TY - JOUR
AU - McElreavey, K.
AB - Abstract Deletions of distal chromosome 9p24 are often associated with 46,XY gonadal dysgenesis and, depending on the extent of the deletion, the monosomy 9p syndrome. We have previously noted that some cases of 46,XY gonadal dysgenesis carry a 9p deletion and exhibit behavioural problems consistent with autistic spectrum disorder. These cases had a small terminal deletion of 9p with limited or no somatic anomalies that are characteristic of the monosomy 9p syndrome. Here, we present a new case of 46,XY partial gonadal dysgenesis and autistic spectrum disorder associated with a de novo deletion of 9p24 that was detected by ultra-high resolution oligo microarray comparative genomic hybridization. The deletion included the candidate sex-determining genes in the region DMRT1 and DMRT3. These data suggest that a gene responsible for autistic spectrum disorder is located within 9p24. It remains to be determined if the gonadal dysgenesis and autistic spectrum disorder are caused by a single gene or if they are caused by distinct genetic entities at 9p24. autistic spectrum disorder, gonadal dysgenesis, chromosome 9p deletion, sex determination, ultra-high resolution oligo microarray comparative genomic hybridization Introduction Deletions of the terminal portion of 9p are associated with monosomy 9p syndrome (also termed Afi syndrome), which is characterized by mental retardation and characteristic somatic anomalies [trigonocephaly and upward slanting palpebral fissures together with mental retardation, midface hypoplasia, hypertelorism, epicanthus, small palpebral fissures, flat nasal bridge, anteverted nares, low-set malformed posteriorly angulated ears, a long upper lip, microstomia and micrognathia (Alfi et al., 1973; Huret et al., 1988)]. In ~70% of individuals with a 46,XY male karyotype, there are various degrees of sex reversal ranging from a 46,XY female with complete gonadal dysgenesis to males with mild hypospadias (Hoo et al., 1989; Bennett et al., 1993). Christ et al. (1999) delimited the critical monosomy 9p syndrome region to a 4-6-Mb genomic region in 9p22–23 between the markers D9S1869 (telomeric) and D9S162 (centromeric). This data is consistent with the results of Veitia et al. (1998), who independently delimited the monosomy 9p critical region between the markers D9S144 and D9S168 and the sex-reversal critical region between D9S1813 and pter. These data indicated that the 9p-deletion syndrome and the sex-reversal locus are distinct entities and that some 46,XY females that do not present with somatic anomalies may harbour 9p deletions. Although the genes responsible for the monosomy 9p syndrome remain to be identified, there are two candidate genes that may be responsible for the gonadal phenotype. These are the DMRT1 and DRMTA3 (also known as DMRT3) genes on chromosome 9p. DMRT1 and DMRTA3 have been described in the consensus critical region by their homology with the DM domain genes doublesex (dsx) of Drosophila and mab-3 of Caenorhabditis. The dsx controls the terminal switch of the pathway leading to sex fate choice in Drosophila and mab-3 is necessary to confer male traits in C. elegans (Raymond et al., 2000). Normal external genitalia and normal pubertal development have been described in 46,XX females with deletions of 9p (Vialard et al., 2002; Ounap et al., 2004) suggesting that the sex-determining gene(s) on 9p play a role only in the formation of the testis or that they play a role in gonadogenesis in both sexes but that testis formation is more sensitive to changes in gene dosage. The latter has been described for a number of genes involved in testis formation such as SOX9 and DAX1 (Bardoni et al., 1994; Foster et al., 1994). Recently, we described two patients with small terminal deletions of 9p associated with 46,XY gonadal dysgenesis. Both of these patients did not exhibit the classical characteristics of the monosomy 9p syndrome. One patient had limited somatic anomalies (mild hypotonia and a left clubfoot), while the second patient, carrying a non-cytogenetically detectable microdeletion of 9p24, had no