.04  0.04  Chromic oxide  0.30  0.30  0.30  Tylosinc  —  0.20  —  Rotational antibioticsd  —  —  0.50 to 0.75  Cornstarch  0.75  0.55  0 to 0.25  Analyzed composition, %      Dry matter  83.60  82.95  83.71      Nitrogen  3.36  3.40  3.38      Lysine  1.19  1.28  1.26      Threonine  0.81  0.84  0.82  a AP-301, American Protein Corporation, Ames, IA. b Provided/kg diet: Cu, 235 mg; Mg, 284 mg; Zn, 150 mg; Fe, 150 mg; Mn, 50 mg; I, 1.2 mg; Se, 0.3 mg; vitamin A, 11,023 IU; vitamin E, 33 IU; vitamin D, 2,755 IU; vitamin K (menadione), 1.82 mg; vitamin B12, 33 μg; riboflavin, 6.6 mg; pantothenic acid, 26 mg; niacin, 88 mg; choline, 274 mg; thiamin, 2.2 mg; vitamin B6, 3.3 mg; folacin, 0.66 mg; and biotin, 110 μg. c Tylan-40, Elanco Animal Health, Indianapolis, IN. d Rotation pattern: 0.50% chloretetracycline sulfamethazine penicillin (CSP-250, Boehringer Ingelheim, St. Joseph, MO); 0.75% bacitracin-roxarsone (BMD/3-Nitro, Alpharma, Fort Lee, NJ); 0.75% lincomycin (Lincomycin 20, Upjohn, Kalamazoo, MI); 0.75% carbadox (Mecadox-10, Pfizer Animal Health, NY, NY); 0.75% virginiamycin (Stafac 20, Pfizer Animal Health, NY, NY). View Large The diets (Table 1) were formulated to meet or exceed the nutrient requirements of pigs 15 to 35 kg in weight as outlined by NRC (1988), and included the following. 1) A control diet without antibiotics (n = 5); 2) a continuous supplementation of the macrolide antibiotic tylosin phosphate (Elanco Animal Health, Greenfield, IN; inhibits protein synthesis in gram-positive bacteria) at 40 g/ton, as per the manufacturer's recommended dose for growth promotion (n = 5); and 3) a weekly antibiotic rotation diet (n = 5) as follows: wk 1, 250 g/ton chlorotetracycline sulfathiazole penicillin (CSP-250; Boehringer Ingelheim, St. Joseph, MO; inhibits gram-positive cell wall synthesis); wk 2, 30 g/ton bacitracin (inhibits gram-positive cell wall synthesis) + 4 g/ton of the anticoccidial roxarsone (BMD/3-Nitro, Alpharma, Fort Lee, NJ); wk 3, 20 g/ton lincomycin (Upjohn, Kalamazoo, MI; inhibits gram-positive protein snythesis); wk 4, 25 g/ton carbadox (Mecadox-10, Pfizer Animal Health, NY, NY; broad-spectrum DNA synthesis inhibitor); and wk 5, 10 g/ton virginiamycin (Stafac 20, Pfizer Animal Health; inhibits gram-positive protein synthesis). Each experimental period lasted 7 d, and ileal digesta collection occurred on d 7 of each period. Digesta were collected continuously from 0800 to 2000 via the T-cannula into polyethylene tubing (5 cm × 25 cm; Rand Materials Handling Equipment, Pawtucket, RI) that was emptied every hour into plastic containers and stored at −20°C until the end of collection, at which time they were stored at −80°C until analysis. All pigs were necropsied at d 35, when luminal contents were taken directly from a 2-cm section excised from the mid-ileum (defined by continuous Peyer's patch), which was slightly anterior of the cannulation site. All samples were snap-frozen in liquid nitrogen and stored at −80°C until analysis. Genomic DNA Extraction. Genomic DNA was isolated from all ileal samples from 200 mg of luminal contents using a previously described phenol extraction method (Tsai and Olsen, 1992; Wilson and Blitchington, 1996). PCR-DGGE. For PCR-DGGE analysis of total bacteria, each DNA sample was standardized to 20 μg/mL and then amplified using primers specific for conserved sequences flanking the variable V3 region of 16S rDNA (341F: 5′ CACGGG GGGGCCTACGGGAGGCAGCAG 3′ + 5′ 40 nucleotide GC clamp and 534R: 5′ ATTACCGCGGTGCTGG 3′), as described previously (Muyzer et al., 1998). To reduce spurious PCR products, touchdown PCR was performed as described by Muyzer and Smalla (1988). After visual confirmation of the PCR products with agarose gel electrophoresis, DGGE was performed using the Bio-Rad D-code system (Hercules, CA) as described previously (Simpson et al., 1999). To separate PCR fragments, 35 to 60% linear DNA-denaturing gradients (100% denaturant is equivalent to 7 mol/L urea and 40% deionized formamide) were formed in 8% polyacrylamide gels using a Bio-Rad Gradient Former. Bacterial V3 16S PCR products were loaded in each lane and electrophoresis performed at 60°C at 150 V for 2 h and then for 1 h at 200 V. Additionally, bacterial reference ladders representing known bacterial strains were loaded to allow standardization of band migration and gel curvature among different gels (Simpson et al., 1999). The reference ladder comprised the following species, listed in order from the top of the gel to the bottom: Bacteroides fragilis, B. thetaiotaomicron, Desulfovibrio vulgaris, Streptococcus bovis, Escherichia coli, Ruminococcus albus 7, D. desulfuricans, Clostridium perfringens, R. albus 8, and Fibrobacter succinogenes. After electrophoresis, gels were silver-stained and scanned using a GS-710 calibrated imagining densitometer (BioRad). Each individual amplicon was then visualized as a distinct band representing at least one bacterial species on the gel. When antibiotic-dependent differences in PCR-DGGE banding profiles were observed, distinguishing bands were excised, reamplified as described for PCR-DGGE, cloned using a TOPO TA cloning kit (InVitrogen, Carlsbad, CA), and sequenced using an automated sequencing system (Applied Biosystems, Foster City, CA) at the W. M. Keck Center for Comparative and Functional Genomics, University of Illinois Biotechnology Center (Urbana, IL). Sequence