TY - JOUR
AU - Babes, Alexandru
AB - Abstract Camphor is known to potentiate both heat and cold sensations. Although the sensitization to heat could be explained by the activation of heat-sensitive transient receptor potential (TRP) channels TRPV1 and TRPV3, the camphor-induced sensitization to cooling remains unexplained. In this study, we present evidence for the activation of the cold- and menthol-sensitive channel transient receptor potential melastatin 8 (TRPM8) by camphor. Calcium transients evoked by camphor in HEK293 cells expressing human and rat TRPM8 are inhibited by the TRPM8 antagonists 4-(3-chloro-2-pyridinyl)-N-[4-(1,1-dimethylethyl)phenyl]-1-piperazinecarboxamide and 2-aminoethyl diphenylborinate. Camphor also sensitized the cold-induced calcium transients and evoked desensitizing outward-rectifying currents in TRPM8-expressing HEK293 cells. In the presence of ruthenium red (a blocker of TRPV1, TRPV3, and TRPA1), the camphor sensitivity of cultured rat dorsal root ganglion neurons was highest in a subpopulation of cold- and icilin-sensitive neurons, strongly suggesting that camphor activates native TRPM8. Camphor has a dual action on TRPM8: it not only activates the channel but also inhibits its response to menthol. The icilin-insensitive chicken TRPM8 was also camphor insensitive. However, camphor was able to activate an icilin-insensitive human TRPM8 mutant channel. The activation and sensitization to cold of mammalian TRPM8 are likely to be responsible for the psychophysical enhancement of innocuous cold and “stinging/burning” cold sensations by camphor. chicken TRPM8, dorsal root ganglion, eucalyptol, human TRPM8, icilin, menthol Introduction Camphor is a bicyclic monoterpene traditionally extracted from camphor laurel (Cinnamomum camphora) and used historically for topical applications and inhalation. Although the scent of camphor is mediated by odorant receptors, G protein-coupled receptors in vertebrate olfactory receptor neurons (Sicard 1985; Adipietro et al. 2012), camphor has also other, less understood, sensory properties. Part of its long-established psychophysical features consists in modulation of temperature sensing. According to Green (1990), camphor potentiates the perceived intensity of both hot and cold stimuli when applied on the hairy skin. The physiologically relevant concentration is probably very high due to the fact that camphor is usually topically applied in concentrations up to 10–20% (w/v; equivalent to ~0.6–1.3M) (Green 1990; Xu et al. 2005). Other investigators (Burrow et al. 1983) have reported that camphor, eucalyptol, and menthol evoke a cold sensation following vapor inhalation from each of these compounds and conclude that all 3 stimulate cold receptors in the nose. Transient receptor potential (TRP), subfamily M, member 8 (TRPM8) is a non-selective cation channel activated by low temperatures (8–28 °C) and cooling mimetic compounds such as menthol and its derivatives, by eucalyptol, and also by the super-cooling agent icilin (McKemy et al. 2002). Activation by icilin is calcium dependent, being absent or very small when extracellular Ca2+ is replaced with ethylene glycol tetraacetic acid (Chuang et al. 2004). TRPM8 is expressed not only in small diameter neurons from trigeminal and dorsal root ganglia (DRG; McKemy et al. 2002) but also in olfactory receptor neurons (Nakashimo et al. 2010). Camphor was recently shown to modulate the activity of several temperature-activated ion channels from the TRP family. The compound was reported to be an agonist of the warmth-sensing TRPV3 (Moqrich et al. 2005), a partial agonist of the heat-sensing TRPV1 (Xu et al. 2005), an inhibitor of the noxious cold sensor TRPA1 (Story et al. 2003; Xu et al. 2005, Macpherson et al. 2006), and is also acting on other ion channels (Park et al. 2001; Hall et al. 2004)—none of which can explain the cooling sensation due to camphor. In insects, camphor activates a TRPA1 homolog, the honey bee Hymenoptera-specific TRPA channel, which is heat activated (Kohno et al. 2010) and partially inhibits the heat-elicited current mediated by the Drosophila TRP channel Painless (Sokabe et al. 2008). Camphor was shown, together with menthol and cinnamaldehyde, to inhibit the basal phospholipase C (PLC) activity in HEK293T cells (Kim et al. 2008), whereas PLC activated by Ca2+ entry is known to inhibit TRPM8 via phosphatidylinositol bisphosphate (PIP2) depletion (Daniels et al. 2009). Although camphor was reported to have either no effect (McKemy et al. 2002, Xu et al. 2005; Macpherson et al. 2006) or a minor effect on TRPM8 (Vogt-Eisele et al. 2007), all the previous results were only based on whole-cell patch clamp experiments, a technique that may interfere with intracellular signaling pathways. Our previous work based on calcium microfluorimetry (Babes et al. 2006) revealed non-adapting cold-sensitive DRG neurons displaying slight camphor sensitivity and a general TRPM8-like pharmacological profile (menthol and icilin sensitivity and absence of inhibition by ruthenium red [RuR]). In this study, we have investigated the action of camphor on recombinant human, rat, and chicken TRPM8 (cTRPM8) as well as native TRPM8 from rat DRG neurons using calcium imaging with conventional whole-cell and perforated patch clamp. In order to investigate the TRPV1-independent action of camphor on cultured DRG neurons, we have exploited the differential action of RuR on TRPV1 and TRPM8 (Weil et al. 2005). RuR is also a blocker of TRPV3 (Xu et al. 2002), which is considered to be absent from rodent DRG, although contradictory reports exist (Peier et al. 2002; Frederick et al. 2007). cTRPM8 was considered an interesting target for testing camphor, considering that the chicken TRPV1 ortholog is camphor insensitive (Xu et al. 2005). This allows the study of a possible intraspecies conservation of activator sensitivity between different TRP ion channels. Materials and methods Ion channel heterologous expression Human TRPM8 (hTRPM8) was stably expressed in HEK293 cells (a kind gift from Prof. Thomas Voets, KU Leuven, Belgium). Rat TRPV1 (rTRPV1; inside pcDNA3), cTRPM8 (inside pcDNA3-Sfi2), and hTRPM8 D802A (inside pIRES-EGFP, a kind gift from Dr Frank Kühn, RWTH Aachen, Germany) were transiently expressed in HEK293T cells using calcium phosphate coprecipitation. For the experiments on rTRPV1, we also used HEK293 cells stably expressing rTRPV1 (a kind gift from Prof. Makoto Tominaga, OIIB Okazaki, Japan). After the transfection procedure, cells were plated onto 35-mm Petri dishes or 24-mm borosilicate glass coverslips (0.17mm thick), which had been treated with poly-d-lysine (0.1mg/mL for 30min). The cells were used for experiments within 1–2 days. cTRPM8 cloning cTRPM8 was cloned from DRG of 2–4-day-old Gallus domesticus chicks. Trizol-extracted total RNA was reverse transcribed (Clontech) with an anchored