TY - JOUR
AU1 - Zhang,, Jiani
AU2 - Ding,, Lixin
AU3 - Sun,, Gaofeng
AU4 - Ning,, Huacheng
AU5 - Huang,, Ruixue
AB - Abstract Radiation resistance is the most common challenge for improving radiotherapy. The mechanisms underlying the development of radioresistance remain poorly understood. This study aims to explore the role of LINC00460 in ionizing radiation-induced radioresistance as well as the mechanisms by which LINC00460 is regulated by radiation exposure. The expression of LINC00460 was measured. Cell proliferation and colony formation were measured in HCT116 cells after treatment by radiation. The development of epithelial–mesenchymal transition (EMT) was determined with or without knockdown LINC00460 expression using western blot analysis. Transcription activity was determined using a series of LINC00460-promoter luciferase reporter gene vectors. LINC00460 expression was significantly higher in HCT116 cells, relative to other cell types, with LINC00460 expression significantly affecting HCT116 cell proliferation. Suppression of LINC00460 inhibits EMT development in HCT116 cells via regulation of ZEB1 expression. Furthermore, LINC00460 expression was induced by irradiation via the activation of c-jun transcription factor-binding element located on the LINC00460 promoter. LINC00460 was shown to play a crucial role in EMT-associated progression of colorectal cancer, indicating that LINC00460 may be an indicator or new potential therapeutic target for colorectal cancer radiosensitization. radiation, lncRNA, cancer Introduction Colorectal cancer (CRC) is a leading cause of mortality and morbidity worldwide, accounting for almost 9% of all cancer incidence. With approximately 1.6 million new cases diagnosed annually [1, 2], CRC represents a serious public health concern. Moreover, the global burden of CRC has risen gradually each year [3] and is expected to increase by up to 80% by 2035, accounting for almost 2.4 million cases and 1.3 million deaths worldwide. Possible causes for this increased incidence and morbidity include an aging population, unfavorable dietary habits, and a low frequency of physical exercise [4, 5] as well as geographic variations, with CRC now the predominant form of cancer in many western countries [6]. Treatment for CRC typically consists of surgery as a primary intervention followed by chemoradiotherapy as two-thirds of CRC cases are found in the colon or rectum [7]. Radiotherapy is widely used as a treatment for CRC, with advances in radiotherapy equipment and therapy planning now enabling more direct targeting of tumor tissues, while sparing the adjacent normal tissues [5, 6]. However, despite advances in radiotherapy, cure rates have remained largely stable, with no significant changes in long-term survival, along with persistently high recurrence rates over the past decades. This lack of progress highlights the urgent need for improvements in radiotherapy treatments. From a clinical standpoint, the most common challenge that patients face is the development of resistance to radiotherapy [8, 9], which is also a major obstacle for decreasing recurrence. As a result, it is crucial to elucidate the mechanisms underlying the development of radioresistance in CRC. Regulation of the epithelial–mesenchymal transition (EMT) in epithelial cancer cells has recently been shown to play an important role in promoting tumor migration, invasion, and dissemination [10–12]. A recent study by Xiaohui et al. found that ionizing radiation (IR), a conventional cancer therapy, contributes to radioresistance via the regulation of EMT in nasopharyngeal cancer [13]. Similar findings have also been reported in CRC, with EMT directly implicated in the development of radioresistance [14]. Although activation of EMT is not necessary for the promotion of cancer cell invasion and dissemination, it is closely associated with cancer radioresistance [15]. Better regulation of EMT is therefore required for the treatment and prevention of radioresistance; however, the mechanisms underlying these processes remain poorly understood. Promisingly, long non-coding RNAs (lncRNAs) have emerging as pivotal players, having been directly implicated in a number of biological processes, including the development of EMT in cancer. TUG1 lncRNA has been shown to affect papillary thyroid cancer cell EMT development