data were analyzed using Sequencher 3.0 (Gene Codes, Ann Arbor, MI) and a basic local alignment search tool (http://www.ncbi.nlm.nih.gov/BLAST/) search was performed to identify sequences. Estimates of Microbial Richness and Diversity. Diversity Database (Version 2.1) of the “Discovery Series” (BioRad) was used to analyze PCR-DGGE banding patterns by measuring migration distance and intensity of the bands within each lane of a gel (Simpson et al., 2000). This information was then used to analyze banding patterns via measures of community diversity, including band number and Sorenson's pairwise similarity (Cs) (Sneath and Sokal, 1973; Magurran, 1988). These indices measure ecological diversity using such parameters as species richness (the number of different species) and evenness (the distribution of individual species in the ecosystem) (Magurran, 1988). Band number corresponds to the number of individual bands in a single gel lane. Sorenson's pairwise similarity coefficient Cs, sometimes referred to as the dice coefficient, is a similarity index used to compare species composition of different ecosystems (Sheehan, 1984; Magurran, 1988; Gillan et al., 1998). Two identical profiles create a Cs value of 100%, whereas completely different profiles (no common bands) result in a Cs value of 0%. For this comparison, the banding pattern for each sample was compared to the other members in the same treatment group (intragroup) and to each other group (intergroup), allowing comparisons of ileal bacterial populations. Analysis of Lactobacillus sp. Colonization by Real-Time Quantitative PCR. A quantitative real-time PCR-based method was developed to specifically measure lactobacilli concentrations in the luminal contents of the pig ileum. Genomic DNA from ileal lumen samples were used as templates for PCR amplification in a GeneAmp 5700 Sequence Detection System (Applied Biosystems) using a Lactobacillus sp.-specific 16S rDNA primer (Lab-0159; GGAAACAG(A/G)TGCTAATACCG 3′), together with a universal primer (Univ-0515; ATCGTATTACCGCGGCTGCTGGCA 3′; Heilig et al., 2002). To assess the total concentration of bacterial DNA, 16S V3 rDNA fragments were amplified with the 534R and 341F primers without the additional 5′ 40 nucleotide GC clamp. The standard amplification protocol of Deplancke et al. (2002) was followed. However, for the amplification of the 356-bp rDNA fragment of lactobacilli, the elongation step was changed from 76° for 1 m to 72° for 1 m. Amplificativon was performed in a 25-μL final volume containing 2× SYBR Green PCR Master Mix (Applied Biosystems), 0.5 μM (each) primer, and 5 μL DNA template. For both primer sets, a standard curve was generated with Lactobacillus genomic DNA. The DNA concentrations used were, respectively, 10, 100, and 1000 pg/μL, and these concentrations were plotted against the CT value. The CT value represents the threshold cycle, or the PCR cycle at which an increase in fluorescence from SYBR Green, generated via the binding of SYBR Green to double-stranded DNA, above a baseline signal (derived from samples without DNA template) can first be detected. The GeneAmp 5700 Sequence Detection System (Applied Biosystems) then generates a standard curve vs. log DNA concentration for all standards and determines the DNA concentration of unknowns by interpolation. All standards and unknowns from mucosal and luminal contents from the ileum are expressed as the average percentage of Lactobacillus sp. rDNA relative to total bacterial rDNA. Statistical Analysis. Analysis of diversity and similarity indices was performed using SAS (Version 6.09; SAS Institute, Cary, NC). The General Linear Model procedure was used to compare differences according to antibiotic treatment for all indices. Specific antibiotic treatment effects were determined by the least significant difference test with an assigned P-value of <0.05. Results Comparison of Ileal Bacterial Diversity via 16S rDNA PCR-DGGE. Ileal samples collected from individual pigs on d 0, 7, 14, 21, 28, and 35 of antibiotic treatment were used for PCR-DGGE of the V3 region of 16S rDNA.. Each gel contained all samples from the three treatments for each day. Results from d 14 are presented in Figure 1 as a representative gel image. Diversity Database software was used to analyze PCR-DGGE banding patterns. The effects of antibiotic regimen on numbers of 16S rDNA PCR-DGGE bands (amplicons) in each sample were compared (Figure 2). By d 7 (wk 1), band numbers did not differ (P > 0.05) between treatment groups and did not differ from d 0 (P > 0.05). By d 14, fewer (P < 0.05) bands were observed for pigs treated with tylosin and rotation compared to the control group. Further, band numbers at d 14 for tylosin- and rotation-treated animals were lower (P < 0.05) than on d 0 and 7 in their respective treatments. The number of bands in tylosin-treated pigs then increased such that band numbers were not different (P > 0.05) between the tylosin and control treatments by d 21 (after 3 wk of treatment) and continuing to d 35. However, the number of bands continued to be lower (P < 0.05) at d 28 and 35 in rotation-treated pigs than in control pigs. The number of bands in control pigs remained constant (P > 0.05) throughout the 5-wk period (Figure 2). Figure 1. View largeDownload slide Analysis of antibiotic-dependent alterations of ileal microbial profiles. Denaturing