TY - JOUR
AU - Zhang, Jian
AB - Abstract Vascularization is an important early indicator of osteogenesis involving biomaterials. Bone repair and new bone formation are associated with extensive neovascularization. Silicon-based biomaterials have attracted widespread attention due to their rapid vascularization. Although calcium phosphate cement (CPC) is a mature substitute for bone, the application of CPC is limited by its slow degradation and insufficient promotion of neovascularization. Calcium silicate (CS) has been shown to stimulate vascular endothelial proliferation. Thus, CS may be added to CPC (CPC–CS) to improve the biocompatibility and neovascularization of CPC. In the early phase of bone repair (the inflammatory phase), macrophages accumulate around the biomaterial and exert both anti- and pro-inflammatory effects. However, the effect of CPC–CS on macrophage polarization is not known, and it is not clear whether the effect on neovascularization is mediated through macrophage polarization. In the present study, we explored whether silicon-mediated macrophage polarization contributes to vascularization by evaluating the CPC–CS-mediated changes in the immuno-environment under different silicate ion contents both in vivo and in vitro. We found that the silicon released from CPC–CS can promote macrophage polarization into the M2 phenotype and rapid endothelial neovascularization during bone repair. Dramatic neovascularization and osteogenesis were observed in mouse calvarial bone defects implanted with CPC–CS containing 60% CS. These findings suggest that CPC–CS is a novel biomaterial that can modulate immune response, promote endothelial proliferation, and facilitate neovascularization and osteogenesis. Thus, CPC–CS shows potential as a bone substitute material. calcium phosphate cement, calcium silicate, macrophage, angiogenesis, osteogenesis Introduction Silicate ions are vital for osteogenesis [1]. Biomaterials containing silicate ions have wide applications in the repair of bone defects [2–4]. Previous studies have indicated that silicate ion-containing biomaterials can stimulate the proliferation and differentiation of osteoblasts, and the released silicon ions can activate the expressions of bone-related genes [5–7]. Neovascularization is a critical step in bone repair. The growth of bone tissue requires blood vessels to provide nutrients, cytokines, and hormones and to remove metabolites; the blood vessels must also act as a communication network between the bone and adjacent tissues [8]. Calcium silicate (CS) has been reported to stimulate the proliferation of blood vessel endothelial cells and upregulate the expressions of vascular endothelial growth factor along with basic fibroblast growth factor and its receptor [9]. However, the exact underlying mechanism remains unclear. Bone repair, which is initiated by inflammation, can be compromised by an overactive or underactive inflammatory response. The implantation of artificial bone materials induces host immune response, the process of which is intimately associated with macrophages [10]. A host of immune responses could be triggered after implantation but before neovascularization and osteogenic formation [11]. Low-grade inflammation can promote osteogenesis and vascularization [12]. Macrophages are the dominant immune effector cells during the process of inflammation. Thus, macrophages are regarded as important therapeutic targets in development, metabolic homeostasis, and disease. Macrophage polarization into different phenotypes (i.e. M1 and M2) promotes vascularization during tissue healing [13–16]. The M1 phenotype, which is induced by Lipopolysaccharides (LPS) and interferon-gamma (IFN-γ), can promote the production and release of pro-inflammatory cytokines, such as tumor necrosis factor-alpha, interleukin-1β (IL-1β), IL-6, and IL-12. The M1 phenotype regulates inflammatory reactions and microorganism eradication and aggravates inflammatory responses by modulating Th1 and Th17. It has been shown that M1 macrophages secrete high levels of vascular endothelial growth factor, suggesting a positive effect on angiogenesis [15]. The M2 phenotype, which is induced by IL-4 with CD206 and CD163 upregulation, plays an important role in wound healing and blood vessel regeneration by secreting the anti-inflammatory cytokines IL-4 and IL-10 [17,18]. Recent studies have confirmed that macrophage polarization plays a role in blood vessel formation, and some silicon-containing materials can promote macrophage polarization [15,17–21]. However, no research has confirmed if doping calcium phosphate cement (CPC) with silicon can facilitate angiogenesis by promoting the polarization of macrophages. CPC has excellent biological properties and is similar to the inorganic composition of natural bone. Clinically, it has been used in bone replacement, cranio-maxillofacial repair, and vertebroplasty. The application of CPC as a bone substitute material is limited by its slow degradation and insufficient promotion of neovascularization [13]. CS has been shown to stimulate vascular endothelial proliferation [19]. Thus, we investigated the effect of adding CS to CPC on its biocompatibility and neovascularization. In the present study, we examined whether silicate ion-mediated macrophage polarization can promote osteogenesis by evaluating the effects of immune responses induced by biomaterials with different silicon contents on vascularization both in vivo and in vitro. Materials and Methods Biomaterial preparation As shown in Table 1, CPC–CS samples were fabricated from CPC (provided by the Key Laboratory for Ultrafine Materials of the Ministry of Education, East China University of Science and Technology, Shanghai, China) and CS (purchased from Sinopharm Chemical Reagent Co., Ltd, Shanghai, China) with different mass ratios in alkaline aqueous solutions. After preparation, the CPC–CS samples were hydrothermally treated at 100°C for 2 h. CS was synthesized from calcium nitrate and sodium silicate solutions with equal molar ratios. CS powder was heated in a muffle furnace at 600°C for 4 h and then mixed with CPC powder that had been ball-milled, passed through a 60-mesh filter, and ground. The CPC–CS samples were prepared by mixing the solid powders with setting liquids containing