oligo-dT primer, and PCR was carried out using an equal mix of Pfu (Promega) and Turbo Pfu (Stratagene, Agilent Technologies) enzymes. Primers for PCR were based on Gallus gallus genomic reads at the 5′ end, and on resequencing of a chicken bursal expressed sequence tag clone (AJ456804, a kind gift from Dr Jean-Marie Buerstedde) to obtain a sequence from the 3′ untranslated region; SfiI enzyme sites were added for later cloning. The primer sequences used were as follows: agctgtggccattacggccatgaggcaccgaagaaatggcaattttgag (5′ end) and ctgggcggccgcctcggccgctcagatatctgcttttcagtcac (3′ end). After amplification, the PCR product was cut and ligated into a vector modified from pcDNA3 (Invitrogen) by replacement of the multiple cloning site by one containing SfiI sites. Rat DRG culture DRG neuron cultures were obtained from selected DRG (T12-S1) of adult male Wistar rats (150–200g) killed by 2min of CO2 exposure, followed by decapitation, according to the European Guidelines on Laboratory Animal Care, with the approval of the institutional ethics committee of the University of Bucharest. The culturing procedure was largely described elsewhere (Reid et al. 2002). Briefly, removed DRGs were incubated in a mixture of 2mg/mL collagenase (type XI) and 2.5mg/mL dispase (from Bacillus polymyxa; Gibco, Invitrogen) for 1h at 37 °C in IncMix solution (155mM NaCl, 1.5mM K2HPO4, 5.6mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES], 4.8mM Na-HEPES, 5mM glucose, adjusted to pH 7.4 with NaOH). After trituration, the cell suspension was filtered through a nylon mesh sieve with 35-μm pore size (N35S; Biodesign Inc.), and the dissociated cells were plated onto glass coverslips (see Ion channel heterologous expression, above) and cultured (37 °C and 5% CO2) in Dulbecco’s modified Eagle medium/Ham’s F12 medium (1:1) supplemented with 10% horse serum and gentamicin (50 μg/mL). All chemicals for cell culture were from Sigma, unless otherwise mentioned. Ca2+ microfluorimetry HEK293 cells and DRG neurons cultured on 24-mm diameter glass coverslips were incubated in standard extracellular solution (see Electrophysiology, below) containing 2 μM calcium green-1 AM and 0.02% Pluronic F-127 (both from Invitrogen) and left to recover for another 30min before recording. The data were recorded using Axon Imaging Workbench 2.2 (Molecular Devices). After background subtraction, the Ca2+ imaging data were plotted as mean ± standard deviation (SD). Data were also quantified using custom-written software as ΔF/F0 (amplitude) for each recorded cell, the ratio between the maximum fluorescence change during the stimulus and the baseline fluorescence before the stimulus. For DRG neurons, the ΔF/F0 threshold was arbitrarily set at 10% to identify responding neurons. The area under the curve (AUC) was computed from the start of the response until the signal recovered to baseline or, if the baseline was not reached, until the application of the next stimulus. Electrophysiology Whole-cell patch clamp currents were amplified using a WPC-100 patch clamp amplifier (E.S.F. Electronic), filtered at 3kHz, and digitized at 5–25kHz through an Axon Instruments DigiData 1322A interface driven by pCLAMP 8 (Molecular Devices). The extracellular solution contained (in mM) 140 NaCl, 4 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, 4.54 NaOH, and 5 glucose (pH 7.4 at 25 °C [NaOH]). The intracellular solution for conventional whole-cell patch clamp on HEK293 cells and DRG neurons contained (in mM) 140 KCl, 0.05 CaCl2, 1 MgATP, 0.1 EGTA, and 10 HEPES (pH 7.2 at 25 °C [KOH]). For perforated patch clamp on HEK293 cells, we used amphotericin B and a k-gluconate-based solution containing (in mM): 100 k-gluconate, 40 KCl, 8 NaCl, 1 MgCl2, and 10 HEPES (pH 7.2 at 25 °C [NaOH]). For increasing the aqueous solubility of amphotericin B, the pipette solution was prepared using a method derived from that described by Yawo and Chuhma (1993). Amphotericin B (5mg) and fluorescein disodium salt (20mg) were mixed together in 2mL of methanol. After vortexing and vigorous shaking, 100 μL of this mixture were deposited at the bottom of a 2-mL polyethylene test tube. This volume was dried completely under a stream of CO2 gas, and then 1mL of the k-gluconate-based solution (20 μm filtered) was added. The resulting solution, containing 250 μg/mL of amphotericin B and 1mg/mL of fluorescein, was not further filtered. All procedures were performed under low-intensity illumination. Borosilicate capillaries with filament (GC150F-10; Harvard Apparatus) were pulled using a vertical micropipette puller (PUL-100; World Precision Instruments), tip polished for resistances of 2–5 MΩ, and back-filled with the aforementioned solution. Positive pressure was applied to the pipette while also having the extracellular solution flow in the opposite direction relative to the solution efflux from the patch pipette. Using HEK293 cells, gigaseal was obtained normally and the perforation was gradual; the membrane capacitance and the access resistance were stabilized after about 3–5min. Temperature control During Ca2+ microfluorimetry experiments, the temperature inside the bath was controlled via a computer-controlled custom-made Peltier-driven perfusion system, improved from the previously described version (Reid et al. 2001) by having 2 larger Peltier elements (30×15mm) each rated at 20.9W (Eureca Meβtechnik) and a faster exchange rate, for the rapid delivery of controlled concentrations from the chemical stimuli to the cells. This was essential for recording the transient responses evoked by camphor. In brief, the chamber previously described, constructed with glass coverslips, was replaced with a 18-gauge stainless steel tubing, reducing the solution cooling volume from ~150 to <100 μL, a miniature manifold was used (MM-6; Harvard Apparatus) and all other dead volumes were reduced, whereas the flow rate was maintained close to the optimal value of 1.5mL/min. The temperature was measured during the actual recordings in the immediate proximity of the field of cells imaged, using a T-type thermocouple (IT-1E; Physitemp). If not otherwise mentioned, the experiments were performed with the temperature maintained at 25 °C. During patch clamp experiments, the temperature of the recording chamber was set at 25 °C also by using a Peltier-driven micro-incubator (PDMI-2 controlled by TC-202A; Harvard Apparatus). Data analysis All data were analyzed in OriginPro 8.0 (OriginLab). Data comparison of cell responses were performed by paired-samples Student’s t-test or ratio t-test, if not otherwise mentioned. Results are presented as means ± SD. The classical form of the Hill equation was used for fitting ΔF/F0 against camphor concentration. Solutions and chemicals Stock solutions were made either in dimethyl sulfoxide (camphor, icilin, 2-aminoethyl diphenylborinate [2-APB], 