gradient gel electrophoresis (DGGE) profile generated from PCR amplified V3-16S rDNA from pig ileal bacterial populations at d 14. Microbial DNA was isolated from luminal samples collected from ileal-cannulated pigs from each treatment group (n = 5), and PCR-DGGE performed as described in Materials and Methods. Lanes are marked across the top according to administration of: tylosin (T); antibiotic rotation (R); control (C); no sample (x); and reference ladder (L). Lanes are marked across the bottom with pig number. Letters A through E indicate bands differentially present in specific treatments. A, L. gasseri; B, L. johnsonii; C, S. infantarius; D, L. crispatus; E, Bacillus species; and F, Lactobacillus species. Figure 1. View largeDownload slide Analysis of antibiotic-dependent alterations of ileal microbial profiles. Denaturing gradient gel electrophoresis (DGGE) profile generated from PCR amplified V3-16S rDNA from pig ileal bacterial populations at d 14. Microbial DNA was isolated from luminal samples collected from ileal-cannulated pigs from each treatment group (n = 5), and PCR-DGGE performed as described in Materials and Methods. Lanes are marked across the top according to administration of: tylosin (T); antibiotic rotation (R); control (C); no sample (x); and reference ladder (L). Lanes are marked across the bottom with pig number. Letters A through E indicate bands differentially present in specific treatments. A, L. gasseri; B, L. johnsonii; C, S. infantarius; D, L. crispatus; E, Bacillus species; and F, Lactobacillus species. Figure 2. View largeDownload slide The effect of antibiotic treatment on the number of V3-16S rDNA PCR-DGGE bands in ileal samples from pigs fed tylosin, rotation, or control diets (n = 5/treatment). Each band represents at least one bacterial species. The number of bands associated with each treatment were counted and averaged per d 0, 7, 14, 21, 28, and 35. Values not sharing a common letter are different (P < 0.05). Figure 2. View largeDownload slide The effect of antibiotic treatment on the number of V3-16S rDNA PCR-DGGE bands in ileal samples from pigs fed tylosin, rotation, or control diets (n = 5/treatment). Each band represents at least one bacterial species. The number of bands associated with each treatment were counted and averaged per d 0, 7, 14, 21, 28, and 35. Values not sharing a common letter are different (P < 0.05). The effects of tylosin and antibiotic rotation on ileal lumen 16S rDNA banding patterns were further assessed by comparisons of Sorenson's pairwise similarity coefficients (Cs), as presented in Figure 3. Intragroup Cs values (comparison across samples within a treatment; Figure 3A) did not differ (P > 0.05) between treatments at d 0 or 7. At d 14, and continuing through d 28, the intragroup Cs values of tylosin- and rotation-treated pigs were greater (P < 0.05) than those of control, but did not differ (P > 0.05) from each other, indicating that antibiotic treatment increased the homogeneity of ileal microbial populations. At d 0 and 7, Cs values for intergroup comparisons of samples across treatments did not differ (P > 0.05) from each other (Figure 3B). At d 14 and 21, Cs values based on comparisons of tylosin and antibiotic rotation treatments vs. the controls were both lower (P < 0.05) than the intergroup comparison between tylosin and antibiotic rotation treatments, indicating that the microbiota was similar between the antibiotic treatments but different from the controls. At d 28 and 35, Cs values based on intergroup comparisons between antibiotic rotation samples vs. both control- and tylosin-fed pigs were decreased (P < 0.05) relative to the comparisons between tylosin vs. control treatments. Therefore, antibiotic rotation continued to select for a unique microbiota from that of the controls at d 28 and 35 whereas tylosin did not. Figure 3. View largeDownload slide Sorenson's similarity indices (Cs) were used to compare average percent similarities of 16S rDNA PCR-DGGE banding patterns (the average number of bands in common) within (intra-) each treatment group and for intergroup comparisons. Values represent averages and SEM for 5 pigs from each experimental treatment from d 7, 14, 21, 28, and 35 of the antibiotic treatment period. (A) Intragroup: tylosin; rotation; and control. (B) Intergroup: C vs. T, control vs. tylosin; C vs. R, control vs. rotation; T vs. R, tylosin vs. rotation. Values that do not have common letter within each day differ (P < 0.05). Figure 3. View largeDownload slide Sorenson's similarity indices (Cs) were used to compare average percent similarities of 16S rDNA PCR-DGGE banding patterns (the average number of bands in common) within (intra-) each treatment group and for intergroup comparisons. Values represent averages and SEM for 5 pigs from each experimental treatment from d 7, 14, 21, 28, and 35 of the antibiotic treatment period. (A) Intragroup: tylosin; rotation; and control. (B) Intergroup: C vs. T, control vs. tylosin; C vs. R, control vs. rotation; T vs. R, tylosin vs. rotation. Values that do not have common letter within each day differ (P < 0.05). Antibiotic-Specific 16S rDNA PCR-DGGE Bands. Six 16S rDNA-V3 bands determined by visual inspection to be differentially affected by tylosin or antibiotic rotation treatments were excised from d 7, 14, 21, and 28 PCR-DGGE gels harboring ileal luminal samples, and