different contents of CS at a powder-to-liquid ratio of 3:1 (g/ml). Subsequently, cement pastes were obtained and injected into molds with a pressure of 2 MPa for 2 min. The cement columns and molds were then demolded and incubated at 37°C and 100% relative humidity for 72 h. The CPC–CS samples with CS contents of 20%, 40%, 60%, and 80% (weight percentage of the hydrated cement) were labeled as CPC20CS, CPC40CS, CPC60CS, and CPC80CS, respectively. The contents and distributions of calcium, silicon, and phosphorus in the CPC–CS and CPC samples were analyzed by energy-dispersive X-ray spectroscopy (EDS) attached to a scanning electron microscope (Hitachi, Tokyo, Japan). Table 1. Composition of the materials Sample . CPC (wt%) . CS (wt%) . CPC 100 0 CPC20CS 80 20 CPC40CS 60 40 CPC60CS 40 60 CPC80CS 20 80 CS 0 100 Sample . CPC (wt%) . CS (wt%) . CPC 100 0 CPC20CS 80 20 CPC40CS 60 40 CPC60CS 40 60 CPC80CS 20 80 CS 0 100 Open in new tab Table 1. Composition of the materials Sample . CPC (wt%) . CS (wt%) . CPC 100 0 CPC20CS 80 20 CPC40CS 60 40 CPC60CS 40 60 CPC80CS 20 80 CS 0 100 Sample . CPC (wt%) . CS (wt%) . CPC 100 0 CPC20CS 80 20 CPC40CS 60 40 CPC60CS 40 60 CPC80CS 20 80 CS 0 100 Open in new tab Sterile CPC–CS samples with different CS contents were immersed in high-glucose Dulbecco’s modified Eagle medium (DMEM), transferred to a shaker, and kept at 37°C for 2 weeks. The extracts were collected by centrifugation at 250 g for 5 min and sanitized using a 0.22-mm filter. The elemental distributions of the collected liquids were evaluated by inductively coupled plasma-optical emission spectroscopy (ICP-OES; PerkinElmer, Waltham, USA). Cell culture The macrophage-like RAW264.7 Abelson leukemia virus-transformed cell line derived from BALB/c mice was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The primary human umbilical vein endothelial cell (HUVEC) line was commercially obtained from Keygene Company (Nanjing, China). The RAW264.7 and HUVEC cells were cultured in high-glucose DMEM and F12K DMEM (Gibco, Carlsbad, USA) supplemented with 10% fetal bovine serum (FBS), respectively. The cells were treated with 0.25% trypsin and made into a single-cell suspension with the density adjusted to 2 × 105 cells/ml. Biocompatibility CPC and CPC–CS samples with dimensions of 15 × 15 × 2 mm3 were added to the wells of a 12-well plate followed by incubation with 1 ml of RAW264.7 cell suspension with the density adjusted to 3 × 107 cells/ml. After incubation for 4 days, the materials were fixed with 2.5% glutaraldehyde for 24 h, processed, and evaluated by scanning electron microscopy to observe cell growth on the material surfaces. A total of five observation areas were selected randomly and examined at 1000× magnification to count the number of cells. The CPC group served as the control group. The viability of cells in the CPC, CS, and CPC–CS extracts was assessed by CCK-8 assay. Briefly, the biomaterials were co-cultured with macrophages for 4 days. Subsequently, 100 μl of CCK-8 and 1 ml of DMEM were added to each well and incubated for 4 h, followed by the aspiration of 100 μl of liquid into the 96-well plate. Cell proliferation and viability were assessed by measuring the optical density at 450 nm with a microplate reader (Bio-Rad, Hercules, USA). CPC co-cultured with macrophages was used as the control. Flow cytometric analysis RAW264.7 cells were divided into four groups: the control group; the M1 group (cultured in medium containing 20 μg/ml of IFN-γ and 100 μg/ml of LPS); the M2 group (cultured in medium containing 20 μg/ml of IL4); and the extract stimulation group (cultured with CPC60CS extract). After the cell density reached 90%, the culture medium in each group was substituted with the formulated spare culture solution, and the cells were cultured for an additional 4 days. The cells were then harvested and used to analyze the expressions of CD206 (a biomarker of M2) and CD11c (a biomarker of M1) by flow cytometry (Thermo-Fisher Scientific, Waltham, USA) using FlowJo software (TreeStar, Ashland, USA). Gene expression analysis Gene expression was analyzed by real-time quantitative polymerase chain reaction (RT-qPCR). Briefly, total RNA was extracted from cells using Trizol reagent (Invitrogen, Carlsbad, USA), and messenger RNA (mRNA) was reverse transcribed into complementary DNA using a Thermo-Scientific K1622 kit (Thermo-Fisher Scientific) according to the manufacturer’s instructions. The mRNA expressions of CD163, CD206, nitric oxide synthase (NOS, a biomarker of M1), and arginase-1 (Arg-1, a biomarker of M2) were measured using primers purchased from Sangon Biotech Shanghai Corporation (Shanghai, China). The RT-PCR cycling parameters were as follows: 94°C for 10 min, 94°C for 15 s, and 60°C for 1 min for a total of 40 cycles. The sequences of primers are shown in Table 2. The expression values were calculated using the 2–ΔΔCT method and standardized to that of GAPDH, and each experiment was repeated six times. Table 2. Sequence of primers used in the qRT-PCR Gene . Sequence (5ʹ → 3ʹ) . GAPDH Forward GTTGAGGTCAATGAAGGGG Reverse CTACTGTGCTTCAGGGACAAC iNOS Forward ACATCGACCCGTCCACAGTAT Reverse CAGAGGGGTAGGCTTGTCTC Arg-1 Forward CTCCAAGCCAAAGTCCTTAGAG Reverse GGAGCTGTCATTAGGGACATCA CD206 Forward CTCTGTTCAGCTATTGGACGC Reverse TGGCACTCCCAAACATAATTTGA CD163 Forward GGTGGACACAGAATGGTTCTTC Reverse CCAGGAGCGTTAGTGACAGC Gene . Sequence (5ʹ → 3ʹ) . GAPDH Forward GTTGAGGTCAATGAAGGGG Reverse CTACTGTGCTTCAGGGACAAC iNOS Forward ACATCGACCCGTCCACAGTAT Reverse CAGAGGGGTAGGCTTGTCTC Arg-1 Forward CTCCAAGCCAAAGTCCTTAGAG Reverse GGAGCTGTCATTAGGGACATCA CD206 Forward CTCTGTTCAGCTATTGGACGC Reverse TGGCACTCCCAAACATAATTTGA CD163 Forward GGTGGACACAGAATGGTTCTTC Reverse CCAGGAGCGTTAGTGACAGC Open in new tab Table 2. Sequence of primers used in the qRT-PCR Gene . Sequence (5ʹ → 3ʹ) . GAPDH Forward GTTGAGGTCAATGAAGGGG Reverse CTACTGTGCTTCAGGGACAAC iNOS Forward ACATCGACCCGTCCACAGTAT Reverse CAGAGGGGTAGGCTTGTCTC Arg-1 Forward CTCCAAGCCAAAGTCCTTAGAG Reverse GGAGCTGTCATTAGGGACATCA CD206 Forward CTCTGTTCAGCTATTGGACGC Reverse TGGCACTCCCAAACATAATTTGA CD163 Forward GGTGGACACAGAATGGTTCTTC Reverse CCAGGAGCGTTAGTGACAGC Gene . Sequence (5ʹ → 3ʹ) . GAPDH Forward GTTGAGGTCAATGAAGGGG Reverse CTACTGTGCTTCAGGGACAAC iNOS Forward ACATCGACCCGTCCACAGTAT Reverse