TY - JOUR
AU - Farinotti,, Robert
AB - Abstract Purpose. The effect of ABCB1 3435C>T on tacrolimus concentrations in liver transplant recipients was studied. Tacrolimus is a substrate for P-glycoprotein, the product of the ABCB1 gene. To determine whether the ABCB1 single-nucleotide polymorphism (SNP) 3435C>T was associated with variation in the tacrolimus concentration:dose ratio (C:D) in 42 liver transplant recipients during three months after transplantation. Methods. Forty-two Caucasian patients who underwent an orthotopic liver transplantation from cadaveric donors received a basic immunosuppressive regimen containing tacrolimus and corticosteroids; mycophenolate mofetil was added in 18 cases. The SNP 3435C>T in exon 26 was investigated by MboI restriction-enzyme digestion, leading to the identification of CC, TT, or CT status at nucleotide 3435. Results obtained for the three genotypes were compared for each of three values: daily weight-adjusted tacrolimus dose, blood trough tacrolimus concentration, and C:D. Results. The wild-type genotype (3435CC) was observed in 10 patients (24%); 23 patients (55%) were heterozygous (3435CT) and 9 patients (21%) were homozygous for the mutation (3435TT). One to three days after liver transplantation, the mean ± S.D. C:D was significantly higher in subjects homozygous for the mutation compared with subjects with the wild-type allele (236 ± 119 ng · kg/mL · mg versus 104 ± 74 ng · kg/mL · mg, respectively; p = 0.0167). Subjects with the heterozygous allele had an intermediate mean ± S.D. C:D (131 ± 108 ng · kg/mL · mg). One or three months after transplantation, no significant difference in the tacrolimus C:D was evident among the three groups. Conclusion. The ABCB1 3435C>T polymorphism influenced the tacrolimus C:D in the first days after liver transplantation. Blood levels, Dosage, Immunosuppressive agents, Mycophenolate mofetil, Pharmacokinetics, Polymorphisms, Steroids, cortico-, Tacrolimus, Transplantation Tacrolimus, an immunosuppressive drug used in organ transplantation, is characterized by high interindividual variations in oral bioavailability and a low therapeutic index. It therefore requires monitoring by measuring whole blood trough concentration, which should be 5–15 ng/mL to avoid transplant rejection and minimize adverse effects.1 Genes encoding the cytochrome P-450 (CYP) biotransformation isoenzyme 3A (CYP3A) and drug transporters have an important role in tacrolimus bioavailability.2 Tacrolimus is a substrate for P-glycoprotein, which is the product of the ABCB1 (ATP-binding cassette B1) gene.3 P-glycoprotein is capable of transporting different hydrophobic, cationic, and amphoteric substrates. In the intestine, P-glycoprotein is located almost exclusively within the brush border on the apical (luminal) surface of the enterocyte, where it pumps xenobiotics back into the intestinal lumen. Since P-glycoprotein is an efflux transporter, its high expression in the enterocyte reduces intestinal drug absorption; thus, variation in intestinal P-glycoprotein expression affects drug bioavailability.4 P-glycoprotein is involved in the initial intestinal absorption of tacrolimus, which is the tacrolimus clearance mechanism that occurs before hepatic metabolism by CYP isoenzyme 3A4 (CYP3A4) and CYP isoenzyme 3A5 (CYP3A5). The mean oral bioavailability of tacrolimus is about 22% (range, 14–38%).5 The half-life of tacrolimus is long and variable (3.5–40.5 hours); in adult and pediatric liver transplant recipients, tacrolimus’s average half-life is 11.7 and 12.4 hours, respectively, compared with 15.6 hours in adult kidney transplant recipients.6 The tacrolimus trough concentration is strongly correlated with the area under the time–concentration curve (AUC) at steady state and is therefore a good indicator of systemic exposure in liver transplantation.7 Achieving target tacrolimus trough concentrations soon after posttransplantation is important for reducing the risk of acute rejection and adverse effects. Undre et al.8 suggested that the risk of acute transplant rejection is higher with low systemic exposure to tacrolimus during the early posttransplantation period. They reported that the mean AUC0–12 hr of tacrolimus on day 2 after kidney transplantation was significantly lower in patients who experienced acute rejection than in those who remained rejection free. Therefore, those investigators recommended that the tacrolimus concentration 12 hours after dosing of at least 10 ng/mL should be reached two to three days after kidney transplantation. Masuda et al.9 found that in living donor liver transplant recipients, the probability of acute cellular rejection during the first 10 days after surgery was significantly associated with the average trough tacrolimus concentration between postoperative days 2 and 4 and that variation in the concentration:dose ratio (C:D) was related to the enterocyte messenger RNA (mRNA) expression level of P-glycoprotein but not CYP3A4. The intestinal expression level of P-glycoprotein and the average trough concentration were identified as factors useful for predicting the risk of acute cellular rejection between postoperative days 2 and 4 after liver transplantation. One