sequenced for phylogenetic identification (representative bands labeled in Figure 1). Several PCR-DGGE bands occurred more frequently in certain treatment groups (summarized in Table 2). For example, L. gasseri was present at d 7 in four of the five tylosin-treated pigs but not detected in rotation and control-fed pigs. Bands identified in control samples as L. crispatus (d 28 to 35) and an unknown Lactobacillus sp. (d 21 to 35) were not detected in three of the five pigs treated with tylosin, and three of the five pigs treated with the antibiotic rotation. Lactobacillus johnsonii (d 28 to 35), Streptococcus infantarius (d 21 to 35) and a Bacillus sp. (d 28 to 35) were absent in three of five pigs treated with the antibiotic rotation but present in controls. Table 2. PCR-denaturing gradient gel electrophoresis (DGGE) detection of bacteria modulated by antibiotic administration Bacteriaa  Similarityb  Treatmentcd  Day (gel)e  Resultf  (A) L. gasseri  98.6  4 T  7 only  Increase  (B) L. johnsonii  97.4  4 R  14  Decrease  (C) S. infantarius  97.7  4 R  21  Decrease  (D) L. crispatus  98.2  3T, 4R  28  Decrease  (E) Bacillus sp.  97.1  3 R  28  Decrease  (F) Lactobacillus sp.  98.1  4T, 4R  21  Decrease  Bacteriaa  Similarityb  Treatmentcd  Day (gel)e  Resultf  (A) L. gasseri  98.6  4 T  7 only  Increase  (B) L. johnsonii  97.4  4 R  14  Decrease  (C) S. infantarius  97.7  4 R  21  Decrease  (D) L. crispatus  98.2  3T, 4R  28  Decrease  (E) Bacillus sp.  97.1  3 R  28  Decrease  (F) Lactobacillus sp.  98.1  4T, 4R  21  Decrease  a Corresponding bacteria sequenced from 16S rDNA PCR-DGGE gel shown in Figure 1. b Percent similarity of cloned PCR-DGGE band shown in Figure 1, via basic local alignment search tool analysis of the 16S rDNA database (http://www.ncbi.nlm.nih.gov/BLAST). c Number of animals (n = 5/treatment) exhibiting specific treatment effect. d Treatment: T, tylosin; R, rotation. e The gel and corresponding experimental day from which the affected amplicon was first detected. Unless noted, these effects continued through the remainder of the experiment. f Observed increase or decrease of bacterial presence compared to controls. View Large Table 2. PCR-denaturing gradient gel electrophoresis (DGGE) detection of bacteria modulated by antibiotic administration Bacteriaa  Similarityb  Treatmentcd  Day (gel)e  Resultf  (A) L. gasseri  98.6  4 T  7 only  Increase  (B) L. johnsonii  97.4  4 R  14  Decrease  (C) S. infantarius  97.7  4 R  21  Decrease  (D) L. crispatus  98.2  3T, 4R  28  Decrease  (E) Bacillus sp.  97.1  3 R  28  Decrease  (F) Lactobacillus sp.  98.1  4T, 4R  21  Decrease  Bacteriaa  Similarityb  Treatmentcd  Day (gel)e  Resultf  (A) L. gasseri  98.6  4 T  7 only  Increase  (B) L. johnsonii  97.4  4 R  14  Decrease  (C) S. infantarius  97.7  4 R  21  Decrease  (D) L. crispatus  98.2  3T, 4R  28  Decrease  (E) Bacillus sp.  97.1  3 R  28  Decrease  (F) Lactobacillus sp.  98.1  4T, 4R  21  Decrease  a Corresponding bacteria sequenced from 16S rDNA PCR-DGGE gel shown in Figure 1. b Percent similarity of cloned PCR-DGGE band shown in Figure 1, via basic local alignment search tool analysis of the 16S rDNA database (http://www.ncbi.nlm.nih.gov/BLAST). c Number of animals (n = 5/treatment) exhibiting specific treatment effect. d Treatment: T, tylosin; R, rotation. e The gel and corresponding experimental day from which the affected amplicon was first detected. Unless noted, these effects continued through the remainder of the experiment. f Observed increase or decrease of bacterial presence compared to controls. View Large Quantification of Lactobacillus sp. in Ileal Contents. A quantitative real-time, PCR-based method was used to specifically measure total Lactobacillus concentrations as a percentage of total bacteria (Figure 4). Both Lactobacillus-specific and the bacterial-specific primers yielded one band of the correct size, respectively, 356 bp for Lactobacillus amplicons and 220 bp for bacteria-specific amplicons when visualized on an agarose gel (Figure 4A). Regression values for the Lactobacillus-specific primers and the bacterial primer set when log DNA concentrations were plotted against CT values were both 0.99 as determined by serial dilution of Lactobacillus DNA in the concentration range of 10 to 1000 pg/μL. Total 16S rDNA bacterial populations were diminished (P < 0.05) by tylosin and antibiotic rotation treatments relative to controls at d 14 and 21 (Figure 4B). The antibiotic rotation continued to suppress the total bacterial population at d 28 and 35, whereas tylosin did not (Figure 4C). The percentage of Lactobacillus species was greater (P < 0.05) in tylosin-treated pigs at d 14 through 35 relative to rotation-treated and control pigs (Figure 4D). Figure 4. View largeDownload slide Quantitative PCR assay of bacterial V3-16S rDNA in ileal DNA isolated from pigs fed either tylosin, rotation, or control diets. (A) Gel electrophoresis of 356-bp quantitative real-time PCR amplicons generated from genomic DNA derived from a mixed culture of lactobacilli. The PCR amplicons in Lanes 1 to 3 were generated from, respectively, 10-fold serial dilutions of genomic lactobacilli DNA. M corresponds to a 1-kb ladder (Gibco BRL, Rockville, MD). (B) DNA concentrations (10, 100, and 1,000 pg/mL) were plotted against the CT value, which represents the threshold cycle or the PCR cycle at which an increase in