dysmorphic features (Veitia et al., 1998). However, in both cases learning difficulties and disruptive behaviour were noted and both patients were diagnosed as having affective disorder as well as gonadal dysgenesis. Here, we describe a third case of a 46,XY individual with partial gonadal dysgenesis, a deletion of 9p24 and autistic spectrum disorder. Materials and Methods Patient description This individual of French origin was born prematurely at 32 weeks of gestation with ambiguous external genitalia. The external genitalia consisted of a genital bud and striated non-fused labioscrotal folds and perineal hypospadias. The basal plasma gonadotropin levels were evaluated at birth (J1). Serum testosterone was 1.8 ng/ml and rose to 3.3 ng/ml following stimulation by human chorionic gonadotrophin (hCG). Serum 17-OH progesterone was 2.9 ng/ml and rose to 3.6 following hCG stimulation. Dihydrotestosterone levels were 0.6 ng/ml rising to 0.9 ng/ml following stimulation. Family history was unremarkable although the mother reported premature ovarian failure. At the age of two months, laparatomy revealed a left streak gonad and a right dysgenetic gonad, a left hemiuterus (13 cm) and fallopian tube. The left gonadal histology revealed undifferentiated parenchymal tissue, with no follicular structures visible. The dense stroma contained poorly defined cord-like structures with an absence of germ cells. The right gonad consisted of a streak of fibrous tissue (superior pole) and poorly differentiated testis (inferior pole). Histology revealed both numerous poorly defined cord-like structures (superior pole) and seminiferous tubule-like structures (inferior pole) with some rare Sertoli cells. The patient was diagnosed as 46,XY partial gonadal dysgenesis and was raised as a male. At 18 months of age, behavioural problems were noted: at crèche he displayed considerable agitation and stereotypic verbal and gestural movements. There was an absence of interaction with other children and adults. He also showed a fascination for lights, water and noise. At 3 years of age, relational difficulties were reported as well as an inability to follow simple tasks. The patient was noted as stubborn, overactive, impulsive and had temper tantrums when frustrated. He showed delays in motor acquisitions and language development. He was insensitive to pain and had poor eye contact. At 11 years 7 months, height was 142.7 cm, weight 33 kg and bone aged 11–12 years. Serum FSH levels were 15.6 U, LH 1.3 U/l and testosterone 0.7 ng/ml. At this time molecular biology studies were conducted. An analysis of the SRY gene by direct sequencing revealed an open-reading frame identical to that of a normal male. Since we have previously noted two patients with deletions of chromosome 9p, 46,XY gonadal dysgenesis and affective disorder, we decided to further investigate the karyotype and perform molecular analyses of distal 9p. Molecular analyses DNA was extracted from peripheral blood lymphocytes using standard techniques. The SRY gene was sequenced as described elsewhere (Veitia et al., 1998). Using the PCR primers indicated in Table 1, we sequenced the open-reading frame of both the DMRT1 and DMRT3 genes. The conditions of amplification were: for DMRT1 exon 1, incubation at 95°C for 5 min followed by 40 cycles of 95°C 1 min, 68°C 1 min and 72°C 30 s. For DMRT1 exons 2 and 4, incubation at 95°C for 5 min followed by 40 cycles of 95°C 1 min, 57°C 30 s and 72°C 1 min. For DMRT1 exon 3, incubation at 95°C for 5 min followed by 40 cycles of 95°C 1 min, 62°C 1.30 min and 72°C 30 s. For DMRT1 exon 5, incubation at 95°C for 5 min followed by 40 cycles of 95°C 1 min, 50°C 30 s and 72°C 30 s. For DMRT3 exon 1, the PCR conditions were incubation at 95°C for 5 min followed by 40 cycles of 95°C 1 min and 62°C 1.30 min with no extension time. For DMRT3 exon 2, two amplicons were used to amplify the entire exon for direct sequencing (Table 1). Both primer pairs of each amplicon were used with the same conditions of incubation conditions at 95°C for 5 min followed by 35 cycles of 95°C 1 min and 60°C 1 min with no extension time. Table 