polymorphism of the ABCB1 gene has been associated with lower intestinal P-glycoprotein expression and activity in vivo. This single-nucleotide polymorphism (SNP) is a cytosine-to-thymine exchange at nucleotide 3435 (3435C>T) located in exon 26 and does not affect the amino acid sequence of P-glycoprotein. Caucasians homozygous for the mutation at position 3435 (thymine, thymine) had significantly lower P-glycoprotein levels in the small intestine compared with the remainder of the population and had higher plasma digoxin concentrations after oral administration of the drug.10 CYP3A4 gene polymorphisms have been linked with variation in drug pharmacokinetics. Some studies have shown that CYP3A5 can contribute to interindividual variation of the apparent clearance of oral tacrolimus.11,12 However, in the case of liver transplantation, CYP3A is not functional in the early days after transplantation. Because of the seriousness of avoiding graft rejection and the major contribution of P-glycoprotein during the first week after liver transplantation, we studied the influence of the ABCB1 polymorphism for up to three months posttransplantation. We investigated whether the 3435C>T polymorphism might influence the tacrolimus dosage requirement in liver transplant recipients. To this end, we compared the ABCB1 3435C>T SNP with the C:D in 42 de novo liver transplant recipients several days, one, and three months after transplantation. Few studies have been conducted in Europe on the influence of this P-glycoprotein SNP on the tacrolimus C:D in the setting of liver transplantation.13,–15 Methods Patients Forty-two Caucasian patients (31 men and 11 women) who underwent an orthotopic liver transplantation from cadaveric donors were included. They received a basic immunosuppressive regimen containing tacrolimus with corticosteroids, and mycophenolate mofetil was added in 18 cases. The study was approved by the institutional review board, and written informed consent was obtained from all patients. For every patient, the tacrolimus initial dosage, 0.1 mg/kg daily, was administered orally by nasogastric tube twice daily in divided doses. The dosage was then adjusted according to trough concentrations determined every day, 12 hours after the evening dose during the first month. Target blood tacrolimus concentrations were 8–15 ng/mL from day 0 to week 6 and 5–12 ng/mL after week 6. Methylprednisolone 10 mg/kg was administered orally before and after surgery; the dosage was reduced to 0.3 mg/kg on day 1 after surgery and tapered progressively after day 14. The patients did not receive any other drugs known to interact significantly with tacrolimus. Acute and chronic rejections were recorded, confirmed by biopsy, and graded according to Banff criteria.16 Therapeutic drug monitoring Blood collected for tacrolimus monitoring was treated with ethylene diamine tetraacetic acid (EDTA). Whole blood tacrolimus trough levels were measured using a microparticle enzyme immunoassay for tacrolimus (Tacrolimus II, Abbott Laboratories) with an Abbott IMx clinical analyzer. The functional sensitivity of the assay was 4.1 ng/mL. The laboratory was a member of the International Tacrolimus Proficiency Testing Scheme. Doses of tacrolimus were individually adjusted by blood trough concentrations. Data were recorded one to three days and one and three months after liver transplantation. Plasma bilirubin, creatinine, urea, and glucose levels were recorded before transplantation and one and three months after transplantation. Plasma creatinine levels were determined using the Jaffe kinetic method on a Synchron LX20 clinical system (Beckman Coulter) according to the manufacturer’s instructions. Plasma urea, bilirubin, and glucose levels were measured using the Synchron LX20 clinical system. The glomerular filtration rate (GFR) was estimated from the creatinine clearance using the Cockcroft-Gault17 formula. Genotype determination Genomic DNA was isolated from EDTA-anticoagulated whole blood using the QIAamp DNA Blood mini kit (Qiagen, Courtabeuf, France). The SNP 3435C>T in exon 26 was investigated by MboI restriction-enzyme digestion of exon-26 polymerase chain reaction (PCR) products. Primers were designed as forward 5′GATCTGTGAACTCTTGTTTTCA and reverse 5′GAAGAGAGACT TACATTAGGC. The PCR mixture contained 0.5 μL of genomic DNA, 0.5 μM of primers, 1 unit of Taq gold DNA polymerase (Applied Biosystems), 50 mM of potassium chloride, 10 mM of tris(hydroxymethyl) aminomethane–hydrochloride pH 8.3, 2.5 mM of magnesium chloride, and 200 μM of each deoxyribonucleotide triphosphate in a final volume of 30 μL. Cycling was performed in a GeneAmp PCR system 2400 (Applied Biosystems) with initial denaturation at 95°C for 10 minutes, and further denaturation occurred at 94°C for 30 seconds, 60°C for 30 seconds, 72°C for 30 seconds, and 72°C for 10 minutes. The 244-base pair PCR product was submitted to overnight MboI digestion at 37°C. The MboI restriction enzyme cleaves the wild-type allele at nucleotides 3434 and 3606, resulting in three fragments of 172, 68, and 4 base pairs. The mutated 3435T allele is cleaved only at nucleotide 3606, resulting in two fragments of 240 and 4 base pairs. Reaction