fluorescence above a baseline signal (derived from samples without DNA template) can first be detected. The GeneAMp 5700 sequence detection system then generates a standard curve vs. log DNA concentration for all standards and determines the DNA concentration of unknowns by interpolation. (C) Total bacterial DNA concentrations vs. CT (threshold PCR cycle). (D) qPCR analysis of the concentration of lactobacilli expressed as a percentage of total bacterial 16S rDNA. Values that do not have a common letter differ (P < 0.05). Figure 4. View largeDownload slide Quantitative PCR assay of bacterial V3-16S rDNA in ileal DNA isolated from pigs fed either tylosin, rotation, or control diets. (A) Gel electrophoresis of 356-bp quantitative real-time PCR amplicons generated from genomic DNA derived from a mixed culture of lactobacilli. The PCR amplicons in Lanes 1 to 3 were generated from, respectively, 10-fold serial dilutions of genomic lactobacilli DNA. M corresponds to a 1-kb ladder (Gibco BRL, Rockville, MD). (B) DNA concentrations (10, 100, and 1,000 pg/mL) were plotted against the CT value, which represents the threshold cycle or the PCR cycle at which an increase in fluorescence above a baseline signal (derived from samples without DNA template) can first be detected. The GeneAMp 5700 sequence detection system then generates a standard curve vs. log DNA concentration for all standards and determines the DNA concentration of unknowns by interpolation. (C) Total bacterial DNA concentrations vs. CT (threshold PCR cycle). (D) qPCR analysis of the concentration of lactobacilli expressed as a percentage of total bacterial 16S rDNA. Values that do not have a common letter differ (P < 0.05). Discussion Results from PCR-DGGE and qPCR of V3-16S rDNA demonstrate that tylosin and the antibiotic rotation initially reduced and homogenized the pig ileal microbiota with specific alterations observed in lactobacillus, bacillus, and streptococcal species. These effects continued throughout the experiment for pigs administered the antibiotic rotation. However, beginning at d 21, tylosin-treated pigs were indistinguishable from controls in terms of microbial homogeneity and the concentration of total bacteria. From d 14, the total lactobacilli concentration as a percentage of total bacteria was greater in tylosin-treated relative to antibiotic rotation and control pigs. These microbial alterations provide evidence for mechanisms by which antibiotics may enhance animal growth. Ileal bacterial concentrations, as estimated by 16S rDNA qPCR of total bacteria (1.5 × 109 per gram of contents), were similar to those reported previously for culturable bacteria from the last third of the pig small intestine (Jensen and Jørgensen, 1994). Here, tylosin and the antibiotic rotation both initially decreased total bacterial populations and selected for an ileal microbiota that was relatively homogeneous among similarly treated pigs and distinct from the microbiota of control pigs. These effects reflect, in part, a selection against three Lactobacillus species as well as a Bacillus and a Streptococcus species. Similar results were demonstrated via 16S rDNA PCR-DGGE and culture-based analyses by Knarreborg et al. (2002), whereby they determined that lactobacilli were among the bacterial groups most often diminished by antibiotic administration. Lactobacilli and streptococci are thought to predominate in the upper small intestine, whereas the distal small intestine (ileum) maintains a more diverse microbiota (Fewins, 1957). Therefore, due to the prevalence of lactobacilli and streptococci within the small intestine where the majority of nutrient absorption occurs, the alteration of these bacteria is a potentially important mechanism whereby antibiotics affect animal growth. Also, the antibiotic-induced homogenization of the microbiota observed here may explain, in part, the homogenized growth performance commonly observed in animals fed antimicrobial growth promoters (Schwarz et al., 2001). At the least, the data indicate the need to determine the extent to which microbial populations vary among individual pigs throughout the production life cycle, relative to growth performance. Microbial homogenization may ultimately prove to be a target mechanism for alternatives to antimicrobial growth promoters. However, the PCR-DGGE procedure used here is limited to threshold detection limits of at least 107 to 108 cfu (Simpson et al., 1999). The PCR amplicons of multiple organisms may also migrate to the same position on the gel, resulting in a single band (Simpson et al., 1999). Based on these limitations, other potentially important antibiotic effects may not have been detected. Previous culture-based studies have demonstrated that small intestinal bacteria compete with the host for energy and amino acids while also producing toxic metabolites, such as vasoactive amines, ammonia, phenols, and indoles (Hedde and Lindsey, 1986; Macfarlane and Macfarlane, 1997). For example, bacterial use of glucose produces lactic acid, which reduces the energy available to the host epithelium, resulting in a loss of as much as 6% of the net energy in pig diets (Vervaeke et al., 1979; Saunders and Sillery, 1982). Additionally, bacterial lactate production increases the rate of nutrient transit through the intestine by increasing peristalsis (Saunders and Sillery, 1982). Dietary energy