1: PCR primer pairs used for amplification of the ANKRD15, DMRT1 and DMRT3 genes Gene  Forward primer  Reverse primer  ANKRD15  ANKRD15exon1  ttcaaaaccaccaggcattt  cctctgaggaacagataaaagca  ANKRD15exon4  gagttttggtggctgggata  ctggccctagaatcctgatg  ANKRD15exon6  cagaacccaggaccacatct  tcctttatcctctgcgtgct  DMRT1  Exon 1  ggcagacctcgccactccag  aaggctgaacccgggctccc  Exon 2  tctgtgttttggcaaagctg  ctgcttctgtggctgcaa  Exon 3  gcaggtcttgggtaggaagg  catgtggctttcacacaacc  Exon 4  caaggtgtcgggaacatagg  ctctctcaaccccaaatcca  Exon 5  ggagagcgtcactttctttgtt  ccatgcagatggtagtcacg  DMRT3  Exon 1  cggagcacacacgaccac  gtcctcccaagtggagctg  Exon 2–5′ region  aacttccgcagaacctgaga  agatgtggcctctcctcaga  Exon 2–3′ region  tgcatttgctcttccaaaaa  agagtcggcagaaaacctca  Gene  Forward primer  Reverse primer  ANKRD15  ANKRD15exon1  ttcaaaaccaccaggcattt  cctctgaggaacagataaaagca  ANKRD15exon4  gagttttggtggctgggata  ctggccctagaatcctgatg  ANKRD15exon6  cagaacccaggaccacatct  tcctttatcctctgcgtgct  DMRT1  Exon 1  ggcagacctcgccactccag  aaggctgaacccgggctccc  Exon 2  tctgtgttttggcaaagctg  ctgcttctgtggctgcaa  Exon 3  gcaggtcttgggtaggaagg  catgtggctttcacacaacc  Exon 4  caaggtgtcgggaacatagg  ctctctcaaccccaaatcca  Exon 5  ggagagcgtcactttctttgtt  ccatgcagatggtagtcacg  DMRT3  Exon 1  cggagcacacacgaccac  gtcctcccaagtggagctg  Exon 2–5′ region  aacttccgcagaacctgaga  agatgtggcctctcctcaga  Exon 2–3′ region  tgcatttgctcttccaaaaa  agagtcggcagaaaacctca  View Large The parental origin of the 9p deletion was explored using a series of markers insertion/deletion (in/del) polymorphisms located within the minimal critical region on 9p that have been described elsewhere (Ergun-Longmire et al., 2005). Each in/del polymorphism was amplified using a PCR reaction mixture containing 20 ng of genomic DNA, all 4 dNTPs (each at 200 µM), 1.5 mM MgCl2, 1 unit of Taq polymerase (Eurobio), and each oligonucleotide at 0.25 µM. After heating for 10 min at 95°C, the PCR reaction was performed for 35 cycles at 95°C for 30 s, 56°C for 30 s and 72°C for 30 s. The PCR products were separated by electrophoresis on 4% agarose gel with 0.1 g/ml ethidium bromide. Ultra-high resolution oaCGH Isothermal oligo design, array fabrication, DNA labelling, oaCGH experiments, data normalization and log2(Cy3/Cy5) ratio calculations were performed by NimbleGen (NimbleGen Systems, Inc., Madison, WI, USA). The arrays were constructed by maskless array synthesis technology (NimbleGen Systems, Inc.), with up to 385 000 oligonucleotides being synthesized by photolithography on an array by previously described methods (Singh-Gasson et al., 1999; Nuwaysir et al., 2002; Selzer et al., 2005). Results and Discussion A small terminal deletion of chromosome 9p was observed by ultra-high resolution comparative genomic hybridization and subsequent high resolution cytogenetic analysis (Fig. 1). The karyotype of the patient was 46,XY,del(9p24). The karyotype of the patient's father and mother was normal. In order to determine the parent origin of the chromosome 9p with a distal deletion, we screened for loss-of-heterozygosity using a series of in/del polymorphisms within the deleted region. The in/del marker rs3028563 proved informative. This marker is located within the open reading frame of the DOCK8 gene on 9p24 (Fig. 1). The patient inherited his intact chromosome 9p from his mother and inherited his deleted chromosome 9p from his father. In a previous case, a chromosome 9p deletion associated with 46,XY complete gonadal dysgenesis, learning difficulties and affective disorder, the deleted chromosome 9 was of maternal origin (Veitia et al., 1998, patient 2). In a second patient (Veitia et al., 1998, patient 1) with affective disorder but normal IQ, the rearranged chromosome 9p with a deletion was of paternal origin. Other studies have shown that the inheritance of a deleted chromosome 9 can be of either paternal or maternal origin suggesting that genetic imprinting is not involved in the development of the phenotype (Christ et al., 1999). The SRY gene sequence of the patient was identical to that of a normal male. Taking these cases together (Veitia et al., 1998), the minimal region associated with gonadal dysgenesis and autistic spectrum disorder extents from DMRT3 to the 9p telomere. Figure 1: View largeDownload slide (A) Ultra-high resolution oaCGH using the Nimblegen whole genome CGH array (NimbleGen Systems, Inc.) The high-capacity microarray contains 385 000 probes with a median probe spacing of 6 kb. Array data was analysed using the SignalMap Software V1.8 (NimbleGen Systems, Inc.). The genome profile of the patient versus normal male reference genomic DNA is shown for chromosome 9. The X-axis coordinates indicate the relative position of the oligo probes ordered by genomic map position on chromosome 9. The Y-axis shows the log2 ratio shift. The top panel shows the normalized signal whole-chromosome profile using qspline normalization. The middle panel shows the window averaging of signals in 60 kb segments. Segmented data are shown in red and the deleted region is indicated by the red circle. The lower panel indicates the genomic position of transcripts on chromosome 9p. Raw data are shown in black. (B) Partial karyotype of patient after RHG banding showing a terminal deletion of 9p24 (indicated by arrow, right). Agarose gel electrophoresis of in/del marker rs3028563 (left) . The patient did not inherit the 88 bp fragment of DNA from his father indicating that the deletion was of paternal origin. The paternity was confirmed using microsatellite markers (data not shown). M, 100 bp molecular weight ladder; 1, amplification from father's DNA; 2, amplification of patient's DNA; 3, amplification of DNA from the mother Figure 1: View largeDownload slide (A) Ultra-high resolution oaCGH using the Nimblegen whole genome CGH array (NimbleGen Systems, Inc.) The high-capacity microarray contains 385 000 probes with a median probe spacing of 6 kb. Array data was analysed using the SignalMap Software V1.8 (NimbleGen Systems, Inc.). The genome profile of the patient versus normal male reference genomic DNA is shown for chromosome 9. The X-axis coordinates indicate the relative position of the oligo probes ordered by genomic map position on chromosome 9. The Y-axis shows the log2 ratio shift. The top panel shows the normalized signal whole-chromosome profile using qspline normalization. The middle panel shows the window averaging of signals in 60 kb segments. Segmented data are shown in red and the deleted region is indicated by the red circle. The lower panel indicates the genomic position of transcripts on chromosome 9p. Raw data are shown in black. (B) Partial karyotype of patient after RHG banding showing a terminal deletion of 9p24 (indicated by arrow, right). Agarose gel electrophoresis of in/del marker rs3028563 (left) . The patient did not inherit the 88 bp fragment of DNA from his father indicating that the deletion was of paternal origin. The paternity was confirmed using microsatellite markers (data not shown). M, 100 bp molecular weight ladder; 1, amplification from father's DNA; 2, amplification of patient's DNA; 3, amplification of DNA from the mother Mental retardation has been described in a 45,Xt(Y;9) girl who presented with normal female external genitalia, uterus and a right streak gonad and a left dysplastic ovary (de Ravel et al., 2004). Mental retardation, together with characteristic monosomy 9p syndrome features were described in a female patient with a deletion of distal 9p (46,XY, del(9)(p22); Livadas et al., 2003). A child with craniosynostosis, partial absence of the corpus callosum, developmental delay, precocious puberty and deletion of chromosome 9(p12p13.3) has also been reported (Eshel et al., 2002). In addition, a locus associated with obsessive-compulsive disorder has been mapped to 9p24 (Willour et al., 2004). Recently, three patients with terminal deletions of 9p24 have been described (Ounap et al., 2004). One of these individuals (patient 3) was a 46,XX female with severe mental retardation, clumsy gait, aggressiveness and autistic behaviour. These data and those of the patient described here suggest that there is a gene associated with autistic spectrum disorders located on distal 9p24. The gonadal phenotype may be caused by either haploinsufficency of one or more of the tightly-linked DM-domain containing genes on 9p24 or by unmasking a recessive mutation within the deleted region. DMRT1 forms part of a 220 kb cluster of DM-domain containing genes on chromosome 9p comprising DMRT1–DMRTA3–DMRT2 (Brunner et al., 2001; Ottolenghi et al., 2002). DMRT1 is an excellent candidate for the gonadal dysgenesis, although point mutations in the gene have not yet been identified associated with this phenotype (Calvari et al., 2000; Ottolenghi and McElreavey, 2000). In many vertebrate species, DMRT1 expression is limited to the developing gonads and expression is upregulated specifically in the developing testis (De Grandi et al., 2000; Kettlewell et al., 2000; Moniot et al., 2000). The chicken DMRT1 orthologue maps to the Z chromosome suggesting again a role in sex determination. Mice lacking Dmrt1 do not show complete sex reversal. Instead, the testes are small and show signs of defects in somatic and germ cells after birth. DMRTA3 has a restricted expression pattern in vertebrate embryos and may also contribute to both the gonadal and behavioural phenotypes. In both chicken and mouse embryos, DMRTA3 is expressed primarily in the developing forebrain, neural tube and nasal placodes (Smith et al., 2002). DMRTA3 is also expressed in human brain tissue (Ottolenghi et al., 2000a,,b). Expression has also been detected in human testis but not ovarian tissue and may contribute to the more severe gonadal phenotype seen in the human cases of monosomy 9p whne compared with the Dmrt1 loss-of-function mutation in the mouse (Ottolenghi et al., 2002; Smith et al., 2002). DMRT2 expression data from fish suggest that it may function during early somitogenesis (Meng et al., 1999). Direct sequencing of the DMRT1 and DMRT3 amplicons revealed that the sequence of both genes was identical to that of a normal male control. This result is consistent with the hypothesis that haploinsufficency is responsible for the phenotype. There are several genes on chromosome 9p that may be responsible for the behavioural phenotype (Ottolenghi et al., 2000a,b). These include the genes DOCK8, COBW, ANKRD15 and FOXD4. Forkhead genes are key regulators of embryogenesis and tumourigenesis (Kaufmann and Knochel, 1996). These genes are members of a large family of transcription factors with highly conserved 100-amino acid DNA-binding forkhead domains (Kaufmann and Knochel, 1996). In 1994, Pierrou et al. identified a 318-bp partial human cDNA sequence (U13 223) with high homology to the forkhead domain and named it FREAC5 for forkhead-related activator 5. This gene was recently renamed FOXD4 (Kaestner et al. 2000). The FOXD4 gene is located ~100 kb from the 9p telomere and it is predicted to encode a single-exon ORF of 408 amino acids with a conserved amino termini, including a highly conserved forkhead domain. Although mutations in forkhead genes are a cause of specific human diseases, including a speech and language disorder (FOXP2; Lai et al. 2001) the FOXD4 gene is expressed at high levels in heart and skeletal muscle and at low levels in other tissues including brain tissue (Pierrou et al. 1994). DOCK8 is located ~400 kb distal to the DMRT1 gene. In mammalian cells, the DOCK family of proteins have roles in regulating cytoskeletal reorganization (Ruusala et al., 2004). DOCK8 may be involved in the reorganization of the actin filament system and is expressed in placenta, lung, kidney and pancreas, with low levels in heart and brain tissue. The kidney ankyrin repeat-containing protein (ANKRD15) gene is located ~100 kb distal to the DMRT gene cluster (Ottolenghi et al., 2000a,b, 2002). Northern blot analysis revealed expression in all tissues examined except peripheral blood leukocytes. Highest expression was found in heart, prostate and ovary (Nagase et al., 1996). Recently, a deletion polymorphism in the general population that encompasses the ANKRD15 gene has been reported (Iafrate et al., 2004; Conrad et al., 2006). We explored the possibility that the patient carried this deletion by amplifying segments of the ANKRD15 gene. The amplification of ANKRD15 exons 1, 4 and 6 revealed PCR fragments of the expected size indicating that the patient did not carry the deletion polymorphism (data not shown). Cobalamin synthetase W (COBW) is an intronless gene isolated from Pseudomonas denitrificans, which encodes a 354-amino acid cobalamin (vitamin B12)-synthesis protein (Crouzet et al., 1991). In Pseudomonas, the gene functions in the synthesis of vitamin B12 but it is unknown whether the human orthologues have maintained this function. The early onset type of cobalamin deficiency is characterized by feeding difficulties, failure to thrive, hypotonia, seizures, microcephaly and developmental delay. Mental retardation is a common finding (Biancheri et al., 2001). Each of these genes is a candidate for the autistic spectrum disorder phenotype. It is unknown if this phenotype is caused by haploinsufficiency or by the unmasking of a recessive allele. It is also unclear if a mutation involving a single gene is responsible for 46,XY gonadal dysgenesis and autistic spectrum disorder or if they are genetically distinct entities. It would be of interest to systematically screen this region of 9p for microdeletions in patients presenting with either 46,XY gonadal dysgenesis and/or autistic spectrum disorders. This could be easily achieved using the high resolution microarray approaches or by fluorescent in situ hybridization on metaphase spreads with informative BACs corresponding to the region. Acknowledgements The authors acknowledge funding from the GIS-Institut des Maladies Rares. References Alfi O,  Donnell GN,  Crandall BF,  Derencsenyi A,  Menon R.  Deletion of the short arm of chromosome 9 (46, 9p-): A new deletion syndrome,  Ann Genet ,  1973, vol.  16 (pg.  17- 22) Google Scholar PubMed  Bardoni B,  Zanaria E,  Guioli S,  Floridia G,  Worley KC,  Tonini G,  Ferrante E,  Chiumello G,  McCabe ER,  Fraccaro M, et al.  A dosage sensitive locus at chromosome Xp21 is involved in male to female sex reversal,  Nat Genet ,  1994, vol.  7 (pg.  497- 501) Google Scholar CrossRef Search ADS PubMed  Biancheri R,  Cerone R,  Schiaffino MC,  Caruso U,  Veneselli E,  Perrone MV,  Rossi A,  Gatti R.  Cobalamin (Cbl) C/D deficiency: clinical, neurophysiological and neuroradiologic findings in 14 cases,  Neuropediatrics ,  2001, vol.  32 (pg.  14- 22) Google Scholar CrossRef Search ADS PubMed  Bennett CP,  Docherty Z,  Robb SA,  Ramani P,  Hawkins JR,  Grant D.  Deletion 9p and sex reversal,  J Med Genet ,  1993, vol.  30 (pg.  518- 520) Google Scholar CrossRef Search ADS PubMed  Brunner B,  Hornung U,  Shan Z,  Nanda I,  Kondo M,  Zend-Ajusch E,  Haaf T,  Ropers HH,  Shima A,  Schmid M, et al.  Genomic organization and expression of the doublesex-related gene cluster in vertebrates and detection of putative regulatory regions for DMRT1,  Genomics ,  2001, vol.  77 (pg.  8- 17) Google Scholar CrossRef Search ADS PubMed  Calvari V,  Bertini V,  De Grandi A,  Peverali G,  Zuffardi O,  Ferguson-Smith M,  Knudtzon J,  Camerino G,  Borsani G,  Guioli S.  A new submicroscopic deletion that refines the 9p region for sex reversal,  Genomics ,  2000, vol.  65 (pg.  203- 212) Google Scholar CrossRef Search ADS PubMed  Christ LA,  Crowe CA,  Micale MA,  Conroy JM,  Schwartz S.  Chromosome breakage hotspots and delineation of the critical region for the 9p-deletion syndrome,  Am J Hum Genet ,  1999, vol.  65 (pg.  1387- 1395) Google Scholar CrossRef Search ADS PubMed  Conrad DF,  Andrews TD,  Carter NP,  Hurles ME,  Pritchard JK.  A high-resolution survey of deletion polymorphism in the human genome,  Nat Genet ,  2006, vol.  38 (pg.  75- 81) Google Scholar CrossRef Search ADS PubMed  Crouzet J,  Levy-Schil S,  Cameron B,  Cauchois L,  Rigault S,  Rouyez MC,  Blanche F,  Debussche L,  Thibaut D.  Nucleotide sequence and genetic analysis of a 13.1-kilobase-pair Pseudomonas denitrificans DNA fragment containing five cob genes and identification of structural genes encoding Cob(I)alamin adenosyltransferase, cobyric acid synthase, and bifunctional cobinamide kinase-cobinamide phosphate guanylyltransferase,  J Bacteriol ,  1991, vol.  173 (pg.  6074- 6087) Google Scholar PubMed  De Grandi A,  Calvari V,  Bertini V,  Bulfone A,  Peverali G,  Camerino G,  Borsani G,  Guioli S.  The expression pattern of a mouse doublesex-related gene is consistent with a role in gonadal differentiation,  Mech Dev ,  2000, vol.  90 (pg.  323- 326) Google Scholar CrossRef Search ADS PubMed  De Ravel TJ,  Fryns JP,  Van Driessche J,  Vermeesch JR.  Complex chromosome re-arrangement 45,X,t(Y;9) in a girl with sex reversal and mental retardation,  Am J Med Genet A ,  2004, vol.  124 (pg.  259- 262) Google Scholar CrossRef Search ADS   Ergun-Longmire B,  Vinci G,  Alonso L,  Matthew S,  Tansil S,  Lin-Su K,  McElreavey K,  New MI.  Clinical, hormonal and cytogenetic evaluation of 46,XX males and review of the literature,  J Pediatr Endocrinol Metab ,  2005, vol.  18 (pg.  739- 748) Google Scholar CrossRef Search ADS PubMed  Eshel G,  Lahat E,  Reish O,  Barr J.  Neurodevelopmental and behavioral abnormalities associated with deletion of chromosome 9p,  J Child Neurol ,  2002, vol.  17 (pg.  50- 51) Google Scholar CrossRef Search ADS PubMed  Foster JW,  Dominguez-Steglich MA,  Guioli S,  Kowk G,  Weller PA,  Stevanovic M,  Weissenbach J,  Mansour S,  Young ID,  Goodfellow PN, et al.  Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene,  Nature ,  1994, vol.  372 (pg.  525- 530) Google Scholar CrossRef Search ADS PubMed  Hoo JJ,  Salafsky IS,  Lin CC,  Pinsky L.  Possible location of a recessive testis forming gene on 9p24,  Am J Hum Genet ,  1989 (Suppl) (45)pg.  A73  Huret JL,  Leonard C,  Forestier B,  Rethoré MO,  Lejeune J.  Eleven new cases of del (9p) and features from 80 cases,  J Med Genet ,  1988, vol.  25 (pg.  741- 749) Google Scholar CrossRef Search ADS PubMed  Iafrate AJ,  Feuk L,  Rivera MN,  Listewnik ML,  Donahoe PK,  Qi Y,  Scherer SW,  Lee C.  Detection of large-scale variation in the human genome,  Nat Genet ,  2004, vol.  36 (pg.  949- 951) Google Scholar CrossRef Search ADS PubMed  Kaestner KH,  Knochel W,  Martinez DE.  Unified nomenclature for the winged helix/forkhead transcription factors,  Genes Dev ,  2000, vol.  14 (pg.  142- 146) Google Scholar PubMed  Kettlewell JR,  Raymond CS,  Zarkower D.  Temperature-dependent expression of turtle Dmrt1 prior to sexual differentiation,  Genesis ,  2000, vol.  26 (pg.  174- 178) Google Scholar CrossRef Search ADS PubMed  Kaufmann E,  Knochel W.  Five years on the wings of fork head,  Mech Dev ,  1996, vol.  57 (pg.  3- 20) Google Scholar CrossRef Search ADS PubMed  Lai CS,  Fisher SE,  Hurst JA,  Vargha-Khadem F,  Monaco AP.  A forkhead-domain gene is mutated in a severe speech and language disorder,  Nature ,  2001, vol.  413 (pg.  519- 523) Google Scholar CrossRef Search ADS PubMed  Livadas S,  Mavrou A,  Sofocleous C,  van Vliet-Constantinidou C,  Dracopoulou M,  Dacou-Voutetakis C.  Gonadoblastoma in a patient with del(9)(p22) and sex reversal: report of a case and review of the literature,  Cancer Genet Cytogenet ,  2003, vol.  143 (pg.  174- 177) Google Scholar CrossRef Search ADS PubMed  Meng A,  Moore B,  Tang H,  Yuan B,  Lin S.  A Drosophila doublesex-related gene, terra, is involved in somitogenesis in vertebrates,  Development ,  1999, vol.  126 (pg.  1259- 1268) Google Scholar PubMed  Moniot B,  Berta P,  Scherer G,  Sudbeck P,  Poulat F.  Male specific expression suggests role of DMRT1 in human sex determination,  Mech Dev ,  2000, vol.  91 (pg.  323- 325) Google Scholar CrossRef Search ADS PubMed  Nagase T,  Seki N,  Ishikawa K,  Tanaka A,  Nomura N.  Prediction of the coding sequences of unidentified human genes. V. The coding sequences of 40 new genes (KIAA0161-KIAA0200) deduced by analysis of cDNA clones from human cell line KG-1,  DNA Res ,  1996, vol.  3 (pg.  17- 24) Google Scholar CrossRef Search ADS PubMed  Nuwaysir EF,  Huang W,  Albert TJ,  Singh J, et al.  Gene expression analysis using oligonucleotide arrays produced by maskless photolithography,  Genome Res ,  2002, vol.  12 (pg.  1749- 1755) Google Scholar CrossRef Search ADS PubMed  Ottolenghi C,  McElreavey K.  Deletions of 9p and the quest for a conserved mechanism of sex determination,  Mol Genet Metab ,  2000, vol.  71 (pg.  397- 404) Google Scholar CrossRef Search ADS PubMed  Ottolenghi C,  Veitia R,  Barbieri M,  Fellous M,  McElreavey K.  The human doublesex-related gene, DMRT2, is homologous to a gene involved in somitogenesis and encodes a potential bicistronic transcript,  Genomics ,  2000, vol.  64 (pg.  179- 186) Google Scholar CrossRef Search ADS PubMed  Ottolenghi C,  Veitia R,  Quintana-Murci L,  Torchard D,  Scapoli L,  Souleyreau-Therville N,  Beckmann J,  Fellous M,  McElreavey K.  The region on 9p associated with 46,XY sex reversal contains several transcripts expressed in the urogenital system and a novel doublesex-related domain,  Genomics ,  2000, vol.  64 (pg.  170- 178) Google Scholar CrossRef Search ADS PubMed  Ottolenghi C,  Fellous M,  Barbieri M,  McElreavey K.  Novel paralogy relations among human chromosomes support a link between the phylogeny of doublesex-related genes and the evolution of sex determination,  Genomics ,  2002, vol.  79 (pg.  333- 343) Google Scholar CrossRef Search ADS PubMed  Ounap K,  Uibo O,  Zordania R,  Kiho L,  Ilus T,  Oiglane-Shlik E,  Bartsch O.  Three patients with 9p deletions including DMRT1 and DMRT2: A girl with 46,XY complement, bilateral ovotestes and extreme mental retardation, and two XX females with normal pubertal development,  Am J Hum Genet ,  2004, vol.  130A (pg.  415- 423) Pierrou S,  Hellqvist M,  Samuelsson L,  Enerback S,  Carlsson P.  Cloning and characterization of seven human forkhead proteins: binding site specificity and DNA bending,  EMBO J ,  1994, vol.  13 (pg.  5002- 5012) Google Scholar PubMed  Raymond CS,  Murphy MW,  O'Sullivan MG,  Bardwell VJ,  Zarkower D.  Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation,  Genes Dev ,  2000, vol.  14 (pg.  2587- 2595) Google Scholar CrossRef Search ADS PubMed  Ruusala A,  Aspenstrom P.  Isolation and characterisation of DOCK8, a member of the DOCK180-related regulators of cell morphology,  FEBS Lett ,  2004, vol.  572 (pg.  159- 166) Google Scholar CrossRef Search ADS PubMed  Selzer RR,  Richmond TA,  Pofahl NJ,  Green RD,  Eis PS,  Nair P,  Brothman AR,  Stallings RL.  Analysis of chromosome breakpoints in neuroblastoma at sub-kilobase resolution using fine-tiling oligonucleotide array CGH,  Genes Chromosomes Cancer ,  2005, vol.  44 (pg.  305- 319) Google Scholar CrossRef Search ADS PubMed  Singh-Gasson S,  Green RD,  Yue YY,  Nelson C,  Blattner F,  Sussman MR,  Cerrina F.  Maskless fabrication of light-directed oligonucleotide microarrays using a digital micromirror array,  Nat Biotechnol ,  1999, vol.  17 (pg.  974- 978) Google Scholar CrossRef Search ADS PubMed  Smith CA,  Hurley TM,  McClive PJ,  Sinclair AH.  Restricted expression of DMRT3 in chicken and mouse embryos,  Mech Dev ,  2002, vol.  119 (pg.  S73- S76) Google Scholar CrossRef Search ADS PubMed  Veitia RA,  Nunes M,  Quintana-Murci L,  Rappaport R, et al.  Swyer syndrome and 46,XY partial gonadal dysgenesis associated with 9p deletions in the absence of monosomy-9p syndrome,  Am J Hum Genet ,  1998, vol.  63 (pg.  901- 905) Google Scholar CrossRef Search ADS PubMed  Vialard F,  Ottolenghi C,  Gonzales M,  Choiset A, et al.  Deletion of 9p associated with gonadal dysfunction in 46,XY but not in 46,XX human fetuses,  J Med Genet ,  2002, vol.  39 (pg.  514- 518) Google Scholar CrossRef Search ADS PubMed  Willour VL,  Yao Shugart Y,  Samuels J,  Grados M,  Cullen B,  Bienvenu OJ3rd,  Wang Y,  Liang KY,  Valle D,  Hoehn-Saric R, et al.  Replication study supports evidence for linkage to 9p24 in obsessive-compulsive disorder,  Am J Hum Genet ,  2004, vol.  75 (pg.  508- 513) Google Scholar CrossRef Search ADS PubMed  © The Author 2007. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org
TI - Association of deletion 9p, 46,XY gonadal dysgenesis and autistic spectrum disorder
JF - Molecular Human Reproduction
DO - 10.1093/molehr/gam045
DA - 2007-07-20
UR - https://www.deepdyve.com/lp/oxford-university-press/association-of-deletion-9p-46-xy-gonadal-dysgenesis-and-autistic-EM2YCrWBwM
SP - 685
EP - 689
VL - 13
IS - 9
DP - DeepDyve
ER -