products were separated by electrophoresis with 12% polyacrylamide gel and revealed by ethidium bromide, leading to identification of CC (wild type), TT (mutated), or CT status at nucleotide 3435. A CC sample and a TT sample were added as a quality control in each series. Statistical analysis Results obtained for the three genotypes were compared for each of three values: daily weight-adjusted tacrolimus dose, blood trough tacrolimus concentration, and C:D. C:D was calculated by dividing the tacrolimus trough level by the corresponding milligrams of tacrolimus given per kilogram of body weight over 24 hours. The Hardy-Weinberg equilibrium of alleles at individual loci was tested with a chi-square test with 1 degree of freedom to compare the observed and expected genotype frequencies among patients. A parametric test was used when variables followed a normal distribution. To ensure that data were normally distributed, the Shapiro-Wilk test was applied. When the distribution significantly differed from normal, a nonparametric test was used. One-way analysis of variance or Kruskal–Wallis test was used to detect differences among patients with different genotypes for each sequential time point; the a priori level of significance was <0.0167. Bonferroni adjustment was used to detect significant differences between groups in two-by-two comparisons. Statistical analyses were performed using StatView, version 5.0 (Abacus Concepts, Berkeley, CA). Results The demographic characteristics of the 42 patients are shown in Table 1. Overall, the mean ± S.D. age was 54 ± 12 years. The wild-type genotype (3435CC) was observed in 10 patients (24%), whereas 23 patients (55%) were heterozygous (3435CT), and 9 patients (21%) were homozygous for the 3435TT mutation. No significant differences in patients’ age, mean weight, and corticosteroid treatment were observed. The genotype distribution of each polymorphism was in Hardy-Weinberg equilibrium—none of the observed frequencies was significantly different from the expected frequencies (data not shown). In the first three days after transplantation, the mean weight-adjusted tacrolimus dosage did not significantly differ among the three groups (Table 2). In addition, this dose did not vary significantly at one or three months after transplantation. As previously described, there was a high interindividual variability in the dose required to achieve the target concentration range. In the CC and CT groups, the mean trough tacrolimus concentration was in or slightly above the target range (8–15 ng/mL) as soon as the treatment was started; it was significantly higher in the TT group than in the CT group. During this initial period, 6 of the 10 patients in the CC group had a trough tacrolimus concentration of <8 ng/mL, as did 12 of the 23 patients in the CT group and 1 of the 9 in the TT group. After one or three months, the mean tacrolimus level remained in the target range in all three groups. These data were then analyzed in terms of C:D. The initial mean ± S.D. C:D was significantly higher in 3435TT carriers compared with CT and CC carriers. No significant difference among the three groups was observed one or three months later. Biopsy-confirmed acute liver rejection occurred in one 3435CC carrier. There was no significant difference among the three groups in renal function as assessed by creatinine and urea levels or in hepatic function assessed by bilirubin and glycemia before or after transplantation (Table 3). However, the mean ± S.D. GFR before liver transplantation was normal in the CC and TT groups but significantly lower in the CT group than in the TT group. One month after transplantation, the GFR decreased in the three groups and remained stable after three months. At one or three months, the GFR remained higher in the TT group than in the CT or CC group, though the difference was not significant. Plasma bilirubin level (normal range, <17 μmol/L) is a marker of hepatic recovery. As expected, patients’ plasma bilirubin levels decreased with time after transplantation, indicating hepatic recovery. After three months, the total and unconjugated bilirubin levels reached normal values in the three groups (Table 3). In all three groups, before or after transplantation, the mean plasma glucose concentration exceeded the normal range (3.9–5.3 mmol/L). No significant difference was observed among the three groups in plasma glucose concentration. However, at three months, the highest mean glucose concentration occurred in 3435CC patients, who also showed the highest tacrolimus C:D. Discussion There is no consensus on whether the ABCB1 3435C>T SNP affects the pharmacokinetics of immunosuppressive drugs,18 so we investigated the influence of this SNP on the tacrolimus dose and trough level in liver transplant recipients. The observed frequency of CC, CT, and TT genotypes in the studied population (24%, 55%, and 21%, respectively) was consistent with the expected distribution in the Caucasian population.19 Starting with an initial daily dose of 0.1 mg/kg, the mean trough tacrolimus concentration rapidly reached the 8–15-ng/mL target range in CC and CT subjects, while it was greater than the target range in TT