can also be lost via deconjugation and dehydroxylation of bile by microbial bile salt hydrolase (BSH) production, resulting in impaired lipid absorption by the host animal and production of toxic secondary bile salts (De Somer et al., 1963; Eyssen, 1973; De Boever, 2000). Indeed, the inhibition of bile acid biotransformation in the gut is proposed as an important mechanism whereby antibiotics enhance animal growth (Visek, 1978; Feighner and Dashkevicz, 1987, 1988). Lactobacilli may be largely responsible for intestinal BSH activity (De Smet et al., 1995). Specifically, BSH activity in ileal contents of conventional mice was decreased 86% by the elimination of lactobacilli from the microbiota (Tannock et al., 1989). Therefore, nutrient availability may be improved with a concomitant decrease in toxic metabolites derived from microbial metabolism in antibiotic-treated pigs. The antibiotic rotation regimen continually suppressed the growth of the small intestinal microbiota in general, including several gram-positive species as identified from the present sequence analysis. This outcome increased microbial homogeneity in the small intestine of pigs treated with the antibiotic rotation. Tylosin also decreased total bacterial concentrations after 2 wk of treatment and through d 21; however, this effect did not continue through d 35. The latter outcome may reflect the replacement of antibiotic-susceptible strains with antibiotic-resistant organisms (Onishi et al., 1974; Morelli et al., 1988; Baquero et al., 1998). Chronic subtherapeutic tylosin administration to pigs resulted in tylosin resistance and also cross-resistance to other macrolides, lincosamidines, and streptogramines (Knothe, 1977). Antibiotics not only select for resistant strains, but can also independently facilitate the transfer of resistance genes to other bacteria (Salyers and Shoemaker, 1996). Cumulatively, these effects can diminish the effectiveness of therapeutic antibiotic use, and, therefore, the potential selection for and transferal of antibiotic-resistant organisms from the pig to humans remains a critical concern. The qPCR data also indicate that although tylosin decreased total bacterial populations, the concentration of lactobacilli as a percentage of total bacteria was greater in tylosin-treated than control and antibiotic rotation-treated pigs. Similar results were observed in young chicks fed 100 ppm tylosin in which L. gasseri was found only in tylosin-treated birds (Collier et al., 2003). Although tylosin is generally effective against gram-positive bacteria (O'Connor, 1980; Lawrence, 1998), L. gasseri has been found to be particularly resistant to tylosin but still susceptible to virginiamycin (Nagaraja and Taylor, 1987; Felton et al., 1999). Virginiamycin was administered during the second week of the rotation treatment in the present study, potentially explaining the differential effects of the antibiotic rotation vs. tylosin on Lactobacillus population density. The apparent selection of lactobacilli by tylosin is particularly intriguing due to growing interest in and clear justification for the use of lactobacilli as probiotics, despite their potentially detrimental effects on the host (McCracken and Gaskins, 1999; Reid, 1999; Reid et al., 2003). Probiotics suppress the growth of pathogenic bacteria by actively consuming limiting nutrients and via the production of multiple bacteriocins (Cleveland et al., 2001). Also, although potentially energetically costly for the host, Lactobacillus-mediated mucus production enhances the epithelial barrier against pathogenic organisms (Mack et al., 1999; Madsen et al., 2001). Implications These data indicate that antimicrobial growth promoters may improve pig performance, in part, by decreasing bacterial colonization of the small intestine. Thus, the composition of the pig microbiota needs to be further defined within each intestinal region during each production phase and as affected by the genetic background of the host. The results of this study also support the concept that antibiotic alternatives might ideally promote the growth of beneficial commensal bacteria, while suppressing those that are deleterious. Literature Cited Amann, R. I., W. Ludwig, and K. H. Schleifer 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev.  59: 143– 169. Google Scholar PubMed  Anderson, D. B., V. J. McCracken, R. I. Aminov, J. M. Simpson, R. I. Mackie, M. W. A. Verstegen, and H. R. Gaskins 1999. Gut microbiology and growth-promoting antibiotics in swine. Nutr. Abstr. Rev., Series B.  70: 101– 108. Baquero, F., M. C. Negri, M. I. Morosini, and J. Blasquez 1998. Antibiotic-selective environments. Clin. Infect. Dis.  27: S5– S11. Google Scholar CrossRef Search ADS PubMed  Cleveland, J., T. J. Montville, I. F. Nes, and M. L. Chikindas 2001. Bacteriocins: Safe, natural antimicrobials for food preservation. Int. J. Food Microbiol.  71: 1– 20. Google Scholar CrossRef Search ADS PubMed  Collier, C. T., J. D. van der Klis, B. Deplancke, D. B. Anderson, and H. R. Gaskins 2003. The effects of tylosin on bacterial mucolysis, Clostridium perfringens colonization, and intestinal barrier function in a chick model of necrotic enteritis. Antimicrob. Agents Chemother.  47: 3311– 3317. Google Scholar CrossRef Search ADS PubMed  De Boever, P., R. Wouters, L. Verschaeve, P. Berckmans, G. Schoeters, and W. Verstraete 2000. Protective effect of the bile salt hydrolase-active Lactobacillus reuteri against bile salt cytotoxicity. Appl. Microbiol. Biotechnol.  