TY - JOUR
AU - Shimokawa,, Isao
AB - Abstract We investigated the role of the growth hormone/insulin-like growth factor-1 (GH/IGF-1) axis on caloric restriction (CR) using male wild-type and transgenic homozygous dwarf rats bearing an antisense GH transgene and their F1 heterozygous progeny fed either ad libitum or subjected to 30% CR. CR predominantly altered expression of hepatic genes involved in the stress response, xenobiotic metabolism, and lipid metabolism. Most gene expressions involved in stress response and xenobiotic metabolism were regulated in a GH/IGF-1-dependent manner, and those involved in lipid metabolism were regulated in a GH/IGF-1-independent manner. Moreover, CR enhanced the gene expression involved in fatty acid synthesis after feeding and those encoding mitochondrial β-oxidation enzymes during food shortage, probably via transcriptional regulation by peroxisome proliferator-activated receptor α. These results, taken together with serum biochemical measures and hepatic triglyceride content, suggest that CR promotes lipid utilization through hepatic transcriptional alteration and prevents hepatic steatosis in a GH/IGF-1-independent manner. Recent advances in understanding the molecular basis of aging and the genetic control of longevity have involved yeast, Caenorhabditis elegans, and Drosophila (1). Many mammalian homologues of target genes, which extend longevity, are involved in insulin/insulin-like growth factor 1 (IGF-1) receptor signal cascades (1). In mammals, Ames and Snell mutant dwarf mice, which are homozygous for a mutation at the prop-1 and pit-1 locus, respectively, are deficient in growth hormone (GH), prolactin, and thyroid-stimulating hormone. Both mutant mice live 20%–50% longer than controls (2,3). Moreover, mice with disrupted GH receptor/binding proteins live significantly longer than controls (4). Thus, from yeasts to mammals, the GH/insulin/IGF-1 axis or a similar signaling pathway is likely to be an important regulator of life span (1,3,5). Although new genetic interventions that extend mammalian life span are emerging, caloric restriction (CR) remains the most robust, reproducible, and simplest experimental manipulation known to extend both median and maximum life span and to retard a broad spectrum of age-associated pathophysiological changes in laboratory rodents (6–10). Life-span extension by CR has been observed in several species, from yeasts to laboratory rodents. Studies have recently been extended to nonhuman primates, and data suggest that CR may be effective in primates as well (11,12). The attenuation of oxidative and other stresses, and modulation of glycemia and insulinemia may be a significant factor in the actions of CR, but the exact underlying mechanisms are still unknown (8–10). However, CR animals share many characteristics with long-living dwarf mice, including smaller body size and lower plasma insulin and IGF-1 levels (5,13,14). To clarify the relationship between the effects of GH/IGF-1 suppression and CR, we have previously examined the survival of male wild-type Wistar (−/−) rats, homozygous transgenic dwarf rats bearing an antisense GH transgene (mini, severe suppression of GH/IGF-1, tg/tg), and their F1 heterozygous progeny (moderate suppression of GH/IGF-1, tg/−) fed either ad libitum (AL) or subjected to 30% CR (15–17). The median and maximum life span was extended by 10% in AL (tg/−) rats compared with AL (−/−) rats. Unexpectedly, however, the longevity of AL (tg/tg) rats was shortened by 10%. Regardless of the severity of GH/IGF-1 suppression, however, CR markedly extends the median and maximum survival of all three genotypes (16,17). CR also further extends the longevity of Ames dwarf mice (18). Therefore, the retardation of aging by CR might not merely depend upon the GH/IGF-1 axis, but it may also be independently regulated by the GH/IGF-1 axis. In the present study, we compared hepatic gene expression profiles, serum biochemical measures, and hepatic triglyceride content in 24-week-old male AL and CR rats after feeding. We also investigated CR rats during food shortage in three genotypes to clarify GH/IGF-1 suppression-dependent and suppression-independent alterations. Experimental Procedures Animal Characteristics The transgenic dwarf (mini, tg/tg) rats used in this study were described previously (15,19). The colony of (tg/tg) rats was maintained under specific pathogen-free (SPF) conditions. Jcl:Wistar rats (Wistar, Japan Clea, Tokyo), which were the genetic background of (tg/tg) rats, were also used for the experiments. F1 hetero (tg/−) progeny were created by male (tg/tg) × female (−/−). Characteristics of (tg/tg) and (tg/−) rats and their husbandry were described previously (15). Briefly, the three genotype rats, (tg/tg), (tg/−), and (−/−), were maintained under SPF conditions in the Laboratory Animal Center at Nagasaki University Graduate School of Biomedical Sciences. SPF conditions were monitored by serological examination for several microorganisms in sera from sentinel rats when the rats arrived and every 6 months thereafter (15). All male postnatal rats were maintained separately in an individual cage and were provided with water AL and the CR-LPF diet (Oriental Yeast Co. Ltd., Tsukuba, Japan) based on the formula of Charles River Inc. (CRF-1; Wilmington, MA). Protein was reduced by 20% for the long-term study. From 6 weeks of age, the three genotypes, (−/−), (tg/−), and (tg/tg), were divided into two groups; AL and CR (70% of the energy intake). CR rats were fed every other day (16). Their 2-day food allotment was equal to 140% of the mean daily intake of AL rats. Male rats for cross-sectional studies were killed at 24 weeks of age. As shown in Figure 1, CR1 rats, which were provided food 30 minutes prior to turning off the lights in the evening, were killed after turning on the lights in the following morning (CR rats killed after feeding). CR2 rats were killed the next morning after the CR1 rats were killed (CR rats killed prior to feeding). All rats were killed by decapitation within 20 seconds after the first touch of their cages by the investigators. Food intake was measured every 12 hours over the course of 48 hours in 6 groups at 24 weeks of age (Figure 1). Mean body weight (± standard deviation) and plasma IGF-1 levels (± standard error of the mean [SEM]) of the 6 groups are shown in Table 2 (15,16). Serum Biochemical Studies Serum samples were prepared from trunk blood after decapitation and stored at −30°C. Serum triglycerides (GK-GPO-POD method, DIA Auto TG kit; DIA Siyaku, Tokyo, Japan), total cholesterol (CEH-COD-POD method, DIA Auto T-cho kit; DIA Siyaku), free cholesterol (COD-POD method, Ekdia L Eiken F-CHO kit; Eiken Chemical, Tokyo, Japan), phospholipids (PLD-ChOD-POD method, Sica Auto PL; Kanto Kagaku, Tokyo, Japan), free fatty acids (ACS-ACO-POD method, Determiner FFA; Kyowa Medecs, Tokyo, Japan), and total ketone bodies including acetoacetate and D-3-hydroxybutyrate (enzymatic cycling method, Total Ketone Body-Kainos; Kainos Laboratories, Tokyo, Japan) were then measured according to the manufacturers' instructions. Serum total lipids were calculated by a summation technique proposed by Cheek and Wease. RNA Preparation Total RNA was extracted from the liver of six rats in each group by the guanidinium thiocyanate phenol–chloroform method using ISOGEN (Nippon Gene, Toyama, Japan), according to the instructions provided by the manufacturer. Complementary DNA Expression Array Pooled total RNA samples, in which six rat RNA samples were equally mixed in six groups—(−/−) AL and CR2, (tg/−) AL and CR2, and (tg/tg) AL and CR2 rats—were applied in this experiment. Preparation of 32P-labeled complementary DNA (cDNA) probes and hybridization using the Atlas Pure Total RNA Labeling System and Atlas Rat cDNA Expression Array I (Clontech, Palo Alto, CA) were performed according to the instructions provided by the manufacturer. Briefly, the pooled RNA samples in each group were pretreated with DNase I. Poly A+ RNA was then purified with oligo-dT-linked magnetic beads from 45 μg of total RNA. All purified poly A+ RNAs were reverse-transcribed at 50°C for 25 minutes in a reaction mixture containing 50 μCi of [α-32P]dATP, Moloney murine leukemia virus (MMLV) reverse transcriptase, and coding sequences primers. 32P-labeled cDNA probes were then purified through column chromatography. Subsequently, a set of filter membranes containing 1176 rat cDNA clones as a spot of dots was hybridized at 68°C overnight with the 32P-labeled cDNA probes at a concentration of 0.5–1 × 106 cpm/mL. The next day, membranes were washed and exposed to an imaging plate (BAS cassette 2340; Fuji Film, Tokyo, Japan) for 3 days, which was then analyzed by an FLA-3000 image reader (Fuji Film). Densitometric analysis was performed on an imaging system using ARRAY GAUGE version 1.1 software (Fuji Film). Signal intensities were standardized by global normalization. We analyzed pooled samples four times. Data analysis of cDNA expression arrays was reported previously (20,21). Briefly, filtering genes and statistical analyses were performed as follows. Genes with low expression levels close to the background intensity were eliminated in the present analysis. The cutoff value was arbitrarily set at 100 arbitrary units (AU) of the signal intensity where signals were identified visually. The genes whose expression levels fluctuated greatly among the four separate runs were also removed. The distribution of coefficient of variation (CV) of the expression levels of individual genes followed a normal distribution when the CV of each gene was log-transformed. When the logarithmic values of the CVs were located beyond the mean + 2 × standard deviation in the distribution, the genes were eliminated, because these data were considered unreliable. Using this procedure, 288 genes remained in the present analysis. The mean signal intensities derived from four trials using the pooled samples were calculated. To detect the genes altered by CR2 in the three genotypes, the fold change (FC) in each gene was obtained in the three genotypes, and we selected only those genes whose expression increased [FC (CR2/AL) > 1.3] or decreased [FC (−AL/CR2) < −1.3] concomitantly across the three genotypes. In the next step, we evaluated the effect of GH/IGF-1 suppression on gene expression that was significantly altered by CR2 in accordance with a previous report (21). To identify the extent of linear regression between gene expression and plasma IGF-1 levels in six groups of animals, the correlation coefficient (r) and p value were calculated. The presence of statistical significance was inferred when p <.05. Reverse Transcription–Polymerase Chain Reaction and Semiquantification To confirm the results by cDNA expression array, semiquantitative reverse transcription–polymerase chain reaction (RT–PCR) was performed in six individual rat samples from the three genotypes from groups AL, CR1, and CR2 (vs pooled samples used for cDNA expression array). Messenger RNA (mRNA) levels of 30 target genes, including 21 genes spotted on the array membrane, were analyzed. Primer sequences of control β-actin and target genes are shown in Table 1. The method of semiquantitative RT–PCR was described previously (32,34). Briefly, RT and PCR were performed using the GeneAmp RNA PCR kit (Perkin Elmer, Wellesley, MA) and the TaKaRa Ex Taq kit (Takara Biomedicals, Ohtsu, Japan) according to the manufacturers' instructions. In pilot studies, the optimum numbers of thermal cycles and annealing temperatures were determined using the following profile: an initial denaturation step at 94°C for 2 minutes; then repeated cycles of 94°C for 1 minute (denaturation); 55°, 60°, or 65°C for 1 minute (annealing); and 72°C for 1.5 minutes (elongation). We also confirmed that the amount of PCR products reacted with optimum conditions correlated with that of the initial templates. Semiquantitative PCR for control β-actin and targets was then carried out under optimum conditions (Table 1). The control PCR product for β-actin and the target PCR products were mixed equally and subjected to electrophoresis to standardize the relative amount of the target mRNA level of each sample. Amplified bands were detected by SYBR Gold Nucleic Acid Gel Stain (Molecular Probes, Eugene, OR). Each gel image was scanned by an FLA-3000 image reader (Fuji Film), and the intensity of fluorescent bands was analyzed using computer software (Image Gauge, version 3.45; Fuji Film). The analysis using these individual samples was duplicated. Western Blotting for Peroxisome Proliferator-Activated Receptor α Nucleic proteins were extracted from frozen liver tissue (500 mg) as described previously (20). Briefly, liver tissues from AL, CR1, and CR2 wild-type (−/−) rats (four rats in each group) were homogenized with homogenization buffer at 4°C. The homogenate was overlaid on a cushion buffer in ultracentrifuge tubes. The supernatants were removed after ultracentrifugation, and the nuclear pellets were collected on ice. After washing, the nuclear pellets were suspended in ice-cold low-salt buffer, and then nuclear proteins were released by adding a high-salt buffer drop by drop to a final concentration of 0.4 M KCl. Samples were thoroughly mixed by vortexing. Soluble nuclear proteins were recovered by centrifugation and stored at −80°C. The total protein concentrations in the samples were measured with a protein assay reagent kit (Bio-Rad Laboratories, Hercules, CA). A 10 μg protein sample was separated in a 10% sodium dodecyl sulfate–polyacrylamide gel. Proteins were transferred from the gel to polyvinylidene difluoride membranes. The membranes were blocked with 5% bovine serum albumin (BSA) in Tris-buffered saline (TBS) containing 0.1% Tween-20 for 20 minutes at room temperature, and then incubated with rabbit antiperoxisome proliferators-activated receptor α (PPARα) primary antibodies (H-98; 1:1000 dilution in TBS containing 5% BSA and 0.1% Tween-20; Santa Cruz Biotechnology Inc., Santa Cruz, CA) for 2 hours at room temperature. The membranes were washed and incubated for 1 hour with horseradish peroxidase-labeled goat antirabbit immunoglobulin G (IgG) (1:10,000 dilution in TBS containing 5% BSA and 0.1% Tween-20; Santa Cruz Biotechnology Inc.). Positive bands were revealed using an enhanced chemiluminescence (ECL) kit (Amersham Biosciences, Piscataway, NJ) in accordance with the manufacturer's protocol. Each image was scanned by a Fluor Chem imager (Alpha Innotech, San Leandro, CA), and the intensity of fluorescent bands was analyzed using computer software (Image J, version 1.33u; National Institutes of Health). Hepatic Triglyceride Content Hepatic triglyceride was extracted from liver tissues of AL and CR1 rats of three genotypes (six rats in each group) at 24 weeks of age, and the content was measured using a Serum Triglyceride Determination Kit (Sigma-Aldrich Co., St. Louis, MO), according to a previous report (35) and instructions provided by the manufacturer. Hepatic triglyceride content per 100 mg dry tissue weight was calculated. Statistical Analysis Serum biochemical measures and hepatic triglyceride content from AL, CR1, and CR2 rats in the three genotypes (six samples in each group) were expressed as mean ± SEM. The intensity (percentile) of PCR product for target mRNA relative to that for β-actin mRNA from AL, CR1, and/or CR2 rats in the three genotypes (six rats in each group) was obtained. FC values in (tg/−) and (tg/tg) rats compared with (−/−) rats and those of CR1 and CR2 rats compared with AL rats were calculated and expressed as mean ± SEM. Effects of GH/IGF-1 suppression, CR1/CR2 (difference among AL, CR1, and CR2 in the three genotypes) in serum biochemical measures, hepatic triglyceride content, and data derived from RT–PCR were examined using two-way analysis of variance, and subsequently, effects of severe GH/IGF-1 suppression (tg/tg), moderate GH/IGF-1 suppression (tg/−), and CR1 and CR2 were evaluated by a post hoc test, Fisher's Probable Least-Squares Difference test. The presence of significant statistical differences was inferred with p values <.05. The amount of PPARα in the nucleus from liver tissues of wild-type (−/−) AL, CR1, and CR2 rats (four samples in each group) were expressed as mean ± SEM. The data derived from Western blotting were examined using one-way analysis of variance, and subsequently, effects of CR1 and CR2 were evaluated by a post hoc test, Fisher's Probable Least-Squares Difference test. The presence of significant statistical differences was inferred with p values <.05. All the statistical analyses described above were performed using Stat View 5.0 software (SAS Institute Inc., Cary, NC). Results Food Intake at 24 Weeks of Age Daily food intake of (tg/−) AL was 78% and (tg/tg) AL was 67% compared with that of wild (−/−) AL. In AL rats of the three genotypes, 78%–79% of food was eaten in the dark cycles. In (−/−) CR, (tg/−) CR, and (tg/tg) CR rats, respectively, 70%, 84%, and 88% of food intake for 2 days was eaten in the first dark cycle (Dark 1) after feeding. These amounts are equivalent to 101%, 109%, and 118% of the daily food intake of each control in the AL group. In the first day (Dark 1 and Light 1), 85%, 98%, and 97% of food intake for 2 days was eaten in (−/−) CR, (tg/−) CR, and (tg/tg) CR rats, respectively. Therefore, CR rats were nearly fasted on the second day (Dark 2 and Light 2). In particular, (tg/−) CR and (tg/tg) CR rats were only able to eat 2% or 3% of food intake for 2 days in Dark 2, and none of the rats were able to eat in Light 2. Serum Biochemical Analysis at 24 Weeks of Age Serum levels of total lipids and triglycerides were significantly higher in AL rats than in CR1 and CR2 rats in all three genotypes. The serum levels, ordered from highest to lowest, were as follows: (−/−) > (tg/−) > (tg/tg) rats (Table 2). Serum levels of total cholesterol, free cholesterol, and phospholipids were significantly higher in AL rats than in CR1 and CR2 rats in the three genotypes; however, these parameters were not different among the three genotypes (Table 2). Serum levels of free fatty acids were significantly higher in AL and CR2 rats than in CR1 rats in all three genotypes (Table 2). Serum levels of total ketone bodies were higher in CR2 rats than in AL and CR1 rats in all three genotypes. The fractions, serum acetoacetate and D-3-hydrooxybutyrate levels, also showed the same trend as total ketone bodies (Table 2). Hepatic Gene Expression Profile by cDNA Expression Array cDNA expression arrays were used to analyze the gene expression of pooled samples of AL and CR2 of the three genotypes. Based on the minimal optical density and CV, 288 of 1176 genes on the membrane were selected. The genes showing FC > 1.3 or FC < −1.3 consistently across all three genotypes are listed in Table 3. Despite the finding that the three rat genotypes had diverse plasma levels of IGF-1, CR2 significantly enhanced the expression of 12 genes and suppressed the expression of 6 genes (Table 3). CR2 altered the expression of 4 genes involved in stress response and xenobiotic metabolism and 5 genes involved in metabolic pathways. Therefore, CR2 appears to modulate the expression of stress response, xenobiotic metabolism, and metabolic pathway-associated genes. The expression of C3A1, C4A3, LCAD, BFABP ApoAI, and C2C11 (bold, in Table 3), which are involved in lipid metabolism, was modulated by CR2. Most of the lipid metabolism-associated gene expressions (5 of 6 genes) were upregulated by CR2. Particularly, LCAD and BFABP are involved in fatty acid β-oxidation (36,37). Moreover, mCPT1, which is involved in fatty acid β-oxidation, almost met our criteria and appeared to be upregulated by CR2 [(−/−): FC = 1.5, (tg/−): FC = 1.2, (tg/tg): FC = 1.6]. Subsequently, the gene expression profiles modulated by CR2 were compared with plasma IGF-1 levels. As shown in Table 3, the expression of OCT1A and MDR2 showed a negative linear correlation, and those of C2C11, CAIII, and IGF-1 showed a positive linear correlation with plasma IGF-1 levels (italic letters in Table 3). Interestingly, the hepatic mRNA levels of IGF-1 were positively correlated with plasma IGF-1 levels, suggesting that the quantitative validity of the cDNA expression array was supported. Hepatic Gene Expression Using Semiquantitative RT–PCR To confirm the results of cDNA expression arrays, semiquantitative RT–PCR was performed using six individual rat samples in AL, CR1, or CR2 conditions in all three genotypes. Expression levels of several lipid metabolism-associated genes were also examined to clarify CR-mediated alteration in lipid metabolism. The results of 11 gene expressions selected by our criteria on cDNA expression array data were compared with those by semiquantitative RT–PCR (asterisk [*] in Table 3). The expression patterns of both techniques revealed the same results in all 11 genes (Table 4). Therefore, the quantitative validity of both techniques was also supported. Moreover, semiquantitative RT–PCR detected CR2-associated alteration of certain gene expressions (mCPT1, ACO, FASN, ACC, and C2C11), which were not selected by DNA array experiments. With GH/IGF-1 suppression, particularly in (tg/tg) rats, the expression of BFABP, C2C11, C2C22, and CAIII was significantly decreased (Table 4). In contrast, the expression of mTPβ, ACO, OCT1A, MDR2, and GABAt2 was significantly increased. Regardless of the severity of GH/IGF-1 suppression, the mRNA levels of PPARα, a transcriptional accelerator of fatty acid oxidation (38,39), were significantly upregulated in CR2 rats (Figure 2A, Table 4). This alteration appears to be exaggerated in wild-type (−/−) rats. The expression levels of nine mitochondrial β-oxidation-related enzymes were examined and six of them (mCPT1, LCAD, mTPα, mTPβ, mISO, and DECR) were upregulated in CR2 rats. BFABP, which acts as a fatty acid transporter and is related to mitochondrial β-oxidation (37), was also upregulated in CR2 rats (Table 4). In contrast, five of six peroxisomal β-oxidation enzyme gene expressions were not upregulated in CR2 rats. Moreover, C4A3, a microsomal ω-oxidation enzyme, was upregulated in CR2 rats (Table 4). The mRNA levels of ADD1/SREBP1, which is known as a transcriptional accelerator of fatty acid synthesis (26,40), was significantly downregulated in CR2 rats in all three genotypes (Figure 2B, Table 4). FASN and ACC play critical roles in fatty acid synthesis and are regulated transcriptionally by ADD1/SREBP1 (26,40). cDNA expression arrays did not show any significant alteration of FASN and ACC expression, but semiquantitative RT–PCR detected that both gene expressions were downregulated significantly in CR2 rats in a manner similar to ADD1/SREBP1 (Figure 2B). In contrast to CR2 rats, the expression of ADD1/SREBP1, FASN, and ACC were significantly increased in CR1 rats in the three genotypes (Table 4). In stress response-associated and xenobiotic metabolism-associated genes, HSP90, OCT1A, and MDR2 were upregulated, whereas C2C11 and 2C22 were downregulated in CR2 rats (Table 4). Nuclear PPARα Protein It has been reported that PPARα transcriptionally regulates the hepatic expression of several lipid metabolism-associated genes, which vary over the diurnal cycle with food intake (41). These genes include SREBP1-regulatory genes such as FASN as well as the genes encoding mitochondrial β-oxidation enzymes. Therefore, we examined the protein levels of nuclear PPARα in AL, CR1, and CR2 wild-type rats (−/−). As shown in Figure 3, nuclear PPARα protein levels were significantly higher in CR2 rats than in AL and CR1 rats. The levels show a similar trend to mRNA levels of PPARα and several other genes encoding mitochondrial β-oxidation enzymes (Table 4). Hepatic Triglyceride Content Initially we compared hepatic triglyceride content from six CR1 and six CR2 wild-type (−/−) rats and were not able to find a significant difference between both rats. Therefore, we examined the hepatic triglyceride content from AL and CR1 rats in three genotypes. The hepatic triglyceride content was significantly higher in AL rats than in CR1 rats. The content, ordered from highest to lowest, was as follows: (−/−) > (tg/−) > (tg/tg) rats (Figure 4). The level of hepatic triglyceride content showed a trend similar to serum levels of triglycerides (Table 1). Discussion The Role of GH/IGF-1 Suppression in Gene Expression Altered by CR Despite the finding that the three rat genotypes had diverse plasma levels of IGF-1, we found 18 genes that had their expression altered by CR2 (FC > 1.3 or FC < −1.3) consistently in all three genotypes (Table 3). When these gene expressions were compared with plasma IGF-1 levels, the hepatic expression of C2C11, CAIII, and IGF-1 genes were shown to have a positive linear correlation with plasma IGF-1 levels (Table 3). It has been reported that the expression of C2C11 and CAIII are regulated by a male-specific pulsatile GH secretary pattern (42,43). Therefore, the decreased expression of C2C11 and CAIII might not be specific for CR2 in both males and females. In contrast, the expression of OCT1A and MDR2, which were involved in stress response and xenobiotic metabolism, were shown to have a negative linear correlation with plasma IGF-1 levels (Table 3). Moreover, the expression of HSP90, which was also involved in stress response and xenobiotic metabolism, almost met our statistical criteria (r = −0.774, p =.071) and appeared to be negatively correlated with plasma IGF-1 levels, suggesting that CR2 appears to enhance the gene expression involved in certain stress responses and xenobiotic metabolism in a GH/IGF-1 suppression-dependent manner. C3A1, C4A3, LCAD, BFABP, ApoAI, and C2C11 were involved in lipid metabolism (bold, Table 3). Except for C2C11, which was regulated by a male-specific pulsatile GH secretary pattern, all the other five gene expressions were upregulated by CR2, and these gene expressions were not correlated with plasma IGF-1 levels. This finding suggests that CR2 predominantly upregulates the expression of genes encoding lipid metabolism-associated proteins in a GH/IGF-1 suppression-independent manner. Alteration of Lipid Metabolism by CR Because CR further extends the longevity of both Ames dwarf mice (18) and our transgenic dwarf rats (16,17), the altered expression of genes encoding lipid metabolism-associated proteins, which are regulated independently by GH/IGF-1 suppression, might be particularly important in the beneficial action of CR. The expression of genes encoding several mitochondrial β-oxidation enzymes was upregulated to a greater extent than was that of genes encoding peroxisomal β-oxidation enzymes in CR2 rats killed during food shortage (Table 4). These changes were associated with the enhanced expression of PPARα. In addition, the genes associated with fatty acid synthesis, ADD1/SREBP1, FASN, and ACC, were upregulated more significantly in CR1 than AL rats (Table 4). Tsuchiya and colleagues (44) analyzed hepatic gene expression profiles of homozygous and heterozygous Ames dwarf mice fed either AL or CR, and found that CR upregulated the expression of several genes involved in β-oxidation, including CPT1, and downregulated that of genes encoding fatty acid synthesis-associated enzymes, including FASN. They also reported that expression of several genes encoding β-oxidation enzymes was more predominantly regulated by CR than by dwarfism (GH/IGF-1 suppression). Corton and colleagues (45) recently examined the gene expression profiles altered by CR in both wild and PPARα-null mice. They found that CR altered the expression of 78 genes in wild-type mice (1.5-fold or −1.5-fold), but did not affect the expressions of 15 of the 78 genes (19%) in PPARα-null mice. Moreover, the gene expression profiles in CR mice are closely related to those in control mice treated with the PPARα agonist WY-14,643 for 7 days, suggesting that some parts of CR-mediated alteration were transcriptionally regulated via PPARα (45). These previous observations support our data. Because CR2 rats, which were killed prior to feeding, were almost under fasting conditions for approximately 12 hours (Figure 1), exogenous fuel for mitochondrial β-oxidation was deficient. However, serum levels of free fatty acids and ketone bodies were increased in CR2 rats (Table 2). Therefore, endogenous fatty acids mostly derived from adipose tissues must be provided as fuel for the catalyzed substances of mitochondrial β-oxidation enzymes, and this oxidation generates ketone bodies in CR2 rats as well as in fasting animals (36). CR1 rats, which were killed after feeding, ate 35%–51% more food than AL rats in the Dark 1 cycle (Figure 1). Nevertheless, serum levels of total lipids, triglycerides, total and free cholesterols, phospholipids, and free fatty acids were lower in CR1 than in AL rats (Table 2). In addition, the genes associated with fatty acid synthesis were significantly more upregulated in CR1 than in AL rats (Table 4). Possibly, the fuel supplied by feeding may be transferred to and stored in the adipose tissues or used in the peripheral organs more effectively in CR1 than in AL rats through hepatic fatty acid synthesis. In the white adipose tissue of mice, CR upregulates several genes encoding glucose, amino acids, lipids, and mitochondrial energy metabolism-associated proteins and appears to enhance the potential of metabolic activities in adipose tissues (46). The respiratory exchange ratio or respiratory quotient over 24 hours in CR animals fed daily is higher after feeding and lower prior to feeding than that in AL animals. This finding suggests that carbohydrates are more metabolized immediately after feeding and whole-body fuel utilization shifts almost exclusively to lipids prior to feeding when glycogen reserves are depleted in CR animals (47,48). These findings also support our present observation. Therefore, we suggest that CR animals might be able to effectively use the fuel provided by limited food intake via altered hepatic lipid metabolism. Possible Connection Between Altered Lipid Metabolism and Retardation of Aging in CR Animals From the evolutionary view proposed by Holliday, the action of CR may derive from the adaptive response system against food shortages (49,50). Prolonged fasting is characterized by low GH/insulin/IGF-1 levels, low gonadal hormones, low thyroid hormone levels, low leptin, and high glucocorticoid levels in plasma (51,52). This hormonal profile is similar to that of CR animals (53). The prolonged fasting activates mitochondrial β-oxidation, peroxisomal β-oxidation, and the microsomal ω-oxidation system associated with upregulation of mCPT1, VLCAD, MCAD, SCAD, mTPα,β, ACO, pMEI,II, pTHLA,B, and cytochrome P450 4A family gene expression; the majority of these genes are upregulated transcriptionally by PPARα (52,54–56). In contrast, a food shortage in CR animals (CR2) is likely to activate mitochondrial β-oxidation more predominantly than peroxisomal β-oxidation. Constitutive expression of mitochondrial β-oxidation enzymes is more regulated by PPARα than by peroxisomal β-oxidation enzymes (39). In general, mitochondrial β-oxidation produces more adenosine triphosphate (ATP) than does peroxisomal β-oxidation (36,56). Therefore, the gene expression profiles for mitochondrial and peroxisomal β-oxidation in CR2 rats probably reflect constitutive regulation by PPARα. This gene expression profile suggests that CR2 rats have adapted to chronic undernutrition without malnutrition, probably differing from nonadaptable severe fasting animals. When nonadipose tissues are exposed to an excess of lipids, massive triglycerides accumulate ultimately in the tissues, probably resulting in a lipotoxic state including ceramide synthesis and lipid peroxidation (57,58). Moreover, the massive accumulation of triglycerides in the nonadipose tissues such as liver and muscle, and a significant reduction in mitochondrial oxidative phosphorylation activity may be associated with pathophysiological changes including insulin resistance in elderly persons (59). It has been reported that PPARα is necessary for the lipopenic action of the liver and for protection against insulin resistance (60). In our data, CR2 enhances the hepatic expression of PPARα and the PPARα-regulatory genes, but GH/IGF-1 suppression does not. However, both CR and GH/IGF-1 suppression enhance glucose tolerance and insulin sensitivity (61) and prevent the hepatic triglyceride accumulation similarly. Therefore, CR2 might reduce triglyceride accumulation in nonadipose tissue through the upregulation of PPARα, resulting in the protection against the lipotoxic state and insulin resistance. Moreover, a PPARα-independent mechanism may be involved in the reduction of triglyceride accumulation associated with GH/IGF-1 suppression in the liver. It has been reported that CR protected the livers of rodents from damage induced by hepatotoxins such as thioacetamide (45) and lipopolysaccharide (62), and CR-associated protection was attenuated in PPARα-null mice (45). On the basis of the present study and other observations, we propose that effective lipid use, which is independently regulated by GH/IGF-1 suppression, and possibly regulated by PPARα activation, at least in part plays an important role in the beneficial action of CR. Decision Editor: James R. Smith, PhD Figure 1. Open in new tabDownload slide Food intake (gram per rat per 12 hours) in each rat group at 24 weeks of age. The daily food intakes of (tg/−) ad libitum-fed (AL) and (tg/tg) AL were 78% and 67%, respectively, that of wild (−/−) AL (Figure 1). Approximately 80% of the total food intake of AL rats in all three genotypes occurred in the dark cycles. In (−/−), (tg/−), and (tg/tg) rats on caloric restriction (CR), 70%, 84%, and 88%, respectively, of food intake for 2 days took place in the first dark cycle (Dark 1) after feeding, and 85%, 98%, and 97%, respectively, of the feeding was eaten in the first day (Dark 1 and Light 1). Therefore, CR rats were nearly fasted by the second day (Dark 2 and Light 2) Figure 1. Open in new tabDownload slide Food intake (gram per rat per 12 hours) in each rat group at 24 weeks of age. The daily food intakes of (tg/−) ad libitum-fed (AL) and (tg/tg) AL were 78% and 67%, respectively, that of wild (−/−) AL (Figure 1). Approximately 80% of the total food intake of AL rats in all three genotypes occurred in the dark cycles. In (−/−), (tg/−), and (tg/tg) rats on caloric restriction (CR), 70%, 84%, and 88%, respectively, of food intake for 2 days took place in the first dark cycle (Dark 1) after feeding, and 85%, 98%, and 97%, respectively, of the feeding was eaten in the first day (Dark 1 and Light 1). Therefore, CR rats were nearly fasted by the second day (Dark 2 and Light 2) Figure 2. Open in new tabDownload slide Semiquantitative reverse transcription–polymerase chain reaction (RT–PCR). A, Hepatic messenger RNA (mRNA) expression for peroxisome proliferators-activated receptor α (PPARα). Expression levels were significantly higher in the second calorie-restricted (CR2) group than in the ad libitum-fed (AL) and CR1 groups (genotype effect: not significant, dietary effect: p <.01, Genotype × Dietary Effect: p <.05 by two-factor analysis of variance [ANOVA], asterisk: p <.05 by Fisher Probable Least-Squares Difference [PLSD] test). B, Hepatic mRNA expression for ADD1/SREBP1. The expression levels, ordered from highest to lowest, were as follows: CR1 > AL > CR2 (genotype effect: not significant, dietary effect: p <.01, Genotype × Dietary Effect: not significant by two-factor ANOVA, asterisk: p <.05 by Fisher PLSD test). Results are expressed as mean ± standard error of the mean Figure 2. Open in new tabDownload slide Semiquantitative reverse transcription–polymerase chain reaction (RT–PCR). A, Hepatic messenger RNA (mRNA) expression for peroxisome proliferators-activated receptor α (PPARα). Expression levels were significantly higher in the second calorie-restricted (CR2) group than in the ad libitum-fed (AL) and CR1 groups (genotype effect: not significant, dietary effect: p <.01, Genotype × Dietary Effect: p <.05 by two-factor analysis of variance [ANOVA], asterisk: p <.05 by Fisher Probable Least-Squares Difference [PLSD] test). B, Hepatic mRNA expression for ADD1/SREBP1. The expression levels, ordered from highest to lowest, were as follows: CR1 > AL > CR2 (genotype effect: not significant, dietary effect: p <.01, Genotype × Dietary Effect: not significant by two-factor ANOVA, asterisk: p <.05 by Fisher PLSD test). Results are expressed as mean ± standard error of the mean Figure 3. Open in new tabDownload slide Effect of caloric restriction (CR) on the protein levels of nuclear peroxisome proliferators-activated receptor α (PPARα) in the liver from wild-type (−/−) rats. Nucleic proteins were extracted from ad libitum–fed (AL), CR1, and CR2 wild-type (−/−) rats (four rats in each dietary group) and analyzed by Western blotting. One of each AL, CR1, and CR2 rat samples were run with a control sample (nuclear extract of K562 cells) on one gel; this procedure was repeated 4 times. The densitometry data from each band were then normalized using the band derived from the control sample. Top panel: Representative gel image for Western blotting from AL, CR1, and CR2 wild (−/−) rats. The graph shows densitometry data for Western blotting. Nuclear PPARα protein levels were significantly higher in the CR2 group than in the AL and CR1 groups (dietary effect: p <.05 by one-factor analysis of variance, asterisk: p <.05 by Fisher Probable Least-Squares Difference test). Results are expressed as mean ± standard error of the mean Figure 3. Open in new tabDownload slide Effect of caloric restriction (CR) on the protein levels of nuclear peroxisome proliferators-activated receptor α (PPARα) in the liver from wild-type (−/−) rats. Nucleic proteins were extracted from ad libitum–fed (AL), CR1, and CR2 wild-type (−/−) rats (four rats in each dietary group) and analyzed by Western blotting. One of each AL, CR1, and CR2 rat samples were run with a control sample (nuclear extract of K562 cells) on one gel; this procedure was repeated 4 times. The densitometry data from each band were then normalized using the band derived from the control sample. Top panel: Representative gel image for Western blotting from AL, CR1, and CR2 wild (−/−) rats. The graph shows densitometry data for Western blotting. Nuclear PPARα protein levels were significantly higher in the CR2 group than in the AL and CR1 groups (dietary effect: p <.05 by one-factor analysis of variance, asterisk: p <.05 by Fisher Probable Least-Squares Difference test). Results are expressed as mean ± standard error of the mean Figure 4. Open in new tabDownload slide Hepatic triglyceride content. The hepatic triglyceride content was significantly higher in ad libitum-fed (AL) rats than in calorie-restricted (CR)1 rats in all three genotypes. The hepatic triglyceride levels, ordered from highest to lowest, were as follows: (−/−) > (tg/−) > (tg/tg) rats (genotype effect: p <.05, CR effect: p <.05, Genotype × CR effect: not significant by two-factor analysis of variance, asterisk: p <.05 by Fisher Probable Least-Squares Difference test). Results are expressed as mean ± standard error of the mean Figure 4. Open in new tabDownload slide Hepatic triglyceride content. The hepatic triglyceride content was significantly higher in ad libitum-fed (AL) rats than in calorie-restricted (CR)1 rats in all three genotypes. The hepatic triglyceride levels, ordered from highest to lowest, were as follows: (−/−) > (tg/−) > (tg/tg) rats (genotype effect: p <.05, CR effect: p <.05, Genotype × CR effect: not significant by two-factor analysis of variance, asterisk: p <.05 by Fisher Probable Least-Squares Difference test). Results are expressed as mean ± standard error of the mean Table 1. Targets and Primer Sequences Applied for Semiquantitative Reverse Transcription–Polymerase Chain Reaction. Gene Name* . Forward Primer . Reverse Primer . Product Size . Annealing Temperature . No. of Optimal Cycles . References . Lipid metabolism-related transcriptional regulators  1. Peroxisome proliferator-activated receptor α (PPARα)   CCCGGGTCATACTCGCAGG TCAGTACATGTCTCTGTAG 717 55 26 Ouali et al. (22)  2. Adipocyte determination and differentiation factor 1/sterol regulatory element binding protein 1 (ADD1/SREBP1, L16995)   TGCTTCTCTGGGCTCCTCTCTG TGTGGCTCCTGTGTCTGTCTTT 541 60 26 Designed by us Mitochondrial β-oxidation  1. Mitochondrial carnitine palmitoyltransferase 1 (mCPT1, L07736)   GGCAAGCGGGACCATAGAGAAG GGCACAGGGGCAGGAATCAAAC 743 65 28 Designed by us  2. Very-long-chain acyl-CoA dehydrogenase (VLCAD, D30647)   GCTGGCTCGGATGGCTATTCTG TGCGACTCAACTCTGGGTGGAC 449 55 26 Designed by us  3. Long-chain acyl-CoA dehydrogenase (LCAD, J05029)   AAGGATTTATTAAGGGCAAGAAGC GGAAGCGGAGGCGGAGTC 380 55 24 Hildebrandt et. al. (23)  4. Medium-chain acyl-CoA dehydrogenase (MCAD, J02791)   CACCCTCATGTAACTACGCTCAGA ATCCGCCACATTCCTCAG 343 55 24 Hildebrandt et. al. (23)  5. Short-chain acyl-CoA dehydrogenase (SCAD, J05030)   GCCGAGCGCTACTACCGAGATG TCCCCAGCCTTCCCACGACAAC 490 65 30 Designed by us  6. Mitochondrial trifunctional protein, α-subunit (mitochondrial long-chain enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase, mTPα, D16478)   GGCTTGGCTTTCCCCCTTGTCT CTCGGTCTTTCTCCTGCTTCCT 279 55 26 Designed by us  7. Mitochondrial trifunctional protein, β-subunit (mitochondrial long chain 3-ketoacyl-CoA thiolase, mTPβ, D16479)   TCACCATGGCTTGTATCTCTTC AGTGGCCCATTGTCTCGTTAGT 276 60 26 Designed by us  8. Mitochondrial 3,2trans-eynol-CoA isomerase (mISO, X61184)   GAGAAGGAGGGCGAGGCAGGAA TAACCAGAAGGGGGCAACAATG 420 55 24 Designed by us  9. 2,4-dienoyl-CoA reductase precursor (DECR, D00569)   TGCTACCACCTAATGCCTTTCA AACACTTCCTCTCCACCGTCAA 766 55 26 Designed by us Peroxisomal β-oxidation  1. Acyl-CoA oxidase (ACO, J02752)   CAATCACGCAATAGTTCTGGCTC AAGCTCAGGCAGTTCACTCAGG 559 60 22 Ouali et al. (22)  2. Pristanoyl-CoA oxidase (PCO, X95188)   CGAGAACTGAACTTCCTTCG TGGCGAATCCATTATCCAGG 562 55 24 Knoll et al. (24)  3. Peroxisomal multifunctional enzyme type I (L-type bifunctional protein, pMEI, K03249)   AGACCACACGGTTAAAGCCA ACTTCACGACTGCATCCAGA 398 55 24 Knoll et al. (24)  4. Peroxisomal multifunctional enzyme type II (D-type bifunctional protein, pMEII, U37486)   TTGTCGCTCAGAAGTCCTTG TCCTTCCTTCCACATCTCAG 605 55 24 Knoll et al. (24)  5. Peroxisomal 3-ketoacyl-CoA thiolase A (pTHLA, M32801)   ACCACTGTCCTCGATGACAA GGTACAGATGGCTTTGCAAC 818 65 26 Knoll et al. (24)  6. Sterol carrier protein-x (SCPX, M57453)   TATGGAATGTCTGCCTGTCC CCAGTGCTTCATAAGTCAGG 508 55 24 Knoll et al. (24) Microsomal ω-oxidation  1. Cytochrome P450 4A3 (C4A3, M33936)   CAAAGGCTTCTGGAATTTATC CAGCCTTGGTGTAGGACCT 321 55 22 Ito et al. (25) Fatty acid synthesis  1. Fatty acid synthase (FASN, M76767)   CCGAGTGGCTGGGTATTCTTTT AGGGAGCTGTGGATGATGTTGA 597 55 24 Designed by us  2. Acetyl-CoA carboxylase (ACC, J03808)   TGAAGGCTGTGGTGATGGAT CCGTAGTGGTTGAGGTTGGA 681 60 26 Foretz et al. (26) Other lipid metabolism  1. Brain fatty acid-binding protein (BFABP, U02096)   AGGAAGGCGGCAAAGTGGTGAT TAACAGCGAACAGCAACGACAT 253 65 24 Designed by us  2. Apolipoprotein AI (ApoAI, M0001)   AGGAGTTCTGGGCTAACCTGGA GGCTCCAGCTTCTGGCGGTA 167 65 22 Wu et al. (27) Stress response and xenobiotic metabolism  1. HSP90 (HSP90, S45392)   ACATCATCCCCAACCCTC TCCACCAGCAGAAGACTCC 269 60 22 Alderman et al. (28)  2. Organic cation transporter 1A (OCT1A, U76379; X78855)   GCATCGTCTTCCTGGGCTTCAC GCAGCAGGCGAAAGAGCAACAT 412 65 24 Designed by us  3. Multidrug resistance protein 2 (MDR2, L15079)   AAGAATTTGAAGTTGAGCTAAGTGA TGGTTTCCACATCCAGCCTAT 143 60 26 Vos et al. (29)  4. Cytochrome P450 2C11 (C2C11, J02657)   CTGCTGCTGCTGAAACACGTG GGATGACAGCGATACTATCAC 249 60 20 Morris et al. (30)  5. Cytochrome P450 2C22 (C2C22, M58041)   CTATGGGGATGGGAAAGAGAAC TGCTGGAAAATGACACTGGAGA 157 55 24 Designed by us Others  1. Gamma-aminobutyric acid transporter 2 (GABAt2, M95762)   CTCTTTCTTCATCGGGCTCATT TGTAGGTCAGTGGCGTGTATTT 284 55 24 Designed by us  2. Nuclear tyrosine phosphatase (PRL1, L27843)   TCTGCCTGCTCACTCTATGTTT AGCCTCCTCTCCTTTCTTGTTC 268 55 26 Designed by us  3. Carbonic anhydrase III (CAIII, M22413)   TGCTGTGGTTGGCATTTTTC AGGCTGCGCACGTTGGCCAT 264 55 20 Jampel et al. (31) Housekeeping genes  1. β-actin 1 (actin1, V01217)   CGTTGACATCCGTAAAGACC AGCCACCAATCCACACAGAG 173 55 20 Higami et al. (32)  2. β-actin 2 (actin2, V01217)   CACTGCCGCATCCTCTTCCT AGCCACCAATCCACACAGAG 347 55 20 Higami et al. (32)  3. β-actin 3 (actin3, V01217)   TCACCGAGGCCCCTCTGAACCCTA GGCAGTAATCTCCTTCTGCATCCT 641 55 22 Mathur et al. (33) Gene Name* . Forward Primer . Reverse Primer . Product Size . Annealing Temperature . No. of Optimal Cycles . References . Lipid metabolism-related transcriptional regulators  1. Peroxisome proliferator-activated receptor α (PPARα)   CCCGGGTCATACTCGCAGG TCAGTACATGTCTCTGTAG 717 55 26 Ouali et al. (22)  2. Adipocyte determination and differentiation factor 1/sterol regulatory element binding protein 1 (ADD1/SREBP1, L16995)   TGCTTCTCTGGGCTCCTCTCTG TGTGGCTCCTGTGTCTGTCTTT 541 60 26 Designed by us Mitochondrial β-oxidation  1. Mitochondrial carnitine palmitoyltransferase 1 (mCPT1, L07736)   GGCAAGCGGGACCATAGAGAAG GGCACAGGGGCAGGAATCAAAC 743 65 28 Designed by us  2. Very-long-chain acyl-CoA dehydrogenase (VLCAD, D30647)   GCTGGCTCGGATGGCTATTCTG TGCGACTCAACTCTGGGTGGAC 449 55 26 Designed by us  3. Long-chain acyl-CoA dehydrogenase (LCAD, J05029)   AAGGATTTATTAAGGGCAAGAAGC GGAAGCGGAGGCGGAGTC 380 55 24 Hildebrandt et. al. (23)  4. Medium-chain acyl-CoA dehydrogenase (MCAD, J02791)   CACCCTCATGTAACTACGCTCAGA ATCCGCCACATTCCTCAG 343 55 24 Hildebrandt et. al. (23)  5. Short-chain acyl-CoA dehydrogenase (SCAD, J05030)   GCCGAGCGCTACTACCGAGATG TCCCCAGCCTTCCCACGACAAC 490 65 30 Designed by us  6. Mitochondrial trifunctional protein, α-subunit (mitochondrial long-chain enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase, mTPα, D16478)   GGCTTGGCTTTCCCCCTTGTCT CTCGGTCTTTCTCCTGCTTCCT 279 55 26 Designed by us  7. Mitochondrial trifunctional protein, β-subunit (mitochondrial long chain 3-ketoacyl-CoA thiolase, mTPβ, D16479)   TCACCATGGCTTGTATCTCTTC AGTGGCCCATTGTCTCGTTAGT 276 60 26 Designed by us  8. Mitochondrial 3,2trans-eynol-CoA isomerase (mISO, X61184)   GAGAAGGAGGGCGAGGCAGGAA TAACCAGAAGGGGGCAACAATG 420 55 24 Designed by us  9. 2,4-dienoyl-CoA reductase precursor (DECR, D00569)   TGCTACCACCTAATGCCTTTCA AACACTTCCTCTCCACCGTCAA 766 55 26 Designed by us Peroxisomal β-oxidation  1. Acyl-CoA oxidase (ACO, J02752)   CAATCACGCAATAGTTCTGGCTC AAGCTCAGGCAGTTCACTCAGG 559 60 22 Ouali et al. (22)  2. Pristanoyl-CoA oxidase (PCO, X95188)   CGAGAACTGAACTTCCTTCG TGGCGAATCCATTATCCAGG 562 55 24 Knoll et al. (24)  3. Peroxisomal multifunctional enzyme type I (L-type bifunctional protein, pMEI, K03249)   AGACCACACGGTTAAAGCCA ACTTCACGACTGCATCCAGA 398 55 24 Knoll et al. (24)  4. Peroxisomal multifunctional enzyme type II (D-type bifunctional protein, pMEII, U37486)   TTGTCGCTCAGAAGTCCTTG TCCTTCCTTCCACATCTCAG 605 55 24 Knoll et al. (24)  5. Peroxisomal 3-ketoacyl-CoA thiolase A (pTHLA, M32801)   ACCACTGTCCTCGATGACAA GGTACAGATGGCTTTGCAAC 818 65 26 Knoll et al. (24)  6. Sterol carrier protein-x (SCPX, M57453)   TATGGAATGTCTGCCTGTCC CCAGTGCTTCATAAGTCAGG 508 55 24 Knoll et al. (24) Microsomal ω-oxidation  1. Cytochrome P450 4A3 (C4A3, M33936)   CAAAGGCTTCTGGAATTTATC CAGCCTTGGTGTAGGACCT 321 55 22 Ito et al. (25) Fatty acid synthesis  1. Fatty acid synthase (FASN, M76767)   CCGAGTGGCTGGGTATTCTTTT AGGGAGCTGTGGATGATGTTGA 597 55 24 Designed by us  2. Acetyl-CoA carboxylase (ACC, J03808)   TGAAGGCTGTGGTGATGGAT CCGTAGTGGTTGAGGTTGGA 681 60 26 Foretz et al. (26) Other lipid metabolism  1. Brain fatty acid-binding protein (BFABP, U02096)   AGGAAGGCGGCAAAGTGGTGAT TAACAGCGAACAGCAACGACAT 253 65 24 Designed by us  2. Apolipoprotein AI (ApoAI, M0001)   AGGAGTTCTGGGCTAACCTGGA GGCTCCAGCTTCTGGCGGTA 167 65 22 Wu et al. (27) Stress response and xenobiotic metabolism  1. HSP90 (HSP90, S45392)   ACATCATCCCCAACCCTC TCCACCAGCAGAAGACTCC 269 60 22 Alderman et al. (28)  2. Organic cation transporter 1A (OCT1A, U76379; X78855)   GCATCGTCTTCCTGGGCTTCAC GCAGCAGGCGAAAGAGCAACAT 412 65 24 Designed by us  3. Multidrug resistance protein 2 (MDR2, L15079)   AAGAATTTGAAGTTGAGCTAAGTGA TGGTTTCCACATCCAGCCTAT 143 60 26 Vos et al. (29)  4. Cytochrome P450 2C11 (C2C11, J02657)   CTGCTGCTGCTGAAACACGTG GGATGACAGCGATACTATCAC 249 60 20 Morris et al. (30)  5. Cytochrome P450 2C22 (C2C22, M58041)   CTATGGGGATGGGAAAGAGAAC TGCTGGAAAATGACACTGGAGA 157 55 24 Designed by us Others  1. Gamma-aminobutyric acid transporter 2 (GABAt2, M95762)   CTCTTTCTTCATCGGGCTCATT TGTAGGTCAGTGGCGTGTATTT 284 55 24 Designed by us  2. Nuclear tyrosine phosphatase (PRL1, L27843)   TCTGCCTGCTCACTCTATGTTT AGCCTCCTCTCCTTTCTTGTTC 268 55 26 Designed by us  3. Carbonic anhydrase III (CAIII, M22413)   TGCTGTGGTTGGCATTTTTC AGGCTGCGCACGTTGGCCAT 264 55 20 Jampel et al. (31) Housekeeping genes  1. β-actin 1 (actin1, V01217)   CGTTGACATCCGTAAAGACC AGCCACCAATCCACACAGAG 173 55 20 Higami et al. (32)  2. β-actin 2 (actin2, V01217)   CACTGCCGCATCCTCTTCCT AGCCACCAATCCACACAGAG 347 55 20 Higami et al. (32)  3. β-actin 3 (actin3, V01217)   TCACCGAGGCCCCTCTGAACCCTA GGCAGTAATCTCCTTCTGCATCCT 641 55 22 Mathur et al. (33) Notes: *Abbreviation, GeneBank Accession Number. CoA = coenzyme A. Open in new tab Table 1. Targets and Primer Sequences Applied for Semiquantitative Reverse Transcription–Polymerase Chain Reaction. Gene Name* . Forward Primer . Reverse Primer . Product Size . Annealing Temperature . No. of Optimal Cycles . References . Lipid metabolism-related transcriptional regulators  1. Peroxisome proliferator-activated receptor α (PPARα)   CCCGGGTCATACTCGCAGG TCAGTACATGTCTCTGTAG 717 55 26 Ouali et al. (22)  2. Adipocyte determination and differentiation factor 1/sterol regulatory element binding protein 1 (ADD1/SREBP1, L16995)   TGCTTCTCTGGGCTCCTCTCTG TGTGGCTCCTGTGTCTGTCTTT 541 60 26 Designed by us Mitochondrial β-oxidation  1. Mitochondrial carnitine palmitoyltransferase 1 (mCPT1, L07736)   GGCAAGCGGGACCATAGAGAAG GGCACAGGGGCAGGAATCAAAC 743 65 28 Designed by us  2. Very-long-chain acyl-CoA dehydrogenase (VLCAD, D30647)   GCTGGCTCGGATGGCTATTCTG TGCGACTCAACTCTGGGTGGAC 449 55 26 Designed by us  3. Long-chain acyl-CoA dehydrogenase (LCAD, J05029)   AAGGATTTATTAAGGGCAAGAAGC GGAAGCGGAGGCGGAGTC 380 55 24 Hildebrandt et. al. (23)  4. Medium-chain acyl-CoA dehydrogenase (MCAD, J02791)   CACCCTCATGTAACTACGCTCAGA ATCCGCCACATTCCTCAG 343 55 24 Hildebrandt et. al. (23)  5. Short-chain acyl-CoA dehydrogenase (SCAD, J05030)   GCCGAGCGCTACTACCGAGATG TCCCCAGCCTTCCCACGACAAC 490 65 30 Designed by us  6. Mitochondrial trifunctional protein, α-subunit (mitochondrial long-chain enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase, mTPα, D16478)   GGCTTGGCTTTCCCCCTTGTCT CTCGGTCTTTCTCCTGCTTCCT 279 55 26 Designed by us  7. Mitochondrial trifunctional protein, β-subunit (mitochondrial long chain 3-ketoacyl-CoA thiolase, mTPβ, D16479)   TCACCATGGCTTGTATCTCTTC AGTGGCCCATTGTCTCGTTAGT 276 60 26 Designed by us  8. Mitochondrial 3,2trans-eynol-CoA isomerase (mISO, X61184)   GAGAAGGAGGGCGAGGCAGGAA TAACCAGAAGGGGGCAACAATG 420 55 24 Designed by us  9. 2,4-dienoyl-CoA reductase precursor (DECR, D00569)   TGCTACCACCTAATGCCTTTCA AACACTTCCTCTCCACCGTCAA 766 55 26 Designed by us Peroxisomal β-oxidation  1. Acyl-CoA oxidase (ACO, J02752)   CAATCACGCAATAGTTCTGGCTC AAGCTCAGGCAGTTCACTCAGG 559 60 22 Ouali et al. (22)  2. Pristanoyl-CoA oxidase (PCO, X95188)   CGAGAACTGAACTTCCTTCG TGGCGAATCCATTATCCAGG 562 55 24 Knoll et al. (24)  3. Peroxisomal multifunctional enzyme type I (L-type bifunctional protein, pMEI, K03249)   AGACCACACGGTTAAAGCCA ACTTCACGACTGCATCCAGA 398 55 24 Knoll et al. (24)  4. Peroxisomal multifunctional enzyme type II (D-type bifunctional protein, pMEII, U37486)   TTGTCGCTCAGAAGTCCTTG TCCTTCCTTCCACATCTCAG 605 55 24 Knoll et al. (24)  5. Peroxisomal 3-ketoacyl-CoA thiolase A (pTHLA, M32801)   ACCACTGTCCTCGATGACAA GGTACAGATGGCTTTGCAAC 818 65 26 Knoll et al. (24)  6. Sterol carrier protein-x (SCPX, M57453)   TATGGAATGTCTGCCTGTCC CCAGTGCTTCATAAGTCAGG 508 55 24 Knoll et al. (24) Microsomal ω-oxidation  1. Cytochrome P450 4A3 (C4A3, M33936)   CAAAGGCTTCTGGAATTTATC CAGCCTTGGTGTAGGACCT 321 55 22 Ito et al. (25) Fatty acid synthesis  1. Fatty acid synthase (FASN, M76767)   CCGAGTGGCTGGGTATTCTTTT AGGGAGCTGTGGATGATGTTGA 597 55 24 Designed by us  2. Acetyl-CoA carboxylase (ACC, J03808)   TGAAGGCTGTGGTGATGGAT CCGTAGTGGTTGAGGTTGGA 681 60 26 Foretz et al. (26) Other lipid metabolism  1. Brain fatty acid-binding protein (BFABP, U02096)   AGGAAGGCGGCAAAGTGGTGAT TAACAGCGAACAGCAACGACAT 253 65 24 Designed by us  2. Apolipoprotein AI (ApoAI, M0001)   AGGAGTTCTGGGCTAACCTGGA GGCTCCAGCTTCTGGCGGTA 167 65 22 Wu et al. (27) Stress response and xenobiotic metabolism  1. HSP90 (HSP90, S45392)   ACATCATCCCCAACCCTC TCCACCAGCAGAAGACTCC 269 60 22 Alderman et al. (28)  2. Organic cation transporter 1A (OCT1A, U76379; X78855)   GCATCGTCTTCCTGGGCTTCAC GCAGCAGGCGAAAGAGCAACAT 412 65 24 Designed by us  3. Multidrug resistance protein 2 (MDR2, L15079)   AAGAATTTGAAGTTGAGCTAAGTGA TGGTTTCCACATCCAGCCTAT 143 60 26 Vos et al. (29)  4. Cytochrome P450 2C11 (C2C11, J02657)   CTGCTGCTGCTGAAACACGTG GGATGACAGCGATACTATCAC 249 60 20 Morris et al. (30)  5. Cytochrome P450 2C22 (C2C22, M58041)   CTATGGGGATGGGAAAGAGAAC TGCTGGAAAATGACACTGGAGA 157 55 24 Designed by us Others  1. Gamma-aminobutyric acid transporter 2 (GABAt2, M95762)   CTCTTTCTTCATCGGGCTCATT TGTAGGTCAGTGGCGTGTATTT 284 55 24 Designed by us  2. Nuclear tyrosine phosphatase (PRL1, L27843)   TCTGCCTGCTCACTCTATGTTT AGCCTCCTCTCCTTTCTTGTTC 268 55 26 Designed by us  3. Carbonic anhydrase III (CAIII, M22413)   TGCTGTGGTTGGCATTTTTC AGGCTGCGCACGTTGGCCAT 264 55 20 Jampel et al. (31) Housekeeping genes  1. β-actin 1 (actin1, V01217)   CGTTGACATCCGTAAAGACC AGCCACCAATCCACACAGAG 173 55 20 Higami et al. (32)  2. β-actin 2 (actin2, V01217)   CACTGCCGCATCCTCTTCCT AGCCACCAATCCACACAGAG 347 55 20 Higami et al. (32)  3. β-actin 3 (actin3, V01217)   TCACCGAGGCCCCTCTGAACCCTA GGCAGTAATCTCCTTCTGCATCCT 641 55 22 Mathur et al. (33) Gene Name* . Forward Primer . Reverse Primer . Product Size . Annealing Temperature . No. of Optimal Cycles . References . Lipid metabolism-related transcriptional regulators  1. Peroxisome proliferator-activated receptor α (PPARα)   CCCGGGTCATACTCGCAGG TCAGTACATGTCTCTGTAG 717 55 26 Ouali et al. (22)  2. Adipocyte determination and differentiation factor 1/sterol regulatory element binding protein 1 (ADD1/SREBP1, L16995)   TGCTTCTCTGGGCTCCTCTCTG TGTGGCTCCTGTGTCTGTCTTT 541 60 26 Designed by us Mitochondrial β-oxidation  1. Mitochondrial carnitine palmitoyltransferase 1 (mCPT1, L07736)   GGCAAGCGGGACCATAGAGAAG GGCACAGGGGCAGGAATCAAAC 743 65 28 Designed by us  2. Very-long-chain acyl-CoA dehydrogenase (VLCAD, D30647)   GCTGGCTCGGATGGCTATTCTG TGCGACTCAACTCTGGGTGGAC 449 55 26 Designed by us  3. Long-chain acyl-CoA dehydrogenase (LCAD, J05029)   AAGGATTTATTAAGGGCAAGAAGC GGAAGCGGAGGCGGAGTC 380 55 24 Hildebrandt et. al. (23)  4. Medium-chain acyl-CoA dehydrogenase (MCAD, J02791)   CACCCTCATGTAACTACGCTCAGA ATCCGCCACATTCCTCAG 343 55 24 Hildebrandt et. al. (23)  5. Short-chain acyl-CoA dehydrogenase (SCAD, J05030)   GCCGAGCGCTACTACCGAGATG TCCCCAGCCTTCCCACGACAAC 490 65 30 Designed by us  6. Mitochondrial trifunctional protein, α-subunit (mitochondrial long-chain enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase, mTPα, D16478)   GGCTTGGCTTTCCCCCTTGTCT CTCGGTCTTTCTCCTGCTTCCT 279 55 26 Designed by us  7. Mitochondrial trifunctional protein, β-subunit (mitochondrial long chain 3-ketoacyl-CoA thiolase, mTPβ, D16479)   TCACCATGGCTTGTATCTCTTC AGTGGCCCATTGTCTCGTTAGT 276 60 26 Designed by us  8. Mitochondrial 3,2trans-eynol-CoA isomerase (mISO, X61184)   GAGAAGGAGGGCGAGGCAGGAA TAACCAGAAGGGGGCAACAATG 420 55 24 Designed by us  9. 2,4-dienoyl-CoA reductase precursor (DECR, D00569)   TGCTACCACCTAATGCCTTTCA AACACTTCCTCTCCACCGTCAA 766 55 26 Designed by us Peroxisomal β-oxidation  1. Acyl-CoA oxidase (ACO, J02752)   CAATCACGCAATAGTTCTGGCTC AAGCTCAGGCAGTTCACTCAGG 559 60 22 Ouali et al. (22)  2. Pristanoyl-CoA oxidase (PCO, X95188)   CGAGAACTGAACTTCCTTCG TGGCGAATCCATTATCCAGG 562 55 24 Knoll et al. (24)  3. Peroxisomal multifunctional enzyme type I (L-type bifunctional protein, pMEI, K03249)   AGACCACACGGTTAAAGCCA ACTTCACGACTGCATCCAGA 398 55 24 Knoll et al. (24)  4. Peroxisomal multifunctional enzyme type II (D-type bifunctional protein, pMEII, U37486)   TTGTCGCTCAGAAGTCCTTG TCCTTCCTTCCACATCTCAG 605 55 24 Knoll et al. (24)  5. Peroxisomal 3-ketoacyl-CoA thiolase A (pTHLA, M32801)   ACCACTGTCCTCGATGACAA GGTACAGATGGCTTTGCAAC 818 65 26 Knoll et al. (24)  6. Sterol carrier protein-x (SCPX, M57453)   TATGGAATGTCTGCCTGTCC CCAGTGCTTCATAAGTCAGG 508 55 24 Knoll et al. (24) Microsomal ω-oxidation  1. Cytochrome P450 4A3 (C4A3, M33936)   CAAAGGCTTCTGGAATTTATC CAGCCTTGGTGTAGGACCT 321 55 22 Ito et al. (25) Fatty acid synthesis  1. Fatty acid synthase (FASN, M76767)   CCGAGTGGCTGGGTATTCTTTT AGGGAGCTGTGGATGATGTTGA 597 55 24 Designed by us  2. Acetyl-CoA carboxylase (ACC, J03808)   TGAAGGCTGTGGTGATGGAT CCGTAGTGGTTGAGGTTGGA 681 60 26 Foretz et al. (26) Other lipid metabolism  1. Brain fatty acid-binding protein (BFABP, U02096)   AGGAAGGCGGCAAAGTGGTGAT TAACAGCGAACAGCAACGACAT 253 65 24 Designed by us  2. Apolipoprotein AI (ApoAI, M0001)   AGGAGTTCTGGGCTAACCTGGA GGCTCCAGCTTCTGGCGGTA 167 65 22 Wu et al. (27) Stress response and xenobiotic metabolism  1. HSP90 (HSP90, S45392)   ACATCATCCCCAACCCTC TCCACCAGCAGAAGACTCC 269 60 22 Alderman et al. (28)  2. Organic cation transporter 1A (OCT1A, U76379; X78855)   GCATCGTCTTCCTGGGCTTCAC GCAGCAGGCGAAAGAGCAACAT 412 65 24 Designed by us  3. Multidrug resistance protein 2 (MDR2, L15079)   AAGAATTTGAAGTTGAGCTAAGTGA TGGTTTCCACATCCAGCCTAT 143 60 26 Vos et al. (29)  4. Cytochrome P450 2C11 (C2C11, J02657)   CTGCTGCTGCTGAAACACGTG GGATGACAGCGATACTATCAC 249 60 20 Morris et al. (30)  5. Cytochrome P450 2C22 (C2C22, M58041)   CTATGGGGATGGGAAAGAGAAC TGCTGGAAAATGACACTGGAGA 157 55 24 Designed by us Others  1. Gamma-aminobutyric acid transporter 2 (GABAt2, M95762)   CTCTTTCTTCATCGGGCTCATT TGTAGGTCAGTGGCGTGTATTT 284 55 24 Designed by us  2. Nuclear tyrosine phosphatase (PRL1, L27843)   TCTGCCTGCTCACTCTATGTTT AGCCTCCTCTCCTTTCTTGTTC 268 55 26 Designed by us  3. Carbonic anhydrase III (CAIII, M22413)   TGCTGTGGTTGGCATTTTTC AGGCTGCGCACGTTGGCCAT 264 55 20 Jampel et al. (31) Housekeeping genes  1. β-actin 1 (actin1, V01217)   CGTTGACATCCGTAAAGACC AGCCACCAATCCACACAGAG 173 55 20 Higami et al. (32)  2. β-actin 2 (actin2, V01217)   CACTGCCGCATCCTCTTCCT AGCCACCAATCCACACAGAG 347 55 20 Higami et al. (32)  3. β-actin 3 (actin3, V01217)   TCACCGAGGCCCCTCTGAACCCTA GGCAGTAATCTCCTTCTGCATCCT 641 55 22 Mathur et al. (33) Notes: *Abbreviation, GeneBank Accession Number. CoA = coenzyme A. Open in new tab Table 2. Body Weight, Plasma IGF-1 Levels, and Serum Biochemical Data. . (−/−) . . (tg/−) . . (tg/tg) . . Statistical Analysis . . . AL . CR . AL . CR . AL . CR . Effect of GH/IGF-1 Suppression . Effect of CR . Body weight, g 479 ± 34 342 ± 17* 317 ± 32† 226 ± 15*,† 199 ± 9†,‡ 124 ± 11*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR Plasma IGF-1 levels, ng/mL 1039 ± 38 864 ± 32* 603 ± 39† 333 ± 17*,† 281 ± 9†,‡ 205 ± 8*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR . (−/−) . . (tg/−) . . (tg/tg) . . Statistical Analysis . . . AL . CR . AL . CR . AL . CR . Effect of GH/IGF-1 Suppression . Effect of CR . Body weight, g 479 ± 34 342 ± 17* 317 ± 32† 226 ± 15*,† 199 ± 9†,‡ 124 ± 11*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR Plasma IGF-1 levels, ng/mL 1039 ± 38 864 ± 32* 603 ± 39† 333 ± 17*,† 281 ± 9†,‡ 205 ± 8*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR . (−/−) . . . (tg/−) . . . (tg/tg) . . . Statatistical Analysis . . Serum data . AL . CR1 . CR2 . AL . CR1 . CR2 . AL . CR1 . CR2 . Effect of GH/IGF-1 Suppression . Effect of CR1/CR2 . Total lipid, mg/dL 724 ± 52 438 ± 31* 468 ± 53* 590 ± 57† 490 ± 11 425 ± 20* 531 ± 27† 372 ± 14*,‡ 388 ± 17* (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Triacylglycerols, mg/dL 380 ± 46 145 ± 44* 195 ± 46* 276 ± 45† 182 ± 12 136 ± 17* 188 ± 19† 91 ± 12 87 ± 16 (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Total cholesterol, mg/dL 94 ± 1 86 ± 7 80 ± 3* 91 ± 3 88 ± 1 86 ± 2 104 ± 2†,‡ 81 ± 3* 89 ± 3* NS AL > CR1, CR2 Free cholesterol, mg/dL 20 ± 1 14 ± 2* 14 ± 1* 15 ± 2† 15 ± 1 13 ± 2 20 ± 1‡ 12 ± 1* 14 ± 1* NS AL > CR1, CR2 Phospholipid, mg/dL 203 ± 7 164 ± 13* 152 ± 6* 177 ± 7† 176 ± 2 160 ± 2 186 ± 5 159 ± 3* 167 ± 5* NS AL > CR1, CR2 Free fatty acids, mEq/L 560 ± 81 293 ± 99* 607 ± 35§ 460 ± 49 287 ± 41 540 ± 95§ 583 ± 57 300 ± 29* 887 ± 110§,‡ NS AL, CR2 > CR1 Total ketone bodies, mmol/L 93 ± 5 97 ± 7 161 ± 50 77 ± 2 104 ± 2 228 ± 74* 99 ± 18 94 ± 12 398 ± 173*,§,†,‡ NS AL, CR1 < CR2 Acetoacetate, mmol/L 36 ± 4 43 ± 2 59 ± 12 28 ± 0 32 ± 4 55 ± 19 32 ± 8 30 ± 4 91 ± 39*,§ NS AL, CR1 < CR2 D-3-hydroxybutyrate, mmol/L 57 ± 6 54 ± 6 101 ± 39 48 ± 2 72 ± 4 173 ± 59* 68 ± 11 64 ± 9 307 ± 134*,§,†,‡ NS AL, CR1 < CR2 . (−/−) . . . (tg/−) . . . (tg/tg) . . . Statatistical Analysis . . Serum data . AL . CR1 . CR2 . AL . CR1 . CR2 . AL . CR1 . CR2 . Effect of GH/IGF-1 Suppression . Effect of CR1/CR2 . Total lipid, mg/dL 724 ± 52 438 ± 31* 468 ± 53* 590 ± 57† 490 ± 11 425 ± 20* 531 ± 27† 372 ± 14*,‡ 388 ± 17* (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Triacylglycerols, mg/dL 380 ± 46 145 ± 44* 195 ± 46* 276 ± 45† 182 ± 12 136 ± 17* 188 ± 19† 91 ± 12 87 ± 16 (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Total cholesterol, mg/dL 94 ± 1 86 ± 7 80 ± 3* 91 ± 3 88 ± 1 86 ± 2 104 ± 2†,‡ 81 ± 3* 89 ± 3* NS AL > CR1, CR2 Free cholesterol, mg/dL 20 ± 1 14 ± 2* 14 ± 1* 15 ± 2† 15 ± 1 13 ± 2 20 ± 1‡ 12 ± 1* 14 ± 1* NS AL > CR1, CR2 Phospholipid, mg/dL 203 ± 7 164 ± 13* 152 ± 6* 177 ± 7† 176 ± 2 160 ± 2 186 ± 5 159 ± 3* 167 ± 5* NS AL > CR1, CR2 Free fatty acids, mEq/L 560 ± 81 293 ± 99* 607 ± 35§ 460 ± 49 287 ± 41 540 ± 95§ 583 ± 57 300 ± 29* 887 ± 110§,‡ NS AL, CR2 > CR1 Total ketone bodies, mmol/L 93 ± 5 97 ± 7 161 ± 50 77 ± 2 104 ± 2 228 ± 74* 99 ± 18 94 ± 12 398 ± 173*,§,†,‡ NS AL, CR1 < CR2 Acetoacetate, mmol/L 36 ± 4 43 ± 2 59 ± 12 28 ± 0 32 ± 4 55 ± 19 32 ± 8 30 ± 4 91 ± 39*,§ NS AL, CR1 < CR2 D-3-hydroxybutyrate, mmol/L 57 ± 6 54 ± 6 101 ± 39 48 ± 2 72 ± 4 173 ± 59* 68 ± 11 64 ± 9 307 ± 134*,§,†,‡ NS AL, CR1 < CR2 Notes: *p <.05 between AL and CR, CR1 or CR2 rats in the same genotypes. §p <.05 between CR1 and CR2 rats in the same genotypes. †p <.05 between (−/−) and (tg/−) or (tg/tg) rats in the same dietary groups. ‡p <.05 between (tg/−) and (tg/tg) rats in the same dietary groups. IGF-1 = Insulin-like growth factor-1; AL = ad libitum fed; CR = calorie restricted; NS = not significant. Open in new tab Table 2. Body Weight, Plasma IGF-1 Levels, and Serum Biochemical Data. . (−/−) . . (tg/−) . . (tg/tg) . . Statistical Analysis . . . AL . CR . AL . CR . AL . CR . Effect of GH/IGF-1 Suppression . Effect of CR . Body weight, g 479 ± 34 342 ± 17* 317 ± 32† 226 ± 15*,† 199 ± 9†,‡ 124 ± 11*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR Plasma IGF-1 levels, ng/mL 1039 ± 38 864 ± 32* 603 ± 39† 333 ± 17*,† 281 ± 9†,‡ 205 ± 8*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR . (−/−) . . (tg/−) . . (tg/tg) . . Statistical Analysis . . . AL . CR . AL . CR . AL . CR . Effect of GH/IGF-1 Suppression . Effect of CR . Body weight, g 479 ± 34 342 ± 17* 317 ± 32† 226 ± 15*,† 199 ± 9†,‡ 124 ± 11*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR Plasma IGF-1 levels, ng/mL 1039 ± 38 864 ± 32* 603 ± 39† 333 ± 17*,† 281 ± 9†,‡ 205 ± 8*,†,‡ (−/−) > (tg/−) > (tg/tg) AL > CR . (−/−) . . . (tg/−) . . . (tg/tg) . . . Statatistical Analysis . . Serum data . AL . CR1 . CR2 . AL . CR1 . CR2 . AL . CR1 . CR2 . Effect of GH/IGF-1 Suppression . Effect of CR1/CR2 . Total lipid, mg/dL 724 ± 52 438 ± 31* 468 ± 53* 590 ± 57† 490 ± 11 425 ± 20* 531 ± 27† 372 ± 14*,‡ 388 ± 17* (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Triacylglycerols, mg/dL 380 ± 46 145 ± 44* 195 ± 46* 276 ± 45† 182 ± 12 136 ± 17* 188 ± 19† 91 ± 12 87 ± 16 (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Total cholesterol, mg/dL 94 ± 1 86 ± 7 80 ± 3* 91 ± 3 88 ± 1 86 ± 2 104 ± 2†,‡ 81 ± 3* 89 ± 3* NS AL > CR1, CR2 Free cholesterol, mg/dL 20 ± 1 14 ± 2* 14 ± 1* 15 ± 2† 15 ± 1 13 ± 2 20 ± 1‡ 12 ± 1* 14 ± 1* NS AL > CR1, CR2 Phospholipid, mg/dL 203 ± 7 164 ± 13* 152 ± 6* 177 ± 7† 176 ± 2 160 ± 2 186 ± 5 159 ± 3* 167 ± 5* NS AL > CR1, CR2 Free fatty acids, mEq/L 560 ± 81 293 ± 99* 607 ± 35§ 460 ± 49 287 ± 41 540 ± 95§ 583 ± 57 300 ± 29* 887 ± 110§,‡ NS AL, CR2 > CR1 Total ketone bodies, mmol/L 93 ± 5 97 ± 7 161 ± 50 77 ± 2 104 ± 2 228 ± 74* 99 ± 18 94 ± 12 398 ± 173*,§,†,‡ NS AL, CR1 < CR2 Acetoacetate, mmol/L 36 ± 4 43 ± 2 59 ± 12 28 ± 0 32 ± 4 55 ± 19 32 ± 8 30 ± 4 91 ± 39*,§ NS AL, CR1 < CR2 D-3-hydroxybutyrate, mmol/L 57 ± 6 54 ± 6 101 ± 39 48 ± 2 72 ± 4 173 ± 59* 68 ± 11 64 ± 9 307 ± 134*,§,†,‡ NS AL, CR1 < CR2 . (−/−) . . . (tg/−) . . . (tg/tg) . . . Statatistical Analysis . . Serum data . AL . CR1 . CR2 . AL . CR1 . CR2 . AL . CR1 . CR2 . Effect of GH/IGF-1 Suppression . Effect of CR1/CR2 . Total lipid, mg/dL 724 ± 52 438 ± 31* 468 ± 53* 590 ± 57† 490 ± 11 425 ± 20* 531 ± 27† 372 ± 14*,‡ 388 ± 17* (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Triacylglycerols, mg/dL 380 ± 46 145 ± 44* 195 ± 46* 276 ± 45† 182 ± 12 136 ± 17* 188 ± 19† 91 ± 12 87 ± 16 (−/−) > (tg/−) > (tg/tg) AL > CR1, CR2 Total cholesterol, mg/dL 94 ± 1 86 ± 7 80 ± 3* 91 ± 3 88 ± 1 86 ± 2 104 ± 2†,‡ 81 ± 3* 89 ± 3* NS AL > CR1, CR2 Free cholesterol, mg/dL 20 ± 1 14 ± 2* 14 ± 1* 15 ± 2† 15 ± 1 13 ± 2 20 ± 1‡ 12 ± 1* 14 ± 1* NS AL > CR1, CR2 Phospholipid, mg/dL 203 ± 7 164 ± 13* 152 ± 6* 177 ± 7† 176 ± 2 160 ± 2 186 ± 5 159 ± 3* 167 ± 5* NS AL > CR1, CR2 Free fatty acids, mEq/L 560 ± 81 293 ± 99* 607 ± 35§ 460 ± 49 287 ± 41 540 ± 95§ 583 ± 57 300 ± 29* 887 ± 110§,‡ NS AL, CR2 > CR1 Total ketone bodies, mmol/L 93 ± 5 97 ± 7 161 ± 50 77 ± 2 104 ± 2 228 ± 74* 99 ± 18 94 ± 12 398 ± 173*,§,†,‡ NS AL, CR1 < CR2 Acetoacetate, mmol/L 36 ± 4 43 ± 2 59 ± 12 28 ± 0 32 ± 4 55 ± 19 32 ± 8 30 ± 4 91 ± 39*,§ NS AL, CR1 < CR2 D-3-hydroxybutyrate, mmol/L 57 ± 6 54 ± 6 101 ± 39 48 ± 2 72 ± 4 173 ± 59* 68 ± 11 64 ± 9 307 ± 134*,§,†,‡ NS AL, CR1 < CR2 Notes: *p <.05 between AL and CR, CR1 or CR2 rats in the same genotypes. §p <.05 between CR1 and CR2 rats in the same genotypes. †p <.05 between (−/−) and (tg/−) or (tg/tg) rats in the same dietary groups. ‡p <.05 between (tg/−) and (tg/tg) rats in the same dietary groups. IGF-1 = Insulin-like growth factor-1; AL = ad libitum fed; CR = calorie restricted; NS = not significant. Open in new tab Table 3. Genes Showing Altered Expression (FC > 1.3 or FC < −1.3) in Three Rat Genotypes by CR2. . FC (CR2/AL) . . . Linear Correlation With Plasma IGF-1 Levels . . GenBank Accession No. . Gene Name . (+/+) . (+/−) . (−/−) . r . p . Enhanced expression by CR2 (12)     Stress response and xenobiotic metabolism (3)         Heat shock protein 90 (HSP90)* 1.4 1.3 1.4 −0.774 .071 S45392         Organic cation transporter 1A (OCT1A)* 1.7 1.4 1.3 −0.829 .041 U76379         Multidrug resistance protein 2 (MDR2)* 2.4 2.3 1.4 −0.824 .044 L15079     Metabolic pathways (4)         Cytochrome P450 3A1 (C3A1) 1.6 1.9 1.3 0.676 .141 M10161         Cytochrome P450 4A3 (C4A3)* 3.6 2.8 1.3 0.200 .704 M33936         LCAD* 1.6 1.7 1.8 −0.206 .695 J05029         Brain fatty acid binding protein (BFABP)* 4.3 2.0 1.8 0.249 .634 U02096     Ion channels and transport proteins (1)         Gamma-aminobutyric acid transporter 2 (GABAt2)* 2.0 1.8 1.7 −0.653 .160 M95762     Modulators, effectors and intracellular transducers (2)         Nuclear tyrosine phosphatase (PRL1)* 2.1 1.8 2.0 −0.398 .435 L27843         14-3-3 protein epsilon; PKC inhibitor protein-1 1.5 1.5 1.3 −0.725 .103 M84416     Extracellular transporters (1)         Apolipoprotein AI (ApoAI)* 2.2 1.3 1.7 0.079 .882 M00001     Protein turnover (1)         Carboxypeptidase E 1.3 1.3 1.9 0.588 .219 P15087 Reduced expression by CR2 (6)     Stress response and xenobiotic metabolism (1)         Cytochrome P450 2C11 (C2C11)* −1.5 −1.4 −2.1 0.985 .000 J02657     Metabolic pathways (1)         Carbonic anhydrase III (CAIII)* −1.9 −1.7 −1.4 0.857 .029 M22413     Extracellular signaling and communication (2)         Macrophage migration inhibitory factor (MIF) −1.3 −1.3 −1.9 −0.098 .854 U62326         Insulin-like growth factor I (IGF-I) −1.7 −1.5 −1.8 0.915 .010 M15480     Cell cycle regulators (1)         G2/M-specific cyclin G −1.4 −1.9 −1.5 0.117 .825 X70871     Protein turnover (1)         TAP-related matrix metalloproteinase 10 (MMP10) −1.4 −1.6 −1.6 0.431 .393 M65253 . FC (CR2/AL) . . . Linear Correlation With Plasma IGF-1 Levels . . GenBank Accession No. . Gene Name . (+/+) . (+/−) . (−/−) . r . p . Enhanced expression by CR2 (12)     Stress response and xenobiotic metabolism (3)         Heat shock protein 90 (HSP90)* 1.4 1.3 1.4 −0.774 .071 S45392         Organic cation transporter 1A (OCT1A)* 1.7 1.4 1.3 −0.829 .041 U76379         Multidrug resistance protein 2 (MDR2)* 2.4 2.3 1.4 −0.824 .044 L15079     Metabolic pathways (4)         Cytochrome P450 3A1 (C3A1) 1.6 1.9 1.3 0.676 .141 M10161         Cytochrome P450 4A3 (C4A3)* 3.6 2.8 1.3 0.200 .704 M33936         LCAD* 1.6 1.7 1.8 −0.206 .695 J05029         Brain fatty acid binding protein (BFABP)* 4.3 2.0 1.8 0.249 .634 U02096     Ion channels and transport proteins (1)         Gamma-aminobutyric acid transporter 2 (GABAt2)* 2.0 1.8 1.7 −0.653 .160 M95762     Modulators, effectors and intracellular transducers (2)         Nuclear tyrosine phosphatase (PRL1)* 2.1 1.8 2.0 −0.398 .435 L27843         14-3-3 protein epsilon; PKC inhibitor protein-1 1.5 1.5 1.3 −0.725 .103 M84416     Extracellular transporters (1)         Apolipoprotein AI (ApoAI)* 2.2 1.3 1.7 0.079 .882 M00001     Protein turnover (1)         Carboxypeptidase E 1.3 1.3 1.9 0.588 .219 P15087 Reduced expression by CR2 (6)     Stress response and xenobiotic metabolism (1)         Cytochrome P450 2C11 (C2C11)* −1.5 −1.4 −2.1 0.985 .000 J02657     Metabolic pathways (1)         Carbonic anhydrase III (CAIII)* −1.9 −1.7 −1.4 0.857 .029 M22413     Extracellular signaling and communication (2)         Macrophage migration inhibitory factor (MIF) −1.3 −1.3 −1.9 −0.098 .854 U62326         Insulin-like growth factor I (IGF-I) −1.7 −1.5 −1.8 0.915 .010 M15480     Cell cycle regulators (1)         G2/M-specific cyclin G −1.4 −1.9 −1.5 0.117 .825 X70871     Protein turnover (1)         TAP-related matrix metalloproteinase 10 (MMP10) −1.4 −1.6 −1.6 0.431 .393 M65253 Notes: Number of genes is shown in parentheses. Genes showing linear correlation with plasma IGF-1 levels (p <.05) are shown in italics. Genes involved in lipid metabolism are in bold. *The expression level of genes was examined by semiquantitative reverse transcription–polymerase chain reaction as well. FC = fold change; AL = ad libitum fed; CR = calorie-restricted; LCAD = long chain-specific acyl-CoA dehydrogenase. Open in new tab Table 3. Genes Showing Altered Expression (FC > 1.3 or FC < −1.3) in Three Rat Genotypes by CR2. . FC (CR2/AL) . . . Linear Correlation With Plasma IGF-1 Levels . . GenBank Accession No. . Gene Name . (+/+) . (+/−) . (−/−) . r . p . Enhanced expression by CR2 (12)     Stress response and xenobiotic metabolism (3)         Heat shock protein 90 (HSP90)* 1.4 1.3 1.4 −0.774 .071 S45392         Organic cation transporter 1A (OCT1A)* 1.7 1.4 1.3 −0.829 .041 U76379         Multidrug resistance protein 2 (MDR2)* 2.4 2.3 1.4 −0.824 .044 L15079     Metabolic pathways (4)         Cytochrome P450 3A1 (C3A1) 1.6 1.9 1.3 0.676 .141 M10161         Cytochrome P450 4A3 (C4A3)* 3.6 2.8 1.3 0.200 .704 M33936         LCAD* 1.6 1.7 1.8 −0.206 .695 J05029         Brain fatty acid binding protein (BFABP)* 4.3 2.0 1.8 0.249 .634 U02096     Ion channels and transport proteins (1)         Gamma-aminobutyric acid transporter 2 (GABAt2)* 2.0 1.8 1.7 −0.653 .160 M95762     Modulators, effectors and intracellular transducers (2)         Nuclear tyrosine phosphatase (PRL1)* 2.1 1.8 2.0 −0.398 .435 L27843         14-3-3 protein epsilon; PKC inhibitor protein-1 1.5 1.5 1.3 −0.725 .103 M84416     Extracellular transporters (1)         Apolipoprotein AI (ApoAI)* 2.2 1.3 1.7 0.079 .882 M00001     Protein turnover (1)         Carboxypeptidase E 1.3 1.3 1.9 0.588 .219 P15087 Reduced expression by CR2 (6)     Stress response and xenobiotic metabolism (1)         Cytochrome P450 2C11 (C2C11)* −1.5 −1.4 −2.1 0.985 .000 J02657     Metabolic pathways (1)         Carbonic anhydrase III (CAIII)* −1.9 −1.7 −1.4 0.857 .029 M22413     Extracellular signaling and communication (2)         Macrophage migration inhibitory factor (MIF) −1.3 −1.3 −1.9 −0.098 .854 U62326         Insulin-like growth factor I (IGF-I) −1.7 −1.5 −1.8 0.915 .010 M15480     Cell cycle regulators (1)         G2/M-specific cyclin G −1.4 −1.9 −1.5 0.117 .825 X70871     Protein turnover (1)         TAP-related matrix metalloproteinase 10 (MMP10) −1.4 −1.6 −1.6 0.431 .393 M65253 . FC (CR2/AL) . . . Linear Correlation With Plasma IGF-1 Levels . . GenBank Accession No. . Gene Name . (+/+) . (+/−) . (−/−) . r . p . Enhanced expression by CR2 (12)     Stress response and xenobiotic metabolism (3)         Heat shock protein 90 (HSP90)* 1.4 1.3 1.4 −0.774 .071 S45392         Organic cation transporter 1A (OCT1A)* 1.7 1.4 1.3 −0.829 .041 U76379         Multidrug resistance protein 2 (MDR2)* 2.4 2.3 1.4 −0.824 .044 L15079     Metabolic pathways (4)         Cytochrome P450 3A1 (C3A1) 1.6 1.9 1.3 0.676 .141 M10161         Cytochrome P450 4A3 (C4A3)* 3.6 2.8 1.3 0.200 .704 M33936         LCAD* 1.6 1.7 1.8 −0.206 .695 J05029         Brain fatty acid binding protein (BFABP)* 4.3 2.0 1.8 0.249 .634 U02096     Ion channels and transport proteins (1)         Gamma-aminobutyric acid transporter 2 (GABAt2)* 2.0 1.8 1.7 −0.653 .160 M95762     Modulators, effectors and intracellular transducers (2)         Nuclear tyrosine phosphatase (PRL1)* 2.1 1.8 2.0 −0.398 .435 L27843         14-3-3 protein epsilon; PKC inhibitor protein-1 1.5 1.5 1.3 −0.725 .103 M84416     Extracellular transporters (1)         Apolipoprotein AI (ApoAI)* 2.2 1.3 1.7 0.079 .882 M00001     Protein turnover (1)         Carboxypeptidase E 1.3 1.3 1.9 0.588 .219 P15087 Reduced expression by CR2 (6)     Stress response and xenobiotic metabolism (1)         Cytochrome P450 2C11 (C2C11)* −1.5 −1.4 −2.1 0.985 .000 J02657     Metabolic pathways (1)         Carbonic anhydrase III (CAIII)* −1.9 −1.7 −1.4 0.857 .029 M22413     Extracellular signaling and communication (2)         Macrophage migration inhibitory factor (MIF) −1.3 −1.3 −1.9 −0.098 .854 U62326         Insulin-like growth factor I (IGF-I) −1.7 −1.5 −1.8 0.915 .010 M15480     Cell cycle regulators (1)         G2/M-specific cyclin G −1.4 −1.9 −1.5 0.117 .825 X70871     Protein turnover (1)         TAP-related matrix metalloproteinase 10 (MMP10) −1.4 −1.6 −1.6 0.431 .393 M65253 Notes: Number of genes is shown in parentheses. Genes showing linear correlation with plasma IGF-1 levels (p <.05) are shown in italics. Genes involved in lipid metabolism are in bold. *The expression level of genes was examined by semiquantitative reverse transcription–polymerase chain reaction as well. FC = fold change; AL = ad libitum fed; CR = calorie-restricted; LCAD = long chain-specific acyl-CoA dehydrogenase. Open in new tab Table 4. Altered Gene Expressions Analyzed by Semiquantitative RT–PCR. . Compared With (−/−) . . Compared With AL . . FunctionsGene Name . (tg/−) . (tg/tg) . CR1 . CR2 . Lipid metabolism-related transcriptional regulators     PPARα NS NS NS ↑ 1.6 ± 0.2 (–)     ADD1/SREBP1 NS NS ↑1.6 ± 0.1 ↓ −2.7 ± 0.1 (–) Mitochondrial β-oxidation     mCPT1 NS NS NS ↑ 1.7 ± 0.2 (no)     VLCAD NS NS NS NS (yes)     LCAD NS NS ↑ 1.9 ± 0.2 (yes)     MCAD NS NS NS NS (yes)     SCAD NS NS NS NS (yes)     mTPα NS NS NS ↑ 1.4 ± 0.1 (–)     mTPβ NS ↑ 1.4 ± 0.2 NS ↑ 1.8 ± 0.2 (–)     mISO NS NS NS ↑ 3.6 ± 0.6 (–)     DECR NS NS NS ↑ 1.5 ± 0.1 (–) Peroxisomal β-oxidation     ACO NS ↑ 1.4 ± 0.1 NS ↑ 1.5 ± 0.1 (no)     PCO NS NS NS NS (–)     pMEI NS NS NS NS (–)     pMEII NS NS NS NS (–)     pTHLA NS NS NS NS (–)     SCPX NS NS NS NS (yes) Microsomal ω-oxidation     C4A3 NS NS NS ↑ 2.4 ± 0.1 (yes) Fatty acid synthesis     FASN NS NS ↑ 1.9 ± 0.2 ↓ −4.3 ± 0.2 (no)     ACC NS NS ↑ 1.9 ± 0.3 ↓ −2.4 ± 0.2 (no) Other lipid metabolism     BFABP NS ↓ −1.2 ± 0.3 NS ↑ 3.1 ± 0.5 (yes)     ApoAI NS NS NS ↑ 1.3 ± 0.1 (yes) Stress response and xenobiotic metabolism     HSP90 NS NS NS ↑ 1.5 ± 0.2 (yes)     OCT1A ↑ 1.4 ± 0.1 ↑ 1.7 ± 0.1 NS ↑ 1.4 ± 0.1 (yes)     MDR2 ↑ 1.4 ± 0.1 ↑ 1.6 ± 0.2 ↓ −1.6 ± 0.1 ↑ 1.7 ± 0.1 (yes)     C2C11 NS ↓ −7.9 ± 0.1 NS ↓ −1.2 ± 0.1 (yes)     C2C22 NS ↓ −1.2 ± 0.1 NS ↓ −1.8 ± 0.1 (no) Others     GABAt2 NS ↑ 1.5 ± 0.2 NS ↑ 1.7 ± 0.2 (yes)     PRL1 NS NS NS ↑ 1.4 ± 0.1 (yes)     CAIII ↓ −1.5 ± 0.1 ↓ −2.9 ± 0.2 NS ↓ −1.8 ± 0.2 (yes) . Compared With (−/−) . . Compared With AL . . FunctionsGene Name . (tg/−) . (tg/tg) . CR1 . CR2 . Lipid metabolism-related transcriptional regulators     PPARα NS NS NS ↑ 1.6 ± 0.2 (–)     ADD1/SREBP1 NS NS ↑1.6 ± 0.1 ↓ −2.7 ± 0.1 (–) Mitochondrial β-oxidation     mCPT1 NS NS NS ↑ 1.7 ± 0.2 (no)     VLCAD NS NS NS NS (yes)     LCAD NS NS ↑ 1.9 ± 0.2 (yes)     MCAD NS NS NS NS (yes)     SCAD NS NS NS NS (yes)     mTPα NS NS NS ↑ 1.4 ± 0.1 (–)     mTPβ NS ↑ 1.4 ± 0.2 NS ↑ 1.8 ± 0.2 (–)     mISO NS NS NS ↑ 3.6 ± 0.6 (–)     DECR NS NS NS ↑ 1.5 ± 0.1 (–) Peroxisomal β-oxidation     ACO NS ↑ 1.4 ± 0.1 NS ↑ 1.5 ± 0.1 (no)     PCO NS NS NS NS (–)     pMEI NS NS NS NS (–)     pMEII NS NS NS NS (–)     pTHLA NS NS NS NS (–)     SCPX NS NS NS NS (yes) Microsomal ω-oxidation     C4A3 NS NS NS ↑ 2.4 ± 0.1 (yes) Fatty acid synthesis     FASN NS NS ↑ 1.9 ± 0.2 ↓ −4.3 ± 0.2 (no)     ACC NS NS ↑ 1.9 ± 0.3 ↓ −2.4 ± 0.2 (no) Other lipid metabolism     BFABP NS ↓ −1.2 ± 0.3 NS ↑ 3.1 ± 0.5 (yes)     ApoAI NS NS NS ↑ 1.3 ± 0.1 (yes) Stress response and xenobiotic metabolism     HSP90 NS NS NS ↑ 1.5 ± 0.2 (yes)     OCT1A ↑ 1.4 ± 0.1 ↑ 1.7 ± 0.1 NS ↑ 1.4 ± 0.1 (yes)     MDR2 ↑ 1.4 ± 0.1 ↑ 1.6 ± 0.2 ↓ −1.6 ± 0.1 ↑ 1.7 ± 0.1 (yes)     C2C11 NS ↓ −7.9 ± 0.1 NS ↓ −1.2 ± 0.1 (yes)     C2C22 NS ↓ −1.2 ± 0.1 NS ↓ −1.8 ± 0.1 (no) Others     GABAt2 NS ↑ 1.5 ± 0.2 NS ↑ 1.7 ± 0.2 (yes)     PRL1 NS NS NS ↑ 1.4 ± 0.1 (yes)     CAIII ↓ −1.5 ± 0.1 ↓ −2.9 ± 0.2 NS ↓ −1.8 ± 0.2 (yes) Notes: ↑↓: p <.05 analyzed by Fisher's Probable Least-Squares Difference test; number of fold changes ± standard error of the mean compared with (−/−) or AL rats. Parentheses: similarity to the results obtained by DNA array. (yes) = Same results were observed between both RT–PCR and DNA array. (no) = same results were not observed between both RT–PCR and DNA array. (–) = genes were not spotted in the DNA array membrane or were not selected from our criteria based on the minimal optical density and coefficient of variation. AL = ad libitum fed; CR = calorie-restricted; RT–PCR = reverse transcription–polymerase chain reaction; NS = no significant difference. Open in new tab Table 4. Altered Gene Expressions Analyzed by Semiquantitative RT–PCR. . Compared With (−/−) . . Compared With AL . . FunctionsGene Name . (tg/−) . (tg/tg) . CR1 . CR2 . Lipid metabolism-related transcriptional regulators     PPARα NS NS NS ↑ 1.6 ± 0.2 (–)     ADD1/SREBP1 NS NS ↑1.6 ± 0.1 ↓ −2.7 ± 0.1 (–) Mitochondrial β-oxidation     mCPT1 NS NS NS ↑ 1.7 ± 0.2 (no)     VLCAD NS NS NS NS (yes)     LCAD NS NS ↑ 1.9 ± 0.2 (yes)     MCAD NS NS NS NS (yes)     SCAD NS NS NS NS (yes)     mTPα NS NS NS ↑ 1.4 ± 0.1 (–)     mTPβ NS ↑ 1.4 ± 0.2 NS ↑ 1.8 ± 0.2 (–)     mISO NS NS NS ↑ 3.6 ± 0.6 (–)     DECR NS NS NS ↑ 1.5 ± 0.1 (–) Peroxisomal β-oxidation     ACO NS ↑ 1.4 ± 0.1 NS ↑ 1.5 ± 0.1 (no)     PCO NS NS NS NS (–)     pMEI NS NS NS NS (–)     pMEII NS NS NS NS (–)     pTHLA NS NS NS NS (–)     SCPX NS NS NS NS (yes) Microsomal ω-oxidation     C4A3 NS NS NS ↑ 2.4 ± 0.1 (yes) Fatty acid synthesis     FASN NS NS ↑ 1.9 ± 0.2 ↓ −4.3 ± 0.2 (no)     ACC NS NS ↑ 1.9 ± 0.3 ↓ −2.4 ± 0.2 (no) Other lipid metabolism     BFABP NS ↓ −1.2 ± 0.3 NS ↑ 3.1 ± 0.5 (yes)     ApoAI NS NS NS ↑ 1.3 ± 0.1 (yes) Stress response and xenobiotic metabolism     HSP90 NS NS NS ↑ 1.5 ± 0.2 (yes)     OCT1A ↑ 1.4 ± 0.1 ↑ 1.7 ± 0.1 NS ↑ 1.4 ± 0.1 (yes)     MDR2 ↑ 1.4 ± 0.1 ↑ 1.6 ± 0.2 ↓ −1.6 ± 0.1 ↑ 1.7 ± 0.1 (yes)     C2C11 NS ↓ −7.9 ± 0.1 NS ↓ −1.2 ± 0.1 (yes)     C2C22 NS ↓ −1.2 ± 0.1 NS ↓ −1.8 ± 0.1 (no) Others     GABAt2 NS ↑ 1.5 ± 0.2 NS ↑ 1.7 ± 0.2 (yes)     PRL1 NS NS NS ↑ 1.4 ± 0.1 (yes)     CAIII ↓ −1.5 ± 0.1 ↓ −2.9 ± 0.2 NS ↓ −1.8 ± 0.2 (yes) . Compared With (−/−) . . Compared With AL . . FunctionsGene Name . (tg/−) . (tg/tg) . CR1 . CR2 . Lipid metabolism-related transcriptional regulators     PPARα NS NS NS ↑ 1.6 ± 0.2 (–)     ADD1/SREBP1 NS NS ↑1.6 ± 0.1 ↓ −2.7 ± 0.1 (–) Mitochondrial β-oxidation     mCPT1 NS NS NS ↑ 1.7 ± 0.2 (no)     VLCAD NS NS NS NS (yes)     LCAD NS NS ↑ 1.9 ± 0.2 (yes)     MCAD NS NS NS NS (yes)     SCAD NS NS NS NS (yes)     mTPα NS NS NS ↑ 1.4 ± 0.1 (–)     mTPβ NS ↑ 1.4 ± 0.2 NS ↑ 1.8 ± 0.2 (–)     mISO NS NS NS ↑ 3.6 ± 0.6 (–)     DECR NS NS NS ↑ 1.5 ± 0.1 (–) Peroxisomal β-oxidation     ACO NS ↑ 1.4 ± 0.1 NS ↑ 1.5 ± 0.1 (no)     PCO NS NS NS NS (–)     pMEI NS NS NS NS (–)     pMEII NS NS NS NS (–)     pTHLA NS NS NS NS (–)     SCPX NS NS NS NS (yes) Microsomal ω-oxidation     C4A3 NS NS NS ↑ 2.4 ± 0.1 (yes) Fatty acid synthesis     FASN NS NS ↑ 1.9 ± 0.2 ↓ −4.3 ± 0.2 (no)     ACC NS NS ↑ 1.9 ± 0.3 ↓ −2.4 ± 0.2 (no) Other lipid metabolism     BFABP NS ↓ −1.2 ± 0.3 NS ↑ 3.1 ± 0.5 (yes)     ApoAI NS NS NS ↑ 1.3 ± 0.1 (yes) Stress response and xenobiotic metabolism     HSP90 NS NS NS ↑ 1.5 ± 0.2 (yes)     OCT1A ↑ 1.4 ± 0.1 ↑ 1.7 ± 0.1 NS ↑ 1.4 ± 0.1 (yes)     MDR2 ↑ 1.4 ± 0.1 ↑ 1.6 ± 0.2 ↓ −1.6 ± 0.1 ↑ 1.7 ± 0.1 (yes)     C2C11 NS ↓ −7.9 ± 0.1 NS ↓ −1.2 ± 0.1 (yes)     C2C22 NS ↓ −1.2 ± 0.1 NS ↓ −1.8 ± 0.1 (no) Others     GABAt2 NS ↑ 1.5 ± 0.2 NS ↑ 1.7 ± 0.2 (yes)     PRL1 NS NS NS ↑ 1.4 ± 0.1 (yes)     CAIII ↓ −1.5 ± 0.1 ↓ −2.9 ± 0.2 NS ↓ −1.8 ± 0.2 (yes) Notes: ↑↓: p <.05 analyzed by Fisher's Probable Least-Squares Difference test; number of fold changes ± standard error of the mean compared with (−/−) or AL rats. Parentheses: similarity to the results obtained by DNA array. (yes) = Same results were observed between both RT–PCR and DNA array. (no) = same results were not observed between both RT–PCR and DNA array. (–) = genes were not spotted in the DNA array membrane or were not selected from our criteria based on the minimal optical density and coefficient of variation. AL = ad libitum fed; CR = calorie-restricted; RT–PCR = reverse transcription–polymerase chain reaction; NS = no significant difference. Open in new tab This research was supported by a Research Grant for Longevity Sciences from the Ministry of Health, Welfare, and Labor of Japan (12-05) and by a Grant-in Aid for Scientific Research (C) (2), Japan Society of the Promotion of Science (12670206). We thank Yutaka Araki and Yuko Moriyama in the Department of Pathology & Gerontology and all members of the Laboratory Animal Center and Radioisotope Center of Nagasaki University for their technical assistance and cooperation. We also thank Professor Richard Weindruch and Jennifer D. Christensen at the Wisconsin Primate Research Center, University of Wisconsin-Madison, for their invaluable suggestions and editorial help. References 1 Kenyon C. The plasticity of aging: insights from long-lived mutants. Cell. 2005 ; 120 : 449 -460. 