4-(3-chloro-2-pyridinyl)-N-[4-(1,1-dimethylethyl)phenyl]-1-piperazinecarboxamide [BCTC], and allyl isothiocyanate [AITC]), ethanol (menthol and capsaicin) or H2O (RuR). The camphor stock solution (2M) was made considering a 20% volume displacement by camphor. The 0.5–10mM working solutions were vigorously shaken at 37 °C for at least 15min. The standard extracellular solution was vehicle (dimethyl sulfoxide and ethanol) corrected. All chemicals were from Sigma-Aldrich except icilin and BCTC, from Tocris Bioscience. Menthol was (1R,2S,5R)-(−)-menthol and camphor was (1R)-(+)-camphor. Results Camphor activates hTRPM8 in a concentration- and temperature-dependent manner The effect of camphor on hTRPM8 was assessed using a HEK293 cell line stably expressing hTRPM8. Before the recording, the cells were left for about 5min to recover after starting the perfusion of extracellular solution at 25 °C. Untransfected HEK293T cells displayed either no variations or small decreases in intracellular calcium concentration ([Ca2+]i) during camphor applications (2–10mM, 30 s–2-min duration; data not shown). In hTRPM8-HEK293 cells held at 25 °C, increasing concentrations of camphor (0.5, 1, 2, and 10mM, 30 s each) evoked increasing [Ca2+]i transients with mean ΔF/F0 ± SD values of 0.03±0.06, 0.06±0.03, 0.16±0.08, and 0.47±0.14, respectively, (n = 59; Figure 1A). At 2 and 10mM, the responses to camphor were fast and transient, desensitizing before the end of the 30-s camphor perfusion. By fitting the results with a Hill equation, the resulting EC50 for hTRPM8 activation by camphor was 4.48mM, and the Hill coefficient was 1.38 (Figure 1B). Menthol (100 μM, 30 s) was applied at the end of the recording to confirm functional expression of hTRPM8. Figure 1 Open in new tabDownload slide Camphor activates hTRPM8 expressed in HEK293 cells. (A) Increasing concentrations of camphor (0.5, 1, 2, and 10mM) evoked increasing [Ca2+]i transients. Menthol (100 µM) was applied at the end of the experiment to confirm functional expression of TRPM8. The solid black line shows the mean (n = 59) and the dotted lines show the SD (n = 59). (B) Calcium imaging data from A, fitted using a Hill equation with EC50 = 4.48mM and a Hill coefficient n = 1.38. (C) Whole-cell currents elicited by camphor (10mM) recorded in conventional patch clamp on hTRPM8-HEK293 cells. Representative current–voltage relationship showing the increase of the outwardly rectifying currents in response to camphor and menthol (100 μM). Inset: typical inward current recorded at –80 mV in response to camphor (t ≈ 25 °C). (D) Inward currents elicited by camphor and recorded in perforated patch clamp at –80 mV are larger and show reduced tachyphylaxis. Whole-cell peak currents elicited by 10mM of camphor in hTRPM8-HEK293 cells were recorded in the voltage clamp mode (at a holding potential of −80 mV). The current densities had a large variance (range −3.2 to −109.8 pA/pF; median −7.9 pA/pF and mean −18.8±30.5 pA/pF; n = 12). Camphor (10mM) was applied at 25 °C for 10 s, 2 or 3 times at 2-min intervals. The larger currents were transient and a marked desensitization ensued (not shown), whereas the smaller currents elicited by camphor were more sustained (Figure 1C inset). Recordings of current–voltage relationships during voltage ramps (−100 to +80 mV and back to −100 mV over 3.4 s) were performed during the small but sustained currents (Figure 1C). The removal of intrapipette Ca2+ and buffering with 2mM of EGTA did not substantially affect the amplitude of the currents (data not shown). Considering the apparent discrepancy in amplitudes and tachyphylaxis of camphor-evoked responses between calcium imaging and whole-cell patch clamp recordings and suspecting the decisive contribution of an intracellular factor, we performed perforated patch clamp experiments on hTRPM8-HEK293 cells. These experiments revealed indeed much larger inward currents at the −80 mV holding potential with a lower variance (range −19.9 to −85.7 pA/pF; median −37.0 pA/pF and mean −47.3±27.2 pA/pF; n = 8). The currents were transient, and tachyphylaxis was similar to the results from calcium imaging (Figure 1D). To investigate the temperature dependence of camphor-evoked activation of recombinant hTRPM8, the temperature of the extracellular solution was switched from 32 to 25 °C, which evoked an increase in [Ca2+]i in all cells (Figure 2A). Figure 2 Open in new tabDownload slide Camphor activates hTRPM8 and rTRPM8 in a temperature-dependent manner. (A) A cooling step from 32 to 25 °C shows the enhanced response to camphor at 25 °C in hTRPM8-HEK293 cells. Camphor (10mM) and menthol (100 µM) were applied for 1min each. Note the transient nature of the response to camphor, compared with the sustained response to menthol; mean trace ± SD (n = 54). Right: the responses to camphor at 32 and 25 °C are plotted as mean ΔF/F0 ± SD (***P < 0.001, n = 54). (B) rTRPM8 transiently expressed in HEK293T cells was activated by camphor (10mM) at 25 °C but not at 32 °C. (C) Camphor (5mM) sensitizes the response of hTRPM8 to mild cooling ramps (c.r.; from ~33 to ~27 °C) by increasing the amplitude and recovery time to baseline. At 33 °C, camphor alone did not evoke a calcium transient; mean trace ± SD (n = 51). A recorded c.r. is displayed in detail in the inset. (D) The AUC from C is plotted for each cold-induced response; the difference in AUC between the 3rd and 4th ramp (in the presence of 5mM camphor) is statistically significant (***P < 0.001, n = 51). Data presented as individual cell AUC and AUC mean ± SD. At 32 °C, the response to camphor (10mM) was very small and slow, with a mean ΔF/F0 of 0.03±0.04 (n = 54) at the end of the 1-min application; in contrast, the response at 25 °C was fast and transient, with a mean ΔF/F0 of 0.24±0.06 (n = 54; Figure 2A right). The 1-min perfusions also revealed the transient nature of the response to camphor compared with the sustained increase in [Ca2+]i evoked by menthol, illustrated by the difference in the half-width durations and the mean AUC of the response to the 2 compounds (14.7±6.4 s/323.6±251.3 arbitrary unit for the acquired fluorescence signal [a.u.s] for camphor and 70.3±4.9 s/1567.1±556.2 a.u.s for menthol; P < 0.001, n = 54). The same experiment was also performed on HEK293T cells transiently transfected with rat TRPM8 (rTRPM8; Figure 2B). Camphor (10mM) application at 32 °C produced a decrease in fluorescence in some cells, similar to the effect recorded in untransfected cells, whereas at 25 °C, camphor evoked fast [Ca2+]i transients with a mean ΔF/F0 of 0.19±0.01 (n = 50). The sensitizing effect of camphor on the cold-induced activation of hTRPM8 was investigated by applying the compound during a succession of mild cooling ramps (from 33 to 27 °C in about 44 s). Camphor (5mM) was applied before, during, and after the 4th temperature ramp in the series and also on the descending