TY - JOUR
AU - Gemma,, Nobuhiro
AB - Approximately 170 million people worldwide are affected by the hepatitis C virus (HCV). Interferon has been developed to treat HCV hepatitis, but its effectiveness depends on factors including the type and copy number of the infecting viruses and individual patient characteristics. Some single-nucleotide polymorphisms (SNPs) in the host are correlated with responsiveness (1)(2)(3)(4). Two SNPs are at nucleotide positions −88 (G or T) and −123 (C or A) within an interferon-stimulated response element-like sequence in the promoter region of the MxA gene (1)(2). The MxA protein is interferon-inducible and is known to inhibit the replication of a wide variety of single-stranded RNA viruses (5). Two other of these SNPs are at nucleotide position −221 (C or G; X/Y) within the promoter region of the mannose-binding lectin (MBL) gene and at codon 54 (A or G; A/B) within exon 1 of this gene (3)(4). The functions of MBL include the elimination of pathogens (6). The identification of these genetic variations in patients can help predict the efficacy of interferon in the treatment of HCV. DNA microarrays or DNA chip-based technologies can be used for the simultaneous genotyping of polymorphisms. The technologies used in recently reported DNA hybridization devices or indicators include gold nanoparticles (7)(8), enzyme-amplified electronic transduction (9), electrocatalysis (10), conducting polymers(11), surfactant bilayers (12), surface-attached molecular beacons (13), and ferrocene-labeled signaling probes (14). Most studies involved fundamental investigations of their properties, however, and despite the advances in these detection strategies, there has been relatively little progress toward the goal of simultaneous genotyping of multiple significant genetic variations in real clinical samples. In previous studies, we have found that Hoechst 33258, which is a minor-groove binder and specifically binds to double-stranded DNA, is electrochemically active and useful for electrochemical DNA detection (15)(16). The use of Hoechst 33258 in the electrochemical detection of the hepatitis B virus DNA and of an electrochemical peptide nucleic acid array for the genotyping of a single SNP within the c-Ki-ras gene have also been described previously (17)(18). We present an electrochemical DNA array for the simultaneous genotyping of four SNPs (MxA-88, MxA-123, MBLX/Y, and MBLA/B) using target DNA prepared from blood samples of HCV patients. The substrates used for the genotyping of the SNPs in this study were prepared as described previously (18). Each substrate consists of 20 working electrodes (500-μm diameter), a reference electrode, and a counter electrode. Oligonucleotide probes with a thiol group at the 5′ or 3′ end were obtained as custom synthesis products from Greiner Japan. The sequences of these probes are listed in Table 1 . Each working electrode was spotted with 100 nL of the probe solution containing the oligonucleotide probes (5 μmol/L), 400 mmol/L sodium chloride, and 0.1 mmol/L HCl by use of a spotter (Pixsys NQ/SQ series; Cartesian Technology). The substrate was then kept at room temperature for 1 h to immobilize the probes on the gold electrode through the thiol. The substrate was then washed with distilled water to remove the probes that did not bind covalently. Table 1. Sequences of the probes and primers. Name . Sequence,1 5′–3′ . Probes  −88G HS2 -TTTCTGCGCCCGGA  −88T HS-GTTTCTGCTCCCGGA  −123A GTGCTGAAGGTGCG-SH  −123C GTGCTGCAGGTGCG-SH  X/YG ATGCTTTCCGTGGCA-SH  X/YC ATGCTTTCGGTGGCA-SH  A/B-A CTTGGTGTCATCACG-SH  A/B-G CTTGGTGCCATCACG-SH Noncomplimentary CTGGACGAAGACTGA-SH Primers  −88F Biotin-GAGCTAGGTTTCGTTTCTGC  −88R CGCTAGTCTCCGCCACGAAC  −123F CTGAAGACCCCCAATTACCAATGC  −123R Biotin-TAGCTCCTGGCCCCGCACCT  X/YF Biotin-GTCCCATTTGTTCTCACTGC  X/YR CATGGTCCTCACCTTGGTGT  A/BF Biotin-GCAAAGATGGGCGTGATG  A/BR CTGGTGCCATCCCTACTGAA Name . Sequence,1 5′–3′ . Probes  −88G HS2 -TTTCTGCGCCCGGA  −88T HS-GTTTCTGCTCCCGGA  −123A GTGCTGAAGGTGCG-SH  −123C GTGCTGCAGGTGCG-SH  X/YG ATGCTTTCCGTGGCA-SH  X/YC ATGCTTTCGGTGGCA-SH  A/B-A CTTGGTGTCATCACG-SH  A/B-G CTTGGTGCCATCACG-SH Noncomplimentary CTGGACGAAGACTGA-SH Primers  −88F Biotin-GAGCTAGGTTTCGTTTCTGC  −88R CGCTAGTCTCCGCCACGAAC  −123F CTGAAGACCCCCAATTACCAATGC  −123R Biotin-TAGCTCCTGGCCCCGCACCT  X/YF Biotin-GTCCCATTTGTTCTCACTGC  X/YR CATGGTCCTCACCTTGGTGT  A/BF Biotin-GCAAAGATGGGCGTGATG  A/BR CTGGTGCCATCCCTACTGAA 1 The bold, underlined bases indicate the polymorchic sites. 2 -HS or -SH indicates a thiol. Open in new tab Table 1. Sequences of the probes and primers. Name . Sequence,1 5′–3′ . Probes  −88G HS2 -TTTCTGCGCCCGGA  −88T HS-GTTTCTGCTCCCGGA  −123A GTGCTGAAGGTGCG-SH  −123C GTGCTGCAGGTGCG-SH  X/YG ATGCTTTCCGTGGCA-SH  X/YC ATGCTTTCGGTGGCA-SH  A/B-A CTTGGTGTCATCACG-SH  A/B-G CTTGGTGCCATCACG-SH Noncomplimentary CTGGACGAAGACTGA-SH Primers  −88F Biotin-GAGCTAGGTTTCGTTTCTGC  −88R CGCTAGTCTCCGCCACGAAC  −123F CTGAAGACCCCCAATTACCAATGC  −123R Biotin-TAGCTCCTGGCCCCGCACCT  X/YF Biotin-GTCCCATTTGTTCTCACTGC  X/YR CATGGTCCTCACCTTGGTGT  A/BF Biotin-GCAAAGATGGGCGTGATG  A/BR CTGGTGCCATCCCTACTGAA Name . Sequence,1 5′–3′ . Probes  −88G HS2 -TTTCTGCGCCCGGA  −88T HS-GTTTCTGCTCCCGGA  −123A GTGCTGAAGGTGCG-SH  −123C GTGCTGCAGGTGCG-SH  X/YG ATGCTTTCCGTGGCA-SH  X/YC ATGCTTTCGGTGGCA-SH  A/B-A CTTGGTGTCATCACG-SH  A/B-G CTTGGTGCCATCACG-SH Noncomplimentary CTGGACGAAGACTGA-SH Primers  −88F Biotin-GAGCTAGGTTTCGTTTCTGC  −88R CGCTAGTCTCCGCCACGAAC  −123F CTGAAGACCCCCAATTACCAATGC  −123R Biotin-TAGCTCCTGGCCCCGCACCT  X/YF Biotin-GTCCCATTTGTTCTCACTGC  X/YR CATGGTCCTCACCTTGGTGT  A/BF Biotin-GCAAAGATGGGCGTGATG  A/BR CTGGTGCCATCCCTACTGAA 1 The bold, underlined bases indicate the polymorchic sites. 2 -HS or -SH indicates a thiol. Open in new tab DNA fragments were amplified by PCR using the corresponding primers (listed in Table 1 ). The primers were obtained as custom synthesis products from SIGMA GENOSIS. Human genome samples, provided by Toshiba General Hospital and approved by the Institutional Review Board, were extracted from blood with a QIAamp DNA blood reagent set (Qiagen). The four fragments were amplified in two tubes and purified with the QIAquick PCR purification reagent set (Qiagen). The four types of purified PCR products were then mixed, and single-stranded DNA was recovered from the mixture by use of magnetic streptavidin beads (MAGNOTEX-SA; TAKARA BIO Inc.). We simultaneously reacted 20 μL of 2× standard saline citrate solution (300 mmol/L NaCl, 30 mmol/L trisodium citrate) containing the four single-stranded target DNAs with the probes immobilized on the working electrodes in a cover well (volume, 20 μL; diameter, 13 mm; depth, 0.2 mm; Grace BIO-LABS). The hybridization reaction was carried out under thermostated conditions at 35 °C for 60 min and was followed by a washing step in which the array was dipped in 50 μL of 0.2× standard saline citrate solution at 35 °C for 40 min to remove nonspecifically