subjects. Accordingly, C:D was significantly lower in CC patients than in TT patients and was intermediate in the CT group. This is consistent with greater intestinal absorption of tacrolimus in the TT group due to lower P-glycoprotein expression, as described by Hoffmeyer et al.10 Wei-lin et al.15 also found that in living-donor liver transplant recipients, the tacrolimus C:D was significantly lower in ABCB1 3435CC- carrying patients than among recipients carrying ABCB1 3435T allele, regardless of the donor’s CYP3A5 phenotype, at one week and during the first month after transplantation. Goto et al.13 observed that the pharmacokinetics of tacrolimus was influenced by P-glycoprotein in the intestine during the first week post-transplantation. Their findings are consistent with our previous observations regarding cyclosporine treatment in liver transplant recipients20 and with the results found by Foote et al.2 in renal transplant recipients, which showed that ABCB1 SNPs are associated with differences in cyclosporine exposure only in the first week posttransplantation. The early difference we observed in tacrolimus C:D among the three genotypes was not present one or three months after transplantation. Since hepatic metabolism is a major elimination process for calcineurin inhibitors like tacrolimus, liver recovery may account at least partly for this observation. Goto et al.13 found that after the first week after liver transplantation, tacrolimus is mainly excreted via hepatic metabolism. Thorn et al.21 found that the hepatic mRNA expression of CYP3A4 and CYP3A5, but not P-glycoprotein, increased during the first year after orthotopic liver transplantation. A significant relationship has been observed among intrahepatic tacrolimus concentration and two ABCB1 polymorphisms (C1199G>A and 2677G>TA) but not with hepatic expression of CYP3A5.22 We observed no significant difference between the initial tacrolimus dose and the dose required one or three months later. This differs from data we obtained for cyclosporine in liver transplant recipients, which showed that the cyclosporine dose required to reach the target therapeutic range decreased between the early days and one month after transplantation.20 The fact that cyclosporine and not tacrolimus behaves as a P-glycoprotein inhibitor in vivo might account for this observation. Although cyclosporine reduced hepatic and intestinal P-glycoprotein activity, therapeutic doses of tacrolimus did not alter P-glycoprotein activity in renal transplant recipients or in healthy control subjects.23 In agreement with that, while cyclosporine increased atorvastatin systemic exposure due to an inhibition of P-glycoprotein and CYP, tacrolimus did not interact with atorvastatin.24 A few months after transplantation, patients usually require less drug to achieve the same blood trough concentration of immunosuppressive drugs. We found that, in the three months after liver transplantation, the tacrolimus C:D increased in 3435CC patients, remained stable in CT patients, and decreased in TT patients. Zheng et al.25 conducted a sequential analysis of tacrolimus dosage over the first year after lung transplantation by ABCB1 haplotypes and observed that, depending on the haplotype, the mean C:D may increase or decrease over time. Several studies have suggested that bilirubin is a substrate for P-glycoprotein.26,27 Tacrolimus clearance is significantly reduced by elevated total bilirubin levels in hematopoietic cell transplant recipients.28 We did not find a significant difference in bilirubin levels among the three groups. Decreased corticosteroid dosage may also lead to reduced liver enzyme induction and a subsequent reduction in tacrolimus clearance. Renal dysfunction, a major late complication of liver transplantation, is predicted by high levels of calcineurin inhibitors.29 At three months, our TT group had the highest GFR; this finding is consistent with that group also having the lowest C:D. Hebert et al.30 reported that the frequency of renal dysfunction three years posttransplantation was reduced among patients homozygous for the ABCB1 2677T allele. They found that the mean serum creatinine concentration was greatest in patients with a 2677GT or 2677GG genotype compared with the 2677TT genotype and that this was also true for the 3435CT and 3435CC genotypes compared with the 3435TT genotype. Therefore, patients with two 3435T alleles may have reduced renal exposure to tacrolimus. Overall, our most significant observation is the higher C:D in the TT group at the initiation of treatment. Several studies have shown a lower tacrolimus dose requirement in TT patients. Macphee et al.31 found that 3 months after renal transplantation, the CC genotype was associated with a mean reduction in blood tacrolimus level of 1.44 times (95% confidence interval, 1.11–1.86 times), compared with the TT genotype. Akbas et al.32 observed that after 6 and 12 months, the tacrolimus C:D was higher in TT patients, and Anglicheau et al.33 made the same observations in renal transplant recipients with the 2677 SNP after 1 month, an SNP linked to the 3435 SNP. Finally, Fredericks et al.34 studied 206 stable renal transplant recipients and