CAGAGGGGTAGGCTTGTCTC Arg-1 Forward CTCCAAGCCAAAGTCCTTAGAG Reverse GGAGCTGTCATTAGGGACATCA CD206 Forward CTCTGTTCAGCTATTGGACGC Reverse TGGCACTCCCAAACATAATTTGA CD163 Forward GGTGGACACAGAATGGTTCTTC Reverse CCAGGAGCGTTAGTGACAGC Open in new tab Inflammatory cytokine quantification RAW264.7 cells were cultured with either different CPC–CS or CPC extracts (+LPS; 5 μg/ml) or high-glucose DMEM (without FBS supplementation) with or without IFN-γ (20 μg/ml) and LPS (100 μg/ml). The cell suspension was added to a 24-well plate and cultured in a cell incubator under 5% CO2 at 37°C for 5 days. IL-10 in the supernatant was evaluated using an enzyme-linked immunosorbent assay (ELISA) kit (NeoBioscience, Shenzhen, China) according to the manufacturer’s instructions. Cells cultured with high-glucose DMEM without intervention served as the blank group, and cells cultured with CPC extract served as the control group. Co-culture and tube formation assay For co-culturing, HUVEC cells were seeded into transwell inserts (0.4 mm pore size; BD Falcon, New Jersey, USA) at a density of 5 × 104 cells per well. On the apical side, the RAW264.7 cells with equal cellular density were cultured in DMEM, CPC extract, or CPC60CS extract. The cells were cultured for 4 days, and the supernatants were collected for subsequent tube formation assay. The ECMatrix gel (Thermo Fisher Scientific) was prepared following the manufacturer’s instructions. ECMatrix (50 μl) was added to a 96-well plate followed by centrifugation at 150 g and 4°C for 10 min. The plate was incubated at 37°C for 1 h to solidify the ECMatrix gel. Cell density was adjusted to 5 × 104 cells/ml with the collected supernatants, and 200 μl of the cell suspension was added to each well and incubated for 6 h. Tube formation was observed under a phase-contrast microscope. The total capillary length and number of branch points were counted in each image using ImageJ software (version 1.45). Animal models Animal studies were carried out with approval from the Ethics Committee of Zhongshan Hospital, Fudan University. A calvarial defect model was created in 72 SPF C57BL/6 male mice (6 weeks old; SLAC Laboratory Animal, Shanghai, China). The mice were anesthetized by intramuscular injection, followed by scalp shaving and scrubbing. Thereafter, the mouse calvarium was exposed with an approximately 1-cm sagittal midline scalp incision. After the periosteum was gently removed, a 2-mm hole was created on one side of the parietal bone with a drill. Caution was taken to maintain the integrity of the dura matter when drilling full-thickness holes. CPC–CS and CPC were then implanted in the bone defects in the experimental and control groups, respectively. The surgical sites were irrigated with sterile normal saline, and the incisions were closed with sutures. Postoperative management consisted of the intramuscular injection of 10,000 U penicillin. The mice were euthanized at 1, 2, 4, and 8 weeks after the operation. Representative photos of the animal models during the operation are presented in Supplementary Fig. S1. The parietal bones were harvested and fixed in formaldehyde for 24 h, followed by decalcification and embedding. Tissue sections were prepared for hematoxylin and eosin (HE) staining and immunohistochemistry analyses. Detection of neovascularization and macrophage polarization Neovascularization was evaluated by immunostaining for the endothelial biomarkers CD31 and CD341 2 weeks after the operation. The macrophage phenotypes and distribution were evaluated 1 and 2 weeks after the operation by staining for CD206 and CD11c. Positive cells were counted in five randomly selected observation areas under a magnification of 200×. Microvessel density (MVD) was determined by counting the CD34-positive vessels in five randomly selected observation areas under a magnification of 200×. Assessment of osteogenesis Mice parietal bones were harvested at 4 and 8 weeks after the operation, and the tissue sections were stained with HE to observe bone repair. The area of new bone, including the area of new cartilage matrix calcification, trabeculae, and the mature bone tissue, was calculated using Image-Pro Plus 6.0 software. The percentage of the new bone area was calculated as follows: area of new bone/total area of the bone defect ×100%. Statistical analysis Data were analyzed using SPSS21.0 software. All data are expressed as the mean ± standard deviation. Comparisons among three or more groups were performed with the one-way analysis of variance or nonparametric test, as appropriate. Statistical significance was indicated by a two-sided P value less than 0.05. Results Characterization of biomaterials The EDS elemental maps of the CPC–CS samples with different CS contents are shown in Fig. 1. As shown by the silicate ion concentrations measured by ICP-OES, the silicate ion concentration increased as the ratio of CS in the CPC–CS sample increased (Table 3). Figure 1. Open in new tabDownload slide Element information of the materials detected by EDS Figure 1. Open in new tabDownload slide Element information of the materials detected by EDS Table 3. Quantitative analysis of elements in materials by ICP-OES (mg/kg) . Si . Ca . Mg . P . CPC 22.0 11.1 9.5 200.2 CPC20CS 49.8 17.9 7.6 36.2 CPC40CS 64.4 6.0 2.3 41.2 CPC60CS 98.4 8.0 3.1 15.7 CPC80CS 119.7 11.1 4.6 16.9 . Si . Ca . Mg . P . CPC 22.0 11.1 9.5 200.2 CPC20CS 49.8 17.9 7.6 36.2 CPC40CS 64.4 6.0 2.3 41.2 CPC60CS 98.4 8.0 3.1 15.7 CPC80CS 119.7 11.1 4.6 16.9 Open in new tab Table 3. Quantitative analysis of elements in materials by ICP-OES (mg/kg) . Si . Ca . Mg . P . CPC 22.0 11.1 9.5 200.2 CPC20CS 49.8 17.9 7.6 36.2 CPC40CS 64.4 6.0 2.3 41.2 CPC60CS 98.4 8.0 3.1 15.7 CPC80CS 119.7 11.1 4.6 16.9 . Si . Ca . Mg . P . CPC 22.0 11.1 9.5 200.2 CPC20CS 49.8 17.9 7.6 36.2 CPC40CS 64.4 6.0 2.3 41.2 CPC60CS 98.4 8.0 3.1 15.7 CPC80CS 119.7 11.1 4.6 16.9 Open in new tab Biocompatibility of CPC–CS The scanning electron microscopy images of the samples indicated increasing surface coarseness, sclerosis, and compaction as the concentration of silicate ions was increased (Fig. 2A). After the incubation of the RAW264.7 cells with CPC–CS for 4 days, scanning electron microscopy indicated uniform cell density along with a circular, quasi-circular, long-spindle, or polygonal morphology with