part of the 5th temperature ramp (Figure 2C). At the baseline temperature of 33 °C, camphor did not evoke a response by itself. The half-width duration of the cold-induced increase in [Ca2+]i was substantially increased in the presence of camphor (from 26.4±23.9 s for the 3rd ramp to 138.9±83.5 s for the 4th ramp; P < 0.001, n = 51). The AUC also increased (Figure 2D) from 286.4±204.1 a.u.s for the 3rd ramp to 2220.2±1175.1 a.u.s for the 4th (n = 51, P < 0.001), whereas the mean ΔF/F0 increased from 0.27±0.16 to 0.48±0.22 (n = 51, P < 0.001). Camphor also markedly desensitized the responses to the following cooling ramps in the series (6th and 7th). To reveal the origin of the [Ca2+]i transients, we switched the perfusion to a nominally calcium-free extracellular solution. The removal of external calcium ions inhibited the [Ca2+]i increase evoked by camphor and menthol by 96.3 ± 8.0% (n = 114) and 54.3 ± 28.9% (n = 114), respectively (Figure 3A). This suggests that, contrary to menthol, camphor does not trigger endoplasmic reticulum Ca2+ release. TRPM8 antagonists block hTRPM8 activation by camphor We tested the inhibitory effect of the TRPM8 and TRPV1 antagonist BCTC (Weil et al. 2005) on hTRPM8 activation by camphor. When BCTC (5 μM) was pre- and then co-applied with 5mM of camphor, it almost completely (94.5±20.9%, n = 109) and reversibly blocked the response to camphor at 25 °C (Figure 3B). Figure 3 Open in new tabDownload slide The origin of the camphor-evoked [Ca2+]i transients and inhibition by TRPM8 antagonists. (A) The [Ca2+]i transients evoked by camphor are due to calcium entry. The switch to a nominally Ca2+-free extracellular solution abolished the response to camphor (5mM ), whereas the [Ca2+]i transient evoked by menthol (100 μM ) was only partially inhibited (n = 114). (B) The TRPM8 antagonist BCTC (5 μM) blocked the response to camphor (5mM; n = 109). (C) 2-APB (150 μM) inhibited the [Ca2+]i transient evoked by camphor (5mM) in hTRPM8-HEK293 cells (n = 77). All data are presented as mean ± SD. We also tested the effect of 2-APB, an agonist of other 2 TRP ion channels activated by camphor (TRPV1 and TRPV3; Hu et al. 2004) and a known TRPM8 inhibitor (Hu et al. 2004). 2-APB (150 μM) blocked almost entirely (93.8±7.3%, n = 77) and reversibly the [Ca2+]i transient evoked by 5mM of camphor in hTRPM8-HEK293 cells at 25 °C (Figure 3C). These 2 antagonists (BCTC and 2-APB) also produced a marked decrease in the baseline fluorescence at 25 °C, indicating sustained activation of hTRPM8 at this temperature. Interestingly, BCTC (1 μM) was also found to completely and persistently inhibit TRPV1 activation by camphor (10mM), unlike other TRPV1 competitive antagonists (Xu et al. 2005; Supplementary Figure S1). Camphor modulates differently the TRPM8 responses to its agonists menthol and icilin We first investigated the effect of camphor on the activation of hTRPM8 by its known agonists, menthol and icilin, using calcium microfluorimetry. In these experiments, the concentrations for menthol (5 μM) and icilin (0.1 μM) were chosen close to their estimated EC50 values from our calcium imaging recordings on hTRPM8-expressing HEK293 cells and similar to those found in other studies performed in similar conditions (Behrendt et al. 2004; Klein et al. 2011). When coapplied, camphor (5mM) strongly (ca. 62%) and reversibly inhibited the sustained response to menthol (5 μM; Figure 4A), from 0.36±0.15 to 0.14±0.09 (ΔF/F0; n = 77, P < 0.001; Figure 4D). This inhibition was also tested and confirmed at higher menthol (10–50 μM) and lower camphor concentrations (1–2mM; data not shown). Figure 4 Open in new tabDownload slide Camphor inhibits the activation of TRPM8 by menthol in hTRPM8-HEK293 cells. (A) Camphor (5mM) reversibly inhibited the sustained activation of hTRPM8 by menthol (5 µM). Also, by successively applying camphor, camphor with menthol, and menthol alone, a gradual increase in [Ca2+]i was obtained; mean trace ± SD (n = 77). (B) Representative examples of inward and outward currents elicited by menthol (100 µM) reversibly inhibited camphor (5mM). (C) Typical current–voltage relationship showing the same TRPM8 current inhibition during voltage ramps. (D) Left: normalized fluorescence, the ratio between the fluorescence change during and after camphor coapplication (arrows at “b” and “c” in A) and that evoked by menthol alone (arrow at “a”), all measured from the same baseline (***P < 0.001, n = 77). Right: pooled data for the relative currents measured during and after camphor coapplication (marked with “ii” and “iii” in B) normalized to the initial plateau current (marked “i”) elicited by menthol, at −60 and +80 mV (***P < 0.001, n = 7 for both). We also investigated this inhibition in whole-cell patch clamp experiments on hTRPM8-HEK293 cells recorded at constant negative (−60 mV) and positive (+80 mV) holding potentials (Figure 4B) and also during voltage ramps (−100 to +100 mV over 400ms; Figure 4C). Camphor (5mM) inhibited in average ca. 68% of the inward plateau current elicited by menthol (100 μM) at −60 mV, whereas at +80 mV, the mean inhibition of the outward current reached ca. 85% and was again reversible (Figure 4D).The normalized currents during and after the camphor coapplication were 0.32±0.20 and 1.74±0.63 (P < 0.001, n = 7) at −60 mV, respectively, whereas at +80 mV, normalized currents were 0.15±0.17 and 1.17±0.09, respectively (P < 0.001, n = 7; Figure 4C). Following an icilin challenge (0.1 μM, 20 s), the response of hTRPM8-HEK293 to camphor (2mM) was absent (Figure 5A), indicating a profound and lasting cross-tachyphylaxis. During a prolonged second icilin application, after the installment of acute desensitization (to 2.2% of the icilin response amplitude), coapplication of camphor (2M) evoked a strong increase in [Ca2+]i, recovering from the desensitized state to 118% of the amplitude evoked by the previous icilin response (ΔF/F0 = 0.33±0.13, compared with 0.297±0.096, for icilin alone, 2nd application, n = 66; Figure 5A). The potentiation of the icilin [Ca2+]i transients was reproducible during multiple camphor applications (data not shown). Figure 5 Open in new tabDownload slide Camphor enhances the hTRPM8-HEK293 cells responses to icilin. (A) Following the icilin-induced desensitization, camphor (2mM) evoked a new response when coapplied with icilin (0.1 μM ); mean trace ± SD (n = 66). Right: fluorescence change from baseline, ΔF in the desensitized state (arrow at “b”) and at camphor coapplication (arrow at “c”) normalized to ΔF at the peak of the icilin response (arrow at “a”; ***P < 0.001, n = 66). (B) The current elicited by coapplying camphor (10mM) and icilin (2 μM) is supra-additive in relation to the currents elicited by camphor or icilin alone (t ≈ 25 °C). Right: the current densities for the points marked on the current trace; the difference between “ii” and “iv” is statistically significant (**P < 0.01, n = 4) The peak whole-cell currents elicited by camphor (10mM) and icilin (2 μM) recorded in hTRPM8-HEK293 cells in voltage clamp (−80 mV) were markedly enhanced when the 2 compounds were applied together, displaying a supra-additive mutual potentiation (Figure 5B). The peak current densities were −6.6±3.0 pA/pF for camphor alone, −25.0±20.8 pA/pF for icilin alone, and −119.2±19.8 pA/pF for camphor plus icilin (n = 4, P < 0.01). The camphor potentiation of the icilin-evoked inward currents abated over time in this type of experiments (Figure 5B). As expected for the potentiation by camphor of an icilin-elicited current, under both extracellularly and intracellularly Ca2+-free conditions (by replacing Ca2+ with 2mM EGTA extracellularly and 5mM intracellularly), no resolvable currents could be recorded when icilin and camphor were coapplied (data not shown). Camphor activates native rTRPM8 All experiments on rat DRG neurons were performed on small diameter neurons (filtered through a 35-μm cell sieve) in the presence of RuR (10 μM) in order to block other ion channels known to be activated by camphor (TRPV1 and TRPV3) or by icilin (TRPA1, although it is activated at substantially higher icilin concentrations than the one we have used here [Story et al. 2003]). We have already shown that recombinant rTRPM8 channels are activated by camphor (10mM) at 25 °C (Figure 2B). RuR (10 μM) did not inhibit the camphor (5mM) activation of rTRPM8 (Supplementary Figure S2), whereas it entirely blocked the response of rTRPV1 to camphor, as previously described (data not shown; Xu et al. 2005). The efficacy of the RuR blocking effect on TRPV1 and TRPA1 was tested by applying capsaicin (2 µM, 30 s) at 32 °C and AITC (100 µM, 1–2min) at 32 or 25 °C: only 9.0% (15/166) of the total neuronal population treated with RuR was activated by capsaicin compared with 51.9% (80/154) of a control group (P < 0.001, Fisher’s Exact test, 2-tailed). Similarly, only 6.0% (10/166) of the RuR-treated neurons responded to 100 µM AITC compared with 21.4% in control conditions (P < 0.001). Moreover, the mean response amplitude (ΔF/F0) to AITC was strongly reduced, 0.15±0.013 for the RuR-treated group compared with 0.38±0.04 for control (P < 0.001, unpaired Student’s t-test). In the presence of RuR, capsaicin activated only 1 of 26 camphor-sensitive neurons and AITC activated 4 of 39 icilin-sensitive neurons. The effects of camphor (10mM) and icilin (2 μM) were recorded at 25 °C (Figure 6A and B). Of the total number of recorded neurons, 15.6% (26/166) were activated by camphor and 23.5% (39/166) were activated by icilin (Figure 6C). The camphor- and icilin-sensitive neurons represented 69.23% (18/26) of the camphor-sensitive group and 46.15% (18/39) of the icilin-sensitive group. The camphor-evoked responses were fast and transient, similar to those mediated by recombinant TRPM8. Figure 6 Open in new tabDownload slide Camphor activates a subpopulation of cold- and icilin-sensitive rat DRG neurons. (A) Examples of traces from individual DRG neurons showing responses to a cooling step (from 32 to 25 °C), camphor (10mM; applied after 1min from the cooling stimulus), and icilin (2 μM), all in the presence of 10 μM RuR. (B) Same as in A, except for an inserted AITC challenge (100 μM), which evoked no response. (C) Left: 23.5% of the total number of neurons imaged responded to icilin (2 μM) in the presence of RuR (10 μM); 46.15% of these neurons also responded to camphor (10mM). Right: 28.2% of icilin-sensitive neurons also responded to the initial mild cooling step (from 32 to 25 °C); 81.8% of these icilin- and cold-sensitive neurons were also camphor sensitive. A mild cooling step (from 32 to 25 °C) was also used to identify cold-sensitive neurons with high activation temperature (low threshold). We found that 42.3% (11/26) of the camphor-sensitive neurons, 28.2% (11/39) of the icilin-sensitive neurons, and 81.8% (9/11) of the camphor- and icilin-sensitive neurons were also activated by the cooling step (Figure 6C). In total, 20 neurons were considered cold sensitive, of which 45% (9/20) were camphor and icilin sensitive, 1 neuron was icilin-only sensitive, and 1 neuron camphor-only sensitive. The remaining 9 neurons were not activated by camphor or icilin. Altogether, this indicates a strong coexpression of cold, camphor, and icilin sensitivity in our population of RuR-treated, small-sized DRG neurons. In another set of experiments using RuR, DRG neurons were exposed to icilin (2 µM) for 1min and subsequently to a 30-s camphor (10mM) coapplication. Most of the icilin responses in DRG neurons displayed acute desensitization. The coapplication of icilin and camphor evoked [Ca2+]i transients in all 26 icilin-sensitive neurons recorded, with the mean amplitude recovering to 99.4±20.8% of the initial icilin response amplitude, compared with 61.0±22.8% of the same initial amplitude during the desensitized state (n = 26, P < 0.001; Figure 7B and C right), similar to the effect observed with recombinant hTRPM8. Figure 7 Open in new tabDownload slide Camphor enhancement of the icilin-evoked activation of rat DRG neurons. (A) Left: cold-sensitive neurons were identified using calcium imaging and a cooling stimulus (ramp, from ~34 to ~19 °C in about 42 s). Right: the same neurons were recorded in whole-cell patch clamp at −80 mV and 25 °C, revealing a larger inward current when icilin and camphor were coapplied after acute desensitization to icilin; also visible is the smaller current in response to a second camphor challenge after another 30 s–1-min icilin. (B) All icilin-sensitive neurons recorded at 25 °C displayed a recovery of the Ca2+ signal (arrows at “c”) close to the initial amplitude (arrows at “a”) when camphor was coapplied after a period of acute desensitization (arrows at “b”). (C) Pooled data from patch clamp and calcium imaging experiments. Left: current densities at the points labeled in A (*P < 0.5, n = 6). Right: fluorescence change marked with arrows at “b” and at “c” (in B) normalized to that at “a,” all measured from the same baseline (***P < 0.001, n = 26). We further investigated this effect on rat DRG neurons with conventional whole-cell patch clamp on cold-sensitive neurons preselected using calcium imaging. A cooling ramp from ~34 to ~18 °C in ca. 42 s was used as a stimulus for identifying cold-sensitive neurons (Figure 7A left). RuR (10 μm) was present in the extracellular solution through the entire duration of the patch clamp recordings, performed at 25 °C. During the initial 1-min exposure to icilin (2 µM), only 3 of the 6 recorded neurons presented a fast inward current at the −80 mV holding potential (mean current density −13.6±11.0 pA/pF) and a marked acute desensitization followed. All 6 cold-sensitive neurons displayed a large, rapidly desensitizing inward