found that lower-dose-normalized blood tacrolimus concentrations were achieved for 2677GG genotype patients compared with 2677TT and for 3435CC patients compared with 3435TT patients. They found that the difference was not significant when patients were subclassified as producers and nonproducers of CYP3A5. Goto et al.13,14 did not find any influence of the 3435C>T SNP polymorphism on the tacrolimus C:D in living-donor liver transplant recipients. They demonstrated that in living-donor liver transplant recipients, P-glycoprotein expression in the intestine contributed to the trough tacrolimus level for the first week posttransplantation, after which the main organ of influence was the liver. Indeed, hepatic metabolism contributed to the excretion of tacrolimus after the first week of transplantation.13 Unlike what was observed in Caucasians,10 Masuda et al.35 did not observe any relationship between the 3435C>T SNP and intestinal expression of P-glycoprotein but instead concluded that the intestinal mRNA level is a useful molecular marker for determination of the oral dose of tacrolimus in recipients of a living-donor liver transplant immediately after surgery. A recent report also indicated that the ABCB1 mRNA level in enterocytes contributes to interindividual variation in tacrolimus oral clearance early after living-donor liver transplantation.12 Although the serum concentration of digoxin after oral administration of a single dose was higher in TT Caucasian subjects,10 it was lower in Japanese subjects harboring the mutant allele 3435T.36 Together, these data suggest that the Caucasian or Japanese genetic background influences the regulation of expression and that findings in Japanese subjects might not be relevant in a Caucasian population. However, Wei-lin et al.15 found that recipient ABCB1 C3435T polymorphism was a major determinant of trough tacrolimus concentrations in 50 Chinese liver transplant recipients, since recipients with the 3435CC genotype required a higher dosage of tacrolimus. However, the donors’ ABCB1 and recipients’ CYP3A5 genotypes did not affect the recipients’ pharmacokinetics. The relationship between the ABCB1 C3435T polymorphism and tacrolimus dosage or C:D is also influenced by the phenotype for CYP3A5. Wei-lin et al.15 found that the CYP3A5*1 allele was significantly associated with the tacrolimus dosage and C:D at two weeks and at one month after transplantation but not at one week. This suggests that the transplanted livers began to influence metabolism of tacrolimus approximately two weeks posttransplantation. Conclusion The ABCB1 3435C>T polymorphism influenced the tacrolimus C:D in the first days after liver transplantation. Table 1. Characteristics of Liver Transplant Recipients Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. Mean ± S.D. age (yr) 58 ± 14 53 ± 13 51 ± 9 No. (%) male 7 (70) 16 (70) 7 (78) Mean ± S.D. weight (kg) 73 ± 19 63 ± 17 76 ± 10 Mean ± S.D. daily postoperative prednisolone dose (mg)     Days 1–3 21 ± 5 20 ± 5 23 ± 3     1 mo 14 ± 5 13 ± 3 14 ± 1     3 mo 9 ± 5 7 ± 3 8 ± 3 Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. Mean ± S.D. age (yr) 58 ± 14 53 ± 13 51 ± 9 No. (%) male 7 (70) 16 (70) 7 (78) Mean ± S.D. weight (kg) 73 ± 19 63 ± 17 76 ± 10 Mean ± S.D. daily postoperative prednisolone dose (mg)     Days 1–3 21 ± 5 20 ± 5 23 ± 3     1 mo 14 ± 5 13 ± 3 14 ± 1     3 mo 9 ± 5 7 ± 3 8 ± 3 Table 1. Characteristics of Liver Transplant Recipients Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. Mean ± S.D. age (yr) 58 ± 14 53 ± 13 51 ± 9 No. (%) male 7 (70) 16 (70) 7 (78) Mean ± S.D. weight (kg) 73 ± 19 63 ± 17 76 ± 10 Mean ± S.D. daily postoperative prednisolone dose (mg)     Days 1–3 21 ± 5 20 ± 5 23 ± 3     1 mo 14 ± 5 13 ± 3 14 ± 1     3 mo 9 ± 5 7 ± 3 8 ± 3 Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. Mean ± S.D. age (yr) 58 ± 14 53 ± 13 51 ± 9 No. (%) male 7 (70) 16 (70) 7 (78) Mean ± S.D. weight (kg) 73 ± 19 63 ± 17 76 ± 10 Mean ± S.D. daily postoperative prednisolone dose (mg)     Days 1–3 21 ± 5 20 ± 5 23 ± 3     1 mo 14 ± 5 13 ± 3 14 ± 1     3 mo 9 ± 5 7 ± 3 8 ± 3 Table 2. Postoperative Tacrolimus-Related Characteristics of Liver Transplant Recipients Mean ± S.D. Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp < 0.0167 for comparison with CT (analysis of variance). cp < 0.0167 for comparison with CT and CC (Kruskal–Wallis test). Daily tacrolimus dose (mg/kg)     Days 1–3 0.107 ± 0.05 0.081 ± 0.039 0.083 ± 0.049     1 mo 0.123 ± 0.078 0.13 ± 0.074 0.109 ± 0.061     3 mo 0.091 ± 0.067 0.094 ± 0.073 0.093 ± 0.048 Trough tacrolimus concentration (ng/mL)     Days 1–3 10.2 ± 7.9 9.1 ± 4.9 16.0 ± 7.4b     1 mo 13.08 ± 5.69 10.4 ± 4.52 10.6 ± 3.15     3 mo 10.43 ± 2.98 8.34 ± 3.44 7.97 ± 1.73 Concentration:dose ratio (ng · kg/mL · mg)     Days 1–3 104 ± 74 131 ± 108 236 ± 119c     1 mo 162 ± 136 104 ± 66 136 ± 114     3 mo 156 ± 92 127 ± 84 106 ± 57 Mean ± S.D. Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp < 0.0167 for comparison with CT (analysis of variance). cp < 0.0167 for comparison with CT and CC (Kruskal–Wallis test). Daily tacrolimus dose (mg/kg)     Days 1–3 0.107 ± 0.05 0.081 ± 0.039 0.083 ± 0.049     1 mo 0.123 ± 0.078 0.13 ± 0.074 0.109 ± 0.061     3 mo 0.091 ± 0.067 0.094 ± 0.073 0.093 ± 0.048 Trough tacrolimus concentration (ng/mL)     Days 1–3 10.2 ± 7.9 9.1 ± 4.9 16.0 ± 7.4b     1 mo 13.08 ± 5.69 10.4 ± 4.52 10.6 ± 3.15     3 mo 10.43 ± 2.98 8.34 ± 3.44 7.97 ± 1.73 Concentration:dose ratio (ng · kg/mL · mg)     Days 1–3 104 ± 74 131 ± 108 236 ± 119c     1 mo 162 ± 136 104 ± 66 136 ± 114     3 mo 156 ± 92 127 ± 84 106 ± 57 Table 2. Postoperative Tacrolimus-Related Characteristics of Liver Transplant Recipients Mean ± S.D. Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp < 0.0167 for comparison with CT (analysis of variance). cp < 0.0167 for comparison with CT and CC (Kruskal–Wallis test). Daily tacrolimus dose (mg/kg)     Days 1–3 0.107 ± 0.05 0.081 ± 0.039 0.083 ± 0.049     1 mo 0.123 ± 0.078 0.13 ± 0.074 0.109 ± 0.061     3 mo 0.091 ± 0.067 0.094 ± 0.073 0.093 ± 0.048 Trough tacrolimus concentration (ng/mL)     Days 1–3 10.2 ± 7.9 9.1 ± 4.9 16.0 ± 7.4b     1 mo 13.08 ± 5.69 10.4 ± 4.52 10.6 ± 3.15     3 mo 10.43 ± 2.98 8.34 ± 3.44 7.97 ± 1.73 Concentration:dose ratio (ng · kg/mL · mg)     Days 1–3 104 ± 74 131 ± 108 236 ± 119c     1 mo 162 ± 136 104 ± 66 136 ± 114     3 mo 156 ± 92 127 ± 84 106 ± 57 Mean ± S.D. Value in VariousABCB13435 Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp < 0.0167 for comparison with CT (analysis of variance). cp < 0.0167 for comparison with CT and CC (Kruskal–Wallis test). Daily tacrolimus dose (mg/kg)     Days 1–3 0.107 ± 0.05 0.081 ± 0.039 0.083 ± 0.049     1 mo 0.123 ± 0.078 0.13 ± 0.074 0.109 ± 0.061     3 mo 0.091 ± 0.067 0.094 ± 0.073 0.093 ± 0.048 Trough tacrolimus concentration (ng/mL)     Days 1–3 10.2 ± 7.9 9.1 ± 4.9 16.0 ± 7.4b     1 mo 13.08 ± 5.69 10.4 ± 4.52 10.6 ± 3.15     3 mo 10.43 ± 2.98 8.34 ± 3.44 7.97 ± 1.73 Concentration:dose ratio (ng · kg/mL · mg)     Days 1–3 104 ± 74 131 ± 108 236 ± 119c     1 mo 162 ± 136 104 ± 66 136 ± 114     3 mo 156 ± 92 127 ± 84 106 ± 57 Table 3. Comparison of Laboratory Values in Liver Transplant Recipients Mean ± S.D. Value in VariousABCB1Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp = 0.0167 for comparison with CT (Kruskal–Wallis test). Glomerular filtration rate (mL/min)     Preoperatively 98.9 ± 37.6 72.8 ± 22.8 107.5 ± 28.9b     1 mo postoperatively 55.9 ± 24.6 61.3 ± 23.1 74.9 ± 32.1     3 mo postoperatively 56.6 ± 18.3 61.4 ± 22.4 84.6 ± 34.4 Plasma creatinine concentration (μmol/L)     Preoperatively 77 ± 22 94 ± 28 85 ± 23     1 mo postoperatively 137 ± 80 113 ± 33 111 ± 25     3 mo postoperatively 133 ± 56 113 ± 33 101 ± 27 Plasma urea concentration (mmol/L)     Preoperatively 7.7 ± 7.2 9.8 ± 7.0 4.1 ± 2     1 mo postoperatively 11.7 ± 10.2 11.0 ± 6.9 8.0 ± 3.2     3 mo postoperatively 10.4 ± 8.6 7.8 ± 2.8 7.4 ± 2.6 Plasma glucose concentration (mmol/L)     Preoperatively 8.20 ± 4.09 6.80 ± 1.79 8.20 ± 4.1     1 mo postoperatively 5.95 ± 1.21 6.16 ± 1.38 7.33 ± 2.18     3 mo postoperatively 6.48 ± 1.30 6.07 ± 0.75 5.66 ± 1.53 Total plasma bilirubin concentration (μmol/L)     Preoperatively 51 ± 82 88 ± 173 100 ± 112     1 mo postoperatively 43 ± 76 27 ± 50 17 ± 12     3 mo postoperatively 16 ± 8 13 ± 3 12 ± 5 Unconjugated plasma bilirubin concentration (μmol/L)     Preoperatively 23 ± 48 40 ± 102 41 ± 53     1 mo postoperatively 31 ± 63 17 ± 42 6 ± 43     3 mo postoperatively 4 ± 5 3 ± 1 2 ± 1 Mean ± S.D. Value in VariousABCB1Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp = 0.0167 for comparison with CT (Kruskal–Wallis test). Glomerular filtration rate (mL/min)     Preoperatively 98.9 ± 37.6 72.8 ± 22.8 107.5 ± 28.9b     1 mo postoperatively 55.9 ± 24.6 61.3 ± 23.1 74.9 ± 32.1     3 mo postoperatively 56.6 ± 18.3 61.4 ± 22.4 84.6 ± 34.4 Plasma creatinine concentration (μmol/L)     Preoperatively 77 ± 22 94 ± 28 85 ± 23     1 mo postoperatively 137 ± 80 113 ± 33 111 ± 25     3 mo postoperatively 133 ± 56 113 ± 33 101 ± 27 Plasma urea concentration (mmol/L)     Preoperatively 7.7 ± 7.2 9.8 ± 7.0 4.1 ± 2     1 mo postoperatively 11.7 ± 10.2 11.0 ± 6.9 8.0 ± 3.2     3 mo postoperatively 10.4 ± 8.6 7.8 ± 2.8 7.4 ± 2.6 Plasma glucose concentration (mmol/L)     Preoperatively 8.20 ± 4.09 6.80 ± 1.79 8.20 ± 4.1     1 mo postoperatively 5.95 ± 1.21 6.16 ± 1.38 7.33 ± 2.18     3 mo postoperatively 6.48 ± 1.30 6.07 ± 0.75 5.66 ± 1.53 Total plasma bilirubin concentration (μmol/L)     Preoperatively 51 ± 82 88 ± 173 100 ± 112     1 mo postoperatively 43 ± 76 27 ± 50 17 ± 12     3 mo postoperatively 16 ± 8 13 ± 3 12 ± 5 Unconjugated plasma bilirubin concentration (μmol/L)     Preoperatively 23 ± 48 40 ± 102 41 ± 53     1 mo postoperatively 31 ± 63 17 ± 42 6 ± 43     3 mo postoperatively 4 ± 5 3 ± 1 2 ± 1 Table 3. Comparison of Laboratory Values in Liver Transplant Recipients Mean ± S.D. Value in VariousABCB1Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp = 0.0167 for comparison with CT (Kruskal–Wallis test). Glomerular filtration rate (mL/min)     Preoperatively 98.9 ± 37.6 72.8 ± 22.8 107.5 ± 28.9b     1 mo postoperatively 55.9 ± 24.6 61.3 ± 23.1 74.9 ± 32.1     3 mo postoperatively 56.6 ± 18.3 61.4 ± 22.4 84.6 ± 34.4 Plasma creatinine concentration (μmol/L)     Preoperatively 77 ± 22 94 ± 28 85 ± 23     1 mo postoperatively 137 ± 80 113 ± 33 111 ± 