pseudopodia characteristic of RAW264.7 cells in all groups except the CPC80CS group. As shown in Fig. 2B, the RAW264.7 cells in the CPC80CS group exhibited low cellular density and suboptimal viability. The total cell count in each group was calculated in six randomly selected microscopic fields at a magnification of 1000× (Fig. 2C). Figure 2. Open in new tabDownload slide Cell survival and adhesion on the material surface (A) The surface of the material under the scanning electron microscopy. (B) Typical representative images showing the adherent cells on the surface of the material. (C) Differences in the numbers of adherent cells among groups. (D) Cell viability of macrophages cultured on materials. **P < 0.01. Figure 2. Open in new tabDownload slide Cell survival and adhesion on the material surface (A) The surface of the material under the scanning electron microscopy. (B) Typical representative images showing the adherent cells on the surface of the material. (C) Differences in the numbers of adherent cells among groups. (D) Cell viability of macrophages cultured on materials. **P < 0.01. CCK8 assay indicated that CPC–CS with 60% or less CS had a minimal effect on cell viability, whereas cell viability was significantly impaired in the CPC80CS and CS groups (Fig. 2D). Cells co-cultured with CS showed no adhesion, suggesting the strong cellular toxicity of materials with high concentrations of silicon. Regulation of macrophage polarization by material extracts Flow cytometry showed minimal expressions of CD206 and CD11c in the macrophages after LPS + IFN-γ stimulation (M1 group) and IL-4 stimulation (M2 group), respectively. Compared with the control group, significantly increased CD206-positive cells were noted after IL-4 stimulation, suggesting polarization toward M2 in the majority of cells. After co-culturing with CPC60CS extracts, expressions of CD206 in the macrophages were similar to those of the M2 group. After LPS + IFN-γ stimulation, CD11c-positive cells were significantly increased, suggesting polarization toward M1. After co-culturing with CPC60CS extracts, CD11c-positive cells were more than that in the M2 group but far less than that in the M1 group, suggesting that the tendency of the extract stimulation group to polarize to M1 was weaker than that of M1 group (Fig. 3A,B). Figure 3. Open in new tabDownload slide Regulation of macrophage polarization by material extracts (A) The flow cytometry results indicated that CD206-positive cells were similar to those of the M2 group, CD11c-positive cells were more than that in the M2 group, but far less than that in the M1 group after being co-cultured with CPC60CS extracts. (B) Statistical analysis was performed for the proportions of CD11c- and CD206-positive cells. (C) Statistical analysis of IL-10 protein expression detected by ELISA compared with the blank group. (D) Gene expressions of Arg-1, iNOS, CD206, and CD163 normalized to GAPDH. *P < 0.05 and **P < 0.01. Figure 3. Open in new tabDownload slide Regulation of macrophage polarization by material extracts (A) The flow cytometry results indicated that CD206-positive cells were similar to those of the M2 group, CD11c-positive cells were more than that in the M2 group, but far less than that in the M1 group after being co-cultured with CPC60CS extracts. (B) Statistical analysis was performed for the proportions of CD11c- and CD206-positive cells. (C) Statistical analysis of IL-10 protein expression detected by ELISA compared with the blank group. (D) Gene expressions of Arg-1, iNOS, CD206, and CD163 normalized to GAPDH. *P < 0.05 and **P < 0.01. The ELISA results indicated that IL-10 expression in RAW264.7 cells was significantly increased in a silicon concentration-dependent manner. The stimulation of RAW264.7 cells with LPS and IFN-γ, which was the classical pathway for the polarization of RAW264.7 cells into the M1 phenotype, did not increase IL-10 protein expression (Fig. 3C). The iNOS and Arg-1 levels were associated with macrophage polarization. Specifically, Arg-1, a biomarker of the M2 phenotype, was significantly upregulated in macrophages cultured with CPC60CS extract. In contrast, iNOS was significantly upregulated in the M1 group compared with that in the CPC60CS group (Fig. 3D). CPC–CS promotes vessel regeneration in vitro The effects of macrophage polarization and silicate ions on endothelial angiogenesis were evaluated by endothelial tube formation assay. As shown in Fig. 4, CPC, CPC–CS, or RAW264.7 and HUVEC co-culture could not dramatically promote angiogenesis, whereas RAW264.7 and HUVEC cultured with CPC60CS extract significantly promoted angiogenesis (Fig. 4A). Quantitative analysis showed that the capillary length and the number of branch points were significantly higher in cells co-cultured with CPC60CS extract compared to those in the other groups (Fig. 4B,C). Figure 4. Open in new tabDownload slide CPC–CS promotes vessel regeneration in vitro (A) Representative images of tube formation of HUVECs cultured in different media. (B) Quantitative analysis of total capillary length. (C) Quantitative analysis of branch points. **P < 0.01. Figure 4. Open in new tabDownload slide CPC–CS promotes vessel regeneration in vitro (A) Representative images of tube formation of HUVECs cultured in different media. (B) Quantitative analysis of total capillary length. (C) Quantitative analysis of branch points. **P < 0.01. CPC–CS promotes neovascularization in vivo Although CD31- and CD34-positive cells were observed at 1 week after operation in all groups, their numbers and distributions differed significantly among the groups. In the control group, only a limited number of CD31-/CD34-positive cells were observed in the periphery of the bone defect. In contrast, in the CPC–CS groups, CD31-/CD34-positive cells also aggregated in the area where the CPC–CS material degraded. The CD31-/CD34-positive cells in the CPC–CS groups tended to grow centripetally in the periphery of the bone defect, especially for CPC–CS with high CS contents (Fig. 5A). Among the groups, the CD31-positive cell count was the highest in the CPC60CS group followed by the CPC40CS group. The numbers of positive cells were statistically different between the CPC60CS group and the CPC80CS, CPC20CS, and CPC40CS groups, respectively (Fig. 