hybridized DNA. The array was reacted for 5 min with 50 μL of phosphate buffer (20 mmol/L) containing 50 μmol/L Hoechst 33258 (WAKO Pure Chemicals Industries, Ltd.) and 100 mmol/L NaCl at 25 °C with a cover well (volume, 50 μL) used as a cap. The electrochemical analyses were carried out with an electrochemical analyzer (Model BAS-100B) and software from Bioanalytical Systems, Inc. The electrochemical signals from each electrode were measured sequentially with a switching scanner (Model 7001; Keithley Instruments, Inc.) and an electrochemical analyzer. Unless otherwise indicated, cyclic voltammetry was carried out at 300 mV/s and 25 °C. The potential sweep range was from −100 to 900 mV. Repeat experiments were performed for 59 genomic samples purified from blood samples of HCV patients. The blood samples were provided by Toshiba General Hospital. To enable a comparison of genotyping methods, direct sequencing was also performed. Fig. 1 shows the distribution charts for each SNP. Each plotted point shows the ratio of the increase of the current peak value (ΔIpa) derived from one type of probe electrode to that derived from another type of probe electrode. The upper shaded bar represents the area between the mean values for the heterozygote samples + 4 SD and the mean values for the heterozygous samples + 6 SD, whereas the lower shaded bar represents the area between the mean values for the heterozygous samples − 4 SD and the mean values for the heterozygous samples − 6 SD. If it is assumed that the distribution of the mean values for heterozygous samples follow a gaussian distribution, statistically, ≥99% of the plots for heterozygous samples will be between the shaded bars and ≥99.999% of the plots for heterozygous samples will be between or on the shaded bars. Three areas—the area between the shaded bars, the area above the upper shaded bar, and the area below the lower shaded bar—contained all of the plotted points. A few plotted points were off the graph, but this was not a result of errors. The values of these plotted points were >100 or <1/100 because the differences between the ΔIpa values from one type of probe electrode and the values from another type of probe electrode was clearer. Thus, genotyping of patients could be performed with these bars used as thresholds. The genotypes identified from these plots were 100% concordant with the results of the direct sequencing. These results suggest that our electrochemical DNA array could genotype clinical samples as accurately as the direct sequencing method. Figure 1. Open in new tabDownload slide Distribution charts for increases in the current ratios. Each plotted point shows the ratio of ΔIpa derived from one type of probe electrode to that derived from another type of probe electrode. Upper shaded area, area between the mean values for the heterozygous samples + 4 SD and the mean values for the heterozygous samples + 6 SD. Lower shaded area, area between the mean values for the heterozygous samples − 4 SD and the mean values for the heterozygous samples − 6 SD. (A), •, G/G; ♦, G/T; ▪, T/T. (B), •, A/A; ♦, A/C; ▪, C/C. (C), •, G/G; ♦, G/C; ▪, C/C. (D), •, A/A; ♦, A/G; ▪, G/G. Figure 1. Open in new tabDownload slide Distribution charts for increases in the current ratios. Each plotted point shows the ratio of ΔIpa derived from one type of probe electrode to that derived from another type of probe electrode. Upper shaded area, area between the mean values for the heterozygous