TY - JOUR
AU - Chen, Jing
AB - Abstract Background The reverse transcriptase (RT) region of the hepatitis B virus (HBV) is the target of antiviral treatment. However, the discrepancy in RT mutations between nucleos(t)ide analogue (NA)-treated and -untreated chronic hepatitis B (CHB) patients is un clear. Methods Serum samples were collected from 119 NA-treated and 135 NA-untreated patients. The sampling time was decided by the clinician. Full-length HBV RT regions were amplified using nest polymerase chain reaction. The mutations within the RT region were analysed by direct sequencing. Results The incidence of RT mutations in treated patients was higher than that in untreated patients (p<0.05). The classic drug-resistant mutations were detected in 44.5% (53/119) of treated patients, which was significantly higher than in untreated patients (6.7% [9/135]) (p<0.05). The non-classical mutations showed their complexity and diversity in both patient groups. Multiple mutations (three or more) were more frequent in treated patients than in untreated patients (p<0.05). Several novel mutations might be related to NA resistance. Conclusions The selection pressures of NAs accelerated the development of RT mutations, especially within the functional domain. Mutations in the RT region occurred not only at classical sites, but also at other non-classical sites, which might be related to drug resistance and/or viral replication. The biological function and fitness of HBV isolates harbouring these novel mutations need further in vitro and in vivo verification experiments. hepatitis B virus, mutations, reverse transcriptase Introduction Viral hepatitis is a leading cause of human mortality and a major health burden worldwide caused by hepatitis virus.1,2 Among these pathogens, hepatitis B virus (HBV) infection plays a key role in contributing to chronic hepatitis B (CHB), cirrhosis and primary liver cancer and leads to 800 000–1.2 million deaths every year.3–6 Therefore treatment and control of HBV infection is critical in reducing the risk of liver cancer and reducing the global burden of disease.7 Currently, nucleos(t)ide analogues (NAs), including lamivudine (LAM), telbivudine (LdT), adefovirdipicoxil (ADV), entecavir (ETV) and tenofovir (TDF) have been used to inhibit viral replication and reduce the progression of liver diseases.6 However, long-term antiviral treatment with NAs may lead to treatment failure due to the emergence of mutations in the reverse transcriptase (RT) region of the HBV, which is the target of NAs.8–10 Previous studies have reported that there are four categories of NA resistance (NAr)-associated mutations in the RT region: primary mutation, secondary/compensatory mutation, putative resistance mutation and pretreatment mutation.11,12 The former two categories of mutations are associated with reduced drug susceptibility and restoration of virus replication ability; these mutations are known as classical mutations and have been investigated widely in CHB patients.13–15 Putative resistance mutations may be potentially related to NAr or replication compensation.12 Pretreatment mutations were found before NA treatment.11 However, the role of the latter two categories of mutations in the evolution of drug resistance in CHB patients was not well-defined. In addition, many other RT mutations that do not belong to these four categories of mutations were also found in CHB patients,16,17 but the impacts of these mutations on NA drug resistance have not been clarified. A better understanding of the mutation profile in the RT region among treated and untreated CHB patients would be helpful for elucidating the mechanism of RT mutation evolution under antiviral therapy and prevention of drug resistance development. However, the differences between NA-treated and -untreated CHB patients and the possible clinical relevancies of several novel RT mutations remain unclear. Therefore this cross-sectional study was performed to investigate the characteristics of RT mutations among NA-treated and -untreated Chinese CHB patients and to explore the discrepancies between these two groups. Materials and methods Patients From May 2012 to December 2016, a total of 254 CHB patients from the Department of Infectious Diseases in Huzhou Central Hospital were enrolled for this study. The timing of the collected samples was determined by professional infectious disease clinicians. The diagnostic criteria of CHB and virological breakthrough was according to the Chinese guidelines for the prevention and treatment of chronic hepatitis.18 The number of NA-treated CHB patients was 119, while 135 were untreated. The serum samples were collected among NA-treated patients for resistance testing when they were suspected by clinicians of developing drug resistance, such as the following scenarios: patients with inadequate or no virological response or patients who appeared to have a virological breakthrough. Among the NA-treated patients, 110 were undergoing single LAM, ADV or ETV treatment with a mean treatment duration of 23.5±7.8 months. Four patients received sequential treatment (LAM then a switch to ADV) with a mean treatment duration of 21.7±3.9 months. Five patients were treated with a combination of LAM and ADV for a mean treatment duration of 31.4±5.8 months. At the time of detection, patients were excluded based on the following criteria: infection with hepatitis A virus, hepatitis C virus, hepatitis D virus, tuberculosis or human immunodeficiency virus. The serum HBV DNA level of each patient was >500 IU/mL. The study was approved by the ethics committee of Huzhou Central Hospital in accordance with the ethical guidelines of the Declaration of Helsinki. Written informed consent was obtained from each patient. Serum was collected and stored at −70°C until further use. Serological markers Hepatitis B surface antigen, hepatitis B extractable antigen (HBeAg) and anti-hepatitis B core antibodies in serum were detected using the Architect-i2000 system (Abbott Laboratories, Abbott Park, IL, USA). Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were determined by automated techniques (Hitachi 7600, Hitachi, Tokyo, Japan). HBV DNA was quantified using a commercial real-time polymerase chain reaction (PCR) detection kit (Liferiver Bio-Tech, Shanghai, China), with a detection limit of 100 IU/mL. Amplification of the RT region and DNA sequencing HBV DNA was extracted using the QIAamp DNA blood mini kit (Qiagen, Hilden, Germany). The full RT region (nt54–1278) of the HBV genome was amplified by nest-polymerase chain reaction (nest PCR). The primers (Table 1) and conditions for PCR were as described previously.19 The PCR products were purified using a QIAquick gel extraction kit (Qiagen) and direct sequencing was performed with an ABI 3730xl genetic analyser (Applied Biosystems, Waltham, MA, USA). All sequencing was completed by Bioshang Bio-Tech (Shanghai, China). Table 1. Primers for amplification of the RT region Primers . Sequence (5′-3′) . Position (nt) . First found  Forward AGTCAGGAAGACAGCCTACTCC 3146–3167  Reverse AGGTGAAGCGAAGTGCACAC 1596–1577 Second round  Forward TTCCTGCTGGTGGCTCCAGTTC 54–75  Reverse TTCCGCAGTATGGATCGGCAG 1278–1258 Primers . Sequence (5′-3′) . Position (nt) . First found  Forward AGTCAGGAAGACAGCCTACTCC 3146–3167  Reverse AGGTGAAGCGAAGTGCACAC 1596–1577 Second round  Forward TTCCTGCTGGTGGCTCCAGTTC 54–75  Reverse TTCCGCAGTATGGATCGGCAG 1278–1258 Open in new tab Table 1. Primers for amplification of the RT region Primers . Sequence (5′-3′) . Position (nt) . First found  Forward AGTCAGGAAGACAGCCTACTCC 3146–3167  Reverse AGGTGAAGCGAAGTGCACAC 1596–1577 Second round  Forward TTCCTGCTGGTGGCTCCAGTTC 54–75  Reverse TTCCGCAGTATGGATCGGCAG 1278–1258 Primers . Sequence (5′-3′) . Position (nt) . First found  Forward AGTCAGGAAGACAGCCTACTCC 3146–3167  Reverse AGGTGAAGCGAAGTGCACAC 1596–1577 Second round  Forward TTCCTGCTGGTGGCTCCAGTTC 54–75  Reverse TTCCGCAGTATGGATCGGCAG 1278–1258 Open in new tab Genotyping and mutational analysis The genotypes of HBV were determined by the online genotyping tool of the National Center for Biotechnology Information (NCBI; http://www.ncbi.nih.gov/projects/genotyping/form.page.cgi). The mutations within the RT region were analysed with regard to the standard reference HBV isolates obtained from GenBank (genotype B: AB073846, AB602818, D00329; genotype C: AB014381, AY123041, X04615) using MEGA 7.0 software. Statistical analysis Data were analysed using SPSS 24.0 software (IBM, Armonk, NY, USA). Student's t-test was applied for continuous variables and χ2 or Fisher's test was applied for categorical variables. A p-value <0.05 was considered statistically significant. Results Characteristics of treated and untreated CHB patients In the present study, 46.5% (118/254) of the CHB patients were infected with HBV genotype C and 53.5% (136/254) were infected with HBV genotype B. The characteristics of the treated and untreated CHB patients are described in Table 2. Comparison of the demographic and clinical characteristics of these two groups showed that the levels of liver function markers (ALT and AST) were lower in the treated patients (p<0.05). Although the HBV DNA levels of the treated patients (5.8 log IU/mL) were lower than those in the untreated patients (6.3 log IU/mL), no significant difference was found (p>0.05). No significant differences were found between these two groups of patients in terms of gender, age, positive rate of HBeAg and distribution of the HBV genotype (p>0.05). Table 2. Characteristics of NA-treated and untreated CHB patients Characteristics . Untreated (n=135) . Treated (n=119) . p-Value . Age (years), mean±SD 36.4±12.3 37.6±12.3 0.991 Gender (male/female), n/n 92/43 89/30 0.268 Genotype (B/C), n/n 74/61 62/57 0.665 HBeAg (+/−), n/n 84/51 62/57 0.127 HBV DNA (log IU/ml), mean±SD) 6.3±1.6 5.8±1.5 0.553 ALT (IU/L), mean±SD 161.7±229.1 115.3±180.4 0.018 AST (IU/L), mean±SD 94.7±130.4 82.6±146.9 0.013 Characteristics . Untreated (n=135) . Treated (n=119) . p-Value . Age (years), mean±SD 36.4±12.3 37.6±12.3 0.991 Gender (male/female), n/n 92/43 89/30 0.268 Genotype (B/C), n/n 74/61 62/57 0.665 HBeAg (+/−), n/n 84/51 62/57 0.127 HBV DNA (log IU/ml), mean±SD) 6.3±1.6 5.8±1.5 0.553 ALT (IU/L), mean±SD 161.7±229.1 115.3±180.4 0.018 AST (IU/L), mean±SD 94.7±130.4 82.6±146.9 0.013 ALT, alanine aminotrasferase; AST, aspartate aminotransferase; SD, standard deviation. Open in new tab Table 2. Characteristics of NA-treated and untreated CHB patients Characteristics . Untreated (n=135) . Treated (n=119) . p-Value . Age (years), mean±SD 36.4±12.3 37.6±12.3 0.991 Gender (male/female), n/n 92/43 89/30 0.268 Genotype (B/C), n/n 74/61 62/57 0.665 HBeAg (+/−), n/n 84/51 62/57 0.127 HBV DNA (log IU/ml), mean±SD) 6.3±1.6 5.8±1.5 0.553 ALT (IU/L), mean±SD 161.7±229.1 115.3±180.4 0.018 AST (IU/L), mean±SD 94.7±130.4 82.6±146.9 0.013 Characteristics . Untreated (n=135) . Treated (n=119) . p-Value . Age (years), mean±SD 36.4±12.3 37.6±12.3 0.991 Gender (male/female), n/n 92/43 89/30 0.268 Genotype (B/C), n/n 74/61 62/57 0.665 HBeAg (+/−), n/n 84/51 62/57 0.127 HBV DNA (log IU/ml), mean±SD) 6.3±1.6 5.8±1.5 0.553 ALT (IU/L), mean±SD 161.7±229.1 115.3±180.4 0.018 AST (IU/L), mean±SD 94.7±130.4 82.6±146.9 0.013 ALT, alanine aminotrasferase; AST, aspartate aminotransferase; SD, standard deviation. Open in new tab RT mutations (categories 1–4) in treated and untreated CHB patients RT mutations were detected in 71.8% (97/135) of the untreated patients with CHB and 86.5% (103/119) of the treated patients, and the difference was statistically significant (p<0.05). The mutation sites in these patients are given in Table 3. Among these mutations, primary and secondary mutations were found in 44.5% (53/119) of the treated patients and 6.7% (9/135) of the untreated patients. The former was significantly higher than the latter (p<0.05). These mutations included rtM204I/V, rtL80I/V, rtL180M, rtM250L, rtV173L, rtA181T/V, rtN236T, A194G, S202N and I169L. The multiple mutations rate (two or more sites) in the treated patients (74/119 [62.2%]) was more frequent than those in the untreated patients (55/135 [40.7%]) (p<0.001). Furthermore, this difference was more significant in the incidence of patients with more than three mutations between these two groups (37.0% [44/119] vs 14.8% [20/135]; p<0.001). More importantly, the rtM204I/V mutation was the most frequent in this study (Table 3). In addition, the rtL80I mutation was combined with the rtM204I mutation (19/20 [95.0%]), while most of the rtL180M mutations were combined with rtM204V mutations (18/23 [78.3%]). Of note, the majority of patients (19/22 [86.4%]) harbouring rtL80I/V mutations were infected with genotype B. Table 3. Prevalence of RT mutations among CHB patients Mutation category . Type of RT mutation . Untreated (N=135), n (%) . LAM (N=67), n (%) . ADV (N=25), n (%) . ETV (N=18), n (%) . LAM switch to/or add ADV (N=9), n (%) . Total NA-treated (N=119), n (%) . p-Valuea . Primary drug resistance I169L 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000  Mutation (n=7) A181T/V 3 (2.2) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 A194G 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 S202N 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 M204I/V 6 (4.4) 39 (58.2) 1 (4.0) 1 (5.6) 4 (44.4) 45 (37.8) <0.001 N236T 2 (1.5) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 M250L 0 (0.0) 4 (6.0) 1 (4.0) 0 (0.0) 1 (11.1) 6 (5.0) 0.006 Secondary/compensatory L80I/V 3 (2.2) 19 (28.4) 0 (0.0) 0 (0.0) 0 (0.0) 19 (16.0) <0.001  Mutation (n=3) V173L 2 (1.5) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.667 L180M 3 (2.2) 17 (25.4) 0 (0.0) 1 (5.6) 2 (22.2) 20 (16.8) <0.001 Putative NAr S/N53A/D/H/I/S 8 (5.9) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.039  Mutation (n=19) T54N/S 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.218 V84I 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000 L/I91I/L 8 (5.9) 9 (13.4) 1 (4.0) 0 (0.0) 1 (11.1) 11 (9.2) 0.347 H126R 0 (0.0) 0 (0.0) 1 (4.