5C). Among the groups, MVD was the highest in the CPC60CS group followed by the CPC40CS group (Fig. 5D). Figure 5. Open in new tabDownload slide CPC–CS promotes macrophage polarization to M2 and neovascularization in vivo (A) The vessels in tissue sections were detected via CD31 and CD34 immunostaining. (B) M1 and M2 macrophages were detected via CD11c and CD206 immunostaining. (C) Quantitative analysis of CD31-positive cells. (D) MVD indicated by CD34 was counted and compared. (E) Quantitative analysis of CD11c and CD206-positive cells. *P < 0.05 and **P < 0.01. M: material. Red arrow: new newly formed vessel. Blue arrow: positive cell. Figure 5. Open in new tabDownload slide CPC–CS promotes macrophage polarization to M2 and neovascularization in vivo (A) The vessels in tissue sections were detected via CD31 and CD34 immunostaining. (B) M1 and M2 macrophages were detected via CD11c and CD206 immunostaining. (C) Quantitative analysis of CD31-positive cells. (D) MVD indicated by CD34 was counted and compared. (E) Quantitative analysis of CD11c and CD206-positive cells. *P < 0.05 and **P < 0.01. M: material. Red arrow: new newly formed vessel. Blue arrow: positive cell. CPC–CS favors macrophage polarization into the M2 phenotype The expressions of CD206 and CD11c were determined by immunohistochemistry to investigate the distributions of macrophages in different biomaterials. Compared to the control group, the experimental groups contained more CD206+ cells and fewer CD11c+ cells (Fig. 5B,E) at 1 week after operation. No significant differences in CD11c+ cells were observed among the experimental groups. No quantitative study was carried out because the staining effect of tissue slices was poor at 2 weeks after operation. Related images are shown in Supplementary Fig. S2. CPC–CS promotes new bone formation in vivo At 4 weeks after operation, homogeneous, island-shaped new bone tissue containing purplish osteocytes was observed on the periphery of CPC–CS in each CPC–CS group. As shown in the HE staining images, increasing the CS content in CPC–CS facilitated material resorption, and the largest area of new bone was found in the CPC60CS group. In comparison, minimal material degradation was observed in the CPC group. Although CPC was connected to the periphery of the bone defect by connective tissue, no osteoblasts grew in the interior of the material (Fig. 6A,B). At 8 weeks after operation, new tissue replaced the area where the silicon material degraded extensively. Spindle-shaped osteoblasts were observed in the periphery of the new bone tissue, and the bone tissue grew into the center of the bone defect. A small amount of new bone tissue was observed in the periphery of the bone defect in the CPC group. Among the groups, the area of new bone at 8 weeks after operation was the highest in the CPC60CS group followed by the CPC40CS group, the CPC80CS group, the CPC20CS group, the CPC group, and the control group (Fig. 6A,C). Figure 6. Open in new tabDownload slide CPC–CS promotes new bone formation in vivo (A) HE staining of the tissue sections showed new bone tissue with purplish osteocytes that could be observed in the periphery of CPC–CS 4 and 8 weeks after operation. (B,C) New bone area were calculated and compared among six groups 4 and 8 weeks after operation. *P < 0.05 and **P < 0.01. M: material. Figure 6. Open in new tabDownload slide CPC–CS promotes new bone formation in vivo (A) HE staining of the tissue sections showed new bone tissue with purplish osteocytes that could be observed in the periphery of CPC–CS 4 and 8 weeks after operation. (B,C) New bone area were calculated and compared among six groups 4 and 8 weeks after operation. *P < 0.05 and **P < 0.01. M: material. Discussion Silicon-containing biomaterials have been widely applied, and some have already been used clinically [4,22,23]. Nonetheless, the underlying mechanisms, especially the interactions between biomaterials and cells and the involvement of biomaterials in microenvironmental changes, remain unclear. Although CPC has been used clinically for many years, its biological and physical characteristics change dramatically after the incorporation of CS [24]. Scanning electron microscopy revealed good macrophage adhesion in CPC–CS samples with CS contents of 60% or less; however, macrophage adhesion was worse in CPC80CS. CCK-8 assay indicated optimal cell viability with extracts containing low concentrations of silicate ion. Our previous study demonstrated that high concentrations of silicate ion damaged the cytoskeleton and induced cell apoptosis by compromising autophagic flow [25]. Thus, we preliminarily assumed that CPC–CS containing 60% or less CS would be promising for biological applications. Vascularization is an important early indicator of osteogenesis in the presence of biomaterials [8,26]. Bone repair and new bone formation are associated with large amounts of neovascularization [14,23]. Many materials containing silicon have been shown to promote bone regeneration, which is associated with the formation of blood vessel networks [27–30]. Compared to β-tricalcium phosphate (β-TCP), a CS-polyethyl propylene ester showed better performance in terms of inducing angiogenesis and bone formation after implantation in rabbit femur defects [31]. In a previous study, implanting bone defects with 45s biologic glass resulted in increased neovascularization, and the silicate ion concentration was approximately 25 times higher in the unmineralized bone matrix than that in adjacent areas [7]. These silicate ions contributed to bone mineralization by accumulating at the point of calcification, suggesting that silicate ions can stimulate osteogenesis directly. Therefore, we speculated that the bone formation observed in silicon-based biomaterials may be influenced by the effect of silicate ions on blood vessel formation and osteogenesis. β-TCP-containing silicon has been demonstrated to exhibit enhanced bioactivity, and silicate ions can promote osteogenesis by stimulating the proliferation and differentiation of human dental pulp cells [32]. The co-culturing of dental pulp cells and biomaterials containing silicate ions increased the expressions of von Willebrand factor and angiopoietin-1 in a silicate ion concentration-dependent manner [32]. Fielding