samples + 4 SD and the mean values for the heterozygous samples + 6 SD. Lower shaded area, area between the mean values for the heterozygous samples − 4 SD and the mean values for the heterozygous samples − 6 SD. (A), •, G/G; ♦, G/T; ▪, T/T. (B), •, A/A; ♦, A/C; ▪, C/C. (C), •, G/G; ♦, G/C; ▪, C/C. (D), •, A/A; ♦, A/G; ▪, G/G. This array could help in the development of individualized therapies for HCV patients. Note that these four SNPs are not the only predictors of interferon responsiveness in patients; other polymorphisms and viral factors correlated with the responsiveness, e.g., the HCV genotype and mutations within the interferon sensitivity-determining region, have also been reported (19). The detection of these viral factors with the host factors is necessary for reliable prognosis. Many studies on developments in electrochemical DNA or SNP detection technologies have been published recently (7)(8)(9)(10)(11)(12)(13)(14), but simultaneous genotyping of patient blood samples by use of an electrochemical array strategy has not been reported. Taking into account the burden on patients and clinical technologists, our method has many advantages. (a) After preparation of the target DNA, the SNPs can be identified simultaneously within 2 h. (b) Hoechst 33258 is available commercially and is inexpensive. (c) Modification of the target DNA with hybridization indicators is not necessary. (d) The procedures are simple (hybridization, washing, intercalation, and measurement) because there are no complex modification steps or other reaction steps. (e) All procedures are performed on a single array. In this study we also verified that our method could make detection more rapid, easier, and less expensive. Concurrently, we are trying to develop even easier strategies. As one of the approaches, we are developing an automated detection system that performs all of the procedures from hybridization to analysis automatically. Our goal is to deliver a compact, fully automated detection system that can identify DNA from samples such as blood, mucous, and hair roots. This could potentially widen the usefulness of onsite DNA analysis to include criminal investigations and other forensic applications. References 1 Hijikata M, Ohta Y, Mishiro S. Identification of a single nucleotide polymorphism in the MxA gene promoter (G/T at nt-88) correlated with the response of hepatitis C patients to interferon. Intervirology 2000 ; 43 : 124 -127. Crossref Search ADS PubMed 2 Hijikata M, Ohta Y, Mishiro S. Genetic polymorphism of the MxA gene promoter and interferon responsiveness of hepatitis C patients revisited by analyzing two SNP sites (−123 and −88) in vivo and in vitro. Intervirology 2001 ; 44 : 379 -382. Crossref Search ADS PubMed 3 Matsushita M, Hijikata M, Matsushita M, Ohta Y, Mishiro S. Association of mannose-binding lectin gene haplotype LXPA and LYPB with interferon-resistant hepatitis C virus infection in Japanese patients. J Hepatol 1998 ; 29 : 695 -700. Crossref Search ADS PubMed 4 Matsushita M, Hijikata M, Ohta Y, Iwata K, Matsumoto M, Nakao K, et al. Hepatitis C virus infection and mutation of mannose-binding lectin gene MBL. Arch Virol 1998 ; 143 : 645 -651. Crossref Search ADS PubMed 5 Zhao H, De BP, Das T, Banerjee AK. Inhibition of human parainfluenza virus-3 replication by interferon and human MxA. Virology 1996 ; 220 : 330 -338. Crossref Search ADS PubMed 6 Thiel S, Vorup-Jensen T, Stover CM, Schwaeble W, Laursen SB, Poulsen