via the direct targeting of miR-145 [16], whereas lncRNA XLOC_006753 promotes the development of multidrug resistance in gastric cancer cells via the regulation of the mTOR signaling pathway [17]. Furthermore, deficiencies in other lncRNAs, such as HOTAIR, have been shown to reverse EMT progression and improve radioresistance in human cervical cancer HeLa cells [18]. Previous studies by our team identified multiple lncRNAs whose expression changed significantly following IR exposure, including several lncRNAs associated with EMT development [19] based on bioinformatic prediction analyses [11, 20–22]. Here, we hypothesized that lncRNAs contribute to IR-induced radioresistance by promoting the development of EMT processes. First, we observed that lncRNA00460 expression increased in cancer cells after IR exposure. We then established an EMT model to assess cellular responses to IR treatment and identified a variety of EMT-related characteristics. After that, we knocked down lncRNA levels in cancer cells and observed the effects on EMT processes. Finally, we employed a series of luciferase reporter assays to confirm that the lncRNA00460 promoter contains c-jun transcription factor-binding sites, and the activation of c-jun by IR directly contributes to the increased expression of lncRNA00460. Materials and Methods Cell lines, antibodies, and radiation conditions Human colorectal cancer cells (HCT116) were purchased from the American Tissue Culture Collection (ATCC; Manassas, VA, USA) and cultured in RPMI-1640 supplemented with 10% fetal bovine serum and 1% streptomycin–penicillin in a humidified 5% CO2 atmosphere at 37°C according to the ATCC instructions. GAPDH, ZEB1, E-cadherin, N-cadherin, α-SMA, and vimentin antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) or Cell Signaling Technology (Danvers, MA, USA). HCT116 cancer cells were irradiated with 4 Gy of 60Coγ rays at a dose rate of 127.15 cGy/min at room temperature at the Institute of Radiation Medicine, Academy of Military Medical Sciences (Beijing, China). Cell transfection HCT116 cancer cells were passaged the day before transfection. After cells were grown to 60% density, lncRNA00460 small interfering RNA (siRNA) knockdown was conducted via transient transfection with validated lncRNA00460 siRNAs (sense, 5′-CGUUUAACCUUGGAGUCCATT-3′; antisense, 5′-UGGACUCCAAGGUUAAACGTT-3′) using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Scrambled siRNA was used as the negative control. After transfection for 48 h, the cells were collected for further experiments. Western blot analysis Western blot analysis was used to assess protein expression, as described previously [19, 23, 24]. Briefly, either control or case-group cells were treated with lysis buffer, resolved via sodium dodecyl sulfate–polyacrylamide gel electrophoresis, and transferred to polyvinylidene fluoride membranes. The membranes were blocked for 1 h with 5% non-fat milk (Bio-Rad, Hercules, CA, USA) in tris-buffered saline with 0.1% Tween 20 at room temperature. The membranes were subsequently washed and incubated for 1 h with secondary antibodies at room temperature. Signals were then visualized via the addition of chemiluminescent substrates. GAPDH was probed to ensure equal protein loading. β-Actin was used as internal control. The protein bands were visualized by using the enhanced chemiluminescence system (GE Healthcare, Chicago, IN, USA). Cell proliferation and colony formation analysis For the cell proliferation analysis, cells were collected at passage 3–4 and inoculated in 6-well plates at a density of 4 × 106 cells/well. The effects of lncRNA00460 on cell viability were detected using a standard cell counting kit-8 (CCK-8) according to the manufacturer’s instructions. The optical density (OD) of the cells in each group was tested by measuring absorbance at 450 nm using a microplate reader [23]. For colony formation analysis, plates were divided into four groups: 0 Gy LINC00460 siRNA-NC, 0 Gy LINC00460 siRNA, 2 Gy LINC00460 siRNA-NC, and 2 Gy LINC00460 siRNA. After 24 h of transfection, the cells were treated with either 0 or 2 Gy radiation. Survival rate (%) was calculated as follows: (colon formation ratio in the irradiated group/colon formation ratio in the non-irradiated group) × 100%, where colon formation ratio indicates (colon numbers/cell inoculation numbers) × 100%. All experiments were repeated at least three times. Quantitative reverse transcription-polymerase chain reaction HCT116 cells were harvested at the indicated time points after transfection with LINC00460 siRNA or lncRNA00460-NC. Total RNA was extracted using TRIzol reagent, after which 1 μg total RNA was reverse transcribed into cDNA using ReverTra Ace (Toyobo, Osaka, Japan). LINC00460 expression was detected via quantitative reverse transcription-polymerase chain reaction using a Bio-Rad iCycler and iQ Real-Time PCR system (Bio-Rad, Hercules, CA, USA). GAPDH was used as an endogenous control. The sequences of the forward and reverse primers for LINC00460 were as follows: forward, TTGTGGCATTGTTGTAGAAAGACTGA; reverse, GCATACGAATTTGGGTGGG. Construction of LINC00460-promoter luciferase reporter gene vectors and analysis of transcription activity The LINC00460-promoter sequence was determined based on a previous report [24]. Various regions of the LINC00460 promoter that were cloned into a pGL3 basic vector (Promega, Madison, WI, USA) expressing the firefly luciferase reporter gene were constructed as described previously [25, 26]. Briefly, the first 2576 and last 55 bp of the human LINC00460 transcription initiation sites were amplified via PCR using genomic DNA from normal human whole blood as a template. PCR-amplified products were then digested using Kpn I and Hind III restriction enzymes and cloned into pGL3 basic vector plasmids, resulting in the pGL3-LINC00460-2576 recombinant plasmid. To identify the specific region regulating LINC00460 expression, we designed a series of PCR primers to amplify seven promoter-deletion fragments using the pGL3-LINC00460-2576 plasmid as template. Promoter-deletion fragments were then double-digested using Kpn I and Hind III, as before, and cloned into the pGL3 basic vector, yielding a series of deletion plasmids (Table 1). Promoter activity was assessed using a dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions. Luciferase activity was measured using a GloMax luminometer (Promega) and normalized according to the levels of Renilla luciferase activity. Table 1 Primers used to proliferation of LINC00460 promoter fragments Primer . 5′ to 3′ primer sequences . Target fragments/bp . LINC00460_2576_F ACGGTACCTACCCACTAACCACTGTCC 2631 LINC00460_1455_F ACGGTACCTGCCAGGACGCTATGTG 1510 LINC00460_819_F AGGGTACCTGGGATTCCAAGCGTGAG 874 LINC00460_548_F CTGGTACCATCCACCCACCTCCGTCTC 603 LINC00460_352_F AGGGTACCGCCTAAGCAGCACATCA 407 LINC00460_240_F ACGGTACCTGGGACTGAGGAAACACG 295 LINC00460_145_F ACGGTACCTCCACTTGTTCCTAACCCACT 200 LINC00460_44_F AAGGTACCAGCCCTGTTAGAAATGC 99 LINC00460_55_R CTTAAGCTTGGCACTTCCGTCACCTCA Primer . 5′ to 3′ primer sequences . Target fragments/bp . LINC00460_2576_F ACGGTACCTACCCACTAACCACTGTCC 2631 LINC00460_1455_F ACGGTACCTGCCAGGACGCTATGTG 1510 LINC00460_819_F AGGGTACCTGGGATTCCAAGCGTGAG 874 LINC00460_548_F CTGGTACCATCCACCCACCTCCGTCTC 603 LINC00460_352_F AGGGTACCGCCTAAGCAGCACATCA 407 LINC00460_240_F ACGGTACCTGGGACTGAGGAAACACG 295 LINC00460_145_F ACGGTACCTCCACTTGTTCCTAACCCACT 200 LINC00460_44_F AAGGTACCAGCCCTGTTAGAAATGC 99 LINC00460_55_R CTTAAGCTTGGCACTTCCGTCACCTCA Open in new tab Table 1 Primers used to proliferation of LINC00460 promoter fragments Primer . 5′ to 3′ primer sequences . Target fragments/bp . LINC00460_2576_F ACGGTACCTACCCACTAACCACTGTCC 2631 LINC00460_1455_F ACGGTACCTGCCAGGACGCTATGTG 1510 LINC00460_819_F AGGGTACCTGGGATTCCAAGCGTGAG 874 LINC00460_548_F CTGGTACCATCCACCCACCTCCGTCTC 603 LINC00460_352_F AGGGTACCGCCTAAGCAGCACATCA 407 LINC00460_240_F ACGGTACCTGGGACTGAGGAAACACG 295 LINC00460_145_F ACGGTACCTCCACTTGTTCCTAACCCACT 200 LINC00460_44_F AAGGTACCAGCCCTGTTAGAAATGC 99 LINC00460_55_R CTTAAGCTTGGCACTTCCGTCACCTCA Primer . 5′ to 3′ primer sequences . Target fragments/bp . LINC00460_2576_F ACGGTACCTACCCACTAACCACTGTCC 2631 LINC00460_1455_F ACGGTACCTGCCAGGACGCTATGTG 1510 LINC00460_819_F AGGGTACCTGGGATTCCAAGCGTGAG 874 LINC00460_548_F CTGGTACCATCCACCCACCTCCGTCTC 603 LINC00460_352_F AGGGTACCGCCTAAGCAGCACATCA 407 LINC00460_240_F ACGGTACCTGGGACTGAGGAAACACG 295 LINC00460_145_F ACGGTACCTCCACTTGTTCCTAACCCACT 200 LINC00460_44_F AAGGTACCAGCCCTGTTAGAAATGC 99 LINC00460_55_R CTTAAGCTTGGCACTTCCGTCACCTCA Open in new tab Statistical analyses Statistical analyses were performed using Statistical Product and Service Solutions (SPSS) software (ver. 19.0; IBM Corp., Armonk, NY, USA). Quantitative data were expressed as the means ± standard deviations. One-way analysis of variance followed by least significant difference post hoc tests and t-tests were used for the comparison of means. We considered P values <0.05 to be statistically significant. Results LINC00460 significantly affects HCT116 cancer cell proliferation LINC00460 expression was detected in three cell lines including NCM460, HCT116, and HT29 (Fig. 1A). When combined with previous studies examining expression in other cell lines, including HcoEpic, SW620, Ht-29, and lovo, HCT116 cancer cells exhibited the highest expression of LINC00460 [2, 27]. This cell line was therefore chosen as a model for further investigation. Figure 1 Open in new tabDownload slide LINC00460 expression is upregulated in HCT116 cells and linked with cell proliferation. (A) Expression of LINC00460 in various colorectal cancer cell lines relative to a normal human colon epithelial cell line (NCM460) using quantitative reverse transcription-polymerase chain reaction (qRT-PCR). (B). Relative expression of LINC00460 following exposure to 2 or 4 Gy of radiation in HCT116 cells at the indicated time points analyzed using qRT-PCR. Cell viability (OD at 450 nm) was significantly increased in LINC00460 knockdown cells following (C) 2 Gy and (D) 4 Gy of radiation exposure, relative to non-irradiated controls at the indicated time points using a cell counting kit-8 assay. (E) Representative pictures from an HCT116 cell proliferation assay following 2 Gy of irradiation with or without LINC00460 knockdown. (F) The colony-forming ratio (%) of colon cancer cells was calculated based on cell counts. All data are presented as the means ± standard deviations (SDs; n = 3). *P < 0.05; **P < 0.01. Figure 1 Open in new tabDownload slide LINC00460 expression is upregulated in HCT116 cells and linked with cell proliferation. (A) Expression of LINC00460 in various colorectal cancer cell lines relative to a normal human colon epithelial cell line (NCM460) using quantitative reverse transcription-polymerase chain reaction (qRT-PCR). (B). Relative expression of LINC00460 following exposure to 2 or 4 Gy of radiation in HCT116 cells at the indicated time points analyzed using qRT-PCR. Cell viability (OD at 450 nm) was significantly increased in LINC00460 knockdown cells following (C) 2 Gy and (D) 4 Gy of radiation exposure, relative to non-irradiated controls at the indicated time points using a cell counting kit-8 assay. (E) Representative pictures from an HCT116 cell proliferation assay following 2 Gy of irradiation with or without LINC00460 knockdown. (F) The colony-forming ratio (%) of colon cancer cells was calculated based on cell counts. All data are presented as the means ± standard deviations (SDs; n = 3). *P < 0.05; **P < 0.01. Significant increases in LINC00460 expression were observed after 2 or 4 Gy of irradiation at indicated time points (Fig. 1B). Transient knockdown of LINC00460 significantly decreased proliferation in HCT116 cancer cells following both 2 and 4 Gy of irradiation, relative to untreated controls (Fig. 1C and D). LINC00460 knockdown was also shown to significantly inhibit the colony-forming ability of cancer cells (Fig. 1E and F). LINC00460 knockdown inhibits EMT development Next, we established an EMT model to investigate the role of LINC00460 in EMT development. EMT was detected at 48, 72, and 96 h after 4 Gy of irradiation, as evidenced by significant decreases in epithelial biomarker E-cadherin protein expression, along with increases in mesenchymal N-cadherin and vimentin (Fig. 2A). These effects were significantly attenuated following siRNA knockdown of LINC00460 (Fig. 2A–E). Figure 2 Open in new tabDownload slide LINC00460 contributes to EMT development in HCT116 cells in response to IR. (A) Western blot analysis of EMT-related biomarkers (E-cadherin, N-cadherin, vimentin, and α-SMA) in HCT116 cells with or without LINC00460 knockdown at the indicated time points following 4 Gy of irradiation; GAPDH served as the internal control. Quantitative measurement of the relative expression of (B) E-cadherin, (C) N-cadherin, (D) vimentin, and (E) α-SMA with or without knockdown of LINC00460 expression at the indicated time points following 4 Gy of irradiation. Data are presented as the means ± SDs (n = 3); *P < 0.05 between