et al. [22] reported that MVD was three times higher in mice bone defects implanted with β-TCP compounded with SiO2 and zinc oxide than those implanted with pure β-TCP; the β-TCP compounded with SiO2 and zinc oxide increased osteogenesis by modulating the production of type I collagen and osteocalcin. In the present study, we evaluated the angiogenic and osteogenic properties of CPC–CS in a mouse calvarium defect model. Although both CD34 and CD31 are widely used in studies of endothelial cells, some studies suggest that CD34 is superior to CD31 for the investigation of tiny or immature microvessels or single endothelial cells [33,34]. Moreover, CD31 can also stain plasma cells; thus, we alternatively used CD34 as a biomarker for MVD. Among the experimental groups, MVD quantified by CD34 staining was the highest in the CPC60CS group followed by the CPC40CS group. Similar results were obtained based on CD31 immunostaining. In the CPS80Cs group, we observed sparse cell growth and low cellular density at the interfaces between the biomaterial and the bone cortex, which may be explained by the cell toxicity of high concentrations of silicate ions [25]. Osteogenesis exhibited a similar pattern to MVD; that is, new bone formation was significantly higher in the CPC60CS group than in the CPC group, which might be related to the degradation properties of the biomaterials. Porter et al. [35] reported that the dissolvability of hydroxyapatite increased as the silicon content increased both in vivo and in vitro. This agrees with the findings of the current study, where the degradation of CPC was slow, and almost no cell growth or osteogenesis was observed at the center of the bone defect. As the content of CS in CPC increased, degradation was enhanced, and more cell growth was observed. Thus, CPC containing silicon may be a better bone graft material for bone replacement therapy than traditional CPC. The natural inflammatory response plays a major regulatory role in vascularization through the activity of macrophages of different polarization types and the cytokines they secrete [15,26,36]. A previous study showed that macrophages of both M1 and M2 phenotypes were critical for anastomosis between engineered blood vessels and host vasculature in vivo [21]. Chitooligosaccharide at a low concentration and suitable polymerization degrees has a beneficial effect on immunity modulation and can modulate osteogenesis/angiogenesis processes for tissue regeneration without using any inductive agent [20]. Sr ion-loaded sodium titanate nanorods significantly promotes the angiogenesis and formation of CD31hiEmcnhi vessels by modulating the transformation of M1 macrophages toward M2 macrophages [26]. Here, we observed the extensive accumulation of macrophages around the implants, suggesting the pivotal role of macrophages in bone repair. The phenotypic switch of the macrophages to either the M1 or M2 phenotype orchestrates the inflammation and tissue repair following changes to the internal microenvironment [15,16]. Macrophage plasticity, which is characterized by the phenotypic switch between the M1 and M2 phenotypes, results in a complex system in which the distinction between the M1 and M2 phenotypes is blurred [37–39]. Most macrophages are likely in a phase between the M1 and M2 phenotypes. Therefore, we only measured the ratio of M1 or M2 macrophages to the total number of macrophages. The phenotypic switch of macrophages to the M2 phenotype after intervention would exert an anti-inflammatory effect. We further found that CPC–CS exhibited macrophage-modulating properties. First, we used the extract of the material alone to stimulate the macrophages. The levels of phenotypic biomarkers and cytokines characteristic of the M2 phenotype in the experimental group were not statistically different from those of the control group, which was treated using the classical method to promote M1 polarization. We then used LPS to activate the macrophages into an acute inflammatory response state. After culturing with silicon ion-containing extracts, the macrophages were polarized into the M2 phenotype and showed a correlation with Si content. The silicate ions may promote the M1-to-M2 transition and inhibit the expression of M1 biomarkers in the early phase of inflammation, during which M1-mediated inflammation is dominant. Previous studies have suggested that M2 macrophages can repair kidney damage in chronic inflammatory nephropathies, and M2 macrophages with highly expressed IL-10 can drastically improve kidney function in ischemia-reperfusion injury [40,41]. IL-10 is an anti-inflammatory cytokine that inhibits human cytokine synthesis. The expression of IL-10 helps reduce inflammation and promote blood vessel formation [17,18]. Our results showed that CPS-CS significantly elevated IL-10 expression in RAW264.7 cells in a silicate ion concentration-dependent manner. Thus, we speculate that silicate ion plays a vital role in neovascularization by promoting macrophage polarization into the M2 phenotype, which, in turn, inhibits inflammation via the secretion of IL-10. Bone regeneration is initiated by the accumulation of endothelial progenitor cells and mesenchymal stem cells that secrete large amounts of angiogenesis-related factors to promote vascularization; this is followed by the formation of bone structures as the stem cells differentiate and mature into osteoblasts [42]. Therefore, biomaterials that stimulate endothelial cells to form vascular networks in the bone defect and induce the bone progenitor cells to produce extracellular matrix would be ideal for bone regeneration [43,44]. The results of the current study suggest that the pro-angiogenesis effects of CPC, CPC–CS and macrophages are minimal and that co-culturing RAW264.7 and HUVEC cells with CPC–CS extracts significantly promotes vascularization by encouraging the polarization of RAW264.7 macrophages into the M2 phenotype and enhancing the formation of blood vessels under the stimulation of silicate ions. To summarize, in the early phase of inflammation, CPC–CS stimulates macrophage polarization into the M2 phenotype and promotes neovascularization to fight inflammation during tissue repair. In vivo and in vitro research on the promotion of osteogenesis remains limited, and the underlying