25     3 mo postoperatively 133 ± 56 113 ± 33 101 ± 27 Plasma urea concentration (mmol/L)     Preoperatively 7.7 ± 7.2 9.8 ± 7.0 4.1 ± 2     1 mo postoperatively 11.7 ± 10.2 11.0 ± 6.9 8.0 ± 3.2     3 mo postoperatively 10.4 ± 8.6 7.8 ± 2.8 7.4 ± 2.6 Plasma glucose concentration (mmol/L)     Preoperatively 8.20 ± 4.09 6.80 ± 1.79 8.20 ± 4.1     1 mo postoperatively 5.95 ± 1.21 6.16 ± 1.38 7.33 ± 2.18     3 mo postoperatively 6.48 ± 1.30 6.07 ± 0.75 5.66 ± 1.53 Total plasma bilirubin concentration (μmol/L)     Preoperatively 51 ± 82 88 ± 173 100 ± 112     1 mo postoperatively 43 ± 76 27 ± 50 17 ± 12     3 mo postoperatively 16 ± 8 13 ± 3 12 ± 5 Unconjugated plasma bilirubin concentration (μmol/L)     Preoperatively 23 ± 48 40 ± 102 41 ± 53     1 mo postoperatively 31 ± 63 17 ± 42 6 ± 43     3 mo postoperatively 4 ± 5 3 ± 1 2 ± 1 Mean ± S.D. Value in VariousABCB1Genotypesa Variable CC (n= 10) CT (n= 23) TT (n= 9) aC = cytosine, T = thymine. bp = 0.0167 for comparison with CT (Kruskal–Wallis test). Glomerular filtration rate (mL/min)     Preoperatively 98.9 ± 37.6 72.8 ± 22.8 107.5 ± 28.9b     1 mo postoperatively 55.9 ± 24.6 61.3 ± 23.1 74.9 ± 32.1     3 mo postoperatively 56.6 ± 18.3 61.4 ± 22.4 84.6 ± 34.4 Plasma creatinine concentration (μmol/L)     Preoperatively 77 ± 22 94 ± 28 85 ± 23     1 mo postoperatively 137 ± 80 113 ± 33 111 ± 25     3 mo postoperatively 133 ± 56 113 ± 33 101 ± 27 Plasma urea concentration (mmol/L)     Preoperatively 7.7 ± 7.2 9.8 ± 7.0 4.1 ± 2     1 mo postoperatively 11.7 ± 10.2 11.0 ± 6.9 8.0 ± 3.2     3 mo postoperatively 10.4 ± 8.6 7.8 ± 2.8 7.4 ± 2.6 Plasma glucose concentration (mmol/L)     Preoperatively 8.20 ± 4.09 6.80 ± 1.79 8.20 ± 4.1     1 mo postoperatively 5.95 ± 1.21 6.16 ± 1.38 7.33 ± 2.18     3 mo postoperatively 6.48 ± 1.30 6.07 ± 0.75 5.66 ± 1.53 Total plasma bilirubin concentration (μmol/L)     Preoperatively 51 ± 82 88 ± 173 100 ± 112     1 mo postoperatively 43 ± 76 27 ± 50 17 ± 12     3 mo postoperatively 16 ± 8 13 ± 3 12 ± 5 Unconjugated plasma bilirubin concentration (μmol/L)     Preoperatively 23 ± 48 40 ± 102 41 ± 53     1 mo postoperatively 31 ± 63 17 ± 42 6 ± 43     3 mo postoperatively 4 ± 5 3 ± 1 2 ± 1 References 1 Hebert MF. Contributions of hepatic and intestinal metabolism and P-glycoprotein to cyclosporine and tacrolimus oral drug delivery. Adv Drug Deliv Rev . 1997 ; 27 : 201 –14. Crossref Search ADS PubMed 2 Foote CJ, Greer W, Kiberd B et al. Polymorphisms of multidrug resistance gene (MDR1) and cyclosporine absorption in de novo renal transplant patients. Transplantation . 2007 ; 83 : 1380 –4. Crossref Search ADS PubMed 3 Saeki T, Ueda K, Tanigawara Y et al. Human P-glycoprotein transports cyclosporin A and FK 506. J Biol Chem . 1993 ; 268 : 6077 –80. PubMed 4 Evans WE, McLeod HL. Pharmacogenomics—drug disposition, drug targets, and side effects. N Engl J Med . 2003 ; 348 : 538 –49. Crossref Search ADS PubMed 5 Gonschior A, Christians U, Braun F et al. Measurement of blood concentrations of FK 506 (tacrolimus) and its metabolites in seven liver graft patients after first dose by HPLC-MS and microparticulate enzyme immunoassay (MEIA). Br J Clin Pharmacol . 1994 ; 38 : 567 –71. Crossref Search ADS PubMed 6 Jusko WJ, Piekoszewski W, Klintmalm GB et al. Pharmacokinetics of tacrolimus in liver transplant patients. Clin Pharmacol Ther . 1995 ; 57 : 281 –90. Crossref Search ADS PubMed 7 Böttiger Y, Undre NA, Säwe J et al. Effect of bile flow on the absorption of tacrolimus in liver allograft transplantation. Transplant Proc . 2002 ; 34 : 1544 –55. Crossref Search ADS PubMed 8 Undre NA, van Hooff J, Christiaans M et al. Low systemic exposure to tacrolimus correlates with acute rejection. Transplant Proc . 1999 ; 31 : 296 –8. Crossref Search ADS PubMed 9 Masuda S, Goto M, Fukatsu S et al. Intestinal MDR1/ABCB1 level at surgery as a risk factor of acute cellular rejection in living-donor liver transplant patients. Clin Pharmacol Ther . 2006 ; 79 : 90 –102. Crossref Search ADS PubMed 10 Hoffmeyer S, Burk O, Von Richter O et al. Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA . 2000 ; 97 : 3473 –8. Crossref Search ADS PubMed 11 Li D, Lu W, Zhu JY et al. Population pharmacokinetics of tacrolimus and CYP3A5, MDR1 and IL-10 polymorphisms in adult liver transplant patients. J Clin Pharm Ther . 2007 ; 32 : 505 –15. Crossref Search ADS PubMed 12 Fukudo M, Yano I, Yoshimura A et al. Impact of MDR1 and CYP3A5 on the oral clearance of tacrolimus and tacrolimus-related renal dysfunction in adult living-donor liver transplant patients. Pharmacogenet Genomics . 2008 ; 18 : 413 –23. Crossref Search ADS PubMed 13 Goto M, Masuda S, Kiuchi T et al. CYP3A5*1-carrying graft liver reduces the concentration/oral dose ratio of tacrolimus in recipients of living–donor liver transplantation. Pharmacogenetics . 2004 ; 14 : 471 –8. Crossref Search ADS PubMed 14 Goto M, Masuda S, Saito H et al. 3435C>T polymorphism in the gene affects the enterocyte expression level of CYP3A4 rather than Pgp in recipients of living-donor liver transplantation. Pharmacogenetics . 2002 ; 12 : 451 –7. Crossref Search ADS PubMed 15 Wei-lin W, Jing J, Shu-sen Z et al. Tacrolimus dose requirement in relation to donor and recipient ABCB1 and CYP3A5 gene polymorphisms in Chinese liver transplant patients. Liver Transpl . 