53: 709– 714. Google Scholar CrossRef Search ADS PubMed  De Somer, P., H. Eyssen, and E. Evard 1963. The influence of antibiotics on fecal fats in chickens. Pages 84–90 in Biochemical Problems of Lipids.  A. C. Frazer ed. Elsevier/North Holland Publishing Co., Amsterdam. Deplancke, B., O. Vidal, D. Ganessunker, S. M. Donovan, R. I. Mackie, and H. R. Gaskins 2002. Selective growth of mucolytic bacteria including Clostridium perfringens in a neonatal piglet model of total parenteral nutrition. Am. J. Clin. Nutr.  76: 1117– 1125. Google Scholar CrossRef Search ADS PubMed  De Smet, I., L. Van Hoorde, M. Vande Woestyne, H. Christiaens, and W. Verstraete 1995. Significance of bile salt hydrolytic activities of lactobacilli. J. Appl. Bacteriol.  79: 292– 301. Google Scholar CrossRef Search ADS PubMed  Eyssen, H. 1973. Role of gut microflora in metabolism of lipids and sterols. Proc. Nutr. Soc.  32: 59– 63. Google Scholar CrossRef Search ADS PubMed  Feighner, S. D., and M. P. Dashkevicz 1987. Subtherapeutic levels of antibiotics in poultry feeds and their effects on weight gain, feed efficiency, and bacterial cholyltaurine hydrolase activity. Appl. Environ. Microbiol.  53: 331– 336. Google Scholar PubMed  Feighner, S. D., and M. P. Dashkevicz 1988. Effect of dietary carbohydrates on bacterial cholyltaurine hydrolase in poultry intestinal homogenates. Appl. Environ. Microbiol.  54: 337– 342. Google Scholar PubMed  Fewins, B. G., L. G. M. Newland, and C. A. E. Briggs 1957. The normal intestinal flora of the pig. Qualitative studies of lactobacilli and streptococci. J. Appl. Bacteriol.  20: 324. Google Scholar CrossRef Search ADS   Francois, A. C. 1962. Mode of action of antibiotics on growth. World Rev. Nutr. Diet.  3: 21. Gaskins, H. R. 2001. Intestinal bacteria and their influence on swine growth. Pages 585–608 in Swine Nutrition.  A. J. Lewis and L. L. Southern ed. CRC Press, Boca Raton, FL. Google Scholar CrossRef Search ADS   Gillan, D. C., A. G. C. L. Speksnijder, G. Zwart, and C. Deridder 1998. Genetic diversity of the biofilm covering Montacuta ferruginosa (Mollusca, Bivalvia) as evaluated by denaturing gradient gel electrophoresis analysis and cloning of PCR-amplified gene fragments coding for 16S rRNA. Appl. Environ. Microbiol.  64: 3464– 3472. Google Scholar PubMed  Hays, V. W. 1991. Effects of antibiotics. Pages 299–320 in Growth Regulation in Farm Animals.  Advances in Meat Research. Vol. 7. A. M. Pearson and T. R. Dutson ed. Elsevier Applied Science, New York. Hedde, R. D., and T. O. Lindsey 1986. Virginiamycin: A nutritional tool for swine production. Agri-Practice  7, No. 3, 4. Heilig, H. G., E. G. Zoetendal, E. E. Vaughan, P. Marteau, A. D. Akkermans, and W. M de Vos 2002. Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA. Appl. Environ. Microbiol.  68: 114– 123. Google Scholar CrossRef Search ADS PubMed  Jensen, B. B., and H. Jørgensen 1994. Effect of dietary fiber on microbial activity and microbial gas production in various regions of the gastrointestinal tract of pigs. Appl. Environ. Microbiol.  60: 1897– 1904. Google Scholar PubMed  Knarreborg, A., M. A. Simon, R. M. Engberg, B. B. Jensen, and G. W. Tannock 2002. Effects of dietary fat source and subtherapeutic levels of antibiotic on the bacterial community in the ileum of broiler chickens at various ages. Appl. Environ. Microbiol.  68: 5918– 5924. Google Scholar CrossRef Search ADS PubMed  Knothe, H. 1977. A review of the medical considerations of the use of tylosin and other macrolide antibiotics as additives in animal feeds. Infection  5: 183– 187. Google Scholar CrossRef Search ADS PubMed  Lawrence, K. 1998. Growth promoters in swine.  Pages 337–343 in Proc. 15th International Pig Veterinary Society, Birmingham, England. Leser, T. D., R. Lindecrona, B. B. Jensen, and K. Moller 2000. Changes in bacterial community structure in the colon of pigs fed different experimental diets and after infection with Brachyspira hyodysenteriae. Appl. Environ. Microbiol.  66: 3290– 3296. Google Scholar CrossRef Search ADS PubMed  Macfarlane, G. T., and S. Macfarlane 1997. Human colonic microbiota: Ecology, physiology and metabolic potential of intestinal bacteria. Scand. J. Gastroenterol. Suppl.  222: 3– 9. Google Scholar CrossRef Search ADS PubMed  Mack, D. R., S. Michail, S. Wei, L. McDougall, and M. A. Hollingsworth 1999. Probiotics inhibit enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression. Am. J. Physiol.  276: G941– 950. Google Scholar PubMed  Madsen, K., A. Cornish, P. Soper, C. McKaigney, H. Jijon, C. Yachimec, J. Doyle, L. Jewell, and C. De Simone 2001. Probiotic bacteria enhance murine and human intestinal epithelial barrier function. Gastroenterology  121: 580– 591. Google Scholar CrossRef Search ADS PubMed  Magurran, A. 1988. Diversity indices and species abundance models. Pages 8–45 in Ecological Diversity and Its Measurement.  Princeton University Press Princeton, NJ. Google Scholar CrossRef Search ADS   McCracken, V. J., and H. R. Gaskins 1999. Probiotics and the immune system. Pages 85–112 in Probiotics: A Critical Review.  