current when camphor (10mM) and icilin were coapplied (Figure 7A right, current traces from 5 out of the 6 neurons recorded), with a mean peak current density significantly larger compared with that recorded in the icilin desensitized state, −33.7±25.0 and 4.3±8.5 pA/pF, respectively (P < 0.05, n = 6; Figure 7C right). Repeating the coapplication after a further 30 s–1-min exposure to icilin elicited a smaller and more sustained current (Figure 7A right). In 1 neuron, we recorded a small but resolvable current when camphor was applied alone (data not shown), in agreement with the small amplitude of the camphor-elicited currents recorded using conventional whole-cell mode with the same intracellular solution in HEK293 cells expressing hTRPM8 (Figure 1C inset). Camphor does not activate cTRPM8: relation between camphor and icilin sensitivity cTRPM8 is known to be menthol sensitive and icilin insensitive (Chuang et al. 2004). Camphor (5mM) did not evoke an increase in [Ca2+]i in HEK293T cells expressing cTRPM8 at 25 °C, but nonetheless displayed the inhibitory effect on the calcium transient evoked by menthol (Figure 8A): the mean inhibition exerted by 5mM of camphor on the sustained response of cTRPM8 to 100 μM of menthol was 46.3±26.9% (n = 12, P < 0.01). In experiments consisting of 3 successive menthol (100 µM) applications with the second one in the presence of camphor (10mM; Supplementary Figure S3), the mean inhibition reached 71.8±14.9% (n = 28, P < 0.001). Figure 8 Open in new tabDownload slide Relation between icilin and camphor sensitivity of TRPM8. (A) Camphor (5mM) does not activate the icilin-insensitive cTRPM8 at 25 °C, but it still inhibits the response to menthol (100 μM); mean trace ± SD (n = 12). (B) A similar effect was recorded for another agonist of rTRPM8, eucalyptol (2mM), structurally related to camphor; mean trace ± SD (n = 26). (C) Camphor (10mM) and menthol (300 µM; but not icilin [10 µM]) activated HEK293T cells transiently transfected with the icilin-insensitive hTRPM8 D802A mutant. The structurally camphor-related compound eucalyptol, which is a rTRPM8 agonist (McKemy et al. 2002), also failed to activate cTRPM8 at 25 °C when tested at 2–5mM (Figure 8B). Eucalyptol (2mM) inhibited the sustained response of cTRPM8 to 100 µM of menthol (49.6±25.3% mean inhibition; n = 24, P < 0.001). We have also found that although eucalyptol is activating rTRPM8 and hTRPM8, it can also inhibit the response to menthol of these orthologs (Supplementary Figure S4; data not shown), similar to the effects of camphor on TRPM8. The relation between icilin and camphor sensitivity in hTRPM8 was investigated using an icilin-insensitive mutant, D802A (Chuang et al. 2004). The response to camphor (10mM) was present at 25 °C as in the case of the wild-type channel (Figure 8C). As expected, the D802A mutant was not activated by icilin (10 µM). Discussion In this study, we describe the activation of hTRPM8 and rTRPM8 by camphor. Although our experiments were performed at 25 °C, temperature at which recombinant TRPM8 was constitutively active, camphor evoked a large and transient increase in [Ca2+]i with an EC50 of about 4.5mM. The transient [Ca2+]i increase during TRPM8 agonist exposure was also reported in the past for linalool, geraniol, hydroxycitronellal, and eucalyptol when tested on HEK293 cells transfected with mouse TRPM8 (Behrendt et al. 2004). As expected for a TRPM8 activator, camphor’s action was temperature dependent and it potentiated the [Ca2+]i increase during cooling. During repeated cold stimulation, the amplitudes of the cooling-evoked responses following the camphor challenge were attenuated, likely a consequence of the high Ca2+ influx, known to induce TRPM8 desensitization mediated by PLC hydrolysis of PIP2 (Yudin et al. 2011). The already-reported common pharmacological properties of TRPM8 and TRPV1 (Weil et al. 2005) can now be further extended. Besides having camphor as a common agonist in the same concentration range, we demonstrate that TRPM8 and TRPV1 share BCTC as an antagonist in relation to camphor. Also, the synergic action of capsaicin and camphor on TRPV1 (Xu et al. 2005; Marsakova et al. 2012) is paralleled by the action of icilin and camphor on TRPM8. It is known that residues important for capsaicin and icilin gating of TRPV1 and TRPM8, respectively, are located in analog positions on the putative S2-S3 linker (Chuang et al. 2004). We also show that the icilin-insensitive cTRPM8 ortholog is camphor insensitive, similar to its TRPV1 counterpart (Chuang et al. 2004). This may suggest that icilin and camphor share a common important domain for TRPM8 activation. Through experiments on an icilin-insensitive mutant of hTRPM8 (D802A), we have shown that icilin sensitivity is not required for the camphor sensitivity of TRPM8. Interestingly, the well-known mammalian TRPM8 agonist eucalyptol (McKemy et al. 2002), which is structurally related to camphor, also failed to activate cTRPM8 and, similarly to camphor, inhibited the [Ca2+]i transients induced by menthol in cTRPM8, rTRPM8, and hTRPM8 expressed in HEK293 cells. Taken together, our results suggest that camphor has a bimodal action, being not only an inhibitor of TRPM8 menthol-evoked responses but also a mammalian TRPM8 activator, apparently in an independent manner from the menthol and icilin modalities. Both camphor and menthol are monoterpenes, whereas camphor and eucalyptol are bicyclic and menthol monocyclic. This difference may explain the different actions of these 2 classes of compounds on TRPM8, namely the efficacious concentration ranges and possible different mechanisms of activation. In contrast with the synergic effect of icilin and camphor that we describe, the reported absence of such an effect from icilin and menthol (Kühn et al. 2009), supports the hypothesis of a different mode of action of camphor and menthol on TRPM8. We were able to record whole-cell currents (although displaying a large variance) elicited by 10mM of camphor at ~25 °C in hTRPM8-expressing HEK293 cells, unlike previous studies (McKemy et al. 2002; Xu et al. 2005; Macpherson et al. 2006). This may be due in part to the different pipette solution formulation and the speed of solution exchange. When recorded using the perforated patch clamp method, the currents were significantly larger, had a smaller variance, and displayed reduced tachyphylaxis, similar to the results obtained using Ca2+ imaging. This suggests that a cytosolic factor is essential for TRPM8 activation by camphor. Although the nature of this factor remains for the moment unknown, possible candidates are cytosolic enzymes like PLA2 (Andersson et al. 2007) or the dependence on a narrow range of cytosolic Ca2+. The transient nature of the increase in [Ca2+]i and of the large whole-cell currents evoked by camphor is likely to be calmodulin dependent (Sarria et al. 