K, et al. A second series protease associated with mannan-binding lectin that activates complement. Nature 1997 ; 386 : 506 -510. Crossref Search ADS PubMed 7 Ozsoz M, Erdem A, Kerman K, Ozkan D, Tugrul B, Topcuoglu N, et al. Electrochemical genosensor based on colloidal gold nanoparticles for the detection of factor V Leiden mutation using disposable pencil graphite electrodes. Anal Chem 2003 ; 75 : 2181 -2187. Crossref Search ADS PubMed 8 Authier L, Grossiord C, Brossier P. Gold nanoparticle-based quantitative electrochemical detection of amplified human cytomegalovirus DNA using disposable microband electrodes. Anal Chem 2001 ; 73 : 4450 -4456. Crossref Search ADS PubMed 9 Patolsky F, Lichtenstein A, Willner I. Detection of single-base DNA mutations by enzyme-amplified electronic transduction. Nat Biotechnol 2001 ; 19 : 253 -257. Crossref Search ADS PubMed 10 Boon EM, Ceres DM, Drummond TG, Hill MG, Barton JK. Mutation detection by electrocatalysis at DNA-modified electrodes. Nat Biotechnol 2000 ; 18 : 1096 -1100. Crossref Search ADS PubMed 11 Cha J, Han JI, Choi Y, Yoon DS, Oh KW, Lim G. DNA hybridization electrochemical sensor using conducting polymer. Biosens Bioelectron 2003 ; 18 : 1241 -1247. Crossref Search ADS PubMed 12 Vagin MY, Karyakina EE, Hianik T, Karyakin AA. Electrochemical transducers based on surfactant bilayers for the direct detection of affinity interactions. Biosens Bioelectron 2003 ; 18 : 1031 -1037. Crossref Search ADS PubMed 13 Fan C, Plaxco KW, Heeger AJ. Electrochemical interrogation of conformational changes as a reagentless method for the sequence-specific detection of DNA. Proc Natl Acad Sci U S A 2003 ; 100 : 9134 -9137. Crossref Search ADS PubMed 14 Umek RM, Lin SW, Vielmetter J, Terbrueggen RH, Irvine B, Yu CJ, et al. Electronic detection of nucleic acids: a versatile platform for molecular diagnostics. J Mol Diagn 2001 ; 3 : 74 -84. Crossref Search ADS PubMed 15 Hashimoto K, Ito K, Ishimori Y. Novel DNA sensor for electrochemical gene detection. Anal Chim Acta 1994 ; 286 : 219 -224. Crossref Search ADS 16 Hashimoto K, Ito K, Ishimori Y. Sequence-specific gene detection with a gold electrode modified with DNA probes and an electrochemically active dye. Anal Chem 1994 ; 66 : 3830 -3833. Crossref Search ADS PubMed 17 Hashimoto K, Ito K, Ishimori Y. Microfabricated disposable DNA sensor for detection of hepatitis B virus DNA. Sens Actuators B Chem 1998 ; 46 : 220 -225. Crossref Search ADS 18 Hashimoto K, Ishimori Y. Preliminary evaluation of electrochemical PNA array for detection of single base mismatch mutations. Lab on a Chip 2001 ; 1 : 61 -63. Crossref Search ADS PubMed 19 Watanabe H, Enomoto N, Nagayama K, Izumi N, Marumo F, Sato C, et al. Number and position of mutations in the interferon (IFN) sensitivity-determining region of the gene for nonstructural protein 5A correlate with IFN efficacy in Hepatitis C virus genotype 1b infection. J Infect Dis 2001 ; 183 : 1195 -1203. Crossref Search ADS PubMed © 2004 The American Association for Clinical Chemistry This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Electrochemical DNA Array for Simultaneous Genotyping of Single-Nucleotide Polymorphisms Associated with the Therapeutic Effect of Interferon
JO - Clinical Chemistry
DO - 10.1373/clinchem.2003.023283
DA - 2004-03-01
UR - https://www.deepdyve.com/lp/oxford-university-press/electrochemical-dna-array-for-simultaneous-genotyping-of-single-BaAkXZW9jM
SP - 658
VL - 50
IS - 3
DP - DeepDyve
ER -