G. W. Tannock ed. Horizon Scientific Press, Norfolk, England. McCracken, V. J., J. M. Simpson, R. I. Mackie, and H. R. Gaskins 2001. Molecular ecological anlaysis of dietary and antibiotic-induced alterations of the mouse intestinal microbiota. J. Nutr.  131: 1862– 1870. Google Scholar CrossRef Search ADS PubMed  Morelli, L., P. G. Sarra, and V. Bottazzi 1988. In vivo transfer of pAM⌈ from Lactobacillus reuteri to Enterococcus faecalis. J. Appl. Bacteriol.  65: 371– 375. Google Scholar CrossRef Search ADS PubMed  Muyzer, G., and K. Smalla 1998. Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Leeuwenhoek  73: 127– 141. Google Scholar CrossRef Search ADS PubMed  Muyzer, G., T. Brinkhoff, U. Nübel, C. Santegoeds, H. Schäfer, and C. Wawer 1998. Denaturant gradient gel electrophoresis in microbial ecology. Pages 1–27 in Molecular Microbial Ecology Manual. Vol. 3.4.4.  A. Akkermans, J. D. van Elsas, and F. de Bruijn ed. Kluwer Academic Publishers. Nagaraja, T. G., and M. B. Taylor 1987. Susceptability and resistance of ruminal bacteria to antimicrobial feed additive. Appl. Environ. Microbiol.  53: 1620– 1625. Google Scholar PubMed  NRC 1988. Nutrient Requirements of Swine.  9th ed. National Academy Press, Washington, DC. Onishi, H. R., D. R. Daoust, S. B. Zimmerman, D. Hendlin, and E. O. Stapley 1974. Cefoxitin, a semisynthetic cephamycin antibiotic: Resistance to beta-lactamase inactivation. Antimicrob. Agents Chemother.  5: 38– 48. Google Scholar CrossRef Search ADS PubMed  Reid, G. 1999. The scientific basis for probiotic strains of Lactobacillus. Appl. Environ. Microbiol.  65: 3763– 3766. Google Scholar PubMed  Reid, G., M. E. Sanders, H. R. Gaskins, G. R. Gibson, A. Mercenier, B. Rastall, M. Roberfroid, I. Rowland, C. Cherbut, and T. Klaenhammer 2003. New scientific paradigms for probiotics and prebiotics. J. Clin. Gastroenterol.  37: 105– 118. Google Scholar CrossRef Search ADS PubMed  Salyers, A., and N. B. Shoemaker 1996. Resistance gene transfer in anaerobes: New insights, new problems. Clin. Infect. Dis.  23: S36– S43. Google Scholar CrossRef Search ADS PubMed  Saunders, D. R., and J. Sillery 1982. Effect of lactate on structure and function of the rat intestine. Dig. Dis.  27: 33– 41. Google Scholar CrossRef Search ADS   Schwarz, S., C. Kehrenberg, and T. R. Walsh 2001. Use of antimicrobial agents in veterinary medicine and food animal production. Int. J. Antimicrob. Agents  17: 431– 437. Google Scholar CrossRef Search ADS PubMed  Shannon, C. E., and W. Weaver 1949. The Mathematical Theory of Communication University of Illinois Press, Urbana, IL. Sheehan, P. J. 1984. Effects on community and ecosystem structure and dynamics. Pages 51–99 in Effects of Pollutants at the Ecosystem Level.  P. J. Sheehan, D. R. Miller, G. C. Butler, and P. Bourdeau ed. John Wiley & Sons New York, NY. Simpson, J. M., V. J. McCracken, B. A. White, H. R. Gaskins, and R. I. Mackie 1999. Application of denaturant gradient gel electrophoresis for the analysis of the porcine gastrointestinal microbiota. J. Microbiol. Methods  36: 167– 179. Google Scholar CrossRef Search ADS PubMed  Simpson, J. M., V. J. McCracken, H. R. Gaskins, and R. I. Mackie 2000. Denaturing gradient gel electrophoresis analysis of 16S rDNA amplicons to monitor changes in fecal bacterial populations of weaning pigs following introduction of Lactobacillus reuteri strain MM53. Appl. Environ. Microbiol.  66: 4705– 4714. Google Scholar CrossRef Search ADS PubMed  Sneath, P. H., and R. R. Sokal 1973. Numerical Taxonomy: The Principles and Practice of Numerical Classification.  W. H. Freeman & Company San Francisco, CA. Stokstad, E. L. R., T. H. Jukes, J. Pierce, A. C. Page, and A. L Franklin, Jr. 1949. The multiple nature of the animal protein factor. J. Bio. Chem.  180: 647– 654. Tannock, G. W., M. P. Dashkevicz, and S. D. Feighner 1989. Lactobacilli and bile salt hydrolase in the murine intestinal tract. Appl. Environ. Microbiol.  55: 1848– 1851. Google Scholar PubMed  Tollefson, L., S. F. Altekruse, and M. E. Potter 1997. Therapeutic antibiotics in animal feeds and antibiotic resistance. Rev. Sci. Tech.  16: 709– 15. Google Scholar CrossRef Search ADS PubMed  Tsai, Y.-L., and B. H. Olsen 1992. Rapid method for separation of bacterial DNA from humic substances in sediments for polymerase chain reaction. Appl. Environ. Microbiol.  58: 2292– 2295. Google Scholar PubMed  Vervaeke, I. J., J. A. Decuypere, N. A. Dierick, and H. K. Henderickx 1979. Quantitative in vitro evaluation of the energy metabolism influenced by virginiamycin and spiramycin used as growth promoters in pig nutrition. J. Anim. Sci.  49: 846– 856. Google Scholar CrossRef Search ADS   Visek, W. J. 1978. The mode of growth promotion by antibiotics. J. Anim. Sci.  46: 1447– 1469. Google Scholar CrossRef Search ADS   Wilson, K. H., and R. B. Blitchington 1996. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol.  62: 2273– 2278. Google Scholar PubMed  Wubben, J. E., M. R. Smiricky, D. M. Albin, and V. M. Gabert 2001. Improved procedure and cannula design for simple-T cannulation at the distal ileum in growing pigs. Contemp. Top. Lab. Anim. Sci.  40: 27– 31. Google Scholar PubMed  Copyright 2003 Journal of Animal Science
TI - Molecular ecological analysis of porcine ileal microbiota responses to antimicrobial growth promoters
JF - Journal of Animal Science
DO - 10.2527/2003.81123035x
DA - 2003-12-01
UR - https://www.deepdyve.com/lp/oxford-university-press/molecular-ecological-analysis-of-porcine-ileal-microbiota-responses-to-Jd4854DOvh
SP - 3035
EP - 3045
VL - 81
IS - 12
DP - DeepDyve
ER -