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 T128A/D/N/I/P 3 (2.2) 4 (6.0) 5 (20.0) 1 (5.6) 0 (0.0) 10 (8.4) 0.042 R153Q 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V191I 2 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.500 V207L/I/M/F 4 (2.9) 6 (9.0) 0 (0.0) 1 (5.6) 0 (0.0) 7 (5.9) 0.356 S213T 6 (4.4) 2 (3.0) 2 (8.0) 0 (0.0) 0 (0.0) 4 (3.4) 0.754 V214I/A 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 1 (11.1) 3 (2.5) 0.101 Q215H/R 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 1 (11.1) 2 (1.6) 1.000 L217P 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 F221Y/N/H/V 4 (2.9) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.687 L229V/M/F/W 4 (2.9) 3 (4.5) 1 (4.0) 0 (0.0) 1 (11.1) 5 (4.2) 0.738 I233V 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 P237S 2 (1.5) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 N/H238H/N/D/T 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 S256G 6 (4.4) 3 (4.5) 1 (4.0) 1 (5.6) 0 (0.0) 5 (4.2) 1.000 Pretreatment T38A/K 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 2 (22.2) 5 (4.2) 0.112  Mutation (n=6) Y/N124D/H 10 (7.4) 0 (0.0) 2 (8.0) 2 (11.2) 1 (11.1) 5 (4.2) 0.302 N/D134A/E/H/S 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 N139K 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V/I224I/V 7 (5.2) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 R242H/S 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 Novel mutation H/R55Q 2 (1.5) 4 (6.0) 1 (4.0) 2 (11.2) 0 (0.0) 7 (5.9) 0.08  Mutation (n=7) S106C 1 (0.7) 1 (1.5) 2 (8.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 P/S109Q 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.343 I122L/F/N 2 (1.5) 2 (3.0) 3 (12.0) 1 (5.6) 0 (0.0) 6 (5.0) 0.152 Y141F/S 2 (1.5) 1 (1.5) 2 (8.0) 1 (5.6) 0 (0.0) 4 (3.4) 0.423 I163V 0 (0.0) 0 (0.0) 2 (8.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.101 V266I 0 (0.0) 1 (1.5) 4 (16.0) 0 (0.0) 0 (0.0) 5 (4.2) 0.022 Mutation category . Type of RT mutation . Untreated (N=135), n (%) . LAM (N=67), n (%) . ADV (N=25), n (%) . ETV (N=18), n (%) . LAM switch to/or add ADV (N=9), n (%) . Total NA-treated (N=119), n (%) . p-Valuea . Primary drug resistance I169L 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000  Mutation (n=7) A181T/V 3 (2.2) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 A194G 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 S202N 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 M204I/V 6 (4.4) 39 (58.2) 1 (4.0) 1 (5.6) 4 (44.4) 45 (37.8) <0.001 N236T 2 (1.5) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 M250L 0 (0.0) 4 (6.0) 1 (4.0) 0 (0.0) 1 (11.1) 6 (5.0) 0.006 Secondary/compensatory L80I/V 3 (2.2) 19 (28.4) 0 (0.0) 0 (0.0) 0 (0.0) 19 (16.0) <0.001  Mutation (n=3) V173L 2 (1.5) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.667 L180M 3 (2.2) 17 (25.4) 0 (0.0) 1 (5.6) 2 (22.2) 20 (16.8) <0.001 Putative NAr S/N53A/D/H/I/S 8 (5.9) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.039  Mutation (n=19) T54N/S 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.218 V84I 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000 L/I91I/L 8 (5.9) 9 (13.4) 1 (4.0) 0 (0.0) 1 (11.1) 11 (9.2) 0.347 H126R 0 (0.0) 0 (0.0) 1 (4.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 T128A/D/N/I/P 3 (2.2) 4 (6.0) 5 (20.0) 1 (5.6) 0 (0.0) 10 (8.4) 0.042 R153Q 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V191I 2 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.500 V207L/I/M/F 4 (2.9) 6 (9.0) 0 (0.0) 1 (5.6) 0 (0.0) 7 (5.9) 0.356 S213T 6 (4.4) 2 (3.0) 2 (8.0) 0 (0.0) 0 (0.0) 4 (3.4) 0.754 V214I/A 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 1 (11.1) 3 (2.5) 0.101 Q215H/R 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 1 (11.1) 2 (1.6) 1.000 L217P 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 F221Y/N/H/V 4 (2.9) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.687 L229V/M/F/W 4 (2.9) 3 (4.5) 1 (4.0) 0 (0.0) 1 (11.1) 5 (4.2) 0.738 I233V 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 P237S 2 (1.5) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 N/H238H/N/D/T 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 S256G 6 (4.4) 3 (4.5) 1 (4.0) 1 (5.6) 0 (0.0) 5 (4.2) 1.000 Pretreatment T38A/K 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 2 (22.2) 5 (4.2) 0.112  Mutation (n=6) Y/N124D/H 10 (7.4) 0 (0.0) 2 (8.0) 2 (11.2) 1 (11.1) 5 (4.2) 0.302 N/D134A/E/H/S 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 N139K 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V/I224I/V 7 (5.2) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 R242H/S 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 Novel mutation H/R55Q 2 (1.5) 4 (6.0) 1 (4.0) 2 (11.2) 0 (0.0) 7 (5.9) 0.08  Mutation (n=7) S106C 1 (0.7) 1 (1.5) 2 (8.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 P/S109Q 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.343 I122L/F/N 2 (1.5) 2 (3.0) 3 (12.0) 1 (5.6) 0 (0.0) 6 (5.0) 0.152 Y141F/S 2 (1.5) 1 (1.5) 2 (8.0) 1 (5.6) 0 (0.0) 4 (3.4) 0.423 I163V 0 (0.0) 0 (0.0) 2 (8.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.101 V266I 0 (0.0) 1 (1.5) 4 (16.0) 0 (0.0) 0 (0.0) 5 (4.2) 0.022 a Comparison of prevalence of mutation between untreated and treated CHB patients. Open in new tab Table 3. Prevalence of RT mutations among CHB patients Mutation category . Type of RT mutation . Untreated (N=135), n (%) . LAM (N=67), n (%) . ADV (N=25), n (%) . ETV (N=18), n (%) . LAM switch to/or add ADV (N=9), n (%) . Total NA-treated (N=119), n (%) . p-Valuea . Primary drug resistance I169L 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000  Mutation (n=7) A181T/V 3 (2.2) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 A194G 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 S202N 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 M204I/V 6 (4.4) 39 (58.2) 1 (4.0) 1 (5.6) 4 (44.4) 45 (37.8) <0.001 N236T 2 (1.5) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 M250L 0 (0.0) 4 (6.0) 1 (4.0) 0 (0.0) 1 (11.1) 6 (5.0) 0.006 Secondary/compensatory L80I/V 3 (2.2) 19 (28.4) 0 (0.0) 0 (0.0) 0 (0.0) 19 (16.0) <0.001  Mutation (n=3) V173L 2 (1.5) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.667 L180M 3 (2.2) 17 (25.4) 0 (0.0) 1 (5.6) 2 (22.2) 20 (16.8) <0.001 Putative NAr S/N53A/D/H/I/S 8 (5.9) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.039  Mutation (n=19) T54N/S 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.218 V84I 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000 L/I91I/L 8 (5.9) 9 (13.4) 1 (4.0) 0 (0.0) 1 (11.1) 11 (9.2) 0.347 H126R 0 (0.0) 0 (0.0) 1 (4.