molecular mechanisms have not been clarified. Thus, further investigations into the mechanism of the osteoimmunomodulation function of CPC–CS are underway. In summary, we demonstrated that the silicate ions released from CPC–CS biomaterials can stimulate macrophage polarization into the M2 phenotype to modulate inflammatory reactions and promote rapid endothelial vascularization. In a mouse calvarium defect model, the implantation of CPC60CS significantly promoted neovascularization and bone formation. These findings suggest that silicon-doped CPC is a promising new bone repair material that promotes the formation of new blood vessels and bone by modulating immune response, promoting the formation of vascular networks, and facilitating endothelial cell proliferation and migration. Thus, this study provides valuable information for the exploration of novel artificial bone replacement materials for the efficient repair of bone defects. Supplementary Data Supplementary Data is available at Acta Biochimica et Biophysica Sinica online. Acknowledgement We would like to thank Prof. Changsheng Liu and his fellows from the East China University of Science and Technology for their valuable instructions in the experiments. Funding The work was supported by the grants from the National Natural Science Foundation of China (Nos. 31330028 and 81702177). Conflict of Interest The authors declare that they have no conflict of interest. References 1. Yu Q , Chang J, Wu C. Silicate bioceramics: from soft tissue regeneration to tumor therapy . J Mater Chem B 2019 , 7 : 5449 – 5460 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Song Y , Wu H, Gao Y, Li J, Lin K, Liu B, Lei X, et al. Zinc silicate/nano-hydroxyapatite/collagen scaffolds promote angiogenesis and bone regeneration via the p38 MAPK pathway in activated monocytes . ACS Appl Mater Interfaces 2020 , 12 : 16058 – 16075 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Jones JR , Ehrenfried LM, Hench LL. Optimising bioactive glass scaffolds for bone tissue engineering . Biomaterials 2006 , 27 : 964 – 973 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Will J , Gerhardt LC, Boccaccini AR. Bioactive glass-based scaffolds for bone tissue engineering . Adv Biochem Eng Biotechnol 2012 , 126 : 195 – 226 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 5. Li H , Chang J. Stimulation of proangiogenesis by calcium silicate bioactive ceramic . Acta Biomater 2013 , 9 : 5379 – 5389 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Zhai W , Lu H, Chen L, Lin X, Huang Y, Dai K, Naoki K, et al. Silicate bioceramics induce angiogenesis during bone regeneration . Acta Biomater 2012 , 8 : 341 – 349 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Guan J , Zhang J, Guo S, Zhu H, Zhu Z, Li H, Wang Y, et al. Human urine-derived stem cells can be induced into osteogenic lineage by silicate bioceramics via activation of the Wnt/β-catenin signaling pathway . Biomaterials 2015 , 55 : 1 – 11 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Chim SM , Tickner J, Chow ST, Kuek V, Guo B, Zhang G, Rosen V, et al. Angiogenic factors in bone local environment . Cytokine Growth Factor Rev 2013 , 24 : 297 – 310 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Dashnyam K , Buitrago JO, Bold T, Mandakhbayar N, Perez RA, Knowles JC, Lee JH, et al. Angiogenesis-promoted bone repair with silicate-shelled hydrogel fiber scaffolds . Biomater Sci 2019 , 7 : 5221 – 5231 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Shi M , Xia L, Chen Z, Lv F, Zhu H, Wei F, Han S, et al. Europium-doped mesoporous silica nanosphere as an immune-modulating osteogenesis/angiogenesis agent . Biomaterials 2017 , 144 : 176 – 187 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Anderson JM , Rodriguez A, Chang DT. Foreign body reaction to biomaterials . Semin Immunol 2008 , 20 : 86 – 100 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Cooper PR , Takahashi Y, Graham LW, Simon S, Imazato S, Smith AJ. Inflammation-regeneration interplay in the dentine-pulp complex . J Dent 2010 , 38 : 687 – 697 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Wang M , Yu Y, Dai K, Ma Z, Liu Y, Wang J, Liu C. Improved osteogenesis and angiogenesis of magnesium-doped calcium phosphate cement via macrophage immunomodulation . Biomater Sci 2016 , 4 : 1574 – 1583 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Dagtekin G , Schiffer R, Klein B, Jahnen-Dechent W, Zwadlo-Klarwasser G. Modulation of angiogenic functions in human macrophages by biomaterials . Biomaterials 2003 , 24 : 3395 – 3401 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Spiller KL , Anfang RR, Spiller KJ, Ng J, Nakazawa KR, Daulton JW, Vunjak-Novakovic G. The role of macrophage phenotype in vascularization of tissue engineering scaffolds . Biomaterials 2014 , 35 : 4477 – 4488 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Novak ML , Koh TJ. Phenotypic transitions of macrophages orchestrate tissue repair . Am J Pathol 2013 , 183 : 1352 – 1363 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Mahon OR , Browe DC, Gonzalez-Fernandez T, Pitacco P, Whelan IT, Von Euw S, Hobbs C, et al. Nano-particle mediated M2 macrophage polarization enhances bone formation and MSC osteogenesis in an IL-10 dependent manner . Biomaterials 2020 , 239 : 119833. Google Scholar OpenURL Placeholder Text WorldCat 18. Zhai D , Chen L, Chen Y, Zhu Y, Xiao Y, Wu C. Lithium silicate-based bioceramics promoting chondrocyte maturation by immunomodulating M2 macrophage polarization . Biomater Sci 2020 , 8 : 4521 – 4534 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Zhou P , Xia D, Ni Z, Ou T, Wang Y, Zhang H, Mao L, et al. Calcium silicate bioactive ceramics induce osteogenesis through oncostatin M . Bioact Mater 2021 , 6 : 810 – 822 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Huang X , Chen M, Wu H, Jiao Y, Zhou C. Macrophage polarization mediated by chitooligosaccharide (COS) and associated osteogenic and angiogenic activities . ACS Biomater Sci Eng 2020 , 6 : 1614 – 1629 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Graney PL , Ben-Shaul S, Landau S, Bajpai A, Singh B, Eager J, Cohen A, et al. Macrophages of diverse phenotypes drive vascularization of engineered tissues . Sci Adv 2020 , 6 : eaay6391. Google Scholar OpenURL Placeholder Text WorldCat 