2 Brown-Borg HM, Borg KE, Mellska CJ, Bartke A. Dwarf mice and the ageing process. Nature. 1996 ; 384 : 33 . 3 Bartke A. Mini review: role of the growth hormone/insulin-like growth factor system in mammalian aging. Endocrinology. 2005 ; 146 : 3718 -3723. 4 Coschigano KT, Clemmons D, Bellush LL, Kopchick JJ. Assessment of growth parameters and life span of GHR/BP gene-disrupted mice. Endocrinology. 2000 ; 141 : 2608 -2613. 5 Bartke A, Coschigano K, Kopchick J, et al. Genes that prolong life: relationships of growth hormone and growth to aging and life span. J Gerontol A Biol Sci Med Sci. 2001 ; 56A : B340 -B349. 6 Weindruch R, Walford RL. The Retardation of Aging and Disease by Dietary Restriction. Springfield, IL: Charles C Thomas; 1988. 7 Yu BP. Modulation of Aging Processes by Dietary Restriction. Boca Raton, FL: CRC Press; 1994. 8 Sohal RS, Weindruch R. Oxidative stress, caloric restriction, and aging. Science. 1996 ; 273 : 59 -63. 9 Masoro EJ. Overview of caloric restriction and ageing. Mech Ageing Dev. 2005 ; 126 : 913 -922. 10 Sinclair DA. Toward a unified theory of caloric restriction and longevity regulation. Mech Ageing Dev. 2005 ; 126 : 987 -1002. 11 Lane MA, Baer DJ, Rumpler WV, et al. Calorie restriction lowers body temperature in rhesus monkeys, consistent with a postulated anti-aging mechanism in rodents. Proc Natl Acad Sci U S A. 1996 ; 93 : 4159 -4164. 12 Wanagat J, Allison DB, Weindruch R. Caloric intake and aging: mechanisms in rodents and a study in nonhuman primates. Toxicol Sci. 1999 ; 52 :(suppl 2): 35 -40. 13 Mattison JA, Wright C, Bronson RT, Roth GS, Ingram DK, Bartke A. Studies of aging in Ames dwarf mice: effects of caloric restriction. J Am Aging Assoc. 2000 ; 23 : 9 -16. 14 Lane MA. Metabolic mechanisms of longevity: caloric restriction in mammals and longevity mutations in Caenorhabditis elegans; a common pathway? J Am Aging Assoc. 2000 ; 23 : 1 -7. 15 Shimokawa I, Higami Y, Utsuyama M, et al. Lifespan extension by reduction in growth hormone-insulin-like growth factor-1 axis in a transgenic rat model. Am J Pathol. 2002 ; 160 : 2259 -2265. 16 Shimokawa I, Higami Y, Tsuchiya T, et al. Lifespan extension by reduction of the growth hormone-insulin-like growth factor-1 axis: relation to caloric restriction. FASEB J. 2003 ; 17 : 1108 -1109. 17 Shimokawa I, Higami Y. A role for suppression of growth hormone in the antiaging action of caloric restriction. Gerontology. 2001 ; 47 :(suppl 1): 582 . 18 Bartke A, Wright JC, Mattison JA, Ingram DK, Miller RA, Roth GS. Extending the lifespan of long-lived mice. Nature. 2001 ; 414 : 412 . 19 Matsumoto K, Kakidani H, Takahashi A, et al. Growth retardation in rats whose growth hormone gene expression was suppressed by antisense RNA transgene. Mol Reprod Dev. 1993 ; 36 : 53 -58. 20 Tsuchiya T, Higami Y, Komatsu T, et al. Acute stress response in calorie-restricted rats to lipopolysaccharide-induced inflammation. Mech Ageing Dev. 2005 ; 126 : 568 -579. 21 Nadler ST, Stoehr JP, Schueler KL, Tanimoto G, Yandell BS, Attie AD. The expression of adipogenic genes is decreased in obesity and diabetes mellitus. Proc Natl Acad Sci U S A. 2000 ; 97 : 11371 -11376. 22 Ouali F, Djouadi F, Merlet-Benichou C, Bastin J. Dietary lipids regulate beta-oxidation enzyme gene expression in the developing rat kidney. Am J Physiol. 1998 ; 275 : F777 -F784. 23 Hildebrandt AL, Neufer PD. Exercise attenuates the fasting-induced transcriptional activation of metabolic genes in skeletal muscle. Am J Physiol Endocrinol Metab. 2000 ; 278 : E1078 -E1086. 24 Knoll A, Sargueil F, Salles J, Cassagne C, Garbay B. Gene expression of peroxisomal beta-oxidation enzymes in rat brain. Brain Res Mol Brain Res. 1999 ; 74 : 217 -220. 25 Ito O, Alonso-Galicia M, Hopp KA, Roman RJ. Localization of cytochrome P-450 4A isoforms along the rat nephron. Am J Physiol. 1998 ; 274 : F395 -F404. 26 Foretz M, Pacot C, Dugail I, et al. ADD1/SREBP-1c is required in the activation of hepatic lipogenic gene expression by glucose. Mol Cell Biol. 1999 ; 19 : 3760 -3768. 27 Wu JY, Reaves SK, Wang YR, Wu Y, Lei PP, Lei KY. Zinc deficiency decreases plasma level and hepatic mRNA abundance of apolipoprotein A-I in rats and hamsters. Am J Physiol. 1998 ; 275 : C1516 -C1525. 28 Alderman BM, Cook GA, Familari M, Yeomans ND, Giraud AS. Resistance to apoptosis is a mechanism of adaptation of rat stomach to aspirin. Am J Physiol Gastrointest Liver Physiol. 2000 ; 278 : G839 -G846. 29 Vos TA, Hooiveld GJ, Koning H, et al. Up-regulation of the multidrug resistance genes, Mrp1 and Mdr1b, and down-regulation of the organic anion transporter, Mrp2, and the bile salt transporter, Spgp, in endotoxemic rat liver. Hepatology. 1998 ; 28 : 1637 -1644. 30 Morris DL, Davila JC. Analysis of rat cytochrome P450 isoenzyme expression using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). Biochem Pharmacol. 1996 ; 52 : 781 -792. 31 Jampel HD, Chen X, Chue C, Zack DJ. Expression of carbonic anhydrase isozyme III in the ciliary processes and lens. Invest Ophthalmol Vis Sci. 1997 ; 38 : 539 -543. 32 Higami Y, Shimokawa I, Tomita M, et al. Aging accelerates but life-long dietary restriction suppresses apoptosis-related Fas expression on hepatocytes. Am J Pathol. 1997 ; 151 : 659 -663. 33 Mathur PP, Grima J, Mo MY, et al. Differential expression of multiple cathepsin mRNAs in the rat testis during maturation and following lonidamine induced tissue restructuring. Biochem Mol Biol Int. 1997 ; 42 : 217 -233. 34 Shimokawa I, Yanagihara K, Higami Y, et al. Effects of aging and dietary restriction on mRNA levels of receptors for growth hormone- releasing hormone and somatostatin in the rat pituitary. J Gerontol Biol Sci. 2000 ; 55A : B274 -B279. 35 Guzman M, Lo Verme J, Fu J, Oveisi F, Blazquez C, Piomelli D. Oleoylethanolamide stimulates lipolysis by activating the nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR-alpha). J Biol Chem. 2004 ; 279 : 27849 -27854. 36 Salway JG. Metabolism at a Glance. Oxford, UK: Blackwell Science Ltd; 1999. 37 Balendiran GK, Schnutgen F, Scapin G, et al. Crystal structure and thermodynamic analysis of human brain fatty acid- binding protein. J Biol Chem. 2000 ; 275 : 27045 -27054. 38 Schoonjans K, Staels B, Auwerx J. The peroxisome proliferator activated receptors (PPARS) and their effects on lipid metabolism and adipocyte differentiation. Biochim Biophys Acta. 1996 ; 1302 : 93 -109. 39 Aoyama T, Peters JM, Iritani N, et al. Altered constitutive expression of fatty acid-metabolizing enzymes in mice lacking the peroxisome proliferator-activated receptor alpha (PPARalpha). J Biol Chem. 1998 ; 273 : 5678 -5684. 40 Shimano H, Yahagi N, Amemiya-Kudo M, et al. Sterol regulatory element-binding protein-1 as a key transcription factor for nutritional induction of lipogenic enzyme genes. J Biol Chem. 1999 ; 274 : 35832 -35839. 41 Patel DD, Knight BL, Wiggins D, Humphreys SM, Gibbons GF. Disturbances in the normal regulation of SREBP-sensitive genes in PPAR alpha-deficient mice. J Lipid Res. 2001 ; 42 : 328 -337. 42 Takahashi J, Furuhata Y, Ikeda A, et al. Characterization of hepatic cytochrome P450 isozyme composition in the transgenic rat expressing low level human growth hormone. Xenobiotica. 1999 ; 29 : 1203 -1212. 43 Jeffery S, Carter ND, Clark RG, Robinson IC. The episodic secretory pattern of growth hormone regulates liver carbonic anhydrase III. Studies in normal and mutant growth-hormone-deficient dwarf rats. Biochem J. 1990 ; 266 : 69 -74. 44 Tsuchiya T, Dhahbi JM, Cui X, et al. Additive regulation of hepatic gene expression by dwarfism and caloric restriction. Physiol Genomics. 2004 ; 17 : 307 -315. 45 Corton JC, Apte U, Anderson SP, et al. Mimetics of caloric restriction include agonists of lipid-activated nuclear receptors. J Biol Chem. 2004 ; 279 : 46204 -46212. 46 Higami Y, Pugh TD, Page GP, Allison DB, Prolla TA, Weindruch R. Adipose tissue energy metabolism: altered gene expression profile of mice subjected to long-term caloric restriction. FASEB J. 2004 ; 18 : 415 -417. 47 McCarter RJ, Palmer J. Energy metabolism and aging: a lifelong study of Fischer 344 rats. Am J Physiol. 1992 ; 263 : E448 -E452. 48 Duffy PH, Feuers RJ, Leakey JA, Nakamura K, Turturro A, Hart RW. Effect of chronic caloric restriction on physiological variables related to energy metabolism in the male Fischer 344 rat. Mech Ageing Dev. 1989 ; 48 : 117 -133. 49 Holliday R. Food, reproduction and longevity: is the extended lifespan of calorie-restricted animals an evolutionary adaptation? Bioessays. 1989 ; 10 : 125 -127. 50 Masoro EJ, Austad SN. The evolution of the antiaging action of dietary restriction: a hypothesis. J Gerontol A Biol Sci Med Sci. 1996 ; 51A : B387 -B391. 51 Ahima RS, Prabakaran D, Mantzoros C, et al. Role of leptin in the neuroendocrine response to fasting. Nature. 1996 ; 382 : 250 -252. 52 Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, Wahli W. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest. 1999 ; 103 : 1489 -1498. 53 Nelson JF. Neuroendocrine involvement in the retardation of aging by dietary restriction: a hypothesis. In: Yu BP, ed. Modulation of Aging Processes by Dietary Restriction. Boca Raton, FL: CRC Press; 1994:37–55. 54 Hashimoto T, Cook WS, Qi C, Yeldandi AV, Reddy JK, Rao MS. Defect in peroxisome proliferator-activated receptor alpha-inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting. J Biol Chem. 2000 ; 275 : 28918 -28928. 55 Kroetz DL, Yook P, Costet P, Bianchi P, Pineau T. Peroxisome proliferator-activated receptor alpha controls the hepatic CYP4A induction adaptive response to starvation and diabetes. J Biol Chem. 1998 ; 273 : 31581 -31589. 56 Rao MS, Reddy JK. Peroxisomal beta-oxidation and steatohepatitis. Semin Liver Dis. 2001 ; 21 : 43 -55. 57 Unger RH, Orci L. Lipoapoptosis: its mechanism and its diseases. Biochim Biophys Acta. 2002 ; 1585 : 202 -212. 58 Unger RH, Orci L. Diseases of liporegulation: new perspective on obesity and related disorders. FASEB J. 2001 ; 15 : 312 -321. 59 Petersen KF, Befroy D, Dufour S, et al. Mitochondrial dysfunction in the elderly: possible role in insulin resistance. Science. 2003 ; 300 : 1140 -1142. 60 Lee Y, Yu X, Gonzales F, et al. PPAR alpha is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissue. Proc Natl Acad Sci U S A. 2002 ; 99 : 11848 -11853. 61 Yamaza H, Komatsu T, Chiba T, et al. A transgenic dwarf rat model as a tool for the study of calorie restriction and aging. Exp Gerontol. 2004 ; 39 : 269 -272. 62 Tsuchiya T, Higami Y, Komatsu T, et al. Acute stress response in calorie-restricted rats to lipopolysaccharide-induced inflammation. Mech Ageing Dev. 2005 ; 126 : 568 -579. The Gerontological Society of America
TI - Hepatic Gene Expression Profile of Lipid Metabolism in Rats: Impact of Caloric Restriction and Growth Hormone/Insulin-Like Growth Factor-1 Suppression
JO - The Journals of Gerontology Series A: Biomedical Sciences and Medical Sciences
DO - 10.1093/gerona/61.11.1099
DA - 2006-11-01
UR - https://www.deepdyve.com/lp/oxford-university-press/hepatic-gene-expression-profile-of-lipid-metabolism-in-rats-impact-of-E8I1XSReA0
SP - 1099
VL - 61
IS - 11
DP - DeepDyve
ER -