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 T128A/D/N/I/P 3 (2.2) 4 (6.0) 5 (20.0) 1 (5.6) 0 (0.0) 10 (8.4) 0.042 R153Q 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V191I 2 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.500 V207L/I/M/F 4 (2.9) 6 (9.0) 0 (0.0) 1 (5.6) 0 (0.0) 7 (5.9) 0.356 S213T 6 (4.4) 2 (3.0) 2 (8.0) 0 (0.0) 0 (0.0) 4 (3.4) 0.754 V214I/A 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 1 (11.1) 3 (2.5) 0.101 Q215H/R 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 1 (11.1) 2 (1.6) 1.000 L217P 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 F221Y/N/H/V 4 (2.9) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.687 L229V/M/F/W 4 (2.9) 3 (4.5) 1 (4.0) 0 (0.0) 1 (11.1) 5 (4.2) 0.738 I233V 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 P237S 2 (1.5) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 N/H238H/N/D/T 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 S256G 6 (4.4) 3 (4.5) 1 (4.0) 1 (5.6) 0 (0.0) 5 (4.2) 1.000 Pretreatment T38A/K 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 2 (22.2) 5 (4.2) 0.112  Mutation (n=6) Y/N124D/H 10 (7.4) 0 (0.0) 2 (8.0) 2 (11.2) 1 (11.1) 5 (4.2) 0.302 N/D134A/E/H/S 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 N139K 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V/I224I/V 7 (5.2) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 R242H/S 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 Novel mutation H/R55Q 2 (1.5) 4 (6.0) 1 (4.0) 2 (11.2) 0 (0.0) 7 (5.9) 0.08  Mutation (n=7) S106C 1 (0.7) 1 (1.5) 2 (8.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 P/S109Q 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.343 I122L/F/N 2 (1.5) 2 (3.0) 3 (12.0) 1 (5.6) 0 (0.0) 6 (5.0) 0.152 Y141F/S 2 (1.5) 1 (1.5) 2 (8.0) 1 (5.6) 0 (0.0) 4 (3.4) 0.423 I163V 0 (0.0) 0 (0.0) 2 (8.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.101 V266I 0 (0.0) 1 (1.5) 4 (16.0) 0 (0.0) 0 (0.0) 5 (4.2) 0.022 Mutation category . Type of RT mutation . Untreated (N=135), n (%) . LAM (N=67), n (%) . ADV (N=25), n (%) . ETV (N=18), n (%) . LAM switch to/or add ADV (N=9), n (%) . Total NA-treated (N=119), n (%) . p-Valuea . Primary drug resistance I169L 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000  Mutation (n=7) A181T/V 3 (2.2) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 A194G 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 S202N 0 (0.0) 0 (0.0) 0 (0.0) 1 (5.6) 0 (0.0) 1 (0.8) 1.000 M204I/V 6 (4.4) 39 (58.2) 1 (4.0) 1 (5.6) 4 (44.4) 45 (37.8) <0.001 N236T 2 (1.5) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 M250L 0 (0.0) 4 (6.0) 1 (4.0) 0 (0.0) 1 (11.1) 6 (5.0) 0.006 Secondary/compensatory L80I/V 3 (2.2) 19 (28.4) 0 (0.0) 0 (0.0) 0 (0.0) 19 (16.0) <0.001  Mutation (n=3) V173L 2 (1.5) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.667 L180M 3 (2.2) 17 (25.4) 0 (0.0) 1 (5.6) 2 (22.2) 20 (16.8) <0.001 Putative NAr S/N53A/D/H/I/S 8 (5.9) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.039  Mutation (n=19) T54N/S 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.218 V84I 1 (0.7) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 1.000 L/I91I/L 8 (5.9) 9 (13.4) 1 (4.0) 0 (0.0) 1 (11.1) 11 (9.2) 0.347 H126R 0 (0.0) 0 (0.0) 1 (4.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 T128A/D/N/I/P 3 (2.2) 4 (6.0) 5 (20.0) 1 (5.6) 0 (0.0) 10 (8.4) 0.042 R153Q 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V191I 2 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0 (0.0) 0.500 V207L/I/M/F 4 (2.9) 6 (9.0) 0 (0.0) 1 (5.6) 0 (0.0) 7 (5.9) 0.356 S213T 6 (4.4) 2 (3.0) 2 (8.0) 0 (0.0) 0 (0.0) 4 (3.4) 0.754 V214I/A 0 (0.0) 1 (1.5) 1 (4.0) 0 (0.0) 1 (11.1) 3 (2.5) 0.101 Q215H/R 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 1 (11.1) 2 (1.6) 1.000 L217P 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 0.468 F221Y/N/H/V 4 (2.9) 0 (0.0) 2 (8.0) 0 (0.0) 0 (0.0) 2 (1.6) 0.687 L229V/M/F/W 4 (2.9) 3 (4.5) 1 (4.0) 0 (0.0) 1 (11.1) 5 (4.2) 0.738 I233V 0 (0.0) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 P237S 2 (1.5) 1 (1.5) 1 (4.0) 0 (0.0) 0 (0.0) 2 (1.6) 1.000 N/H238H/N/D/T 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 S256G 6 (4.4) 3 (4.5) 1 (4.0) 1 (5.6) 0 (0.0) 5 (4.2) 1.000 Pretreatment T38A/K 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 2 (22.2) 5 (4.2) 0.112  Mutation (n=6) Y/N124D/H 10 (7.4) 0 (0.0) 2 (8.0) 2 (11.2) 1 (11.1) 5 (4.2) 0.302 N/D134A/E/H/S 6 (4.4) 1 (1.5) 0 (0.0) 1 (5.6) 0 (0.0) 2 (1.6) 0.289 N139K 2 (1.5) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 V/I224I/V 7 (5.2) 3 (4.5) 0 (0.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 R242H/S 1 (0.7) 1 (1.5) 0 (0.0) 0 (0.0) 0 (0.0) 1 (0.8) 1.000 Novel mutation H/R55Q 2 (1.5) 4 (6.0) 1 (4.0) 2 (11.2) 0 (0.0) 7 (5.9) 0.08  Mutation (n=7) S106C 1 (0.7) 1 (1.5) 2 (8.0) 0 (0.0) 0 (0.0) 3 (2.5) 0.343 P/S109Q 1 (0.7) 2 (3.0) 0 (0.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.343 I122L/F/N 2 (1.5) 2 (3.0) 3 (12.0) 1 (5.6) 0 (0.0) 6 (5.0) 0.152 Y141F/S 2 (1.5) 1 (1.5) 2 (8.0) 1 (5.6) 0 (0.0) 4 (3.4) 0.423 I163V 0 (0.0) 0 (0.0) 2 (8.0) 1 (5.6) 0 (0.0) 3 (2.5) 0.101 V266I 0 (0.0) 1 (1.5) 4 (16.0) 0 (0.0) 0 (0.0) 5 (4.2) 0.022 a Comparison of prevalence of mutation between untreated and treated CHB patients. Open in new tab In this study, the non-classical mutations (categories 3 and 4) were found at 26 sites. The rates of putative mutation were higher at the rt128, rt207, rt214 and rt229 sites, but statistical significance was found at only the rt128 site (p<0.05). The rates of pretreatment mutations were more frequent at the rt124, rt134 and rt224 sites, although there was no significant difference between the treated and untreated groups (p>0.05). In addition, rtL229V/F mutations coexisted with rtM204I in NA-treated patients. Novel mutations in the RT region among CHB patients There were several mutations that were not classified into the above four categories (Table 3). The mutation rate at sites rt55, rt106, rt109, rt122, rt141, rt163 and rt266 were higher in the treated patients. Interestingly, a difference between treated and untreated patients was found at only the rtV266I site (p<0.05). Some mutations (rtP109Q, rtI163V, rtL199V and rtV266I) in the RT region were detected in the virological breakthrough patients without primary or secondary mutations. These novel mutations may be related to drug susceptibility and/or viral fitness. Mutation site distribution and frequency in treated and untreated patients The discrepancies in mutation distribution and frequency between the treated and untreated patients were also analysed as described previously.20,21 The mutation frequency of the functional domain was higher in the treated patients than in the untreated patients (p<0.05). There were no significant differences in the A–B interdomain or non-A–B interdomains between the treated patients and untreated patients (p>0.05). Comparison results of the number of mutation sites in the different RT regions indicated that the number of mutations in the functional domain was greater than in the non-A–B interdomain in the treated patients (p<0.05). These results also showed that the mutation frequency in the functional domain was highest in the RT region in treated patients (p<0.05; Table 4). Table 4. Mutation site distribution and frequency in NA-treated and untreated CHB patients . Mutation sites, % (n/N)a . Frequency, % (n/N)b . Region in RT . Untreated . Treated . p-Value . Untreated . Treated . p-Value . Domain (A–F) (n=108) 25.0 (27/108) 25.9 (28/108) 0.876 0.55 (81/14 580) 1.19 (153/12 852) <0.001 A–B interdomain (n=71) 33.8 (24/71) 31.0 (22/71) 0.720 0.63 (60/9585) 0.73 (62/8449) 0.378 Non-A–B interdomain (n=47) 29.8 (14/47) 44.6 (21/47) 0.135 0.52 (33/6345) 0.73 (41/5593) 0.139 . Mutation sites, % (n/N)a . Frequency, % (n/N)b . Region in RT . Untreated . Treated . p-Value . Untreated . Treated . p-Value . Domain (A–F) (n=108) 25.0 (27/108) 25.9 (28/108) 0.876 0.55 (81/14 580) 1.19 (153/12 852) <0.001 A–B interdomain (n=71) 33.8 (24/71) 31.0 (22/71) 0.720 0.63 (60/9585) 0.73 (62/8449) 0.378 Non-A–B interdomain (n=47) 29.8 (14/47) 44.6 (21/47) 0.135 0.52 (33/6345) 0.73 (41/5593) 0.139 a Comparison of the number of mutation sites among different RT regions were as follows: domain vs A–B interdomain (untreated patients, p=0.996; treated patients, p=0.460); domain vs non-A–B interdomain (untreated patients, p=0.536; treated patients, p=0.021); A–B interdomain vs non-A–B interdomain (untreated patients, p=0.648; treated patients, p=0.130). b Comparison of mutation frequency among different RT regions were as follows: domain vs A–B interdomain (untreated patients, p=0.482; treated patients, p=0.001); domain vs non-A–B interdomain (untreated patients, p=0.749; treated patients, p=0.005); A–B interdomain vs non-A–B interdomain (untreated patients, p=0.390; treated patients, p=0.996). Open in new tab Table 4. Mutation site distribution and frequency in NA-treated and untreated CHB patients . Mutation sites, % (n/N)a . Frequency, % (n/N)b . Region in RT . Untreated . Treated . p-Value . Untreated . Treated . p-Value . Domain (A–F) (n=108) 25.0 (27/108) 25.9 (28/108) 0.876 0.55 (81/14 580) 1.19 (153/12 852) <0.001 A–B interdomain (n=71) 33.8 (24/71) 31.0 (22/71) 0.720 0.63 (60/9585) 0.73 (62/8449) 0.378 Non-A–B interdomain (n=47) 29.8 (14/47) 44.6 (21/47) 0.135 0.52 (33/6345) 0.73 (41/5593) 0.139 . Mutation sites, % (n/N)a . Frequency, % (n/N)b . Region in RT . Untreated . Treated . p-Value . Untreated . Treated . p-Value . Domain (A–F) (n=108) 25.0 (27/108) 25.9 (28/108) 0.876 0.55 (81/14 580) 1.19 (153/12 852) <0.001 A–B interdomain (n=71) 33.8 (24/71) 31.0 (22/71) 0.720 0.63 (60/9585) 0.73 (62/8449) 0.378 Non-A–B interdomain (n=47) 29.8 (14/47) 44.6 (21/47) 0.135 0.52 (33/6345) 0.73 (41/5593) 0.139 a Comparison of the number of mutation sites among different RT regions were as follows: domain vs A–B interdomain (untreated patients, p=0.996; treated patients, p=0.460); domain vs non-A–B interdomain (untreated patients, p=0.536; treated patients, p=0.021); A–B interdomain vs non-A–B interdomain (untreated patients, p=0.648; treated patients, p=0.130). b Comparison of mutation frequency among different RT regions were as follows: domain vs A–B interdomain (untreated patients, p=0.482; treated patients, p=0.001); domain vs non-A–B interdomain (untreated patients, p=0.749; treated patients, p=0.005); A–B interdomain vs non-A–B interdomain (untreated patients, p=0.390; treated patients, p=0.996). Open in new tab We also compared the mutation distribution and frequency in the treated and untreated patients infected with different genotypes (B or C). In each genotype (B or C), the mutation rate and frequency in the treated group were higher than those in the untreated group (p<0.05), but although the mutation rate was higher in the treated C-genotype patients than in the untreated C-genotype patients, there was no statistical significance (p>0.05). No significant differences were found when the mutation rate and frequency between the genotype C and genotype B patients were compared (p>0.05; Table 5). Table 5. Mutation frequency in different genotypes among NA-treated and untreated CHB patients Genotype . Mutation rate, % (n/N) . p-Value . Mutation frequency, % (n/N) . p-Value . B (NA-treated) 88.7 (55/62) 0.022a 0.71 (152/21 328) 0.000b B (untreated) 72.9 (54/74) 0.40 (102/25 456) B total 80.1 (109/136) 0.54 (254/46 784) C (NA-treated) 84.2 (48/57) 0.076a 0.59 (116/19 608) 0.000b C (untreated) 70.5 (43/61) 0.37 (78/20 984) C total 77.1 (91/118) 0.556c 0.47 (194/40 592) 0.165d Genotype . Mutation rate, % (n/N) . p-Value . Mutation frequency, % (n/N) . p-Value . B (NA-treated) 88.7 (55/62) 0.022a 0.71 (152/21 328) 0.000b B (untreated) 72.9 (54/74) 0.40 (102/25 456) B total 80.1 (109/136) 0.54 (254/46 784) C (NA-treated) 84.2 (48/57) 0.076a 0.59 (116/19 608) 0.000b C (untreated) 70.5 (43/61) 0.37 (78/20 984) C total 77.1 (91/118) 0.556c 0.47 (194/40 592) 0.165d a Comparison of mutation rates between treated and untreated patients in HBV genotype B or C. b Comparison of mutation frequency between treated and untreated patients in HBV genotype B or C. c Comparison of mutation rates between patients infected with HBV genotype B and C. d Comparison of mutation frequency between patients infected with HBV genotype B and C. Open in new tab Table 5. Mutation frequency in different genotypes among NA-treated and untreated CHB patients Genotype . Mutation rate, % (n/N) . p-Value . Mutation frequency, % (n/N) . p-Value . B (NA-treated) 88.7 (55/62) 0.022a 0.71 (152/21 328) 0.000b B (untreated) 72.9 (54/74) 0.40 (102/25 456) B total 80.1 (109/136) 0.54 (254/46 784) C (NA-treated) 84.2 (48/57) 0.076a 0.59 (116/19 608) 0.000b C (untreated) 70.5 (43/61) 0.37 (78/20 984) C total 77.1 (91/118) 0.556c 0.47 (194/40 592) 0.165d Genotype . Mutation rate, % (n/N) . p-Value . Mutation frequency, % (n/N) . p-Value . B (NA-treated) 88.7 (55/62) 0.022a 0.71 (152/21 328) 0.000b B (untreated) 72.9 (54/74) 0.40 (102/25 456) B total 80.1 (109/136) 0.54 (254/46 784) C (NA-treated) 84.2 (48/57) 0.076a 0.59 (116/19 608) 0.000b C (untreated) 70.5 (43/61) 0.37 (78/20 984) C total 77.1 (91/118) 0.556c 0.47 (194/40 592) 0.165d a Comparison of mutation rates between treated and untreated patients in HBV genotype B or C. b Comparison of mutation frequency between treated and untreated patients in HBV genotype B or C. c Comparison of mutation rates between patients infected with HBV genotype B and C. d Comparison of mutation frequency between patients infected with HBV genotype B and C. Open in new tab Discussion A thorough understanding of the evolutional characteristics of the mutations in the HBV RT region before and after antiviral treatment are necessary to develop personalized therapy strategies for CHB patients and would improve clinical outcomes. In this study, the profile of mutations within the RT region of HBV was analysed by direct sequencing among untreated and treated CHB patients in a tertiary hospital in eastern China. The timing of sample collection was determined by professional infectious disease clinicians. Our results revealed that the mutation rate was higher in the NA-treated patients than in the untreated patients. When compared with classical resistance mutations (primary and secondary mutations), the NA-treated patients also had a significantly higher mutation rate than the untreated patients. In addition, the results indicated that the untreated CHB patients exhibited classical NA resistance mutations, although the incidence was much lower than that in the treatment group. The results also showed that the mutations within the RT region were more frequent in the treated patients than in the untreated patients. These findings indicate that the use of antiviral drugs greatly accelerated the mutations in the RT region of the HBV genome, subsequently leading to drug resistance. Consistent with previous studies,12,15,22–24 rtM204I/V, rt180M, and rtL80I/V mutations that were related to LAM and/or LdT resistance were more frequent in the treated patients than in the untreated patients (Table 3). Although high genetic barrier NAs such as ETV and TDF are currently recommended as first-line therapeutic drugs for HBV infection, LAM was the first anti-HBV drug and has been widely used in China for a long time, thus a large number of patients may already carry rtM204 and/or rtL180 mutations,25,26 which is the basis of cross-resistance to ETV. Moreover, other potential RT mutations (such as rtL91I, rtR153Q, rtV191I and rtF221Y) that have been reported to be associated with TDF were also found in the present study.15,27,28 Notably, the patients harbouring rtM204V/I and/or rtL180M and other potential TDF resistance–associated mutations are at high risk of developing rapid drug resistance to NAs. This would be a serious health problem and a challenge to future antiviral treatment in China. Therefore surveillance and early detection of RT mutations will play a key role in the prevention and control of mutant HBV isolates. Similar to the observations reported in a previous study,15 rtL80I/V and rtM204I mutations or a combination of these two mutations were closely related to genotype B, suggesting that the different genotypes had preferred mutation sites and mutation types. Several studies have reported that the genotypes and combination mutation patterns are correlated.15,22,23 Our study results further confirm that the mutations in different genotypes exhibit their own evolutionary characteristics and distinct combination mutation patterns. In addition, the rtA181V and rtN236T mutations associated with ADV or TDF treatment were detected in only three treated patients, possibly because the number of patients (only 25) was small in the ADV treatment group. Furthermore, it is worth noting that in addition to classical mutations, other non-classical mutations were highly diverse and complex in the present study. Putative NA resistance mutations at rt128 and rt207 were frequently detected in the treated patients. In contrast, the pretreatment mutations at rt124, rt134 and rt224 were more frequent in the untreated patients, suggesting that the viral mutation sites are selective under drug treatment or natural immunity. In agreement with a previous study,12 we also found the rtL229V/F/W mutations were associated with rtM204I in NA-treated patients. It was reported that rtL229 substitutions could restore the replication of rtM204I mutation, but it did not reduce the susceptibility to NAs,29,30 although the clinical and biological significance need further research. Some novel RT mutations were found in virological breakthrough CHB patients. Interestingly, at some sites (rt55, rt106, rt109, rt122, rt128, rt163 and rt266) the mutation rates were higher in the treated patients than in the untreated patients. Several mutations were consistent with those reported previously,31 but others were different. The rtH55R mutation reported in a previous study showed that the detection rate of this mutation was higher in the treated group than in the untreated group of patients infected with HBV genotype C (7.2% vs 3.8%). The rtH55R mutation partly restored the replication capacity of the rtM204I mutant clone in an in vitro study.32 In the present study, the mutation type was rtH55Q in genotype C–infected patients; however, whether this mutation has the same function as rtH55R needs to be further clarified. Of note, the mutation rate at the rt266 site significantly increased in the treatment group compared with the untreated group. A previous study reported that one patient who was infected with genotype D harbouring an rtI266G mutation developed drug resistance after LAM treatment.16 In contrast, our data show that the patients with rtV266I mutations were treated with ADV but were infected with genotype B or C. However, the relationship between mutation at the rt266 site and NA resistance is still unclear. Recently Park et al.33 reported that a quadruple mutation including rtS106C, rtH126Y, rtD134E and rtL269I conferred TDF resistance, as drug susceptibility decreased for CYE and CYEI mutant HBV clones. The former three mutation sites were also found in the present study cohort, indicating that the risk of TDF resistance may still exist, although it has a high genetic barrier. Hayashi et al.34 showed that an rtI163V mutation can rescue viral replication efficacy and was associated with ETV resistance. In contrast, another recent study35 indicated that the rtI163V mutation was not related to ETV treatment. In the present study, the rtI163V mutation occurred in ADV- or ETV-treated patients. Whether these novel RT mutations, alone or in combination with other classical mutations, might impact the effect of antiviral drugs and virus replicative fitness is unclear. Hence additional in vivo and in vitro phenotypic experiments and follow-up studies are required to elucidate the biological function and clinical significance of HBV isolates with these novel mutations. Currently, the RT domain is divided into functional domains (A–F) and non-functional domains (A–B interdomain and non-A–B interdomain).36,37 The study results indicated that the mutation frequency of the functional domains was higher in the treated patients than in the untreated patients, implying that the functional domains are the main regions affected by the antiviral drug and these domains play a key role in viral replication and fitness. Nevertheless, no significant differences were found when the mutation rate and frequency between the genotype C and genotype B patients were compared. However, previous studies have reported that RT mutations are more frequent in patients infected with genotype C than in patients infected with genotype B, not only in treated CHB patients, but also in untreated CHB patients.15,17,23 This difference might be due to the sample size, geographical distribution of the population or selection criteria. Therefore, further research needs to be conducted to assess the relationship between the genotypes and RT mutation distribution and frequency in a large cohort study. There were some limitations in this study. The first was the small sample size, although it was relatively larger than that used in several previous studies comparing the discrepancy within the RT mutation between treated and untreated CHB patients in northern China12 and other countries.22,29,38 The second limitation was the direct sequencing method that was used to detect the mutations in this study. The sensitivity of this method is only 20% and thus some minor variant populations may have been missed. Now, next-generation sequencing (NGS) can identify minor variant populations at a level of <1%, which is a more powerful tool for viral mutations.39,40 Although we did not use the NGS method in this study because of the limited funding and the technical platform, our research focused on the RT region's classical and non-classical mutations in CHB patients, while most studies have focused on the classic resistance mutations in the RT region. This study identified the diversity and complexity in RT mutations of HBV in CHB patients. Therefore monitoring RT mutations among treated and untreated CHB patients is of great significance for the prevention and treatment of HBV. Conclusions In summary, the RT mutation rate was higher in the NA-treated patients than in the untreated patients, especially in the functional domain of the RT region. NA treatment is not only the main selection factor of primary and secondary compensatory mutations, but it is also the driver of some non-classical mutations, and these mutations may associate with NA resistance. Further in vivo and in vitro studies are required to verify the correlation between these novel RT mutations and antiviral drug resistance. These results suggest that monitoring the mutations within the RT region would provide the theoretical support for better therapeutic strategies in clinical settings and new insights into the evolution of HBV under selective pressure. Authors’ contributions WHZ and FCQ conceived and designed the project. DLL and JC collected samples. FJ and DLL performed experiments. WHZ, FCQ and FJ analysed and interpreted the data. WHZ, FCQ and FJ contributed to the manuscript draft and provided revisions. All authors read and approved the final manuscript. Funding This work was supported by the Foundation Project for Science and Technology of Huzhou City (grants 2019GY02 and 2020GY02). Competing interests The authors declare there is no conflicts of interest regarding the publication of this paper. Ethical approval Procedures followed were in accordance with the ethical standards of the Declaration of Helsinki (1964, amended most recently in 2008) of the World Medical Association. The study was approved by the ethics committee of Huzhou Central Hospital in accordance with the ethical guidelines of the Declaration of Helsinki. Written informed consent was obtained from each patient. Data availability Not applicable. References 1 Cowie BC , Carville KS, MacLachlan JH. Mortality due to viral hepatitis in the Global Burden of Disease Study 2010: new evidence of an urgent global public health priority demanding action . Antivir Ther . 2013 ; 18 ( 8 ): 953 – 4 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Lozano R , Naghavi M, Foreman K et al. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010 . Lancet . 2012 ; 380 ( 9859 ): 2095 – 128 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Perz JF , Armstrong GL, Farrington LA et al. The contributions of hepatitis B virus and hepatitis C virus infections to cirrhosis and primary liver cancer worldwide . J Hepatol . 2006 ; 45 ( 4 ): 529 – 38 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Schweitzer A , Horn J, Mikolajczyk RT et al. Estimations of worldwide prevalence of chronic hepatitis B virus infection: a systematic review of data published between 1965 and 2013 . Lancet . 2015 ; 386 ( 10003 ): 1546 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Revill PA , Chisari FV, Block JM et al. A global scientific strategy to cure hepatitis B . Lancet Gastroenterol Hepatol . 2019 ; 4 ( 7 ): 545 – 58 . Google Scholar Crossref Search ADS PubMed WorldCat 6 European Association for the Study of the Liver . EASL 2017 clinical practice guidelines on the management of hepatitis B virus infection . J Hepatol . 2017 ; 67 ( 2 ): 370 – 98 . Crossref Search ADS PubMed WorldCat 7 Fitzmaurice C , Allen C, Barber RM et al. Global, regional, and national cancer incidence, mortality, years of life lost, years lived with disability, and disability-adjusted life-years for 32 cancer groups, 1990 to 2015: a systematic analysis for the Global Burden of Disease Study . JAMA Oncol . 2017 ; 3 ( 4 ): 524 – 48 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Lok AS , Zoulim F, Locarnini S et al. Antiviral drug-resistant HBV: standardization of nomenclature and assays and recommendations for management . Hepatology . 2007 ; 46 ( 1 ): 254 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Hongthanakorn C , Chotiyaputta W, Oberhelman K et al. Virological breakthrough and resistance in patients with chronic hepatitis B receiving nucleos(t)ide analogues in clinical practice . Hepatology . 2011 ; 53 ( 6 ): 1854 – 63 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Liu Y , Wang C, Zhong Y et al. Genotypic resistance profile of hepatitis B virus (HBV) in a large cohort of nucleos(t)ide analogue-experienced Chinese patients with chronic HBV infection . J Viral Hepat . 2011 ; 18 ( 4 ): e29 – 39 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Liu BM , Li T, Xu J et al. Characterization of potential antiviral resistance mutations in hepatitis B virus reverse transcriptase sequences in treatment-naïve Chinese patients . Antiviral Res . 2010 ; 85 ( 3 ): 512 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Li XG , Liu BM, Xu J et al. Discrepancy of potential antiviral resistance mutation profiles within the HBV reverse transcriptase between nucleos(t)ide analogue-untreated and -treated patients with chronic hepatitis B in a hospital in China . J Med Virol . 2012 ; 84 ( 2 ): 207 – 16 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Yang JX , Liu BM, Li XG et al. Profile of HBV antiviral resistance mutations with distinct evolutionary pathways against nucleoside/nucleotide analogue treatment among Chinese chronic hepatitis B patients . Antivir Ther . 2010 ; 15 ( 8 ): 1171 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Li X , Liu Y, Xin S et al. Comparison of detection rate and mutational pattern of drug-resistant mutations between a large cohort of genotype B and genotype C hepatitis B virus-infected patients in north China . Microb Drug Resist . 2017 ; 23 ( 4 ): 516 – 22 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Zhang X , Chen X, Wei M et al. Potential resistant mutations within HBV reverse transcriptase sequences in nucleos(t)ide analogues-experienced patients with hepatitis B virus infection . Sci Rep . 2019 ; 9 : 8078 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Ciftci S , Keskin F, Cakiris A et al. Analysis of potential antiviral resistance mutation profiles within the HBV reverse transcriptase in untreated chronic hepatitis B patients using an ultra-deep pyrosequencing method . Diagn Microbiol Infect Dis . 2014 ; 79 ( 1 ): 25 – 30 Google Scholar Crossref Search ADS PubMed WorldCat 17 Yamani LN , Yano Y, Utsumi T et al. Profile of mutations in the reverse transcriptase and overlapping surface genes of hepatitis B virus (HBV) in treatment-naïve Indonesian HBV carriers . Jpn J Infect Dis . 2017 ; 70 ( 6 ): 647 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Chinese Society of Infectious Diseases, Chinese Society of Hepatology . [The guidelines of prevention and treatment for chronic hepatitis B (2015 version)] . Zhonghua Gan ZangBing Za Zhi . 2015 ; 23 ( 12 ): 888 – 905 . OpenURL Placeholder Text WorldCat 19 Qian F , Qin J, Li D et al. Monitoring of genotypic resistance profile in chronic hepatitis B patients receiving nucleos(t)ide analogues in Huzhou, China . J Infect Dev Ctries . 2016 ; 10 ( 9 ): 996 – 1002 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Kim JE , Lee SY, Kim H et al. Naturally occurring mutations in the reverse transcriptase region of hepatitis B virus polymerase from treatment-naïve Korean patients infected with genotype C2 . World J Gastroenterol . 2017 ; 23 ( 23 ): 4222 – 32 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Choi YM , Lee SY, Kim BJ. Naturally occurring hepatitis B virus reverse transcriptase mutations related to potential antiviral drug resistance and liver disease progression . World J Gastroenterol . 2018 ; 24 ( 16 ): 1708 – 24 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Mirandola S , Sebastiani G, Rossi C et al. Genotype-specific mutations in the polymerase gene of hepatitis B virus potentially associated with resistance to oral antiviral therapy . Antiviral Res . 2012 ; 96 ( 3 ): 422 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Fan J , Zhang Y, Xiong H et al. Nucleotide analogue-resistant mutations in hepatitis B viral genomes found in hepatitis B patients . J Gen Virol . 2015 ; 96 ( Pt 3 ): 663 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Rezanezhadi M , Mohebbi A, Askari FS et al. Hepatitis B virus reverse transcriptase polymorphisms between treated and treatment-naïve chronically infected patients . Virus Dis . 2019 ; 30 ( 2 ): 219 – 26 . Google Scholar Crossref Search ADS WorldCat 25 Locarnini S . Primary resistance, multidrug resistance, and cross-resistance pathways in HBV as a consequence of treatment failure . Hepatol Int . 2008 ; 2 ( 2 ): 147 – 51 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Zoulim F , Locarnini S. Hepatitis B virus resistance to nucleos(t)ide analogues . Gastroenterology . 2009 ; 137 ( 5 ): 1593 – 608 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Lee HW , Chang HY, Yang SY et al. Viral evolutionary changes during tenofovir treatment in a chronic hepatitis B patient with sequential nucleos(t)ide therapy . J Clin Virol . 2014 ; 60 ( 3 ): 313 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Mokaya J , Maponga TG, McNaughton AL et al. Evidence of tenofovir resistance in chronic hepatitis B virus (HBV) infection: an observational case series of South African adults . J Clin Virol . 2020 ; 129 : 104548 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Ji D , Liu Y, Li L et al. The rtL229 substitutions in the reverse transcriptase region of hepatitis B virus (HBV) polymerase are potentially associated with lamivudine resistance as a compensatory mutation . J Clin Virol . 2012 ; 54 ( 1 ): 66 – 72 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Qin B , Zhou Y, Zhou G et al. Substitutions of rtL228 and/or L229 are involved in the regulation of replication and HBsAg secretion in hepatitis B virus, and do not affect susceptibility to nucleos(t)ide analogs . Mol Med Rep . 2017 ; 16 ( 6 ): 9678 – 84 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Panigrahi R , Biswas A, De BK et al. Characterization of antiviral resistance mutations among the Eastern Indian Hepatitis B virus infected population . Virol J . 2013 ; 10 : 56 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Xiang KH , Zhao CY, Wang S et al. Impacts of HBV rtH55R polymerase substitution on viral replication and rtM204I/V resistance to nucleoside/nucleotide antiviral drugs . Antivir Ther . 2018 ; 23 ( 1 ): 33 – 42 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Park ES , Lee AR, Kim DH et al. Identification of a quadruple mutation that confers tenofovir resistance in chronic hepatitis B patients . J Hepatol . 2019 ; 70 ( 6 ): 1093 – 102 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Hayashi S , Murakami S, Omagari K et al. Characterization of novel entecavir resistance mutations . J Hepatol . 2015 ; 63 ( 3 ): 546 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Liu L , Liu Y, Chen R et al. Prevalence of the entecavir-resistance-inducing mutation rtA186T in a large cohort of Chinese hepatitis B virus patients . Antiviral Res . 2019 ; 164 : 131 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Stuyver LJ , Locarnini SA, Lok A et al. Nomenclature for antiviral-resistant human hepatitis B virus mutations in the polymerase region . Hepatology . 2001 ; 33 ( 3 ): 751 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 37 Warner N , Locarnini S, Kuiper M et al. The L80I substitution in the reverse transcriptase domain of the hepatitis B virus polymerase is associated with lamivudine resistance and enhanced viral replication in vitro . Antimicrob Agents Chemother . 2007 ; 51 ( 7 ): 2285 – 92 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Wasityastuti W , Yano Y, Widasari DI et al. Different variants in reverse transcriptase domain determined by ultra-deep sequencing in treatment-naïve and treated Indonesian patients infected with hepatitis B virus . Kobe J Med Sci . 2016 ; 62 ( 1 ): E1 – 8 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 39 Nishijima N , Marusawa H, Ueda Y et al. Dynamics of hepatitis B virus quasispecies in association with nucleos(t)ide analogue treatment determined by ultra-deep sequencing . PLoS One . 2012 ; 7 ( 4 ): e35052 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Fu Y , Zeng Y, Chen T et al. Characterization and clinical significance of natural variability in hepatitis B virus reverse transcriptase in treatment-naive Chinese patients by Sanger sequencing and next-generation sequencing . J Clin Microbiol . 2019 ; 57 ( 8 ): e00119 – 19 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Characterization of mutations in the reverse transcriptase region of hepatitis B virus in treated and untreated chronic hepatitis B patients
JF - Transactions of The Royal Society of Tropical Medicine and Hygiene
DO - 10.1093/trstmh/traa142
DA - 2020-11-24
UR - https://www.deepdyve.com/lp/oxford-university-press/characterization-of-mutations-in-the-reverse-transcriptase-region-of-9JGWBuidpO
SP - 1
EP - 1
VL - Advance Article
IS - 
DP - DeepDyve
ER -