2011). Further studies on menthol- and cold-insensitive mutants will also be required to provide more information concerning the molecular determinants and the mechanisms involved in the gating of TRPM8 by camphor and eucalyptol. The inability of camphor to induce Ca2+ release from endoplasmic reticulum under Ca2+-free conditions, suggests that camphor does not interact with TRPM8 in a Gq protein-activating manner, at least in the absence of extracellular Ca2+. The recent study discussing these effects (Klasen et al. 2012) is not mentioning Gq activation being induced by the calcium-dependent TRPM8 agonist icilin. The camphor sensitivity in cultured rat DRG neurons recorded in the continuous presence of RuR was highest in a subpopulation of mild (25 °C) cooling- and icilin-sensitive neurons, 81% of which responded to camphor. This strongly suggests that camphor is activating native TRPM8. The camphor-sensitive neurons from our experiments are likely to be those most sensitive to TRPM8-like stimuli. Although the proportion of cold-responding neurons was low even when compared with the icilin-sensitive population, this can be explained by the relatively mild cooling stimulus used in this study. The cold responses of the icilin-insensitive neurons are possibly mediated by a different receptor. It should also be noted that icilin and camphor displayed in neurons the same synergic action observed in experiments on recombinant TRPM8. These results show that camphor can activate TRPM8 in a physiologically relevant range of concentrations, lower than those usually found in topically applied preparations. Moreover, the potentiation of hTRPM8 cold sensitivity by camphor can explain the results of psychophysical experiments on human subjects (Burrow et al. 1983; Green 1990). The transient camphor activation of TRPM8 observed in our study, the slow cooling procedure employed by Green (1990), and the use of ethanol (80%) as vehicle could explain the small enhancement of the cold sensation reported by the subjects. Ethanol is known to inhibit TRPM8 by limiting the PIP2–TRPM8 interaction (Benedikt et al. 2007). The camphor potentiation of the cold-evoked “burning” sensation that was reported by Green (1990) could be well explained by TRPM8-mediated activation of the cold- and menthol-sensitive type 2 C fibers, which evoke “burning/stinging” sensations (Campero et al. 2009) and further supported by immunohistochemistry evidence for TRPM8-positive C fibers (Kobayashi et al. 2005<). Interestingly, the largest camphor-induced relative increase in the cold “burning” sensation is shown by Green (1990) at 27 °C, close to the TRPM8 threshold and to the base temperature used in our experiments. In another study, subjects reported cold sensation at the level of the nasal mucosa and increased nasal airflow sensation after inhaling camphor, eucalyptus, or menthol vapors (Burrow et al. 1983); camphor was reported by a larger number of subjects to evoke cold and increased airflow sensations compared with eucalyptus oil. The much stronger psychophysical evidence from Burrow et al. (1983) probably reflects also camphor’s shorter access time to nerve terminals in the nasal mucosa following vapor inhalation, compared with camphor’s permeation through skin. As a possible direct application of our findings, camphor does not appear to be a suitable adjuvant in menthol-containing preparations directed at TRPM8 activation, whereas it can be effective as a TRPM8 potentiator in icilin-containing solutions. Supplementary material Supplementary material can be found at Supplementary Data Funding This work was supported by the European Social Fund [POSDRU 107/1.5/S/80765 to T.S.], the Romanian Research Council (CNCS) [PCE 117/2011 to C.D., A.C.C., and A.B.], and by the Science Foundation Ireland [BIM085 to G.R.]. Acknowledgements The authors thank Cristian Neacsu and Liviu Soltuzu for developing the software for extracting and analyzing the calcium imaging data. References Adipietro KA Mainland JD Matsunami H . 2012 . Functional evolution of mammalian odorant receptors . PLoS Genet . 8 ( 7 ): e1002821 . Google Scholar Crossref Search ADS PubMed WorldCat Andersson DA Nash M Bevan S . 2007 . Modulation of the cold-activated channel TRPM8 by lysophospholipids and polyunsaturated fatty acids . J Neurosci . 27 ( 12 ): 3347 – 3355 . Google Scholar Crossref Search ADS PubMed WorldCat Babes A Zorzon D Reid G . 2006 . A novel type of cold-sensitive neuron in rat dorsal root ganglia with rapid adaptation to cooling stimuli . Eur J Neurosci . 24 ( 3 ): 691 – 698 . Google Scholar Crossref Search ADS PubMed WorldCat Behrendt HJ Germann T Gillen C Hatt H Jostock R . 2004 . Characterization of the mouse cold-menthol receptor TRPM8 and vanilloid receptor type-1 VR1 using a fluorometric imaging plate reader (FLIPR) assay . Br J Pharmacol . 141 ( 4 ): 737 – 745 . Google Scholar Crossref Search ADS PubMed WorldCat Benedikt J Teisinger J Vyklicky L Vlachova V . 2007 . Ethanol inhibits cold-menthol receptor TRPM8 by modulating its interaction with membrane phosphatidylinositol 4,5-bisphosphate . J Neurochem . 100 ( 1 ): 211 – 224 . Google Scholar Crossref Search ADS PubMed WorldCat Burrow A Eccles R Jones AS . 1983 . The effects of camphor, eucalyptus and menthol vapour on nasal resistance to airflow and nasal sensation . Acta Otolaryngol . 96 ( 1–2 ): 157 – 161 . Google Scholar Crossref Search ADS PubMed WorldCat Campero M Baumann TK Bostock H Ochoa JL . 2009 . Human cutaneous C fibres activated by cooling, heating and menthol . J Physiol . 587 : 5633 – 5652 . Google Scholar Crossref Search ADS PubMed WorldCat Chuang HH Neuhausser WM Julius D . 2004 . The super-cooling agent icilin reveals a mechanism of coincidence detection by a temperature-sensitive TRP channel . Neuron . 43 ( 6 ): 859 – 869 . Google Scholar Crossref Search ADS PubMed WorldCat Daniels RL Takashima Y McKemy DD . 2009 . Activity of the neuronal cold sensor TRPM8 is regulated by phospholipase C via the phospholipid phosphoinositol 4,5-bisphosphate . J Biol Chem . 284 ( 3 ): 1570 – 1582 . Google Scholar Crossref Search ADS PubMed WorldCat Frederick J Buck ME Matson DJ Cortright DN . 2007 . Increased TRPA1, TRPM8, and TRPV2 expression in dorsal root ganglia by nerve injury . Biochem Biophys Res Commun . 358 ( 4 ): 1058 – 1064 . Google Scholar Crossref Search ADS PubMed WorldCat Green BG . 1990 . Sensory characteristics of camphor . J Invest Dermatol . 94 ( 5 ): 662 – 666 . Google Scholar Crossref Search ADS PubMed WorldCat Hall AC Turcotte CM Betts BA Yeung WY Agyeman AS Burk LA . 2004 . Modulation of human GABAA and glycine receptor currents by menthol and related monoterpenoids . Eur J Pharmacol . 506 – 9 – 16 . Google Scholar Crossref Search ADS WorldCat Hu HZ Gu Q Wang C Colton CK Tang J Kinoshita-Kawada M Lee LY Wood JD Zhu MX . 2004 . 2-aminoethoxydiphenyl borate is a common activator of TRPV1, TRPV2, and TRPV3 . J Biol Chem . 279 ( 34 ): 35741 – 35748 . Google Scholar Crossref Search ADS PubMed WorldCat Kim KY Bang S Han S Nguyen YH Kang TM Kang KW Hwang SW . 2008 . TRP-independent inhibition of the phospholipase C pathway by natural sensory ligands . Biochem Biophys Res Commun . 370 ( 2 ): 295 – 300 . Google Scholar Crossref Search ADS PubMed WorldCat Klasen K Hollatz D Zielke S Gisselmann G Hatt H Wetzel CH . 2012 . The TRPM8 ion channel comprises direct Gq protein-activating capacity . Pflugers Arch . 463 ( 6 ): 779 – 797 . Google Scholar Crossref Search ADS PubMed WorldCat Klein AH Iodi Carstens M McCluskey TS Blancher G Simons CT Slack JP Furrer S Carstens E . 2011 . Novel menthol-derived cooling compounds activate primary and second-order trigeminal sensory neurons and modulate lingual thermosensitivity . Chem Senses . 36 ( 7 ): 649 – 658 . Google Scholar Crossref Search ADS PubMed WorldCat Kobayashi K Fukuoka T Obata K Yamanaka H Dai Y Tokunaga A Noguchi K . 2005 . Distinct expression of TRPM8, TRPA1, and TRPV1 mRNAs in rat primary afferent neurons with adelta/c-fibers and colocalization with trk receptors . J Comp Neurol . 493 ( 4 ): 596 – 606 . Google Scholar Crossref Search ADS PubMed WorldCat Kühn FJ Kühn C Lückhoff A . 2009 . Inhibition of TRPM8 by icilin distinct from desensitization induced by menthol and menthol derivatives . J Biol Chem . 284 ( 7 ): 4102 – 4111 . Google Scholar Crossref Search ADS PubMed WorldCat Kohno K Sokabe T Tominaga M Kadowaki T . 2010 . Honey bee thermal/chemical sensor, AmHsTRPA, reveals neofunctionalization and loss of transient receptor potential channel genes . J Neurosci . 30 ( 37 ): 12219 – 12229 . Google Scholar Crossref Search ADS PubMed WorldCat Macpherson LJ Hwang SW Miyamoto T Dubin AE Patapoutian A Story GM . 2006 . More than cool: promiscuous relationships of menthol and other sensory compounds . Mol Cell Neurosci . 32 ( 4 ): 335 – 343 . Google Scholar Crossref Search ADS PubMed WorldCat Marsakova L Touska F Krusek J Vlachova V . 2012 . Pore helix domain is critical to camphor sensitivity of transient receptor potential vanilloid 1 channel . Anesthesiology . 116 ( 4 ): 903 – 917 . Google Scholar Crossref Search ADS PubMed WorldCat McKemy DD Neuhausser WM Julius D . 2002 . Identification of a cold receptor reveals a general role for TRP channels in thermosensation . Nature . 416 ( 6876 ): 52 – 58 . Google Scholar Crossref Search ADS PubMed WorldCat Moqrich A Hwang SW Earley TJ Petrus MJ Murray AN Spencer KS Andahazy M Story GM Patapoutian A . 2005 . Impaired thermosensation in mice lacking TRPV3, a heat and camphor sensor in the skin . Science . 307 ( 5714 ): 1468 – 1472 . Google Scholar Crossref Search ADS PubMed WorldCat Nakashimo Y Takumida M Fukuiri T Anniko M Hirakawa K . 2010 . Expression of transient receptor potential channel vanilloid (TRPV) 1–4, melastin (TRPM) 5 and 8, and ankyrin (TRPA1) in the normal and methimazole-treated mouse olfactory epithelium . Acta Otolaryngol . 130 ( 11 ): 1278 – 1286 . Google Scholar Crossref Search ADS PubMed WorldCat Park TJ Seo HK Kang BJ Kim KT . 2001 . Noncompetitive inhibition by camphor of nicotinic acetylcholine receptors . Biochem Pharmacol . 61 : 787 – 793 . Google Scholar Crossref Search ADS PubMed WorldCat Peier AM Reeve AJ Andersson DA Moqrich A Earley TJ Hergarden AC Story GM Colley S Hogenesch JB McIntyre P et al. . 2002 . A heat-sensitive TRP channel expressed in keratinocytes . Science . 296 ( 5575 ): 2046 – 2049 . Google Scholar Crossref Search ADS PubMed WorldCat Reid G Amuzescu B Zech E Flonta ML . 2001 . A system for applying rapid warming or cooling stimuli to cells during patch clamp recording or ion imaging . J Neurosci Methods . 111 ( 1 ): 1 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat Reid G Babes A Pluteanu F . 2002 . A cold- and menthol-activated current in rat dorsal root ganglion neurones: properties and role in cold transduction . J Physiol . 545 : 595 – 614 . Google Scholar Crossref Search ADS PubMed WorldCat Sarria I Ling J Zhu MX Gu JG . 2011 . TRPM8 acute desensitization is mediated by calmodulin and requires PIP(2): distinction from tachyphylaxis . J Neurophysiol . 106 ( 6 ): 3056 – 3066 . Google Scholar Crossref Search ADS PubMed WorldCat Sicard G . 1985 . Olfactory discrimination of structurally related molecules: receptor cell responses to camphoraceous odorants . Brain Res . 326 ( 2 ): 203 – 212 . Google Scholar Crossref Search ADS PubMed WorldCat Sokabe T Tsujiuchi S Kadowaki T Tominaga M . 2008 . Drosophila painless is a Ca2+-requiring channel activated by noxious heat . J Neurosci . 28 ( 40 ): 9929 – 9938 . Google Scholar Crossref Search ADS PubMed WorldCat Story GM Peier AM Reeve AJ Eid SR Mosbacher J Hricik TR Earley TJ Hergarden AC Andersson DA Hwang SW et al. . 2003 . ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures . Cell . 112 ( 6 ): 819 – 829 . Google Scholar Crossref Search ADS PubMed WorldCat Vogt-Eisele AK Weber K Sherkheli MA Vielhaber G Panten J Gisselmann G Hatt H . 2007 . Monoterpenoid agonists of TRPV3 . Br J Pharmacol . 151 ( 4 ): 530 – 540 . Google Scholar Crossref Search ADS PubMed WorldCat Weil A Moore SE Waite NJ Randall A Gunthorpe MJ . 2005 . Conservation of functional and pharmacological properties in the distantly related temperature sensors TRVP1 and TRPM8 . Mol Pharmacol . 68 ( 2 ): 518 – 527 . Google Scholar PubMed OpenURL Placeholder Text WorldCat Xu H Blair NT Clapham DE . 2005 . Camphor activates and strongly desensitizes the transient receptor potential vanilloid subtype 1 channel in a vanilloid-independent mechanism . J Neurosci . 25 ( 39 ): 8924 – 8937 . Google Scholar Crossref Search ADS PubMed WorldCat Xu H Ramsey IS Kotecha SA Moran MM Chong JA Lawson D Ge P Lilly J Silos-Santiago I et al. . 2002 . TRPV3 is a calcium-permeable temperature-sensitive cation channel . Nature . 418 ( 6894 ): 181 – 186 . Google Scholar Crossref Search ADS PubMed WorldCat Yawo H Chuhma N . 1993 . An improved method for perforated patch recordings using nystatin-fluorescein mixture . Jpn J Physiol . 43 ( 2 ): 267 – 273 . Google Scholar Crossref Search ADS PubMed WorldCat Yudin Y Lukacs V Cao C Rohacs T . 2011 . Decrease in phosphatidylinositol 4,5-bisphosphate levels mediates desensitization of the cold sensor TRPM8 channels . J Physiol . 589 : 6007 – 6027 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author 2013. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com © The Author 2013. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com
TI - Camphor Activates and Sensitizes Transient Receptor Potential Melastatin 8 (TRPM8) to Cooling and Icilin
JF - Chemical Senses
DO - 10.1093/chemse/bjt027
DA - 2013-09-01
UR - https://www.deepdyve.com/lp/oxford-university-press/camphor-activates-and-sensitizes-transient-receptor-potential-JMN8jILgi7
SP - 563
EP - 575
VL - 38
IS - 7
DP - DeepDyve
ER -