22. Fielding G , Bose S. SiO2 and ZnO dopants in three-dimensionally printed tricalcium phosphate bone tissue engineering scaffolds enhance osteogenesis and angiogenesis in vivo . Acta Biomater 2013 , 9 : 9137 – 9148 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Dashnyam K , El-Fiqi A, Buitrago JO, Perez RA, Knowles JC, Kim HW. A mini review focused on the proangiogenic role of silicate ions released from silicon-containing biomaterials . J Tissue Eng 2017 , 8 : 2041731417707339. Google Scholar OpenURL Placeholder Text WorldCat 24. Kong N , Lin K, Li H, Chang J. Synergy effects of copper and silicon ions on stimulation of vascularization by copper-doped calcium silicate . J Mater Chem B 2014 , 2 : 1100 – 1110 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Li Z , Liu S, Cao Y, Fu T, Jiang L, Zhang J. High concentration of sodium metasilicate impairs autophagic flux and induces apoptosis in human umbilical vein endothelial cells . Biol Trace Elem Res 2019 , 191 : 88 – 97 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Guo S , Yu D, Xiao X, Liu W, Wu Z, Shi L, Zhao Q, et al. A vessel subtype beneficial for osteogenesis enhanced by strontium-doped sodium titanate nanorods by modulating macrophage polarization . J Mater Chem B 2020 , 8 : 6048 – 6058 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Fu X , Liu P, Zhao D, Yuan B, Xiao Z, Zhou Y, Yang X, et al. Effects of nanotopography regulation and silicon doping on angiogenic and osteogenic activities of hydroxyapatite coating on titanium implant . Int J Nanomedicine 2020 , 15 : 4171 – 4189 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Ilyas A , Velton M, Shah A, Monte F, Kim HKW, Aswath PB, Varanasi VG. Rapid regeneration of vascularized bone by nanofabricated amorphous silicon oxynitrophosphide (SiONP) overlays . J Biomed Nanotechnol 2019 , 15 : 1241 – 1255 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Thurston G . Complementary actions of VEGF and angiopoietin-1 on blood vessel growth and leakage . J Anat 2002 , 200 : 575 – 580 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Jabbarzadeh E , Deng M, Lv Q, Jiang T, Khan YM, Nair LS, Laurencin CT. VEGF-incorporated biomimetic poly(lactide-co-glycolide) sintered microsphere scaffolds for bone tissue engineering . J Biomed Mater Res B Appl Biomater 2012 , 100 : 2187 – 2196 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 31. Wang C , Lin K, Chang J, Sun J. Osteogenesis and angiogenesis induced by porous β-CaSiO(3)/PDLGA composite scaffold via activation of AMPK/ERK1/2 and PI3K/Akt pathways . Biomaterials 2013 , 34 : 64 – 77 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Su YF , Lin CC, Huang TH, Chou MY, Yang JJ, Shie MY. Osteogenesis and angiogenesis properties of dental pulp cell on novel injectable tricalcium phosphate cement by silica doped . Mater Sci Eng C Mater Biol Appl 2014 , 42 : 672 – 680 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Pusztaszeri MP , Seelentag W, Bosman FT. Immunohistochemical expression of endothelial markers CD31, CD34, von Willebrand factor, and Fli-1 in normal human tissues . J Histochem Cytochem: Off J Histochem Soc 2006 , 54 : 385 – 395 . Google Scholar Crossref Search ADS WorldCat 34. Nielsen JS , McNagny KM. Novel functions of the CD34 family . J Cell Sci 2008 , 121 : 3683 – 3692 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Porter AE , Patel N, Skepper JN, Best SM, Bonfield W. Comparison of in vivo dissolution processes in hydroxyapatite and silicon-substituted hydroxyapatite bioceramics . Biomaterials 2003 , 24 : 4609 – 4620 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Huang Y , Wu C, Zhang X, Chang J, Dai K. Regulation of immune response by bioactive ions released from silicate bioceramics for bone regeneration . Acta Biomater 2018 , 66 : 81 – 92 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Gordon S , Martinez FO. Alternative activation of macrophages: mechanism and functions . Immunity 2010 , 32 : 593 – 604 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Ivashkiv LB . Inflammatory signaling in macrophages: transitions from acute to tolerant and alternative activation states . Eur J Immunol 2011 , 41 : 2477 – 2481 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Mosser DM , Edwards JP. Exploring the full spectrum of macrophage activation . Nat Rev Immunol 2008 , 8 : 958 – 969 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Jung M , Sola A, Hughes J, Kluth DC, Vinuesa E, Viñas JL, Pérez-Ladaga A, et al. Infusion of IL-10-expressing cells protects against renal ischemia through induction of lipocalin-2 . Kidney Int 2012 , 81 : 969 – 982 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Wilson HM , Chettibi S, Jobin C, Walbaum D, Rees AJ, Kluth DC. Inhibition of macrophage nuclear factor-kappaB leads to a dominant anti-inflammatory phenotype that attenuates glomerular inflammation in vivo . Am J Pathol 2005 , 167 : 27 – 37 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Diomede F , Marconi GD, Fonticoli L, Pizzicanella J, Merciaro I, Bramanti P, Mazzon E, et al. Functional relationship between osteogenesis and angiogenesis in tissue regeneration . Int J Mol Sci 2020 , 21 : 3242. Google Scholar OpenURL Placeholder Text WorldCat 43. Li H , Chang J. Bioactive silicate materials stimulate angiogenesis in fibroblast and endothelial cell co-culture system through paracrine effect . Acta Biomater 2013 , 9 : 6981 – 6991 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Li H , Xue K, Kong N, Liu K, Chang J. Silicate bioceramics enhanced vascularization and osteogenesis through stimulating interactions between endothelia cells and bone marrow stromal cells . Biomaterials 2014 , 35 : 3803 – 3818 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes † contributed equally to this work. © The Author(s) 2021. Published by Oxford University Press on behalf of the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Effect of silicon-doped calcium phosphate cement on angiogenesis based on controlled macrophage polarization
JF - Acta Biochimica et Biophysica Sinica
DO - 10.1093/abbs/gmab121
DA - 2021-09-18
UR - https://www.deepdyve.com/lp/oxford-university-press/effect-of-silicon-doped-calcium-phosphate-cement-on-angiogenesis-based-CY4aT3Ot0x
SP - 1
EP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -