TY - JOUR
AU - Neuhaus, Horst Ekkehard
AB - Abstract The ability of plants to withstand cold temperatures relies on their photosynthetic activity. Thus, the chloroplast is of utmost importance for cold acclimation and acquisition of freezing tolerance. During cold acclimation, the properties of the chloroplast change markedly. To provide the most comprehensive view of the protein repertoire of the chloroplast envelope, we analyzed this membrane system in Arabidopsis (Arabidopsis thaliana) using mass spectrometry-based proteomics. Profiling chloroplast envelope membranes was achieved by a cross comparison of protein intensities across the plastid and the enriched membrane fraction under both normal and cold conditions. We used multivariable logistic regression to model the probabilities for the classification of an envelope localization. In total, we identified 38 envelope membrane intrinsic or associated proteins exhibiting altered abundance after cold acclimation. These proteins comprise several solute carriers, such as the ATP/ADP antiporter nucleotide transporter2 (NTT2; substantially increased abundance) or the maltose exporter MEX1 (substantially decreased abundance). Remarkably, analysis of the frost recovery of ntt loss-of-function and mex1 overexpressor mutants confirmed that the comparative proteome is well suited to identify key factors involved in cold acclimation and acquisition of freezing tolerance. Moreover, for proteins with known physiological function, we propose scenarios explaining their possible roles in cold acclimation. Furthermore, spatial proteomics introduces an additional layer of complexity and enables the identification of proteins differentially localized at the envelope membrane under the changing environmental regime. No other plant cell organelle is so typically associated with the autotrophic lifestyle as the chloroplast. Chloroplasts evolved from cyanobacteria and still contain a small, endogenous genome mainly encoding proteins located in the thylakoid membrane system (McFadden, 1999). These organelles are the cellular site of photosynthetic light reactions and oxygen release, and they harbor the enzymatic machinery required for photosynthetic CO2 fixation, starch production, nitrite and sulfate reduction, and amino acid and fatty acid biosynthesis (Buchanan, 2015). To fulfill all these functions, chloroplasts must import and export a wide variety of metabolic intermediates (Weber et al., 2005), and they have to communicate with the nucleus to balance plastidic and nuclear gene expression (Pfalz et al., 2012). Accordingly, changes in external parameters, such as light intensities or temperatures, can result in substantial genetic and metabolic readjustments. It has been proposed that chloroplasts may serve as “sensors,” centrally positioned in plant responses to abiotic stress stimuli (Crosatti et al., 2013). The required molecular communication between chloroplasts and the nucleus is mediated by retrograde and anterograde signaling processes (Kleine and Leister, 2013), while the altered metabolite exchange between the chloroplast and the cytosol depends on corresponding changes in the chloroplast envelope proteome, among other influences. Cold-tolerant species can gain the capacity to survive freezing temperatures by a process termed “cold acclimation” (Catalá et al., 2011), starting when plants face cold but nonfreezing temperatures. Accordingly, Arabidopsis (Arabidopsis thaliana), as a typical cold-hardy species (Yano et al., 2005), represents a suitable tool for the investigation of molecular and physiological mechanisms underlying acclimation to low temperatures (Strand et al., 1997; Rekarte-Cowie et al., 2008; Schulze et al., 2012; Nägele and Heyer, 2013; Calixto et al., 2018). Based on the following considerations, it appears likely that changes in the chloroplast envelope contribute to the ability of cold-hardy species to acclimate rapidly to decreasing external temperatures. First, proper acclimation to cold depends on photosynthetic activity, providing sugars required for the toleration of low temperatures (Alberdi and Corcuera, 1991; Wanner and Junttila, 1999; Pommerrenig et al., 2018). Therefore, under cold conditions, chloroplasts must maintain, although at lower rates, the daytime export of triose phosphates to allow sugar synthesis in the cytosol. Second, nocturnal starch degradation leads to the presence of Glc and maltose in the chloroplast stroma (Kötting et al., 2010; Sicher, 2011), and mutants with impaired starch mobilization exhibit less freezing tolerance (Kaplan and Guy, 2004; Yano et al., 2005). Thus, we suppose that after onset of chilling temperatures, the export of Glc and maltose must be adapted to altered starch turnover. Third, for effective cryoprotection of thylakoid membranes, raffinose must be imported into the chloroplast (Schneider and Keller, 2009; Knaupp et al., 2011). Fourth, in the cold, stromal Suc is relocated to the cytosol, where it contributes to the acquisition of a maximal freezing tolerance (Patzke et al., 2019). Fifth, to maintain enough membrane fluidity at low temperatures, cold acclimation induces the remodeling of structural lipids in thylakoids and envelope membranes (Moellering et al., 2010; Barrero-Sicilia et al., 2017). To investigate putative changes in the protein composition caused by exposure of plants to cold temperatures, several proteomic analyses have been carried out using, in most cases, total leaf extracts from the model plant Arabidopsis, the closely related species Thellungiella halophila, and also crop plants like alfalfa (Medicago sativa) and wheat (Triticum aestivum; Amme et al., 2006; Awai et al., 2006; Gao et al., 2009; Kosová et al., 2013; Rocco et al., 2013; Chen et al., 2015). Furthermore, the lumen and stromal proteome of isolated Arabidopsis chloroplasts have been examined after plant exposure to 5°C for different time periods (Goulas et al., 2006). Although our knowledge regarding cold-induced metabolic changes in chloroplasts and associated processes is quite comprehensive, it is completely unknown whether and to what degree alterations in the abundance of envelope proteins contribute to cold acclimation. During the past two decades, the protein composition of the envelope membrane has been examined intensively. In particular, studies by Ferro and coworkers (Ferro et al., 2003, 2010) supported the establishment of AT_CHLORO, a comprehensive and experimentally substantiated open access database for subplastidic protein localization (Bruley et al., 2012). This work has been extended very recently by a study revealing so far hidden components of the envelope membrane (Bouchnak et al., 2019). To our knowledge, comparative studies reporting on alterations in the protein composition of the envelope membrane caused by environmental changes are missing. Because of the central role of the chloroplast in cold acclimation, we hypothesized that during this process, the protein content and composition of the envelope becomes modified. Therefore, we performed a comparative analysis of envelope proteins from cold-treated plants and plants constantly grown under standard conditions. We decided to conduct a label-free quantitative proteome study because the labeling of proteins during plant growth (e.g. 15N labeling) requires hydroponic cultivation, whereas plants for the label-free proteome study can be grown on soil and thus under more natural conditions. It is important to mention that the label-free approach has its specific limitations. However, these limitations can be minimized using more biological replicates and extensive statistical analyses (Trentmann and Haferkamp, 2013). To affirm the physiological relevance of the identified changes in protein abundances, we exemplarily investigated the gain of frost tolerance after cold acclimation for two candidate proteins with opposite abundance changes using loss of function or gain of function mutants. RESULTS Envelope Membrane Purification and Mass Spectrometry The isolation of intact chloroplasts from cold acclimated plants and control plants was performed according to an established protocol (Kunst, 1998), with some marginal modifications. Particularly, the initial disruption of leaf tissue with a commercial electric blender turned out to be a critical step, since even slightly prolonged pulsing periods resulted in a dramatically decreased chloroplast yield. The intactness of chloroplasts was determined by phospho-Glc-isomerase enzyme assay. Phospho-Glc-isomerase activity of intact chloroplasts was normalized to that of disrupted (set to 100%) chloroplasts. The intactness generally ranged between 85% and 95% (Supplemental Fig. S1B). This observation suggests that the quality of the isolated chloroplasts is not affected by the cultivation temperatures used (see also Supplemental Fig. S1A), an important prerequisite for subsequent isolation of the envelope membranes. The three-step Suc gradient led to a yellowish band without visible chlorophyll contamination, which is indicative of no, or only minor, contamination with thylakoid membranes. The appearance of this envelope fraction generally resembled that reported by Ferro et al. (2003). Because of the increased detection sensitivity of mass spectrometry (MS), we could reduce the amount of leaf material per single isolation from ∼500 g, as reported by Ferro et al. (2003), to 200 g. Purified envelope membranes were collected by ultracentrifugation and finally washed five times with 1 m sodium carbonate. Sodium carbonate treatment allows removal of soluble proteins weakly attached to membranes (Kim et al., 2015). By this approach, we obtained about 5 μg envelope membrane proteins from 200 g Arabidopsis leaves. Proteins of total chloroplast lysates and of the envelope membrane fraction from cold-acclimated and nonacclimated plants were separated by SDS-PAGE. Subsequent to in-gel tryptic digestion, the resulting peptides in the different samples were analyzed by nanoLC-MS/MS. The proteome analysis of chloroplasts and envelopes from cold-acclimated and nonacclimated plants identified 905 proteins in total (Supplemental Table S1). Envelope Membrane Protein Profiling We used spatial proteomics for envelope membrane protein profiling. The principle of this technique is to fractionate organelles or subcompartments and to identify the distribution of proteins across the differentially enriched subfractions. Here, we compared the protein occurrence in the chloroplast fraction with that in the envelope fractions from standard and cold-cultivated plants. Therefore, MS-based protein identification was carried out in both fractions, the total intact chloroplast and enriched envelopes. This procedural method is depicted in Figure 1A. Envelope-located proteins generally should be present in both fractions (total chloroplast lysate and enriched envelopes) but should be enriched in the envelope preparation, whereas nonenvelope proteins should be depleted from this fraction. Consequently, comparing protein abundances in the two fractions already allows the calculation of an enrichment factor for the envelope-located candidates. In order to model the probabilities for the classification of the identified proteins, either envelope or not, we applied multivariable logistic regression. Combined information from AT_CHLORO (Bruley et al., 2012) and the Plant Proteome Database (Sun et al., 2009) revealed high-quality localization data for 453 of the 905 identified proteins, with 162 assigned to the envelope and 291 to an alternative location (either stroma or thylakoid). The corresponding proteins were chosen as markers for the training of our classifier (localization data and enrichment factors). Figure 1. Open in new tabDownload slide Sample preparation for proteome studies and annotation of envelope proteins by proteome data and molecular features. A, Schematic drawing illustrating cold acclimation and organelle/envelope isolation. B, Graphical representation of the score distribution from features of proteins with known envelope localization (light green) and proteins from other compartments (dark green). The divergence between the distributions allows for separation of the two different classes by the score behavior based on the selected protein features. The FDR (gray) was calculated after 10-fold cross-validation using knowledge from all previously known protein localizations in the data set. Figure 1. Open in new tabDownload slide Sample preparation for proteome studies and annotation of envelope proteins by proteome data and molecular features. A, Schematic drawing illustrating cold acclimation and organelle/envelope isolation. B, Graphical representation of the score distribution from features of proteins with known envelope localization (light green) and proteins from other compartments (dark green). The divergence between the distributions allows for separation of the two different classes by the score behavior based on the selected protein features. The FDR (gray) was calculated after 10-fold cross-validation using knowledge from all previously known protein localizations in the data set. Cold temperatures are known to alter the lipid content and composition of cellular membranes in plants. In order to exploit possible temperature-induced changes in the membrane structure affecting protein extraction, we used both enrichment factors and additionally incorporated a subset of physiochemical amino acid properties with minimal redundancy, while retaining maximum relevance using a minimum spanning tree approach (Zimmer et al., 2018). After training, we reached 97.82% prediction accuracy accessed by 10-fold cross validation. The graphical representation of the score distribution demonstrates that the chosen parameters allow discrimination between envelope- and nonenvelope-located proteins with high accuracy (Fig. 1B). Most nonenvelope proteins exhibit negative score values, whereas envelope proteins occur with higher frequency at positive scores. Consequently, proteins with ambiguous or unknown localization can be assigned to the envelope or nonenvelope group according to their individual score values. We analyzed the score behavior of all 905 identified proteins to check for possible envelope localization. For this, we tolerated a false discovery rate (FDR) of 5% and thus the score value of 0.92 was chosen as cut-off. By this strategy, 207 of the originally identified proteins could be annotated as envelope located (Fig. 2; Supplemental Table S1). The overall quality of our proteome study is given by the pie chart in Figure 2. Here, the localization of the identified proteins is described by a hierarchically organized localization ontology. Figure 2. Open in new tabDownload slide Pie chart demonstrating the general quality of the envelope proteome study. Localization of the identified proteins described by hierarchically organized localization ontology. Multiple ontology tags indicate either technically indistinguishable or biologically meaningful multilocalization of the respective proteins. Figure 2. Open in new tabDownload slide Pie chart demonstrating the general quality of the envelope proteome study. Localization of the identified proteins described by hierarchically organized localization ontology. Multiple ontology tags indicate either technically indistinguishable or biologically meaningful multilocalization of the respective proteins. Cold Temperatures Alter the Protein Repertoire of the Envelope Membrane The central role of the chloroplast in cold acclimation led us to the assumption that exposure of Arabidopsis to low temperatures might alter the amount and composition of proteins in the envelope membrane. Accordingly, envelopes from cold-treated plants might contain proteins that have not been assigned to this localization before, because they are missing or are of very low abundance and thus were not detected in the chloroplast envelope of plants grown under optimal culture conditions. Moreover, one might envision that certain chloroplast proteins are differently located under varying environmental regimes. Spatial proteomics allows insights into the cellular organization as well as the dynamics of the subcellular distribution of proteins and might also help to assign proteins with previously nonenvelope or unknown localization to the envelope, particularly in the cold-treated plants. First, we compared the envelope protein levels of cold-acclimated plants with those of control plants. This analysis revealed that cold treatment changed the abundance of ∼20% of the identified envelope proteins (38 of 207; Table 1). Most of these proteins (35 of 38) showed lower abundance. It is imaginable that cultivation of plants under cold temperatures decreases the amount of the detected envelope proteins either due to a generally decelerated protein synthesis or a decrease in the efficiency of extraction from the corresponding membranes. However, the observations that the individual proteins exhibit different degrees in reduction and that at least three proteins were even of substantially higher abundance (log2 fold change [FC] from 7.46 to 10.07) contradicts this assumption (Table 1). Interestingly, one of the three proteins with increased abundance was previously not assigned to the envelope location (ABCF5/GCN5 [At5g64840]). Moreover, the set of proteins that decreased after cold treatment also contained two envelope candidates (BCA1 [At3g01500] and ABCB24/ATM2 [At4g28620]). Intrinsic or chloroplast envelope associated proteins with changed abundance after 4 days of cold acclimation at 4°C Table 1. Intrinsic or chloroplast envelope associated proteins with changed abundance after 4 days of cold acclimation at 4°C The TM domain number was revised using information provided by ARAMEMNON release 8.1 and protein-specific publications. Localization of the identified proteins was based on AT_CHLORO and this study. The coding was as follows: Ch, chloroplast; E, envelope; IE, inner envelope; IO, outer envelope; S, stroma; *previously predicted envelope localization confirmed by this study; new, intrinsic or envelope-associated proteins identified in this study. tRNA, Transfer RNA. Gene Identification . Protein Names . log2FC . sd log2FC change . No. of TM Domains . Localization . 4°C–22°C . At1g15500 Plastidic ATP/ADP antiporter (AATP2/NTT2) ↑ +9.69 0.33 11 Ch/E/IE At4g17170 Putative RAB-B-class small GTPase (RAB-B1b) ↑ +7.46 0.19 0 Ch/E new At5g64840 Putative subfamily F ABC protein (ABCF5/GCN5) ↑ +10.07 0.38 0 Ch/E new At5g33320 Phosphoenolpyruvate/phosphate translocator (PPT1/CUE1) ↓ −11.06 0.45 7-8 Ch/E/IE At5g17520 Maltose translocator (RCP1/MEX1) ↓ −9.05 0.27 9 Ch/E/IE At3g51140 Putative DnaJ-chaperone-like protein ↓ −1.05 0.41 4 Ch/E/OE At4g39460 S-adenosylmethionine transporter (SAMC1/SAMT1) ↓ −2.07 0.76 6 Ch/E/IE At5g16010 Putative steroid 5-α reductase ↓ −10.18 0.12 6-7 Ch/E* At4g32400 Nucleotide uniporter (SHS1/BT1) ↓ −1.10 0.44 6 Ch/E/IE At5g42960 Putative OEP24-type outer membrane channel ↓ −1.14 0.47 0 Ch/E/OE 12 β-barrels At1g65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) ↓ −9.25 0.52 0 Ch/E/IE At4g33350 Chloroplast inner envelope translocon component (Tic22-IV) ↓ −1.23 0.27 0 Ch/E/IE At3g01500 Beta carbonic anhydrase 1, chloroplastic ↓ −1.32 0.34 0 Ch/E new At2g01320 Putative subfamily G ABC-type transporter (ABCG7/WBC7) ↓ −9.52 0.54 5 Ch/E* At5g14220 Protoporphyrinogen IX oxidase (PPO2) ↓ −1.44 0.57 0 Ch/E* At5g12860 Plastidic 2-oxoglutarate/malate translocator (DiT1/pOMT1) ↓ −1.45 0.90 14 Ch/E/IE At1g08640 CJD1 (Chloroplast J-like Domain 1) influences fatty acid composition of chloroplast lipids ↓ −1.47 0.37 3 Ch/E/IE At5g02940 Putative Pollux/Castor-type voltage-gated ion channel (Pollux-L1) ↓ −1.48 1.20 3 Ch/E* At2g43630 Protein of unknown function ↓ −1.53 0.37 1 Ch/E/IE At3g08740 Elongation factor P (EF-P) family protein ↓ −7.60 0.86 0 Ch/E & Ch/S At1g78620 Putative phytyl-phosphate kinase (VTE6) ↓ −1.56 0.09 6 Ch/E/IE At5g23040 Putative DnaJ-chaperone-like protein involved in protochlorophyllide oxidoreductase stabilization (CPP1/CDF1/DnaJD11) ↓ −1.58 0.11 3-4 Ch/E/IE At2g45740 Member of the peroxin11 (PEX11) gene family ↓ −7.66 0.37 1-3 Ch/E/IE At1g10510 RNI-like superfamily protein EMBRYO DEFECTIVE 2004 ↓ −0.65 0.20 1 Ch/E/IE At3g10840 Putative α/β-fold-type hydrolase ↓ −9.74 0.36 0-2 Ch/S At3g32930 Protein of unknown function ↓ −7.72 0.39 0 Ch/S At2g17695 Putative chloroplast outer envelope solute channel (OEP23) ↓ −7.74 0.44 0 Ch/E* At2g42770 Putative PMP22/Mpv17-type protein of unknown function ↓ −0.71 0.09 2-4 Ch/E/IE At3g20330 Aspartate carbamoyltransferase (ATCase) ↓ −9.80 0.87 0 Ch/E/IE At2g24820 Putative component of inner envelope protein import machinery | Phyllobilin hydroxylase (TIC55/Tic55-II) ↓ −0.76 0.37 2 Ch/E/IE At3g57280 Plastid fatty acid exporter (FAX1) ↓ −1.77 0.31 4 Ch/E/IE At5g42130 Putative (animal Mitoferrin)-like carrier (MFL1) ↓ −0.79 0.20 6 Ch/E/IE At3g49560 Putative tRNA import component of mitochondrial membrane translocase machinery (TRIC1/PRAT2.1/HP30-1) ↓ −0.81 0.27 2-4 Ch/E/IE At3g56910 Putative plastid-specific ribosomal protein (PSRP5) ↓ −0.85 0.59 0 Ch/E/IE At4g28620 Putative subfamily B ABC-type transporter (ABCB24/ATM2) ↓ −0.88 0.73 6 Ch/E new At3g63410 Methyl-6-phytyl-1,4-hydroquinone methyltransferase (APG1/VTE3) ↓ −0.92 0.62 1 Ch/E/IE At3g20320 Putative substrate-binding component of ER-to-thylakoid lipid transfer complex (TGD2/ABCI15) ↓ −1.99 1.71 1 Ch/E/IE At2g35800 Putative calcium-dependent S-adenosyl methionine carrier (SAMTL) ↓ −0.99 0.39 2 Ch/E* Gene Identification . Protein Names . log2FC . sd log2FC change . No. of TM Domains . Localization . 4°C–22°C . At1g15500 Plastidic ATP/ADP antiporter (AATP2/NTT2) ↑ +9.69 0.33 11 Ch/E/IE At4g17170 Putative RAB-B-class small GTPase (RAB-B1b) ↑ +7.46 0.19 0 Ch/E new At5g64840 Putative subfamily F ABC protein (ABCF5/GCN5) ↑ +10.07 0.38 0 Ch/E new At5g33320 Phosphoenolpyruvate/phosphate translocator (PPT1/CUE1) ↓ −11.06 0.45 7-8 Ch/E/IE At5g17520 Maltose translocator (RCP1/MEX1) ↓ −9.05 0.27 9 Ch/E/IE At3g51140 Putative DnaJ-chaperone-like protein ↓ −1.05 0.41 4 Ch/E/OE At4g39460 S-adenosylmethionine transporter (SAMC1/SAMT1) ↓ −2.07 0.76 6 Ch/E/IE At5g16010 Putative steroid 5-α reductase ↓ −10.18 0.12 6-7 Ch/E* At4g32400 Nucleotide uniporter (SHS1/BT1) ↓ −1.10 0.44 6 Ch/E/IE At5g42960 Putative OEP24-type outer membrane channel ↓ −1.14 0.47 0 Ch/E/OE 12 β-barrels At1g65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) ↓ −9.25 0.52 0 Ch/E/IE At4g33350 Chloroplast inner envelope translocon component (Tic22-IV) ↓ −1.23 0.27 0 Ch/E/IE At3g01500 Beta carbonic anhydrase 1, chloroplastic ↓ −1.32 0.34 0 Ch/E new At2g01320 Putative subfamily G ABC-type transporter (ABCG7/WBC7) ↓ −9.52 0.54 5 Ch/E* At5g14220 Protoporphyrinogen IX oxidase (PPO2) ↓ −1.44 0.57 0 Ch/E* At5g12860 Plastidic 2-oxoglutarate/malate translocator (DiT1/pOMT1) ↓ −1.45 0.90 14 Ch/E/IE At1g08640 CJD1 (Chloroplast J-like Domain 1) influences fatty acid composition of chloroplast lipids ↓ −1.47 0.37 3 Ch/E/IE At5g02940 Putative Pollux/Castor-type voltage-gated ion channel (Pollux-L1) ↓ −1.48 1.20 3 Ch/E* At2g43630 Protein of unknown function ↓ −1.53 0.37 1 Ch/E/IE At3g08740 Elongation factor P (EF-P) family protein ↓ −7.60 0.86 0 Ch/E & Ch/S At1g78620 Putative phytyl-phosphate kinase (VTE6) ↓ −1.56 0.09 6 Ch/E/IE At5g23040 Putative DnaJ-chaperone-like protein involved in protochlorophyllide oxidoreductase stabilization (CPP1/CDF1/DnaJD11) ↓ −1.58 0.11 3-4 Ch/E/IE At2g45740 Member of the peroxin11 (PEX11) gene family ↓ −7.66 0.37 1-3 Ch/E/IE At1g10510 RNI-like superfamily protein EMBRYO DEFECTIVE 2004 ↓ −0.65 0.20 1 Ch/E/IE At3g10840 Putative α/β-fold-type hydrolase ↓ −9.74 0.36 0-2 Ch/S At3g32930 Protein of unknown function ↓ −7.72 0.39 0 Ch/S At2g17695 Putative chloroplast outer envelope solute channel (OEP23) ↓ −7.74 0.44 0 Ch/E* At2g42770 Putative PMP22/Mpv17-type protein of unknown function ↓ −0.71 0.09 2-4 Ch/E/IE At3g20330 Aspartate carbamoyltransferase (ATCase) ↓ −9.80 0.87 0 Ch/E/IE At2g24820 Putative component of inner envelope protein import machinery | Phyllobilin hydroxylase (TIC55/Tic55-II) ↓ −0.76 0.37 2 Ch/E/IE At3g57280 Plastid fatty acid exporter (FAX1) ↓ −1.77 0.31 4 Ch/E/IE At5g42130 Putative (animal Mitoferrin)-like carrier (MFL1) ↓ −0.79 0.20 6 Ch/E/IE At3g49560 Putative tRNA import component of mitochondrial membrane translocase machinery (TRIC1/PRAT2.1/HP30-1) ↓ −0.81 0.27 2-4 Ch/E/IE At3g56910 Putative plastid-specific ribosomal protein (PSRP5) ↓ −0.85 0.59 0 Ch/E/IE At4g28620 Putative subfamily B ABC-type transporter (ABCB24/ATM2) ↓ −0.88 0.73 6 Ch/E new At3g63410 Methyl-6-phytyl-1,4-hydroquinone methyltransferase (APG1/VTE3) ↓ −0.92 0.62 1 Ch/E/IE At3g20320 Putative substrate-binding component of ER-to-thylakoid lipid transfer complex (TGD2/ABCI15) ↓ −1.99 1.71 1 Ch/E/IE At2g35800 Putative calcium-dependent S-adenosyl methionine carrier (SAMTL) ↓ −0.99 0.39 2 Ch/E* Open in new tab Table 1. Intrinsic or chloroplast envelope associated proteins with changed abundance after 4 days of cold acclimation at 4°C The TM domain number was revised using information provided by ARAMEMNON release 8.1 and protein-specific publications. Localization of the identified proteins was based on AT_CHLORO and this study. The coding was as follows: Ch, chloroplast; E, envelope; IE, inner envelope; IO, outer envelope; S, stroma; *previously predicted envelope localization confirmed by this study; new, intrinsic or envelope-associated proteins identified in this study. tRNA, Transfer RNA. Gene Identification . Protein Names . log2FC . sd log2FC change . No. of TM Domains . Localization . 4°C–22°C . At1g15500 Plastidic ATP/ADP antiporter (AATP2/NTT2) ↑ +9.69 0.33 11 Ch/E/IE At4g17170 Putative RAB-B-class small GTPase (RAB-B1b) ↑ +7.46 0.19 0 Ch/E new At5g64840 Putative subfamily F ABC protein (ABCF5/GCN5) ↑ +10.07 0.38 0 Ch/E new At5g33320 Phosphoenolpyruvate/phosphate translocator (PPT1/CUE1) ↓ −11.06 0.45 7-8 Ch/E/IE At5g17520 Maltose translocator (RCP1/MEX1) ↓ −9.05 0.27 9 Ch/E/IE At3g51140 Putative DnaJ-chaperone-like protein ↓ −1.05 0.41 4 Ch/E/OE At4g39460 S-adenosylmethionine transporter (SAMC1/SAMT1) ↓ −2.07 0.76 6 Ch/E/IE At5g16010 Putative steroid 5-α reductase ↓ −10.18 0.12 6-7 Ch/E* At4g32400 Nucleotide uniporter (SHS1/BT1) ↓ −1.10 0.44 6 Ch/E/IE At5g42960 Putative OEP24-type outer membrane channel ↓ −1.14 0.47 0 Ch/E/OE 12 β-barrels At1g65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) ↓ −9.25 0.52 0 Ch/E/IE At4g33350 Chloroplast inner envelope translocon component (Tic22-IV) ↓ −1.23 0.27 0 Ch/E/IE At3g01500 Beta carbonic anhydrase 1, chloroplastic ↓ −1.32 0.34 0 Ch/E new At2g01320 Putative subfamily G ABC-type transporter (ABCG7/WBC7) ↓ −9.52 0.54 5 Ch/E* At5g14220 Protoporphyrinogen IX oxidase (PPO2) ↓ −1.44 0.57 0 Ch/E* At5g12860 Plastidic 2-oxoglutarate/malate translocator (DiT1/pOMT1) ↓ −1.45 0.90 14 Ch/E/IE At1g08640 CJD1 (Chloroplast J-like Domain 1) influences fatty acid composition of chloroplast lipids ↓ −1.47 0.37 3 Ch/E/IE At5g02940 Putative Pollux/Castor-type voltage-gated ion channel (Pollux-L1) ↓ −1.48 1.20 3 Ch/E* At2g43630 Protein of unknown function ↓ −1.53 0.37 1 Ch/E/IE At3g08740 Elongation factor P (EF-P) family protein ↓ −7.60 0.86 0 Ch/E & Ch/S At1g78620 Putative phytyl-phosphate kinase (VTE6) ↓ −1.56 0.09 6 Ch/E/IE At5g23040 Putative DnaJ-chaperone-like protein involved in protochlorophyllide oxidoreductase stabilization (CPP1/CDF1/DnaJD11) ↓ −1.58 0.11 3-4 Ch/E/IE At2g45740 Member of the peroxin11 (PEX11) gene family ↓ −7.66 0.37 1-3 Ch/E/IE At1g10510 RNI-like superfamily protein EMBRYO DEFECTIVE 2004 ↓ −0.65 0.20 1 Ch/E/IE At3g10840 Putative α/β-fold-type hydrolase ↓ −9.74 0.36 0-2 Ch/S At3g32930 Protein of unknown function ↓ −7.72 0.39 0 Ch/S At2g17695 Putative chloroplast outer envelope solute channel (OEP23) ↓ −7.74 0.44 0 Ch/E* At2g42770 Putative PMP22/Mpv17-type protein of unknown function ↓ −0.71 0.09 2-4 Ch/E/IE At3g20330 Aspartate carbamoyltransferase (ATCase) ↓ −9.80 0.87 0 Ch/E/IE At2g24820 Putative component of inner envelope protein import machinery | Phyllobilin hydroxylase (TIC55/Tic55-II) ↓ −0.76 0.37 2 Ch/E/IE At3g57280 Plastid fatty acid exporter (FAX1) ↓ −1.77 0.31 4 Ch/E/IE At5g42130 Putative (animal Mitoferrin)-like carrier (MFL1) ↓ −0.79 0.20 6 Ch/E/IE At3g49560 Putative tRNA import component of mitochondrial membrane translocase machinery (TRIC1/PRAT2.1/HP30-1) ↓ −0.81 0.27 2-4 Ch/E/IE At3g56910 Putative plastid-specific ribosomal protein (PSRP5) ↓ −0.85 0.59 0 Ch/E/IE At4g28620 Putative subfamily B ABC-type transporter (ABCB24/ATM2) ↓ −0.88 0.73 6 Ch/E new At3g63410 Methyl-6-phytyl-1,4-hydroquinone methyltransferase (APG1/VTE3) ↓ −0.92 0.62 1 Ch/E/IE At3g20320 Putative substrate-binding component of ER-to-thylakoid lipid transfer complex (TGD2/ABCI15) ↓ −1.99 1.71 1 Ch/E/IE At2g35800 Putative calcium-dependent S-adenosyl methionine carrier (SAMTL) ↓ −0.99 0.39 2 Ch/E* Gene Identification . Protein Names . log2FC . sd log2FC change . No. of TM Domains . Localization . 4°C–22°C . At1g15500 Plastidic ATP/ADP antiporter (AATP2/NTT2) ↑ +9.69 0.33 11 Ch/E/IE At4g17170 Putative RAB-B-class small GTPase (RAB-B1b) ↑ +7.46 0.19 0 Ch/E new At5g64840 Putative subfamily F ABC protein (ABCF5/GCN5) ↑ +10.07 0.38 0 Ch/E new At5g33320 Phosphoenolpyruvate/phosphate translocator (PPT1/CUE1) ↓ −11.06 0.45 7-8 Ch/E/IE At5g17520 Maltose translocator (RCP1/MEX1) ↓ −9.05 0.27 9 Ch/E/IE At3g51140 Putative DnaJ-chaperone-like protein ↓ −1.05 0.41 4 Ch/E/OE At4g39460 S-adenosylmethionine transporter (SAMC1/SAMT1) ↓ −2.07 0.76 6 Ch/E/IE At5g16010 Putative steroid 5-α reductase ↓ −10.18 0.12 6-7 Ch/E* At4g32400 Nucleotide uniporter (SHS1/BT1) ↓ −1.10 0.44 6 Ch/E/IE At5g42960 Putative OEP24-type outer membrane channel ↓ −1.14 0.47 0 Ch/E/OE 12 β-barrels At1g65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) ↓ −9.25 0.52 0 Ch/E/IE At4g33350 Chloroplast inner envelope translocon component (Tic22-IV) ↓ −1.23 0.27 0 Ch/E/IE At3g01500 Beta carbonic anhydrase 1, chloroplastic ↓ −1.32 0.34 0 Ch/E new At2g01320 Putative subfamily G ABC-type transporter (ABCG7/WBC7) ↓ −9.52 0.54 5 Ch/E* At5g14220 Protoporphyrinogen IX oxidase (PPO2) ↓ −1.44 0.57 0 Ch/E* At5g12860 Plastidic 2-oxoglutarate/malate translocator (DiT1/pOMT1) ↓ −1.45 0.90 14 Ch/E/IE At1g08640 CJD1 (Chloroplast J-like Domain 1) influences fatty acid composition of chloroplast lipids ↓ −1.47 0.37 3 Ch/E/IE At5g02940 Putative Pollux/Castor-type voltage-gated ion channel (Pollux-L1) ↓ −1.48 1.20 3 Ch/E* At2g43630 Protein of unknown function ↓ −1.53 0.37 1 Ch/E/IE At3g08740 Elongation factor P (EF-P) family protein ↓ −7.60 0.86 0 Ch/E & Ch/S At1g78620 Putative phytyl-phosphate kinase (VTE6) ↓ −1.56 0.09 6 Ch/E/IE At5g23040 Putative DnaJ-chaperone-like protein involved in protochlorophyllide oxidoreductase stabilization (CPP1/CDF1/DnaJD11) ↓ −1.58 0.11 3-4 Ch/E/IE At2g45740 Member of the peroxin11 (PEX11) gene family ↓ −7.66 0.37 1-3 Ch/E/IE At1g10510 RNI-like superfamily protein EMBRYO DEFECTIVE 2004 ↓ −0.65 0.20 1 Ch/E/IE At3g10840 Putative α/β-fold-type hydrolase ↓ −9.74 0.36 0-2 Ch/S At3g32930 Protein of unknown function ↓ −7.72 0.39 0 Ch/S At2g17695 Putative chloroplast outer envelope solute channel (OEP23) ↓ −7.74 0.44 0 Ch/E* At2g42770 Putative PMP22/Mpv17-type protein of unknown function ↓ −0.71 0.09 2-4 Ch/E/IE At3g20330 Aspartate carbamoyltransferase (ATCase) ↓ −9.80 0.87 0 Ch/E/IE At2g24820 Putative component of inner envelope protein import machinery | Phyllobilin hydroxylase (TIC55/Tic55-II) ↓ −0.76 0.37 2 Ch/E/IE At3g57280 Plastid fatty acid exporter (FAX1) ↓ −1.77 0.31 4 Ch/E/IE At5g42130 Putative (animal Mitoferrin)-like carrier (MFL1) ↓ −0.79 0.20 6 Ch/E/IE At3g49560 Putative tRNA import component of mitochondrial membrane translocase machinery (TRIC1/PRAT2.1/HP30-1) ↓ −0.81 0.27 2-4 Ch/E/IE At3g56910 Putative plastid-specific ribosomal protein (PSRP5) ↓ −0.85 0.59 0 Ch/E/IE At4g28620 Putative subfamily B ABC-type transporter (ABCB24/ATM2) ↓ −0.88 0.73 6 Ch/E new At3g63410 Methyl-6-phytyl-1,4-hydroquinone methyltransferase (APG1/VTE3) ↓ −0.92 0.62 1 Ch/E/IE At3g20320 Putative substrate-binding component of ER-to-thylakoid lipid transfer complex (TGD2/ABCI15) ↓ −1.99 1.71 1 Ch/E/IE At2g35800 Putative calcium-dependent S-adenosyl methionine carrier (SAMTL) ↓ −0.99 0.39 2 Ch/E* Open in new tab To analyze whether the differently abundant envelope proteins are intrinsic to the membrane, we checked for possible membrane spanning domains. For this, we manually curated the information from AT_Chloro and the Plant Proteome Database with data obtained from ARAMEMNON (release 8.1) and diverse publications. For instance, the list of envelope membrane proteins (Table 1) contains four members of the mitochondrial carrier family (BT1 [At4g32400]; SAMC1 [At4g39460]; SAMTL [At2g35800], and MFL1 [At5g42130]). These carriers were initially proposed to contain no or a lower number of transmembrane (TM) domains. However, members of this protein family are classified by their common basic structure, which among others, comprises six TM domains (Haferkamp and Schmitz-Esser, 2012). Therefore, we corrected the corresponding information accordingly. Manual curation of the previous data led to the identification of α-helical domains in 26 out of the 38 envelope proteins. The list of differentially abundant proteins also contains two outer-envelope proteins (OEP23 [At2g17695] and OEP24 [At5g42960]). OEP23 and OEP24 exhibit amphiphilic helices or a β-barrel conformation and act as cation and anion channels, respectively (Goetze et al., 2015; Röhl et al., 1999). Accordingly, at least 28 of the 38 differentially abundant envelope proteins show features of membrane intrinsic proteins. The remaining 10 proteins are considered as rather soluble, and the fact that they were not removed by sodium carbonate suggests that they are tightly attached to the membrane. This membrane association might result from a specific interaction with a membrane intrinsic protein. TGD3 (At1g65410) for example represents the ATPase subunit of the lipid transporter TGD by which it is apparently fixed to the membrane. Moreover, Tic22-IV is part of the protein import machinery and thus might interact not only physiologically but also physically with membrane components of the TIC complex (translocon at the inner chloroplast membrane). RAB-B1b is a putative RAB-B-class small GTPase. Generally, RAB proteins are posttranslationally modified by prenylation and RAB-B1 contains a geranylgeranylation motif (Maurer-Stroh and Eisenhaber, 2005). Consequently, RAB-B1, just like other RAB proteins, can be considered as a peripheral membrane protein, which is temporarily anchored to a membrane via its lipid group but can be released from this location during the GTPase cycle. Interestingly, a proteome study revealed that the putative Asp carbamoyltransferase is palmitoylated (Hemsley et al., 2013) and thus might be attached to the envelope via its lipid anchor. Moreover, a palmitoylation site is predicted for the putative plastid-specific ribosomal protein (PSRP5 [At3g56910]; Ren et al., 2008). Since the remaining five proteins lack clearly predicted lipid modification motifs, their membrane association might be caused by an interaction with a membrane protein. With the help of known or predicted physiological functions, we aimed to affiliate the differently abundant envelope proteins to functional groups. A high number of the envelope proteins (19 of 38) are associated with metabolite and protein translocation. The substrates of the corresponding proteins are heterogeneous and range from ions (like potassium of Pollux-L1; At5g02940) to comparatively large and complex molecules, like lipids (subunits TGD2 and TGD3) or protein precursors. From the 19 transport-associated envelope proteins, only ATP/ADP transporter NTT2 (At1g15500; log2FC +9.7) increased, whereas the majority decreased after onset of cold (Table 1). The lipid transporter subunit TGD3, the ABC-type transporter ABCG7 (At2g01320), OEP23, the maltose exporter MEX1 (At5g17520), and the phosphoenolpyruvate/Pi exchanger PPT1 (At5g33320) were substantially decreased in abundance (log2FC −7.74 to −11.06). By contrast, the remaining envelope proteins associated with translocation exhibited rather minor reductions in their abundance, ranging from log2FC of −0.76 for the phyllobilin hydroxylase TIC55-II (At2g24820), a putative component of the TIC machinery, to log2FC of −2.07 for the S-adenosyl-Met transporter SAMC1 (At4g39460). Interestingly, even though both NTT2 (At1g15500) and BT1 (At4g32400) accept adenine nucleotides as substrates, cold exposure led to opposing changes in their abundances (Table 1). In this context, however, it is important to mention that they fulfill different physiological functions. NTT2 imports ATP in exchange for ADP plus phosphate and by this provides chemical energy to the plastid (Kampfenkel et al., 1995; Tjaden et al., 1998; Reinhold et al., 2007; Trentmann et al., 2008), whereas BT1 represents an uniporter and exports newly generated adenine nucleotides to the cytosol (Kirchberger et al., 2008). The chloroplast inner envelope harbors three sugar transport proteins, the Glc transporter pGlcT (At5g16150), the Suc exporter pSuT (At5g59250), and the maltose exporter MEX1 (At5g17520; Weber et al., 2000; Niittylä et al., 2004; Patzke et al., 2019). Although sugars play an important role in cold acclimation (Kaplan et al., 2006; Pommerrenig et al., 2018), and although all three sugar transporters have been identified in the envelope proteome (Supplemental Table S1), only the abundance of MEX1 changed and in fact became reduced by the cold treatment (log2FC −9.0; Table 1). Of the 38 differentially abundant proteins, four are clearly involved in fatty acid and lipid metabolism (Table 1). The J-like protein CJD1 (At1g08640) influences the composition of chloroplast lipids (Ajjawi et al., 2011), whereas TGD2 (At3g20230) and TGD3 (At1g65410) represent subunits of the phosphatidic acid transfer complex TGD (Lu et al., 2007; Lu and Benning, 2009), and FAX1 (At3g57280) mediates fatty acid export (Li et al., 2015a). Moreover, because the α/β hydrolase superfamily comprises proteases, dehalogenase, and peroxidases as well as epoxide hydrolases, lipases, and esterases, the putative α/β-fold-type hydrolase (At3g10840) might also be associated with lipid and sterol metabolism (Mindrebo et al., 2016). While the latter enzyme and TGD3 are highly reduced in abundance, the remaining three proteins showed comparatively low decrease during cold exposure. Moreover, the cytosol-located RAB-B-class small GTPase RAB-B1b (At4g17170) might indirectly join the group of lipid metabolism-associated proteins, since this class of proteins modifies intracellular membrane fluxes and therefore lipid composition (Karim and Aronsson, 2014). The alterations in the abundances of envelope proteins involved in lipid homeostasis might be causative for cold-induced changes in the membrane lipid composition of the chloroplast and the surrounding cell (Barrero-Sicilia et al., 2017). Tocopherols are cellular antioxidants that protect fatty acids from peroxidation, which may stabilize chloroplast membranes during freezing (Hincha, 2008). Therefore, it was surprising that two proteins involved in tocopherol biosynthesis, VTE6 (At1g78620) and VTE3 (At3g63410), were of lower abundance in cold-treated plants (Fritsche et al., 2017; Mène-Saffrané, 2017). Apart from one enzymatic reaction, the synthesis of vitamin E components (comprising tocopherols, tocotrienols, and plastochromanols) takes place at the inner envelope membrane (Cheng et al., 2003; van Wijk and Kessler, 2017). Because of their role in the protection of fatty acids, VTE3 and VTE6 were affiliated with the functional group of envelope proteins associated with membrane lipid modification. Finally, 24 proteins showed moderate alteration in their abundance (log2FC between −2 and +2), whereas 14 show substantial changes (log2FC <−7 or >7), including all three proteins that increase in response to cold. To investigate whether the obtained data provide insight into the physiological relevance of altered proteins during cold acclimation, we analyzed two proteins with opposing changes in abundance in greater detail. Cold Acclimation Requires Sufficient Energy Translocation across the Inner Plastid Envelope Low temperatures result in photoinhibition and consequently cold acclimation is accompanied by limited plastidic ATP synthesis (Khanal et al., 2017). However, cold-induced adaptations of thylakoid proteins, pigments, or inner envelope composition essentially rely on sufficient ATP availability. NTT-type carriers of land plants act as ATP/ADP transporters and were shown to mediate energy provision to heterotrophic plastids as well as to autotrophic chloroplasts under conditions of missing or reduced photosynthetic activity (Tjaden et al., 1998; Reiser et al., 2004; Reinhold et al., 2007; Kirchberger et al., 2008). The comparative proteome study revealed that the abundance of NTT2 substantially increases in response to cold temperatures (log2FC +9.7; Table 1). Therefore, cold-induced limitations in photosynthetic energy production are apparently compensated by increased NTT-mediated ATP uptake from the cytosol. To test whether NTT activity is indeed required for proper cold acclimation, we made use of NTT loss-of-function mutants. The Arabidopsis genome encodes two ntt isoforms, and thus we analyzed cold acclimation and acquisition of freezing tolerance in the corresponding single (ntt1 and ntt2) mutants as well as in the double (ntt1/2) mutant (Reiser et al., 2004). After six weeks of growth at ambient conditions, ntt1 and ntt2 do not exhibit altered phenotypic appearance when compared to correspondingly grown wild-type plants. The double ntt1/2 mutants, however, were slightly smaller (Fig. 3B, top row). Figure 3. Open in new tabDownload slide Effect of freezing to −10°C on wild type (WT; Col-0), the ntt2 transfer DNA (T-DNA) insertion mutant, the ntt1 T-DNA insertion mutant, and the double ntt1 and ntt2 (ntt1/2) T-DNA insertion mutant. Plants were cultivated for 17 d under standard conditions (22°C day temperature, 18°C night temperature, 10 h day length, 60% relative humidity, and 120 μE light intensity). Subsequently, the temperature was lowered to 4°C for day and night temperature for 4 d (cold acclimation) and then further to −10°C (stepwise 2°C/h). Plants were maintained at −10°C for 15 h before the temperature was raised again to 22°C (stepwise 2°C/h). A and B, Wild-type, ntt2, ntt1, and ntt1/2 mutant plants recovered from −10°C freezing for 3 weeks. The images in A and in B represent two independent experiments. C, Comparison of 6-week-old wild-type, ntt2, ntt1, and ntt1/2 mutant plants with and without −10°C freezing treatment. D, Quantification of wilted leaves from −10°C treated plants after 3 weeks recovery under standard growing conditions. The image in C demonstrates in more detail how leaves were categorized as “wilted”. n = 10 (10 plants per line were analyzed), **P < 0.01, ***P < 0.001, estimated by Student’s t test. Error bars represent the se. Figure 3. Open in new tabDownload slide Effect of freezing to −10°C on wild type (WT; Col-0), the ntt2 transfer DNA (T-DNA) insertion mutant, the ntt1 T-DNA insertion mutant, and the double ntt1 and ntt2 (ntt1/2) T-DNA insertion mutant. Plants were cultivated for 17 d under standard conditions (22°C day temperature, 18°C night temperature, 10 h day length, 60% relative humidity, and 120 μE light intensity). Subsequently, the temperature was lowered to 4°C for day and night temperature for 4 d (cold acclimation) and then further to −10°C (stepwise 2°C/h). Plants were maintained at −10°C for 15 h before the temperature was raised again to 22°C (stepwise 2°C/h). A and B, Wild-type, ntt2, ntt1, and ntt1/2 mutant plants recovered from −10°C freezing for 3 weeks. The images in A and in B represent two independent experiments. C, Comparison of 6-week-old wild-type, ntt2, ntt1, and ntt1/2 mutant plants with and without −10°C freezing treatment. D, Quantification of wilted leaves from −10°C treated plants after 3 weeks recovery under standard growing conditions. The image in C demonstrates in more detail how leaves were categorized as “wilted”. n = 10 (10 plants per line were analyzed), **P < 0.01, ***P < 0.001, estimated by Student’s t test. Error bars represent the se. Moreover, the cold acclimation study revealed that after recovery from freezing, all three mutant lines exhibited more wilted leaves than the wild type (Fig. 3, A and C). The wild type lost on average 4.2 leaves per plant, whereas ntt1, ntt2, and ntt1/2 lost 6.0, 8.0, and 8.5 leaves per plant, respectively. The increased leaf damage of plants lacking either NTT1 or NTT2 indicates that the activity of only one NTT isoform does not suffice to obtain proper freezing tolerance. Moreover, the observation that ntt2 mutants exhibit more wilted leaves per plant than did ntt1 mutants and almost reached the number of dead leaves per plant of the double ntt1/2 mutant suggests that NTT2 is of higher importance for cold acclimation than NTT1. Prevention of Plastidic Maltose Export Is Required for Proper Freezing Tolerance It is well known that tightly balanced cellular sugar and starch homeostasis is critical for the plant’s ability to tolerate low or freezing temperatures (Nägele and Heyer, 2013; Pommerrenig et al., 2018). MEX1, the sole maltose exporter of the chloroplast, was shown to play an important role in starch turnover and thus in the connection of starch and sugar metabolism (Niittylä et al., 2004; Purdy et al., 2013; Ryoo et al., 2013). Interestingly, cold exposure led to considerable depletion of this transport protein from the envelope proteome (log2FC −9.0; Table 1). Moreover, leaves of MEX1 loss-of-function mutants (mex1-1) were shown to exhibit metabolic features of cold acclimation already under warm conditions (Purdy et al., 2013). These observations imply that elevated maltose levels in the plastid are required for proper cold acclimation. Consequently, consistently high maltose export activity might cause perturbations in cold acclimation. To test this hypothesis, we generated mutant plants overexpressing mex1 and analyzed their capacity to cope with freezing temperatures. For this, mex1-1 mutants (Niittylä et al., 2004) were transformed with an expression construct carrying the structural mex1 gene under control of the ubiquitin 10 promotor. Two strong overexpressor lines, pUBQ10::MEX1 lines 1 and 2 (termed pUBQ10::MEX1-1 and pUBQ10::MEX1-2, respectively) were chosen for further study (Supplemental Fig. S2) As previously shown, mex1-1 mutants are highly impaired in growth when compared to the wild type (Supplemental Fig. S2; Niittylä et al., 2004; Purdy et al., 2013) The two mex1 overexpressor lines, however, grew much larger than mex1-1 and showed wild-type appearance (Supplemental Fig. S2). The fact that overexpressing mex1 complemented the dwarf phenotype of the original mex1-1 mutant demonstrates that the introduced maltose transporter is functional (Supplemental Fig. S2). The cold acclimation study revealed that, although massively impaired in growth, the mex1-1 mutant recovers quite well from freezing (Fig. 4A). For quantitative evaluation of the freezing damage, we counted the wilted leaves of the individual plants. While wild-type plants exhibit a mean of 2.9 wilted leaves per plant, the number is only marginally increased (mean value of 3.5) in mex1-1 plants (Fig. 4B). By contrast, the two mex1 overexpressor lines are much more affected (Fig. 4B) and show a significantly higher amount of wilted leaves per plant compared to the wild type or mex1-1. An average of 6.3 and 5.8 leaves per plant of the pUBQ10::MEX1-1 and pUBQ10::MEX1-2 lines, respectively, wilted from freezing (Fig. 4). This result demonstrates that the overexpression of mex1 results in higher susceptibility of the plants to cold stress and supports the idea that elevated maltose levels inside the chloroplast are required for cold acclimation. Figure 4. Open in new tabDownload slide Effect of freezing to −10°C on the wild type (WT; Col-0), the mex1-1 loss of function mutation, and mex overexpressor plants pUBQ10::MEX1-1 and pUBQ10::MEX1-2. Plants were cultivated for 17 d under standard conditions (22°C day temperature, 18°C night temperature, 10 h day length, 60%relative humidity, and 120 μE light intensity). Subsequently, the temperature was lowered to 4°C for day and night temperature (4 d cold acclimation) and afterward the temperature was further lowered to −10°C (stepwise 2°C/h). Plants were kept at −10°C for 15 h before the temperature was raised again to 22°C (stepwise 2°C/h). A, Wild-type, mex1-1 mutation, and overexpressor plants recovered from −10°C freezing for 3 weeks. B, Quantification of wilted leaves from −10°C treated plants after 3 weeks recovery under standard growing conditions. n = 7 (seven plants per plant line were analyzed), ***P < 0.001, **P < 0.01 estimated by Student’s t test. Error bars represent the se. Figure 4. Open in new tabDownload slide Effect of freezing to −10°C on the wild type (WT; Col-0), the mex1-1 loss of function mutation, and mex overexpressor plants pUBQ10::MEX1-1 and pUBQ10::MEX1-2. Plants were cultivated for 17 d under standard conditions (22°C day temperature, 18°C night temperature, 10 h day length, 60%relative humidity, and 120 μE light intensity). Subsequently, the temperature was lowered to 4°C for day and night temperature (4 d cold acclimation) and afterward the temperature was further lowered to −10°C (stepwise 2°C/h). Plants were kept at −10°C for 15 h before the temperature was raised again to 22°C (stepwise 2°C/h). A, Wild-type, mex1-1 mutation, and overexpressor plants recovered from −10°C freezing for 3 weeks. B, Quantification of wilted leaves from −10°C treated plants after 3 weeks recovery under standard growing conditions. n = 7 (seven plants per plant line were analyzed), ***P < 0.001, **P < 0.01 estimated by Student’s t test. Error bars represent the se. Assessing the Cold Acclimation-Dependent Differential Localization of Envelope-Associated Soluble Proteins By using ratiometric measurements comparing protein-specific enrichment factors under normal and cold conditions of the envelope (sub)-proteome (Supplemental Table S1), we were able to assess cold-dependent differential localization (diffloc) by MS. Proteins with a positive log2FC change determined by the factor of their enrichment exhibit a higher abundance in the envelope fraction under cold treatment, whereas those with negative log2FC values are less abundant in the cold-dependent envelope membrane. When the information about envelope localization is superimposed for the proteins that do not have any known transmembrane helices or other established TM domains, dynamic diffloc due to cold becomes apparent (Fig. 5; Table 2). Therefore, an increase in abundance under cold conditions as determined by enrichment factor points to a conditional association of the proteins with the envelope membrane, while a decrease in abundance suggests membrane dissociation. In total, we were able to identify 24 nonintrinsic envelope proteins exhibiting cold acclimation-dependent diffloc (q ≤ 0.05) without changes in abundance (Table 2). For three of these, the changes are rather small and may have no biological relevance (Fig. 5, gray dots) even though they are statistically relevant. Figure 5. Open in new tabDownload slide Cold-dependent diffloc of nonintrinsic envelope membrane-associated proteins identified by MS. Proteins with a positive log2FC change determined by the factor of their enrichment exhibit a higher abundance in the envelope fraction under cold treatment, whereas those with negative log2FC values are less abundant in the envelope membrane. Proteins exhibiting a rather small diffloc are indicated by gray dots. Figure 5. Open in new tabDownload slide Cold-dependent diffloc of nonintrinsic envelope membrane-associated proteins identified by MS. Proteins with a positive log2FC change determined by the factor of their enrichment exhibit a higher abundance in the envelope fraction under cold treatment, whereas those with negative log2FC values are less abundant in the envelope membrane. Proteins exhibiting a rather small diffloc are indicated by gray dots. Identified proteins exhibiting a diffloc at the envelope membrane Table 2. Identified proteins exhibiting a diffloc at the envelope membrane Gene Identification . Protein Names . diffloc . q Value diffloc . At3g44380 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family −12.37 6.88E-10 At4g23430 Translocon at the inner envelope membrane of chloroplasts 32-IVa −10.75 4.66E-09 At1g11320 GDSL esterase/lipase −10.35 2.54E-09 At5g51070 Chaperone component of Clp-type protease complex (ClpD/ERD1) −10.25 2.57E-08 At5g55510 Putative chloroplast envelope translocase component (PRAT1.2/HP22) −10.04 9.46E-09 At5g14100 Subfamily I ABC protein (ABCI11/NAP14) −9.94 1.21E-09 At3g63170 Putative CHI-fold fatty-acid-binding protein (FAP1) −9.77 2.39E-07 At4g33460 Putative subfamily I ABC protein (ABCI10/NAP13) −9.59 1.14E-08 At1g66670 Proteolytic component of Clp-type protease core complex (ClpP3/nClpP3) −9.37 8.48E-09 At3g23700 Putative S1-type protein of small ribosomal subunit −9.23 6.78E-10 At5g45170 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein −9.19 1.63E-07 At1g52670 Putative regulator of acetyl-CoA carboxylase complex (BADC2) −8.68 4.77E-09 At3g19720 Chloroplast fission mediator (DRP5B/AtARC5) −8.64 2.31E-08 At1g63610 Protein of unknown function −8.58 1.04E-07 At3g13470 Putative component of plastidial Cpn60 chaperonin complex (CPN60B2) −7.67 1.27E-08 At1g76180 Early Response to Dehydration (ERD14) −7.06 1.72E-07 At5g14740 Beta carbonic anhydrase (BCA2/AtCA2) −0.56 0.0269066 At4g13010 Inner envelope quinone-oxidoreductase, lacking cleavable N-terminal transit peptide (ceQORH) −0.25 0.0495065 At1g12410 Non-proteolytic component of Clp-type protease core complex (ClpR2/nClpP2) 0.41 0.0016654 At3g10230 Lycopene β-cyclase (LCY-B) 5.99 3.12E-07 At3g26085 CAAX amino terminal protease family protein 6.08 9.79E-06 At5g64816 Protein of unknown function 7.38 1.28E-07 At4g34120 Protein of unknown function, contains CBS-type domain (LEJ1/CDCP1) 8.43 7.71E-08 At2g40490 Uroporphyrinogen decarboxylase (HEME2) 10.52 1.95E-09 Gene Identification . Protein Names . diffloc . q Value diffloc . At3g44380 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family −12.37 6.88E-10 At4g23430 Translocon at the inner envelope membrane of chloroplasts 32-IVa −10.75 4.66E-09 At1g11320 GDSL esterase/lipase −10.35 2.54E-09 At5g51070 Chaperone component of Clp-type protease complex (ClpD/ERD1) −10.25 2.57E-08 At5g55510 Putative chloroplast envelope translocase component (PRAT1.2/HP22) −10.04 9.46E-09 At5g14100 Subfamily I ABC protein (ABCI11/NAP14) −9.94 1.21E-09 At3g63170 Putative CHI-fold fatty-acid-binding protein (FAP1) −9.77 2.39E-07 At4g33460 Putative subfamily I ABC protein (ABCI10/NAP13) −9.59 1.14E-08 At1g66670 Proteolytic component of Clp-type protease core complex (ClpP3/nClpP3) −9.37 8.48E-09 At3g23700 Putative S1-type protein of small ribosomal subunit −9.23 6.78E-10 At5g45170 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein −9.19 1.63E-07 At1g52670 Putative regulator of acetyl-CoA carboxylase complex (BADC2) −8.68 4.77E-09 At3g19720 Chloroplast fission mediator (DRP5B/AtARC5) −8.64 2.31E-08 At1g63610 Protein of unknown function −8.58 1.04E-07 At3g13470 Putative component of plastidial Cpn60 chaperonin complex (CPN60B2) −7.67 1.27E-08 At1g76180 Early Response to Dehydration (ERD14) −7.06 1.72E-07 At5g14740 Beta carbonic anhydrase (BCA2/AtCA2) −0.56 0.0269066 At4g13010 Inner envelope quinone-oxidoreductase, lacking cleavable N-terminal transit peptide (ceQORH) −0.25 0.0495065 At1g12410 Non-proteolytic component of Clp-type protease core complex (ClpR2/nClpP2) 0.41 0.0016654 At3g10230 Lycopene β-cyclase (LCY-B) 5.99 3.12E-07 At3g26085 CAAX amino terminal protease family protein 6.08 9.79E-06 At5g64816 Protein of unknown function 7.38 1.28E-07 At4g34120 Protein of unknown function, contains CBS-type domain (LEJ1/CDCP1) 8.43 7.71E-08 At2g40490 Uroporphyrinogen decarboxylase (HEME2) 10.52 1.95E-09 Open in new tab Table 2. Identified proteins exhibiting a diffloc at the envelope membrane Gene Identification . Protein Names . diffloc . q Value diffloc . At3g44380 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family −12.37 6.88E-10 At4g23430 Translocon at the inner envelope membrane of chloroplasts 32-IVa −10.75 4.66E-09 At1g11320 GDSL esterase/lipase −10.35 2.54E-09 At5g51070 Chaperone component of Clp-type protease complex (ClpD/ERD1) −10.25 2.57E-08 At5g55510 Putative chloroplast envelope translocase component (PRAT1.2/HP22) −10.04 9.46E-09 At5g14100 Subfamily I ABC protein (ABCI11/NAP14) −9.94 1.21E-09 At3g63170 Putative CHI-fold fatty-acid-binding protein (FAP1) −9.77 2.39E-07 At4g33460 Putative subfamily I ABC protein (ABCI10/NAP13) −9.59 1.14E-08 At1g66670 Proteolytic component of Clp-type protease core complex (ClpP3/nClpP3) −9.37 8.48E-09 At3g23700 Putative S1-type protein of small ribosomal subunit −9.23 6.78E-10 At5g45170 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein −9.19 1.63E-07 At1g52670 Putative regulator of acetyl-CoA carboxylase complex (BADC2) −8.68 4.77E-09 At3g19720 Chloroplast fission mediator (DRP5B/AtARC5) −8.64 2.31E-08 At1g63610 Protein of unknown function −8.58 1.04E-07 At3g13470 Putative component of plastidial Cpn60 chaperonin complex (CPN60B2) −7.67 1.27E-08 At1g76180 Early Response to Dehydration (ERD14) −7.06 1.72E-07 At5g14740 Beta carbonic anhydrase (BCA2/AtCA2) −0.56 0.0269066 At4g13010 Inner envelope quinone-oxidoreductase, lacking cleavable N-terminal transit peptide (ceQORH) −0.25 0.0495065 At1g12410 Non-proteolytic component of Clp-type protease core complex (ClpR2/nClpP2) 0.41 0.0016654 At3g10230 Lycopene β-cyclase (LCY-B) 5.99 3.12E-07 At3g26085 CAAX amino terminal protease family protein 6.08 9.79E-06 At5g64816 Protein of unknown function 7.38 1.28E-07 At4g34120 Protein of unknown function, contains CBS-type domain (LEJ1/CDCP1) 8.43 7.71E-08 At2g40490 Uroporphyrinogen decarboxylase (HEME2) 10.52 1.95E-09 Gene Identification . Protein Names . diffloc . q Value diffloc . At3g44380 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family −12.37 6.88E-10 At4g23430 Translocon at the inner envelope membrane of chloroplasts 32-IVa −10.75 4.66E-09 At1g11320 GDSL esterase/lipase −10.35 2.54E-09 At5g51070 Chaperone component of Clp-type protease complex (ClpD/ERD1) −10.25 2.57E-08 At5g55510 Putative chloroplast envelope translocase component (PRAT1.2/HP22) −10.04 9.46E-09 At5g14100 Subfamily I ABC protein (ABCI11/NAP14) −9.94 1.21E-09 At3g63170 Putative CHI-fold fatty-acid-binding protein (FAP1) −9.77 2.39E-07 At4g33460 Putative subfamily I ABC protein (ABCI10/NAP13) −9.59 1.14E-08 At1g66670 Proteolytic component of Clp-type protease core complex (ClpP3/nClpP3) −9.37 8.48E-09 At3g23700 Putative S1-type protein of small ribosomal subunit −9.23 6.78E-10 At5g45170 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein −9.19 1.63E-07 At1g52670 Putative regulator of acetyl-CoA carboxylase complex (BADC2) −8.68 4.77E-09 At3g19720 Chloroplast fission mediator (DRP5B/AtARC5) −8.64 2.31E-08 At1g63610 Protein of unknown function −8.58 1.04E-07 At3g13470 Putative component of plastidial Cpn60 chaperonin complex (CPN60B2) −7.67 1.27E-08 At1g76180 Early Response to Dehydration (ERD14) −7.06 1.72E-07 At5g14740 Beta carbonic anhydrase (BCA2/AtCA2) −0.56 0.0269066 At4g13010 Inner envelope quinone-oxidoreductase, lacking cleavable N-terminal transit peptide (ceQORH) −0.25 0.0495065 At1g12410 Non-proteolytic component of Clp-type protease core complex (ClpR2/nClpP2) 0.41 0.0016654 At3g10230 Lycopene β-cyclase (LCY-B) 5.99 3.12E-07 At3g26085 CAAX amino terminal protease family protein 6.08 9.79E-06 At5g64816 Protein of unknown function 7.38 1.28E-07 At4g34120 Protein of unknown function, contains CBS-type domain (LEJ1/CDCP1) 8.43 7.71E-08 At2g40490 Uroporphyrinogen decarboxylase (HEME2) 10.52 1.95E-09 Open in new tab Interestingly, beside these two groups, there is a cluster of five proteins (decreased abundance) with a strong relation between the diffloc and the overall change in protein abundance under cold (Fig. 5, circled cluster; Table 3). It seems that those proteins compensate for the global protein reduction during cold treatment by associating with membranes following their biochemical binding equilibria. However, proteins showing diffloc that does not occur with a change in abundance might be modulated in their functional capacity. Additionally, there is one single protein with a high increase in abundance that, compared to the other five proteins, exhibits a rather small diffloc (–1.07; Fig. 5, gray dot). Identified proteins exhibiting a diffloc at the envelope but also a difference in total abundance Table 3. Identified proteins exhibiting a diffloc at the envelope but also a difference in total abundance Gene Identification . Protein Names . diffloc . q Value diffloc . Log2-FC 4°C–22°C . AT3G20330 Aspartate carbamoyltransferase (ATCase) 12.57 0.0009683 −9.8 AT3G10840 Putative α/β-fold-type hydrolase 9.056 7.19E-06 −9.742 AT1G65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) 8.17 0.0001917 −9.25 AT3G32930 Protein of unknown function 6.17 4.74E-08 −7.72 AT3G08740 Elongation factor P (EF-P) family protein 6.67 1.38E-07 −7.6 AT5G64840 Putative subfamily F ABC protein (ABCF5/GCN5) −1.07 0.0098313 10.07 Gene Identification . Protein Names . diffloc . q Value diffloc . Log2-FC 4°C–22°C . AT3G20330 Aspartate carbamoyltransferase (ATCase) 12.57 0.0009683 −9.8 AT3G10840 Putative α/β-fold-type hydrolase 9.056 7.19E-06 −9.742 AT1G65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) 8.17 0.0001917 −9.25 AT3G32930 Protein of unknown function 6.17 4.74E-08 −7.72 AT3G08740 Elongation factor P (EF-P) family protein 6.67 1.38E-07 −7.6 AT5G64840 Putative subfamily F ABC protein (ABCF5/GCN5) −1.07 0.0098313 10.07 Open in new tab Table 3. Identified proteins exhibiting a diffloc at the envelope but also a difference in total abundance Gene Identification . Protein Names . diffloc . q Value diffloc . Log2-FC 4°C–22°C . AT3G20330 Aspartate carbamoyltransferase (ATCase) 12.57 0.0009683 −9.8 AT3G10840 Putative α/β-fold-type hydrolase 9.056 7.19E-06 −9.742 AT1G65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) 8.17 0.0001917 −9.25 AT3G32930 Protein of unknown function 6.17 4.74E-08 −7.72 AT3G08740 Elongation factor P (EF-P) family protein 6.67 1.38E-07 −7.6 AT5G64840 Putative subfamily F ABC protein (ABCF5/GCN5) −1.07 0.0098313 10.07 Gene Identification . Protein Names . diffloc . q Value diffloc . Log2-FC 4°C–22°C . AT3G20330 Aspartate carbamoyltransferase (ATCase) 12.57 0.0009683 −9.8 AT3G10840 Putative α/β-fold-type hydrolase 9.056 7.19E-06 −9.742 AT1G65410 Putative component of ER-to-thylakoid lipid transfer complex (TGD3/ABCI13/NAP11) 8.17 0.0001917 −9.25 AT3G32930 Protein of unknown function 6.17 4.74E-08 −7.72 AT3G08740 Elongation factor P (EF-P) family protein 6.67 1.38E-07 −7.6 AT5G64840 Putative subfamily F ABC protein (ABCF5/GCN5) −1.07 0.0098313 10.07 Open in new tab Among the identified proteins exhibiting cold-induced diffloc at the envelope membrane are several interesting candidates (Fig. 5). At least two of these, the chalcone isomerase (CHI)-fold fatty-acid binding protein FAP1 (At3g63170) and the GDSL esterase/lipase (At1g11320), can be assigned to fatty acid, lipid-metabolism/modification. In Arabidopsis, of five CHI-fold proteins characterized to date, three locate to the chloroplast and have been identified as fatty acid-binding proteins. They are highly expressed during increased fatty acid storage, and knockout plants show elevated α-linolenic acid levels (Ngaki et al., 2012). GDSL lipolytic enzymes belong to a family of lipid hydrolysis enzymes widely found in bacteria and plants (Lai et al., 2017). According to our analysis, both proteins seem to dissociate from the envelope membrane during cold acclimation. An analogous behavior has been observed by us for two proteins belonging to subfamily I of the ABC protein family (AtABCI11/AtNAP14 [At5g14100] and AtABCI10/AtNAP13 [At4g33460]). Both of these are so-called soluble nonintrinsic ABC proteins consisting solely of one nucleotide binding site (Sánchez-Fernández et al., 2001), and one, NAP14, has already been characterized as being involved in transition metal homeostasis. Disruption of the nap14 gene results in over-accumulation of transition metals (Fe, Co, Cu, Zn, and Mo) and abnormal chloroplast structures (Shimoni-Shor et al., 2010). However, the physiological role of NAP13 is so far unknown. One of the proteins exhibiting increased attachment to the envelope membrane after cold is part of the tetrapyrrole pathway generating chlorophyll (AtHEME2 [At2g40490]). The enzyme uroporphyrinogen decarboxylase (UROD) converts uroporphyrinogen III into coproporphyrinogen III, which is then further converted to protoporphyrin IX (Terry and Smith, 2013). Depletion of UROD leads to reduction of tetrapyrrole biosynthesis and light-dependent necrosis (Mock and Grimm, 1997). DISCUSSION Our proteome study revealed cold-induced changes in the abundance of 38 envelope proteins. Although only three of these proteins increased in abundance, the corresponding alterations were considerably high and exhibited a log2FC of 7.4 to 10.1. Moreover, among the 35 proteins that decreased in abundance, 11 were highly reduced, whereas the remaining 24 showed only moderate changes. The extreme positive or negative FC values apparently result from the very low abundance of the corresponding envelope proteins under either control or cold conditions. Therefore, the detection limit of the MS apparently causes a certain degree of overestimation of their abundance changes. Independent of a possible overestimation, the observation that the amount of a very low-abundance protein substantially increased is indicative of its stimulated synthesis, whereas the almost complete disappearance of a highly abundant protein implies its effective degradation during cold exposure. One might envision that the moderate reduction of 24 envelope proteins results from a general reduction in protein biosynthesis due to the cold temperatures. However, because most envelope proteins remained unaffected by the cold treatment, it is likely that the observed abundance changes, either moderate or strong, are specific. In the following, we discuss the role of several altered proteins in cold acclimation. Energy Provision to the Chloroplast Is Required for Proper Freezing Tolerance Cold exposure initially results in decreased photosynthesis, which limits energy production in the chloroplast (Khanal et al., 2017). Therefore, metabolic processes in the stroma rely on additional energy provision from the cytosol. The antiporters NTT1 and NTT2 generally mediate ATP uptake into the stroma and play a central role particularly when photosynthetic energy production is insufficient (short-day conditions) or missing (heterotrophic plastids; Tjaden et al., 1998; Reinhold et al., 2007). Therefore, the considerable cold-induced increase in the abundance of NTT2 (+9.7 of 2-fold; Table 1) might lead to stimulated ATP uptake from the cytosol. Here, we demonstrate that absence of NTT2 or of both NTTs (Reiser et al., 2004) results in substantially higher sensitivity of the corresponding mutant plants to freezing temperatures (Fig. 3). This observation demonstrates that cold acclimation relies on NTT-mediated ATP supply to the chloroplast. The increased abundance of NTT2 most likely guarantees the energization of metabolic processes required for cold acclimation, such as the generation of starch or fatty acid synthesis. Cold Acclimation Involves Blockage of Plastidic Maltose Export Sugars are important cryoprotectants, allow vitrification of membranes after water removal, and quench reactive oxygen species (ROS) efficiently, thus fulfilling important functions during cold acclimation and acquisition of freezing tolerance. It is well known that photosynthetic carbohydrate fixation is essential for sugar accumulation in response to cold (Wanner and Junttila, 1999). However, several reports suggest that starch breakdown also contributes to the development of freezing tolerance, particularly during the early phase of low-temperature exposure (Yano et al., 2005; Kaplan et al., 2006). Starch degradation generally results in the release of maltooligosaccharides and finally maltose. Although starch degradation seems to be prerequisite, it is presently unclear whether the released maltose or maltose-derived compounds mediate proper cold acclimation and cryoprotection of the photosynthetic electron transport chain (Yano et al., 2005; Kaplan et al., 2006). Maltose generally leaves the chloroplast via the transporter MEX1 (Niittylä et al., 2004). Interestingly, cold exposure led to considerable depletion of MEX1 from the envelope membrane (log2FC −9.0; Table 1). This observation points to a prevention of maltose export from the plastid during cold temperatures. To gain deeper insight into the role of plastidic or cytosolic maltose in cold acclimation, we generated plants constantly overexpressing MEX1. The reduced tolerance of the corresponding mutants against freezing (Fig. 4) suggests that acquisition of proper freezing tolerance requires not only maltose release during starch degradation but also trapping of maltose in the chloroplast. This conclusion is supported by the fact that although cellular maltose levels rise in response to high and low temperatures, only at low temperatures does maltose accumulate in the chloroplast (Kaplan and Guy, 2004; Lu and Sharkey, 2006). Cold-Induced Changes in Lipid Transfer across the Chloroplast Envelope Cold exposure led to substantial changes in the relative abundance of several proteins associated with fatty acid (FA) and lipid metabolism. In fact, modification of the chloroplast lipid composition is a conditio sine qua non for acclimation and adaptation to low temperatures (Li-Beisson et al., 2010; Barrero-Sicilia et al., 2017). The synthesis of glycerolipids, which represent the major lipid constituents of plant membranes, takes place in two different compartments (Li-Beisson et al., 2010). The prokaryotic type of glycerolipid synthesis in the chloroplast gives rise to lipids almost exclusively carrying C16 fatty acids at the sn-2 position of the glycerol backbone, whereas the eukaryotic pathway at the endoplasmic reticulum (ER) generally produces glycerolipids with C18 fatty acids at the sn-2 position (Li-Beisson et al., 2010). In plants, however, the de novo synthesis of fatty acids is restricted to the chloroplast, and thus, fatty acids must leave the organelle for modification at the ER. Moreover, the resulting ER-derived glycerolipids must enter the chloroplast. FAX1 catalyzes fatty acid export from the chloroplast, and consequently, mutant lines lacking this transporter exhibit decreased levels of ER-derived and increased levels of plastid-derived lipids (Li et al., 2015a). By contrast, the trigalactosyldiacylglycerol (TGD) protein complex mediates ER-to-chloroplast lipid transport (Roston et al., 2012). Moreover, missing or reduced presence of the substrate recognition domain TGD2 or the nucleotide-binding domain TGD3 were shown to hamper translocation across the TGD complex (Lu et al., 2007; Lu and Benning, 2009). Thus, the cold-induced decrease of FAX1 might cause fatty acid retention in the chloroplast and by this stimulate the prokaryotic pathway, whereas cold-induced decrease of TGD2 and TGD3 decreases the uptake of lipids derived from the eukaryotic pathway (Table 1). In fact, cold temperatures were shown to be accompanied by increased carbon fluxes via the prokaryotic pathway and reduced contribution of the eukaryotic pathway (Li et al., 2015b). Therefore, we consider the lowering of FAX1, TGD2, and TGD3 protein levels to be a characteristic factor involved in cold-induced modulation of the glycerolipid composition of chloroplast membranes (Table 1). Cold Acclimation Is Accompanied by Changes in Vesicle Transfer at the Chloroplast Rab-GTPases fulfill different functions in vesicle transport and may be involved in vesicle budding, motility, tethering, and docking. Interestingly, the abundance of the putative Rab-B-class GTPase RAB-B1b was shown to increase after cold treatment (Table 1). This protein is based on N-terminal yellow fluorescent protein fusions predicted to localize to the secretory pathway (Chow et al., 2008; Camacho et al., 2009), but it was also found in the envelope membrane (Table 1; Ferro et al., 2010; Bruley et al., 2012; Bouchnak et al., 2019). The cold-induced increase of RAB-B1b in the chloroplast fraction might thus be indicative of an enhanced fusion of ER-derived vesicles with the outer envelope. The corresponding vesicles might deliver new lipids or other cargos required for cold-induced changes to the chloroplast envelope. However, it is also imaginable that RAB-B1b is part of the intraplastidic vesicle trafficking system, which contributes to the modulation of the thylakoid membrane. Interestingly, cold treatment results in an increase in the lipid-to-protein ratio (Chapman et al., 1983) and is accompanied by an accumulation of vesicles in the stroma (Morré et al., 1991; Westphal et al., 2001). Moreover, already two RAB-GTPases (CPRabA5E [At1g05810] and CPSAR1 [At5g18570]) have been identified as involved in vesicle transport from the inner envelope to the thylakoid (Bang et al., 2009; Chigri et al., 2009; Garcia et al., 2010), and thus one might envision that RAB-B1b contributes to the cold-induced modulation of thylakoid lipid content. Cold-Induced Changes in the Envelope Point to Alterations in Nucleotide Synthesis In plants, the first steps of pyrimidine nucleotide de novo synthesis take place in the plastid stroma (Witz et al., 2012). The enzyme Asp transcarbamylase (ACTase; Hemsley et al., 2013) catalyses the second step in this biosynthesis pathway (Chen and Slocum, 2008). Interestingly, its lipid anchor and our proteome analysis suggest that the ATCase is attached to the inner envelope membrane, at least temporarily. The considerable decrease of the ACTase (At3g20330) abundance (Table 1) in the cold might limit de novo synthesis of pyrimidine nucleotides. Moreover, the transporter (BT1 [At4g32400]) that delivers newly synthesized adenine nucleotides to the cytosol shows decreased abundance in cold-treated plants (Table 1). These observations imply that under cold conditions, the de novo synthesis of pyrimidine and purine nucleotides is of minor importance and that the corresponding salvage pathways might be enough to satisfy the cellular nucleotide demand. The lesser energy costs of these cytosolic salvage pathways (Witz et al., 2012) might represent an advantage particularly under cold conditions. Tocopherol Synthesis Is Apparently Altered in Cold-Acclimated Plants The exposure of plants to low temperatures initially results in the overreduction of the electron transport chain and increased generation of ROS (Tjus et al., 1998). To prevent the ROS-induced damage of fatty acids, plants synthesize specific antioxidants, including tocopherols (vitamin E; Munné-Bosch, 2002; Maeda et al., 2006). At first glance, the moderate decrease of two envelope enzymes of the vitamin E synthesis pathway, VTE6 and VTE3 (Table 1), appears to be contradictory to the importance of tocopherols in cold acclimation. However, in this context it is important to note that defects in tocopherol synthesis may cause changes in the composition of the individual vitamin E vitamers in Arabidopsis (Mène-Saffrané, 2017). Therefore, the moderate decrease in the abundance of VTE3 and VTE6 might represent a putative fine-tuning mechanism, shifting tocopherol biosynthesis toward the production of tocotrienols or PC-8, vitamers with even higher antioxidative function than α-tocopherol (Serbinova et al., 1991; Olejnik et al., 1997). Impact of Cold Acclimation on Chlorophyll Turnover Various observations suggest that chlorophyll biosynthesis is strongly inhibited by cold temperatures (Tewari and Tripathy, 1998, 1999). Interestingly, we discerned that two envelope proteins involved in chlorophyll biosynthesis (Table 1) are of decreased abundance in the cold. The first is protoporphyrinogen IX oxidase2 (PPO2 [At5g14220]), which catalyzes the oxidation of protoporphyrinogen to protoporphyrin IX (Terry and Smith, 2013). The second is a chaperone-like protein (CPP1 [At5g23040]) required for stabilization of the light-dependent protochlorophyllide oxidoreductase (POR; Lee et al., 2013). Therefore, the cold-induced inhibition of chlorophyll biosynthesis becomes visible also on the level of the chloroplast envelope proteome. However, photosynthetic activity, an important prerequisite for cold acclimation, relies on the availability of chlorophyll. In this context, it is important to mention that TIC55, a part of the translocon of the inner membrane, shows decreased abundance in the cold (Table 1). Absence of TIC55 was recently shown to prevent chlorophyll degradation after induction of senescence (Chou et al., 2018). Therefore, the decreased abundance of TIC55 might help to maintain a certain chlorophyll level during cold-induced inhibition of chlorophyll synthesis. Cold Acclimation Induces Differential Localization of Envelope-Associated Soluble Proteins A fundamental method of regulating enzyme activity is to increase or decrease their cellular amounts. Beyond that, higher-order regulation consists of posttranslational modifications such as protein phosphorylation, acetylation, and n-linked glycosylation. However, when protein activity at or in a membrane must be modified, regulation of soluble protein dissociation from, or association to, that membrane might be imaginable. Comparing the abundance of soluble proteins enriched with the purified envelope membranes allowed us to identify proteins that are more apparent or less apparent at the envelope membrane after 4 d of cold acclimation. Therefore, a negative value indicates a putative dissociation from the envelope membrane and a positive value an association to it (Fig. 5; Table 2). This analysis, called diffloc, should not be mixed with dual targeting (e.g. proteins targeted to mitochondria and chloroplast). Of course, such analyses only make sense for nonmembrane intrinsic proteins (no TM domains or other membrane-spanning domains like β-barrels, e.g. of OEPs). Additionally, putative candidates should not exhibit significant changes in total protein abundance at the level of total chloroplasts, as this can result in negative or positive values not displaying a diffloc. This must be considered, as diffloc values are calculated based on protein abundances. We were able to exclude such candidates, as the total abundance changes were determined based on the chloroplast samples. The vigorous treatment of the isolated envelope membranes with sodium carbonate diminishes the identification of weak or, more fittingly, unspecific protein attachment to the envelope. However, identification of envelope-associated proteins without a biological relevance cannot be completely ruled out. Currently, it is only possible to speculate about the processes governing association or dissociation of proteins and about their physiological relevance. However, it is worth mentioning that among the identified diffloc proteins, there are several candidates that exhibit regulatory functions. For example, the three Clp proteins are members of the CLP protease system, a component of the chloroplast protease network (Olinares et al., 2011) essential for chloroplast development. Furthermore, the spectrum of processes in which the identified diffloc proteins are involved includes fatty acid metabolism (FAP1 and BADC1), lipid metabolism (GDSL esterase/lipase), carotenoid (LCY-B) and heme (HEME2) synthesis, protein modification (CAAX amino terminal protease), protein translation (S1-type protein small ribosomal subunit), and several others. In Figure 5, a cluster of proteins is indicated that, in addition to high diffloc values, exhibits high log2FC decreases in abundance (compare Table 1). Despite this decrease in protein abundance, the latter proteins exhibit a positive diffloc value. This indicates that association with the envelope membrane in the cold is a result of a marked biochemical equilibrium toward membrane binding. For example, we assume that the identified association of the Asp carbamoyltransferase (ATCase) reflects its prevalent localization at the chloroplast envelope. CONCLUSION Our analyses revealed that the protein composition and content of the envelope membrane are apparently modified during cold acclimation. The abundance of most envelope membrane proteins was reduced, and that of only three proteins increased, in response to cold treatment. We selected two transport proteins and made use of corresponding mutant plants to analyze whether the observed abundance changes are relevant for cold acclimation. In fact, absence of the protein that usually increases during cold, as well as a consistently high level of the protein that usually vanishes in the cold, led to higher susceptibility of the plants to freezing. Furthermore, the identification of several proteins with known or postulated functions in fatty acid synthesis, lipid metabolism, and lipid protection is in line with the relevance of these membrane compounds to cold acclimation. The identified proteins are promising candidates for detailed future analyses unraveling their individual roles in cold acclimation and freezing tolerance. Our diffloc analysis represents a new approach for the identification of transitional protein associations with the envelope. MATERIALS AND METHODS Plant Cultivation and Cold Acclimation Conditions Arabidopsis (Arabidopsis thaliana) ecotype Columbia (Col-0) was sown on standard soil (type ED73, Hermann Meyer KG; https://www.meyer-shop.com/) and stratified at 4°C for 24 h in darkness. Afterward, the plants were transferred to a plant cultivation chamber (Fitotron model SGR223, Weis Technik). Plants were cultivated at 22°C day temperature, 18°C night temperature, 10 h day length, 60% relative humidity, and 120 μE light intensity. For cold acclimation, plants were incubated for 4 d at 4°C while all other cultivation parameters were kept constant. Nonacclimated plants were further cultivated under standard conditions as described above. Plant leaf material used for organelle purification was collected 1 h before onset of light. Isolation of Chloroplast Envelope Membranes The envelope membrane isolation procedure can be divided into two steps: (1) isolation of intact chloroplasts and (2) enrichment of envelope membranes from these chloroplasts using a Suc step gradient (Supplemental Fig. S1). The isolation of intact chloroplasts was carried out according to an existing protocol (Kunst, 1998) with some modifications: 200 g leaf material was chopped off 34-d-old Arabidopsis plants (cold acclimated and control plants kept at 22°C) and transferred to ice-cold homogenization buffer medium (0.45 m sorbitol, 20 mm Tricine-KOH, pH 8.4, 10 mm EDTA, 10 mm NaHCO3, and 0.1% [w/v] fatty-acid free bovine serum albumin). The ratio of buffer volume to weight of leaf material was 3:1 (v/w). In a glass beaker the buffer/leaf mixture was further cooled in ice water to limit metabolic activity to a minimum. After 30 min the mixture was transferred to a 1 L stainless steel beaker. For a controlled rupture of the leaves, the blender was successively run for 1 s at low, 1 s at medium, and 1 s at high settings (Waring commercial heavy-duty blender). This procedure was repeated twice. The disrupted leaf material was than filtered through three layers of Miracloth (http://www.merckmillipore.com), placed in a funnel, and the flow through collected in an ice-cooled Erlenmeyer flask. From this suspension the chloroplast fraction was collected by centrifugation (1,000g for 10 min at 4°C) and gently resuspended in 8 mL resuspension buffer medium (0.3 m sorbitol, 20 mm Tricine-KOH, pH 7.6, 5 mm MgCl2, and 2.5 mm EDTA) using a natural bristle paint brush. A Percoll gradient was prepared by mixing equal volumes of 2× concentrated resuspension buffer medium and pure Percoll. Of this mixture, 30 mL was transferred to 36-mL centrifuge tubes and centrifuged (Sorval SS34 fixed-angle rotor) at 43,400g for 30 min at 4°C with no brake. Two Percoll gradients were enough for 200 g of leaf material. The Percoll gradient was overlaid with the resuspended chloroplast suspension. After centrifugation in a HB4 swing-out rotor (13,300g for 15 min at 4°C, with no brake), two distinct green bands appeared (Supplemental Fig. S1). The upper band, containing broken chloroplasts, was removed using a water jet pump and the lower band was collected using a wide-open Pasteur pipette. This fraction was transferred to a SS34 tube and diluted with 3 volumes of resuspension buffer medium. From that suspension, intact chloroplasts were collected by centrifugation (HB4 rotor, 2,700g, 5 min, no brake). Enrichment of envelope membranes was carried out according to a given protocol (Ferro et al., 2003) with modifications. The intact chloroplast fraction was vigorously resuspended in 2 mL of buffer medium (10 mm MOPS-NaOH, pH 7.8) and kept on ice for 10 min to allow osmotic disruption of chloroplasts. To prevent protease-driven protein degradation the buffer medium was complemented with a protease inhibitor cocktail (cOmplete, EDTA-free, Sigma Aldrich; www.sigmaaldrich.com). At this step, 100-μL samples were collected from the lysate for the MS-based identification of total chloroplast proteins. A three-step Suc gradient (bottom to top: 4 mL 0.93 m, 0.6 m, and 0.3 m Suc) prepared in Ultra-Clear tubes (16 × 102 mm, Beckman Coulter; www.beckmann.de) was overlaid with 1 mL of disrupted chloroplast preparation. After ultra-centrifugation (70,000g for 1 h at 4°C, with no brake, on a swing-out rotor SureSpin 630, Thermo Fisher Scientific; www.thermo-fisher.com) the yellowish envelope fraction was collected from the interphase between 0.93 m and 0.6 m Suc (Supplemental Fig. S1). This fraction was 2× diluted with double distilled water and the envelope membranes were collected by ultra-centrifugation (400,000g for 20 min at 4°C on a ST120AT rotor, Thermo Fisher Scientific; www.thermofisher.com,). The resulting membrane fraction was resuspended in 1 mL double distilled water to remove any remaining Suc. To remove membrane-associated proteins the envelope membranes were resuspended in 1 m of sodium carbonate (Na2CO3) medium and centrifuged again, as described above. This washing step was repeated five times. Protein Identification by Tryptic Digestion and MS Subsequent to protein estimation by Bradford assay (Bradford, 1976), the double distilled water resuspended envelope membranes or the total chloroplast samples membranes were solubilized by addition of SDS to a final volume of 2% (w/v), and 6× concentrated SDS-PAGE loading dye was added (375 mm Tris-HCl, pH 6.8, 0.3% [w/v] SDS, 60% [v/v] glycerol, 1.5% [w/v] bromophenol blue). Equal amounts of envelope protein and chloroplast samples (isolated from cold-acclimated and control plants) were resolved on 12% SDS-PAGE gels. After Coomassie staining of the gel, the lanes were cut into eight equal pieces and each piece was additionally cut into small cubes of ∼1 mm side length. By consecutively shrinking (in pure acetonitrile) and swelling (in 20 mm NH4HCO3), the buffer in which the gel pieces were resuspended, was removed before the proteins were reduced using 10 mm dithiothreitol and alkylated using 55 mm 2-iodoacetamide. Proteins were digested by addition of 12.5 ng/μL trypsin (Pierce Trypsin Protease MS-Grade, Thermo Fisher Scientific; www.thermoscientific.com) and incubation at 37°C for 15 h. Finally, peptides were extracted from the gel matrix using 2% (v/v) trifluoroacetic acid. To guarantee a complete extraction of peptides the gel pieces were subsequently subjected to a short centrifugation and removal of the supernatant shrunk again using acetonitrile. After short centrifugation, the supernatants were collected and the gel pieces were again treated with 2% (v/v) trifluoroacetic acid. All three supernatants were pooled and dried down by vacuum centrifugation to ∼30 μL. The peptide samples were desalted using handmade C18 STAGE tips following the protocol described by Rappsilber et al. (2007). Finally, the C18 STAGE tip eluates were concentrated to ∼2 μL and filled up to 20 μL with HPLC buffer A (2% [v/v] acetonitrile and 0.1% [v/v] formic acid). Protein Identification and Quantification MS analysis was performed on a high-resolution LC-MS system (Eksigent nanoLC425 coupled to a Triple-TOF 6600, AB Sciex) in information-dependent acquisition mode. HPLC separation of a 7.5 μL sample was performed in trap-elution mode using TriartC18 columns (5-μm particle, 0.5 × 5 mm for trapping; 3-μm particle, 300 μm × 150 mm for separation, YMC). A constant flow of 4 μL min−1 was employed and the gradient ramped within 15 min from 3% to 35% of HPLC buffer B (90% [v/v] acetonitrile, 0.1% [v/v] formic acid), then within 1 min to 80% HPLC buffer B, followed by washing and equilibration steps. The MS recorded one survey scan (250 ms accumulation time, 350–1250 m/z) and fragment spectra (100–1500 m/z) of the 30 most intense parent ions (30 ms accumulation time, charge state >2, intensity >300 cps, exclusion for 6 s after one occurrence), resulting in a total cycle time of 1.2 s. Identification and quantification of the proteins were performed using MaxQuant version 1.6.0.16 (Cox and Mann, 2008). Spectra were matched against the ensemble plants of the Arabidopsis Tair10 genome release 43. The peptide database was constructed considering Met oxidation and acetylation of protein N-termini as variable modifications and cabamido-methylation of cysteines as a fixed modification. FDR thresholds for peptide spectrum matches and protein identification were set to 1%. Protein quantification was carried out using the match-between-runs feature and the MaxQuant label-free quantification (LFQ) algorithm (Cox et al., 2014). To make the complete MS proteomic data available to the scientific community they have been deposited in the ProteomeXchange Consortium via the PRIDE partner repository (Perez-Riverol et al., 2019) with the dataset identifier PXD015794. Identification of Cold-Regulated Envelope Proteins In order to determine whether a protein is localized to the chloroplast envelope and cold regulated, we decided to perform a multivariable logistic regression to integrate literature knowledge as well as data from this study. A positive and negative training data set was constructed using a combination of AT_CHLORO (Ferro et al., 2010; Bruley et al., 2012) and the Plant Proteome Database (Kaplan et al., 2006; Sun et al., 2009), which are curated databases of subplastidial localization of proteins. As regressors, we relied on a selected subset of protein sequence features defined in the AAindex1: Activation Gibbs energy of unfolding at pH 9.0, amino acid composition of MEM of single-spanning proteins, principal component II, hydrophobicity index, the Chou-Fasman parameter of coil conformation, average number of surrounding residues, interior composition of amino acids in intracellular proteins of mesophiles, weights for coil at the window position of −3, helix formation parameters, free energy in alpha-helical regions, average relative fractional occurrence in EL(i) (Rackovsky and Scheraga, 1982), and composition of amino acids in extracellular proteins (Zimmer et al., 2018). This set was extended using the experimental enrichment factors, calculated as the log2FC between the LFQs (abundances) of the plastid and envelope fractions. Subsequently, each score of the trained model was assigned to a posterior error probability (Käll et al., 2008). Analysis was performed using Microsoft F# functional programming language with the bioinformatics library FSharpBio (available on GitHub: https://github.com/CSBiology/BioFSharp) in combination with the open-source and cross-platform machine learning framework ML.NET. Generation of AtMEX1 Overexpression Mutants For cloning of Atmex1, gene sequences were amplified within a PCR reaction using Phusion polymerase. For amplification, we used a forward primer containing a 4-bp sequence (CACC) at its 5′ end and a reverse primer (Atmex1+1f_cacc: CACCATGGAAGGTAAAGCCATCGCG and AtMEX1c+1245r-stop: CGGTCCAAAAACAAGTTCTTTC). Cloning in the pENTR/d-Topo vector was done following the instruction of the pENTR Directional TOPO Cloning Kit (www.thermofisher.com/invitrogen). Entry vectors were then used to perform a recombination reaction with the expression vector pUB-C-GFP (Grefen et al., 2010). The recombination reaction was done with the help of the Gateway LR Clonase II Enzyme Mix (www.thermofisher.com/invitrogen) according to the guidelines of the manufacturer. Atmex1 expression vectors were then used for heat-shock transformation of competent Agrobacterium tumefaciens cells (Höfgen and Willmitzer, 1988). Arabidopsis mex1-1 mutant plants were then transformed according to a simplified version of the “floral dip method” suggested by Clough and Bent (1998). The transformed Agrobacterium strains were grown in 200 mL yeast extract broth liquid culture to an OD600 of ∼0.8. Cells were harvested by centrifugation for 10 min at 4,500g and 4°C, and 5% (w/v) Suc and 0.05% (v/v) Silwet L77 dissolved in water were added to the Agrobacterium pellet. This mixture was then transferred to beakers. Atmex1-1 plants 5–6 weeks old, showing their first closed inflorescences, were dipped in the bacteria culture for about 30 s. The dipped plants were transferred to plastic trays and covered by a plastic hood. After 48 h, the plants were returned to their normal growing conditions, and seeds were harvested 3–4 weeks after dipping. Seeds of Arabidopsis plants obtained from A. tumefaciens-mediated transformation were germinated on soil and selected by spraying with 0.1% (v/v) BASTA (Glufosinat-Ammoniumsalt) herbicide (Logemann et al., 2006). Spraying was carried out on plants 1 week after germination and was repeated four times at intervals of 2 d . Freezing Tolerance Test To perform a freezing tolerance test, seeds of Arabidopsis wild-type and mutant plants were sowed and stratified as described above. After 1 week, seedlings were transferred to small pots containing standard soil (type ED73, Hermann Meyer KG; https://www.meyer-shop.com/) and further cultivated in a Percival plant growth cabinet (Typ AR-36L/LT; www.plantclimatics.de) under the described conditions. After further cultivation for 10 d, the day and night temperatures were lowered to 4°C for 4 d (cold acclimation). At the end of the night period of the day 4, the illumination was set of and the temperature was lowered from 4°C to −10°C in a stepwise manner (2°C/h). The freezing temperature was kept constant for 15 h before it was increased to 22°C in a stepwise manner (2°C/h). Afterward, normal growing conditions were restored (22°C d temperature, 18°C night temperature, 10 h d length, 60% relative humidity, and 120 μE light intensity). Plants were inspected daily, and wilting of leaves was documented by photographs. Statistical Analyses To detect plastidic proteins with a differential abundance at low temperatures, we used the significance analysis of microarrays method for statistical significance analysis (Larsson et al., 2005). Testing was performed using four biological replicates per condition. As response variables, the log2-transformed LFQ values of the plastidic fractions were used. A protein was treated as differentially regulated and envelope localized if its q-value threshold did not exceed 5% at maximum. Analyses were performed using Microsoft F# functional programming language with the bioinformatics library BioFSharp (available on GitHub: https://github.com/CSBiology/BioFSharp). Charts were generated using the graphical chart library FSharp.Plotly (available on GitHub: https://github.com/muehlhaus/FSharp.Plotly). To assess the significance of diffloc proteins we compared the enrichment factors under cold and normal conditions in the log2 space using Student’s t test statistic in significance analysis of microarrays to account for multiple testing. Data of physiological experiments (freezing tolerance) were analyzed using Microsoft Excel for Office 365 MSO. P values were analyzed using unpaired t tests. Accession Numbers Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers AY128844.1 (NTT2, At1g15500) and AY096715.1 (MEX1, At5g17520). All identified proteins listed in Tables 1–3 can be accessed by the given gene identifications using public databases like TAIR (www.arabidopsis.org). Supplemental Data The following supplemental materials are available. Supplemental Figure S1. Flow path of chloroplast envelope membrane isolation and identification of envelope proteins by MS. Supplemental Figure S2. Growth of wild-type, mex1 loss-of-function, and overexpressor mutant plants. Supplemental Table S1. Compiled proteomics result table. LITERATURE CITED Ajjawi I , Coku A, Froehlich JE, Yang Y, Osteryoung KW, Benning C, Last RL ( 2011 ) A J-like protein influences fatty acid composition of chloroplast lipids in Arabidopsis . PLoS One 6 : e25368 Google Scholar Crossref Search ADS PubMed WorldCat Alberdi M , Corcuera LJ ( 1991 ) Cold acclimation in plants . Phytochemistry 30 : 3177 – 3184 Google Scholar OpenURL Placeholder Text WorldCat Amme S , Matros A, Schlesier B, Mock HP ( 2006 ) Proteome analysis of cold stress response in Arabidopsis thaliana using DIGE-technology . J Exp Bot 57 : 1537 – 1546 Google Scholar Crossref Search ADS PubMed WorldCat Awai K , Xu C, Tamot B, Benning C ( 2006 ) A phosphatidic acid-binding protein of the chloroplast inner envelope membrane involved in lipid trafficking . Proc Natl Acad Sci USA 103 : 10817 – 10822 Google Scholar Crossref Search ADS PubMed WorldCat Bang WY , Hata A, Jeong IS, Umeda T, Masuda T, Chen J, Yoko I, Suwastika IN, Kim DW, Im CH, et al. ( 2009 ) AtObgC, a plant ortholog of bacterial Obg, is a chloroplast-targeting GTPase essential for early embryogenesis . Plant Mol Biol 71 : 379 – 390 Google Scholar Crossref Search ADS PubMed WorldCat Barrero-Sicilia C , Silvestre S, Haslam RP, Michaelson LV ( 2017 ) Lipid remodelling: Unravelling the response to cold stress in Arabidopsis and its extremophile relative Eutrema salsugineum . Plant Sci 263 : 194 – 200 Google Scholar Crossref Search ADS PubMed WorldCat Bouchnak I , Brugière S, Moyet L, Le Gall S, Salvi D, Kuntz M, Tardif M, Rolland N ( 2019 ) Unraveling hidden components of the chloroplast envelope proteome: Opportunities and limits of better MS sensitivity . Mol Cell Proteomics 18 : 1285 – 1306 Google Scholar Crossref Search ADS PubMed WorldCat Bradford MM ( 1976 ) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding . Anal Biochem 72 : 248 – 254 Google Scholar Crossref Search ADS PubMed WorldCat Bruley C , Dupierris V, Salvi D, Rolland N, Ferro M ( 2012 ) AT_CHLORO: A chloroplast protein database dedicated to sub-plastidial localization . Front Plant Sci 3 : 205 Google Scholar Crossref Search ADS PubMed WorldCat Buchanan BB , Gruissam WG, Jones RL, editors ( 2015 ) Biochemistry and Molecular Biology of Plants , Ed 2. Wiley Blackwell , Hoboken, NJ Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Calixto CPG , Guo W, James AB, Tzioutziou NA, Entizne JC, Panter PE, Knight H, Nimmo HG, Zhang R, Brown JWS ( 2018 ) Rapid and dynamic alternative splicing impacts the Arabidopsis cold response transcriptome . Plant Cell 30 : 1424 – 1444 Google Scholar Crossref Search ADS PubMed WorldCat Camacho L , Smertenko AP, Pérez-Gómez J, Hussey PJ, Moore I ( 2009 ) Arabidopsis Rab-E GTPases exhibit a novel interaction with a plasma-membrane phosphatidylinositol-4-phosphate 5-kinase . J Cell Sci 122 : 4383 – 4392 Google Scholar Crossref Search ADS PubMed WorldCat Catalá R , Medina J, Salinas J ( 2011 ) Integration of low temperature and light signaling during cold acclimation response in Arabidopsis . Proc Natl Acad Sci USA 108 : 16475 – 16480 Google Scholar Crossref Search ADS PubMed WorldCat Chapman DJ , De-Felice J, Barber J ( 1983 ) Growth temperature effects on thylakoid membrane lipid and protein content of pea chloroplasts . Plant Physiol 72 : 225 – 228 Google Scholar Crossref Search ADS PubMed WorldCat Chen CT , Slocum RD ( 2008 ) Expression and functional analysis of aspartate transcarbamoylase and role of de novo pyrimidine synthesis in regulation of growth and development in Arabidopsis . Plant Physiol Biochem 46 : 150 – 159 Google Scholar Crossref Search ADS PubMed WorldCat Chen J , Han G, Shang C, Li J, Zhang H, Liu F, Wang J, Liu H, Zhang Y ( 2015 ) Proteomic analyses reveal differences in cold acclimation mechanisms in freezing-tolerant and freezing-sensitive cultivars of alfalfa . Front Plant Sci 6 : 105 Google Scholar PubMed OpenURL Placeholder Text WorldCat Cheng Z , Sattler S, Maeda H, Sakuragi Y, Bryant DA, DellaPenna D ( 2003 ) Highly divergent methyltransferases catalyze a conserved reaction in tocopherol and plastoquinone synthesis in cyanobacteria and photosynthetic eukaryotes . Plant Cell 15 : 2343 – 2356 Google Scholar Crossref Search ADS PubMed WorldCat Chigri F , Sippel C, Kolb M, Vothknecht UC ( 2009 ) Arabidopsis OBG-like GTPase (AtOBGL) is localized in chloroplasts and has an essential function in embryo development . Mol Plant 2 : 1373 – 1383 Google Scholar Crossref Search ADS PubMed WorldCat Chou ML , Liao WY, Wei WC, Li AYS, Chu CY, Wu CL, Liu CL, Fu TH, Lin LF ( 2018 ) The direct involvement of dark-induced Tic55 protein in chlorophyll catabolism and its indirect role in the MYB108-NAC signalling pathway during leaf senescence in Arabidopsis thaliana . Int J Mol Sci 19 : 1854 Google Scholar Crossref Search ADS WorldCat Chow CM , Neto H, Foucart C, Moore I ( 2008 ) Rab-A2 and Rab-A3 GTPases define a trans-Golgi endosomal membrane domain in Arabidopsis that contributes substantially to the cell plate . Plant Cell 20 : 101 – 123 Google Scholar Crossref Search ADS PubMed WorldCat Clough SJ , Bent AF ( 1998 ) Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana . Plant J 16 : 735 – 743 Google Scholar Crossref Search ADS PubMed WorldCat Cox J , Hein MY, Luber CA, Paron I, Nagaraj N, Mann M ( 2014 ) Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ . Mol Cell Proteomics 13 : 2513 – 2526 Google Scholar Crossref Search ADS PubMed WorldCat Cox J , Mann M ( 2008 ) MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification . Nat Biotechnol 26 : 1367 – 1372 Google Scholar Crossref Search ADS PubMed WorldCat Crosatti C , Rizza F, Badeck FW, Mazzucotelli E, Cattivelli L ( 2013 ) Harden the chloroplast to protect the plant . Physiol Plant 147 : 55 – 63 Google Scholar Crossref Search ADS PubMed WorldCat Ferro M , Brugière S, Salvi D, Seigneurin-Berny D, Court M, Moyet L, Ramus C, Miras S, Mellal M, Le Gall S, et al. ( 2010 ) AT_CHLORO, a comprehensive chloroplast proteome database with subplastidial localization and curated information on envelope proteins . Mol Cell Proteomics 9 : 1063 – 1084 Google Scholar Crossref Search ADS PubMed WorldCat Ferro M , Salvi D, Brugière S, Miras S, Kowalski S, Louwagie M, Garin J, Joyard J, Rolland N ( 2003 ) Proteomics of the chloroplast envelope membranes from Arabidopsis thaliana . Mol Cell Proteomics 2 : 325 – 345 Google Scholar Crossref Search ADS PubMed WorldCat Fritsche S , Wang X, Jung C ( 2017 ) Recent advances in our understanding of tocopherol biosynthesis in plants: An overview of key genes, functions, and breeding of vitamin E improved crops . Antioxidants 6 : E99 Google Scholar Crossref Search ADS PubMed WorldCat Gao F , Zhou Y, Zhu W, Li X, Fan L, Zhang G ( 2009 ) Proteomic analysis of cold stress-responsive proteins in Thellungiella rosette leaves . Planta 230 : 1033 – 1046 Google Scholar Crossref Search ADS PubMed WorldCat Garcia C , Khan NZ, Nannmark U, Aronsson H ( 2010 ) The chloroplast protein CPSAR1, dually localized in the stroma and the inner envelope membrane, is involved in thylakoid biogenesis . Plant J 63 : 73 – 85 Google Scholar PubMed OpenURL Placeholder Text WorldCat Goetze TA , Patil M, Jeshen I, Bölter B, Grahl S, Soll J ( 2015 ) Oep23 forms an ion channel in the chloroplast outer envelope . BMC Plant Biol 15 : 47 Google Scholar Crossref Search ADS PubMed WorldCat Goulas E , Schubert M, Kieselbach T, Kleczkowski LA, Gardeström P, Schröder W, Hurry V ( 2006 ) The chloroplast lumen and stromal proteomes of Arabidopsis thaliana show differential sensitivity to short- and long-term exposure to low temperature . Plant J 47 : 720 – 734 Google Scholar Crossref Search ADS PubMed WorldCat Grefen C , Donald N, Hashimoto K, Kudla J, Schumacher K, Blatt MR ( 2010 ) A ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies . Plant J 64 : 355 – 365 Google Scholar Crossref Search ADS PubMed WorldCat Haferkamp I , Schmitz-Esser S ( 2012 ) The plant mitochondrial carrier family: Functional and evolutionary aspects . Front Plant Sci 3 : 2 Google Scholar Crossref Search ADS PubMed WorldCat Hemsley PA , Weimar T, Lilley KS, Dupree P, Grierson CS ( 2013 ) A proteomic approach identifies many novel palmitoylated proteins in Arabidopsis . New Phytol 197 : 805 – 814 Google Scholar Crossref Search ADS PubMed WorldCat Hincha DK ( 2008 ) Effects of α-tocopherol (vitamin E) on the stability and lipid dynamics of model membranes mimicking the lipid composition of plant chloroplast membranes . FEBS Lett 582 : 3687 – 3692 Google Scholar Crossref Search ADS PubMed WorldCat Höfgen R , Willmitzer L ( 1988 ) Storage of competent cells for Agrobacterium transformation . Nucleic Acids Res 16 : 9877 Google Scholar Crossref Search ADS PubMed WorldCat Käll L , Storey JD, MacCoss MJ, Noble WS ( 2008 ) Posterior error probabilities and false discovery rates: Two sides of the same coin . J Proteome Res 7 : 40 – 44 Google Scholar Crossref Search ADS PubMed WorldCat Kampfenkel K , Möhlmann T, Batz O, Van Montagu M, Inzé D, Neuhaus HE ( 1995 ) Molecular characterization of an Arabidopsis thaliana cDNA encoding a novel putative adenylate translocator of higher plants . FEBS Lett 374 : 351 – 355 Google Scholar PubMed OpenURL Placeholder Text WorldCat Kaplan F , Guy CL ( 2004 ) β-Amylase induction and the protective role of maltose during temperature shock . Plant Physiol 135 : 1674 – 1684 Google Scholar Crossref Search ADS PubMed WorldCat Kaplan F , Sung DY, Guy CL ( 2006 ) Roles of β-amylase and starch breakdown during temperatures stress . Physiol Plant 126 : 120 – 128 Google Scholar Crossref Search ADS WorldCat Karim S , Aronsson H ( 2014 ) The puzzle of chloroplast vesicle transport—Involvement of GTPases . Front Plant Sci 5 : 472 Google Scholar Crossref Search ADS PubMed WorldCat Khanal N , Bray GE, Grisnich A, Moffatt BA, Gray GR ( 2017 ) Differential mechanisms of photosynthetic acclimation to light and low temperature in Arabidopsis and the extremophile Eutrema salsugineum . Plants (Basel) 6 : E32 Google Scholar Crossref Search ADS PubMed WorldCat Kim H , Botelho SC, Park K, Kim H ( 2015 ) Use of carbonate extraction in analyzing moderately hydrophobic transmembrane proteins in the mitochondrial inner membrane . Protein Sci 24 : 2063 – 2069 Google Scholar Crossref Search ADS PubMed WorldCat Kirchberger S , Tjaden J, Neuhaus HE ( 2008 ) Characterization of the Arabidopsis Brittle1 transport protein and impact of reduced activity on plant metabolism . Plant J 56 : 51 – 63 Google Scholar Crossref Search ADS PubMed WorldCat Kleine T , Leister D ( 2013 ) Retrograde signals galore . Front Plant Sci 4 : 45 Google Scholar Crossref Search ADS PubMed WorldCat Knaupp M , Mishra KB, Nedbal L, Heyer AG ( 2011 ) Evidence for a role of raffinose in stabilizing photosystem II during freeze-thaw cycles . Planta 234 : 477 – 486 Google Scholar Crossref Search ADS PubMed WorldCat Kosová K , Vítámvás P, Planchon S, Renaut J, Vanková R, Prá¡il IT ( 2013 ) Proteome analysis of cold response in spring and winter wheat (Triticum aestivum) crowns reveals similarities in stress adaptation and differences in regulatory processes between the growth habits . J Proteome Res 12 : 4830 – 4845 Google Scholar Crossref Search ADS PubMed WorldCat Kötting O , Kossmann J, Zeeman SC, Lloyd JR ( 2010 ) Regulation of starch metabolism: The age of enlightenment? Curr Opin Plant Biol 13 : 321 – 329 Google Scholar Crossref Search ADS PubMed WorldCat Kunst L ( 1998 ) Preparation of physiologically active chloroplasts from Arabidopsis . In JM Martínez-Zapater , J Salinas , eds, Arabidopsis Protocols, Methods in Molecular Biology , Vol. 82 . Humana Press , Totowa, NJ , pp 43 – 48 Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Lai CP , Huang LM, Chen LO, Chan MT, Shaw JF ( 2017 ) Genome-wide analysis of GDSL-type esterases/lipases in Arabidopsis . Plant Mol Biol 95 : 181 – 197 Google Scholar Crossref Search ADS PubMed WorldCat Larsson O , Wahlestedt C, Timmons JA ( 2005 ) Considerations when using the significance analysis of microarrays (SAM) algorithm . BMC Bioinformatics 6 : 129 Google Scholar Crossref Search ADS PubMed WorldCat Lee JY , Lee HS, Song JY, Jung YJ, Reinbothe S, Park YI, Lee SY, Pai HS ( 2013 ) Cell growth defect factor1/chaperone-like protein of POR1 plays a role in stabilization of light-dependent protochlorophyllide oxidoreductase in Nicotiana benthamiana and Arabidopsis . Plant Cell 25 : 3944 – 3960 Google Scholar Crossref Search ADS PubMed WorldCat Li N , Gügel IL, Giavalisco P, Zeisler V, Schreiber L, Soll J, Philippar K ( 2015a ) FAX1, a novel membrane protein mediating plastid fatty acid export . PLoS Biol 13 : e1002053 Google Scholar Crossref Search ADS WorldCat Li Q , Zheng Q, Shen W, Cram D, Fowler DB, Wei Y, Zou J ( 2015b ) Understanding the biochemical basis of temperature-induced lipid pathway adjustments in plants . Plant Cell 27 : 86 – 103 Google Scholar Crossref Search ADS WorldCat Li-Beisson Y , Shorrosh B, Beisson F, Andersson MX, Arondel V, Bates PD, Baud S, Bird D, Debono A, Durrett TP, et al. ( 2010 ) Acyl-lipid metabolism . Arabidopsis Book 8 : e0133 Google Scholar Crossref Search ADS PubMed WorldCat Logemann E , Birkenbihl RP, Ülker B, Somssich IE ( 2006 ) An improved method for preparing Agrobacterium cells that simplifies the Arabidopsis transformation protocol . Plant Methods 2 : 16 Google Scholar Crossref Search ADS PubMed WorldCat Lu B , Benning C ( 2009 ) A 25-amino acid sequence of the Arabidopsis TGD2 protein is sufficient for specific binding of phosphatidic acid . J Biol Chem 284 : 17420 – 17427 Google Scholar Crossref Search ADS PubMed WorldCat Lu B , Xu C, Awai K, Jones AD, Benning C ( 2007 ) A small ATPase protein of Arabidopsis, TGD3, involved in chloroplast lipid import . J Biol Chem 282 : 35945 – 35953 Google Scholar Crossref Search ADS PubMed WorldCat Lu Y , Sharkey TD ( 2006 ) The importance of maltose in transitory starch breakdown . Plant Cell Environ 29 : 353 – 366 Google Scholar Crossref Search ADS PubMed WorldCat Maeda H , Song W, Sage TL, DellaPenna D ( 2006 ) Tocopherols play a crucial role in low-temperature adaptation and phloem loading in Arabidopsis . Plant Cell 18 : 2710 – 2732 Google Scholar Crossref Search ADS PubMed WorldCat Maurer-Stroh S , Eisenhaber F ( 2005 ) Refinement and prediction of protein prenylation motifs . Genome Biol 6 : R55 Google Scholar Crossref Search ADS PubMed WorldCat McFadden GI ( 1999 ) Endosymbiosis and evolution of the plant cell . Curr Opin Plant Biol 2 : 513 – 519 Google Scholar Crossref Search ADS PubMed WorldCat Mène-Saffrané L ( 2017 ) Vitamin E biosynthesis and its regulation in plants . Antioxidants 7 : E2 10.3390/antiox7010002 Google Scholar Crossref Search ADS PubMed WorldCat Mindrebo JT , Nartey CM, Seto Y, Burkart MD, Noel JP ( 2016 ) Unveiling the functional diversity of the alpha/beta hydrolase superfamily in the plant kingdom . Curr Opin Struct Biol 41 : 233 – 246 Google Scholar Crossref Search ADS PubMed WorldCat Mock HP , Grimm B ( 1997 ) Reduction of uroporphyrinogen decarboxylase by antisense RNA expression affects activities of other enzymes involved in tetrapyrrole biosynthesis and leads to light-dependent necrosis . Plant Physiol 113 : 1101 – 1112 Google Scholar Crossref Search ADS PubMed WorldCat Moellering ER , Muthan B, Benning C ( 2010 ) Freezing tolerance in plants requires lipid remodeling at the outer chloroplast membrane . Science 330 : 226 – 228 Google Scholar Crossref Search ADS PubMed WorldCat Morré DJ , Selldén G, Sundqvist C, Sandelius AS ( 1991 ) Stromal low temperature compartment derived from the inner membrane of the chloroplast envelope . Plant Physiol 97 : 1558 – 1564 Google Scholar Crossref Search ADS PubMed WorldCat Munné-Bosch S ( 2002 ) The function of tocopherols and tocotrienols in plants . Crit Rev Plant Sci 21 : 31 – 57 Google Scholar Crossref Search ADS WorldCat Nägele T , Heyer AG ( 2013 ) Approximating subcellular organisation of carbohydrate metabolism during cold acclimation in different natural accessions of Arabidopsis thaliana . New Phytol 198 : 777 – 787 Google Scholar Crossref Search ADS PubMed WorldCat Ngaki MN , Louie GV, Philippe RN, Manning G, Pojer F, Bowman ME, Li L, Larsen E, Wurtele ES, Noel JP ( 2012 ) Evolution of the chalcone-isomerase fold from fatty-acid binding to stereospecific catalysis . Nature 485 : 530 – 533 Google Scholar Crossref Search ADS PubMed WorldCat Niittylä T , Messerli G, Trevisan M, Chen J, Smith AM, Zeeman SC ( 2004 ) A previously unknown maltose transporter essential for starch degradation in leaves . Science 303 : 87 – 89 Google Scholar Crossref Search ADS PubMed WorldCat Olejnik D , Gogolewski M, Nogala-Kałucka M ( 1997 ) Isolation and some properties of plastochromanol-8 . Food/Nahrung 41 : 101 – 104 Google Scholar Crossref Search ADS WorldCat Olinares PDB , Kim J, van Wijk KJ ( 2011 ) The Clp protease system; a central component of the chloroplast protease network . Biochim Biophys Acta 1807 : 999 – 1011 Google Scholar Crossref Search ADS PubMed WorldCat Patzke K , Prananingrum P, Klemens PAW, Trentmann O, Rodrigues CM, Keller I, Fernie AR, Geigenberger P, Bölter B, Lehmann M, et al. ( 2019 ) The plastidic sugar transporter pSuT influences flowering and affects cold responses . Plant Physiol 179 : 569 – 587 Google Scholar Crossref Search ADS PubMed WorldCat Perez-Riverol Y , Csordas A, Bai J, Bernal-Llinares M, Hewapathirana S, Kundu DJ, Inuganti A, Griss J, Mayer G, Eisenacher M, et al. ( 2019 ) The PRIDE database and related tools and resources in 2019: Improving support for quantification data . Nucleic Acids Res 47 ( D1 ): D442 – D450 Google Scholar Crossref Search ADS PubMed WorldCat Pfalz J , Liebers M, Hirth M, Grübler B, Holtzegel U, Schröter Y, Dietzel L, Pfannschmidt T ( 2012 ) Environmental control of plant nuclear gene expression by chloroplast redox signals . Front Plant Sci 3 : 257 Google Scholar Crossref Search ADS PubMed WorldCat Pommerrenig B , Ludewig F, Cvetkovic J, Trentmann O, Klemens PAW, Neuhaus HE ( 2018 ) In concert: Orchestrated changes in carbohydrate homeostasis are critical for plant abiotic stress tolerance . Plant Cell Physiol 59 : 1290 – 1299 Google Scholar PubMed OpenURL Placeholder Text WorldCat Purdy SJ , Bussell JD, Nunn CP, Smith SM ( 2013 ) Leaves of the Arabidopsis maltose exporter1 mutant exhibit a metabolic profile with features of cold acclimation in the warm . PLoS One 8 : e79412 Google Scholar Crossref Search ADS PubMed WorldCat Rackovsky S , Scheraga HA ( 1982 ) Differential geometry and polymer conformation. 4. Conformational and nucleation properties of individual amino acids . Macromolecules 15 : 1340 – 1346 Google Scholar Crossref Search ADS WorldCat Rappsilber J , Mann M, Ishihama Y ( 2007 ) Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips . Nat Protoc 2 : 1896 – 1906 Google Scholar Crossref Search ADS PubMed WorldCat Reinhold T , Alawady A, Grimm B, Beran KC, Jahns P, Conrath U, Bauer J, Reiser J, Melzer M, Jeblick W, et al. ( 2007 ) Limitation of nocturnal import of ATP into Arabidopsis chloroplasts leads to photooxidative damage . Plant J 50 : 293 – 304 Google Scholar Crossref Search ADS PubMed WorldCat Reiser J , Linka N, Lemke L, Jeblick W, Neuhaus HE ( 2004 ) Molecular physiological analysis of the two plastidic ATP/ADP transporters from Arabidopsis . Plant Physiol 136 : 3524 – 3536 Google Scholar Crossref Search ADS PubMed WorldCat Rekarte-Cowie I , Ebshish OS, Mohamed KS, Pearce RS ( 2008 ) Sucrose helps regulate cold acclimation of Arabidopsis thaliana . J Exp Bot 59 : 4205 – 4217 Google Scholar Crossref Search ADS PubMed WorldCat Ren J , Wen L, Gao X, Jin C, Xue Y, Yao X ( 2008 ) CSS-Palm 2.0: An updated software for palmitoylation sites prediction . Protein Eng Des Sel 21 : 639 – 644 Google Scholar Crossref Search ADS PubMed WorldCat Rocco M , Arena S, Renzone G, Scippa GS, Lomaglio T, Verrillo F, Scaloni A, Marra M ( 2013 ) Proteomic analysis of temperature stress-responsive proteins in Arabidopsis thaliana rosette leaves . Mol Biosyst 9 : 1257 – 1267 Google Scholar Crossref Search ADS PubMed WorldCat Röhl T , Motzkus M, Soll J ( 1999 ) The outer envelope protein OEP24 from pea chloroplasts can functionally replace the mitochondrial VDAC in yeast . FEBS Lett 460 : 491 – 494 Google Scholar Crossref Search ADS PubMed WorldCat Roston RL , Gao J, Murcha MW, Whelan J, Benning C ( 2012 ) TGD1, -2, and -3 proteins involved in lipid trafficking form ATP-binding cassette (ABC) transporter with multiple substrate-binding proteins . J Biol Chem 287 : 21406 – 21415 Google Scholar Crossref Search ADS PubMed WorldCat Ryoo N , Eom JS, Kim HB, Vo BT, Lee SW, Hahn TR, Jeon JS ( 2013 ) Expression and functional analysis of rice plastidic maltose transporter, OsMEX1 . J Korean Soc Appl Biol Chem 56 : 149 – 155 Google Scholar Crossref Search ADS WorldCat Sánchez-Fernández R , Davies TG, Coleman JO, Rea PA ( 2001 ) The Arabidopsis thaliana ABC protein superfamily, a complete inventory . J Biol Chem 276 : 30231 – 30244 Google Scholar Crossref Search ADS PubMed WorldCat Schneider T , Keller F ( 2009 ) Raffinose in chloroplasts is synthesized in the cytosol and transported across the chloroplast envelope . Plant Cell Physiol 50 : 2174 – 2182 Google Scholar Crossref Search ADS PubMed WorldCat Schulze WX , Schneider T, Starck S, Martinoia E, Trentmann O ( 2012 ) Cold acclimation induces changes in Arabidopsis tonoplast protein abundance and activity and alters phosphorylation of tonoplast monosaccharide transporters . Plant J 69 : 529 – 541 Google Scholar Crossref Search ADS PubMed WorldCat Serbinova E , Kagan V, Han D, Packer L ( 1991 ) Free radical recycling and intramembrane mobility in the antioxidant properties of alpha-tocopherol and alpha-tocotrienol . Free Radic Biol Med 10 : 263 – 275 Google Scholar Crossref Search ADS PubMed WorldCat Shimoni-Shor E , Hassidim M, Yuval-Naeh N, Keren N ( 2010 ) Disruption of Nap14, a plastid-localized non-intrinsic ABC protein in Arabidopsis thaliana results in the over-accumulation of transition metals and in aberrant chloroplast structures . Plant Cell Environ 33 : 1029 – 1038 Google Scholar Crossref Search ADS PubMed WorldCat Sicher R ( 2011 ) Carbon partitioning and the impact of starch deficiency on the initial response of Arabidopsis to chilling temperatures . Plant Sci 181 : 167 – 176 Google Scholar Crossref Search ADS PubMed WorldCat Strand A , Hurry V, Gustafsson P, Gardeström P ( 1997 ) Development of Arabidopsis thaliana leaves at low temperatures releases the suppression of photosynthesis and photosynthetic gene expression despite the accumulation of soluble carbohydrates . Plant J 12 : 605 – 614 Google Scholar Crossref Search ADS PubMed WorldCat Sun Q , Zybailov B, Majeran W, Friso G, Olinares PDB, van Wijk KJ ( 2009 ) PPDB, the Plant Proteomics Database at Cornell . Nucleic Acids Res 37 : D969 – D974 Google Scholar Crossref Search ADS PubMed WorldCat Terry MJ , Smith AG ( 2013 ) A model for tetrapyrrole synthesis as the primary mechanism for plastid-to-nucleus signaling during chloroplast biogenesis . Front Plant Sci 4 : 14 Google Scholar Crossref Search ADS PubMed WorldCat Tewari KA , Tripathy CB ( 1998 ) Temperature-stress-induced impairment of chlorophyll biosynthetic reactions in cucumber and wheat . Plant Physiol 117 : 851 – 858 Google Scholar Crossref Search ADS PubMed WorldCat Tewari KA , Tripathy CB ( 1999 ) Acclimation of chlorophyll biosynthetic reactions to temperature stress in cucumber (Cucumis sativus L.) . Planta 208 : 431 – 437 Google Scholar Crossref Search ADS WorldCat Tjaden J , Möhlmann T, Kampfenkel K, Henrichs G, Neuhaus HE ( 1998 ) Altered plastidic ATP/ADP‐transporter activity influences potato (Solanum tuberosum L.) tuber morphology, yield and composition of tuber starch . Plant J 16 : 531 – 540 Google Scholar Crossref Search ADS WorldCat Tjus SE , Møller BL, Scheller HV ( 1998 ) Photosystem I is an early target of photoinhibition in barley illuminated at chilling temperatures . Plant Physiol 116 : 755 – 764 Google Scholar Crossref Search ADS PubMed WorldCat Trentmann O , Haferkamp I ( 2013 ) Current progress in tonoplast proteomics reveals insights into the function of the large central vacuole . Front Plant Sci 4 : 34 Google Scholar Crossref Search ADS PubMed WorldCat Trentmann O , Jung B, Neuhaus HE, Haferkamp I ( 2008 ) Nonmitochondrial ATP/ADP transporters accept phosphate as third substrate . J Biol Chem 283 : 36486 – 36493 Google Scholar Crossref Search ADS PubMed WorldCat van Wijk KJ , Kessler F ( 2017 ) Plastoglobuli: Plastid microcompartments with integrated functions in metabolism, plastid developmental transitions, and environmental adaptation . Annu Rev Plant Biol 68 : 253 – 289 Google Scholar Crossref Search ADS PubMed WorldCat Wanner LA , Junttila O ( 1999 ) Cold-induced freezing tolerance in Arabidopsis . Plant Physiol 120 : 391 – 400 Google Scholar Crossref Search ADS PubMed WorldCat Weber A , Servaites JC, Geiger DR, Kofler H, Hille D, Gröner F, Hebbeker U, Flügge UI ( 2000 ) Identification, purification, and molecular cloning of a putative plastidic glucose translocator . Plant Cell 12 : 787 – 802 Google Scholar Crossref Search ADS PubMed WorldCat Weber APM , Schwacke R, Flügge UI ( 2005 ) Solute transporters of the plastid envelope membrane . Annu Rev Plant Biol 56 : 133 – 164 Google Scholar Crossref Search ADS PubMed WorldCat Westphal S , Soll J, Vothknecht UC ( 2001 ) A vesicle transport system inside chloroplasts . FEBS Lett 506 : 257 – 261 Google Scholar Crossref Search ADS PubMed WorldCat Witz S , Jung B, Fürst S, Möhlmann T ( 2012 ) De novo pyrimidine nucleotide synthesis mainly occurs outside of plastids, but a previously undiscovered nucleobase importer provides substrates for the essential salvage pathway in Arabidopsis . Plant Cell 24 : 1549 – 1559 Google Scholar Crossref Search ADS PubMed WorldCat Yano R , Nakamura M, Yoneyama T, Nishida I ( 2005 ) Starch-related α-glucan/water dikinase is involved in the cold-induced development of freezing tolerance in Arabidopsis . Plant Physiol 138 : 837 – 846 Google Scholar Crossref Search ADS PubMed WorldCat Zimmer D , Schneider K, Sommer F, Schroda M, Mühlhaus T ( 2018 ) Artificial intelligence understands peptide observability and assists with absolute protein quantification . Front Plant Sci 9 : 1559 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This work was supported by the Deutsche Forschungsgemeinschaft (DFG) (Projet number 317551381) within Collaborative Research Centre 175 (Transregio Sonderforschungsbereich 175). [OPEN] Articles can be viewed without a subscription. 2 These authors contributed equally to the article. 3 Senior author. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: H. Ekkehard Neuhaus (neuhaus@rhrk.uni-kl.de). O.T. was responsible for chloroplast and envelope membrane purification, sample preparation for mass spectrometry (MS), freezing-tolerance experiments, data analysis, and manuscript preparation; T.M. was responsible for general design of the MS-based experimental study, machine learning, data analysis, and manuscript preparation; D.Z. performed MS data processing and data analysis; F.S. and M.S. performed MS-based protein identification; I.H. edited the manuscript and completed the writing; I.K. and B.P. generated MEX1 overexpressor lines; and E.N. conceived the research plan and wrote the manuscript. www.plantphysiol.org/cgi/doi/10.1104/pp.19.00947 © 2020 American Society of Plant Biologists. All Rights Reserved. © The Author(s) 2020. Published by Oxford University Press on behalf of American Society of Plant Biologists. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.
TI - Identification of Chloroplast Envelope Proteins with Critical Importance for Cold Acclimation  
JF - Plant Physiology
DO - 10.1104/pp.19.00947
DA - 2020-03-03
UR - https://www.deepdyve.com/lp/oxford-university-press/identification-of-chloroplast-envelope-proteins-with-critical-9ZzDv0xr7b
SP - 1239
EP - 1255
VL - 182
IS - 3
DP - DeepDyve
ER -