2006 ; 12 : 775 –80. Crossref Search ADS PubMed 16 Demetris A, Adams D, Bellamy C et al. Update of the international Banff schema for liver allograft rejection: working recommendations for the histopathologic staging and reporting of chronic rejection. An international panel. Hepatology . 2000 ; 31 : 792 –9. Crossref Search ADS PubMed 17 Cockcroft DW, Gault MH. Prediction of creatinine clearance from serum creatinine. Nephron . 1976 ; 16 : 31 –41. Crossref Search ADS PubMed 18 Mourad M, Wallemacq P, De Meyer M et al. Biotransformation enzymes and drug transporters pharmacogenetics in relation to immunosuppressive drugs: impact on pharmacokinetics and clinical outcome. Transplantation . 2008 ; 85 (suppl 7): S19 –24. Crossref Search ADS PubMed 19 Bernal ML, Sinues B, Fanlo A et al. Frequency distribution of 3435C>T mutation in exon 26 of the gene in a Spanish population. Ther Drug Monit . 2003 ; 25 : 107 –11. Crossref Search ADS PubMed 20 Bonhomme-Faivre L, Devocelle A, Saliba F et al. MDR1 3435C>T polymorphism influences cyclosporin A dose requirement in liver-transplant recipients. Transplantation . 2004 ; 78 : 21 –5. PubMed 21 Thorn M, Lundgren S, Herlenius G et al. Gene expression of cytochromes P450 in liver transplants over time. Eur J Clin Pharmacol . 2004 ; 60 : 413 –20. PubMed 22 Elens L, Capron A, Kerckhove VV et al. 1199G>A and 2677G>T/A polymorphisms of ABCB1 independently affect tacrolimus concentration in hepatic tissue after liver transplantation. Pharmacogenet Genomics . 2007 ; 17 : 873 –83. Crossref Search ADS PubMed 23 Lemahieu WP, Maes BD, Verbeke K et al. CYP3A4 and P-glycoprotein activity in healthy controls and transplant patients on cyclosporine vs. tacrolimus vs. sirolimus. Am J Transplant . 2004 ; 4 : 1514 –22. Crossref Search ADS PubMed 24 Lemahieu WP, Hermann M, Asberg A et al. Combined therapy with atorvastatin and calcineurin inhibitors: no interactions with tacrolimus. Am J Transplant . 2005 ; 5 : 2236 –43. Crossref Search ADS PubMed 25 Zheng HX, Schuetz E, Zeevi A et al. Sequential analysis of tacrolimus dosing in adult lung transplant patients with ABCB1 haplotypes. J Clin Pharmacol . 2005 ; 45 : 404 –10. Crossref Search ADS PubMed 26 Watchko JF, Daood MJ, Hansen TW. Brain bilirubin content in P-glycoprotein-deficient transgenic null mutant mice. Pediatr Res . 1998 ; 44 : 763 –6. Crossref Search ADS PubMed 27 Watchko JF, Daood MJ, Mahmood B et al. P-glycoprotein and bilirubin disposition. J Perinatol . 2001 ; 21 (suppl 1): S43 –7. Crossref Search ADS PubMed 28 Jacobson P, Ng J, Ratanatharathorn V et al. Factors affecting the pharmacokinetics of tacrolimus (FK506) in hematopoietic cell transplant (HCT) patients. Bone Marrow Transplant . 2001 ; 28 : 753 –8. Crossref Search ADS PubMed 29 Cohen AJ, Stegall MD, Rosen CB et al. Chronic renal dysfunction late after liver transplantation. Liver Transpl . 2002 ; 8 : 916 –21. Crossref Search ADS PubMed 30 Hebert MF, Dowling AL, Gierwatowski C et al. Association between ABCB1 (multidrug resistance transporter) genotype and post-liver transplantation renal dysfunction in patients receiving calcineurin inhibitors. Pharmacogenetics . 2003 ; 13 : 661 –74. Crossref Search ADS PubMed 31 Macphee IA, Fredericks S, Tai T et al. Tacrolimus pharmacogenetics: polymorphisms associated with expression of cytochrome P4503A5 and P-glycoprotein correlate with dose requirement. Transplantation . 2002 ; 74 : 1486 –9. Crossref Search ADS PubMed 32 Akbas SH, Bilgen T, Keser I et al. The effect of (ABCB1) polymorphism on the pharmacokinetics of tacrolimus in Turkish renal transplant recipients. Transpl Proc . 2006 ; 38 : 1290 –2. Crossref Search ADS 33 Anglicheau D, Verstuyft C, Puig PL et al. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients. J Am Soc Nephrol . 2003 ; 14 : 1889 –96. Crossref Search ADS PubMed 34 Fredericks S, Moreton M, Reboux S et al. Multidrug resistance gene-1 (MDR-1) haplotypes have a minor influence on tacrolimus dose requirements. Transplantation . 2006 ; 82 : 705 –8. PubMed 35 Masuda S, Goto M, Okuda M et al. Initial dosage adjustment for oral administration of tacrolimus using the intestinal level in living-donor liver transplant recipients. Transpl Proc . 2005 ; 37 : 1728 –9. Crossref Search ADS 36 Sakaeda T, Nakamura T, Horinouchi M et al. MDR1 genotype-related pharmacokinetics of digoxin after single oral administration in healthy Japanese subjects. Pharm Res . 2001 ; 18 : 1400 –4. Crossref Search ADS PubMed Author notes Christiane Allard is acknowledged for her help in manuscript preparation. Funded by Université Paris Sud-11. The authors have declared no potential conflicts of interest. Copyright © 2009, American Society of Health-System Pharmacists, Inc. All rights reserved.
TI - Effect of the ABCB1 3435C>T polymorphism on tacrolimus concentrations and dosage requirements in liver transplant recipients
JF - American Journal of Health-System Pharmacy
DO - 10.2146/ajhp080396
DA - 2009-09-15
UR - https://www.deepdyve.com/lp/oxford-university-press/effect-of-the-abcb1-3435c-t-polymorphism-on-tacrolimus-concentrations-G4iocKjyb6
SP - 1645
VL - 66
IS - 18
DP - DeepDyve
ER -