different groups. Figure 2 Open in new tabDownload slide LINC00460 contributes to EMT development in HCT116 cells in response to IR. (A) Western blot analysis of EMT-related biomarkers (E-cadherin, N-cadherin, vimentin, and α-SMA) in HCT116 cells with or without LINC00460 knockdown at the indicated time points following 4 Gy of irradiation; GAPDH served as the internal control. Quantitative measurement of the relative expression of (B) E-cadherin, (C) N-cadherin, (D) vimentin, and (E) α-SMA with or without knockdown of LINC00460 expression at the indicated time points following 4 Gy of irradiation. Data are presented as the means ± SDs (n = 3); *P < 0.05 between different groups. Effects of LINC00460 on EMT via regulation of ZEB1 expression ZEB1, a potent transcriptional repressor of E-cadherin, plays an essential role in EMT development. To further explore whether ZEB1 expression was affected by LINC00460 deficiency, we examined ZEB1 expression before and after LINC00460 knockdown. Significant decreases in ZEB1 protein expression were observed in HCT116 cells following knockdown of LINC00460, relative to normal cells, following 4 Gy of irradiation (Fig. 3A and B). Figure 3 Open in new tabDownload slide LINC00460 contributes to the activation of ZEB1 in HCT116 cells in response to IR. (A) Western blot analysis of ZEB1 in HCT116 cells with or without LINC00460 knockdown at the indicated time points following 4 Gy of irradiation; GAPDH served as the internal control. (B) Relative expression of ZEB1 in HCT116 cells with or without LINC00460 knockdown at the indicated time points following 4 Gy of irradiation. All data are presented as the means ± SDs (n = 3). *P < 0.05; **P < 0.01 Figure 3 Open in new tabDownload slide LINC00460 contributes to the activation of ZEB1 in HCT116 cells in response to IR. (A) Western blot analysis of ZEB1 in HCT116 cells with or without LINC00460 knockdown at the indicated time points following 4 Gy of irradiation; GAPDH served as the internal control. (B) Relative expression of ZEB1 in HCT116 cells with or without LINC00460 knockdown at the indicated time points following 4 Gy of irradiation. All data are presented as the means ± SDs (n = 3). *P < 0.05; **P < 0.01 Irradiation induces LINC00460 expression via the activation of c-jun transcription factor-binding sites located on the LINC00460 promoter To identify the mechanisms underlying LINC00460 expression in response to irradiation, we constructed a series of luciferase reporter gene vectors driven by the LINC00460 promoter. The first 2576 bp and last 55 bp of the human LINC00460 transcription initiation sites were amplified via PCR using genomic DNA from normal human whole blood as a template (Supplementary Fig. S1A). PCR amplified products were then digested using Kpn I and Hind III restriction enzymes and cloned into pGL3 basic vector plasmids, which were verified by sequencing analysis, resulting in the pGL3-LINC00460-2576 recombinant plasmid (Supplementary Fig. S1B). To identify the specific region regulating LINC00460 expression, we designed a series of PCR primers to amplify seven promoter-truncated fragments using the pGL3-LINC00460-2576 plasmid as a template (Supplementary Fig. S1C). These truncated promoter fragments were then double-digested using Kpn I and Hind III, as before, and cloned into the pGL3 basic vector, yielding a series of -LINC00460-truncated promoters’ plasmids (Supplementary Fig. S1D). Using this approach plus sequencing verification, seven constructs expressing the luciferase reporter driven by the different truncated promoters of LINC00460 were generated—i.e. −2576/+66-, −1455/+66-, −819/+66-, −548/+66-, −352/+66-, −240/+66-, −145/+66-, and −44/+66-bp (Fig. 4A). Promoter activities were deduced based on luciferase activity assay in transiently transfected HCT116 cancer cells. Transcription activity was examined for all seven constructs based on the measurement of luciferase activity. The majority of the deletion constructs (−352/+66-, −240/+66-, −819/+66-, −145/+66-, and −44/+66-bp) exhibited a modest-to-severe decline in luciferase activity, relative to the full-length construct, especially two deleted regions of −240 to −145 and −145 to −44 (Fig. 4B). These results indicate that the essential region regulating LINC00460 transcription in response to irradiation is located −240 to −44 bp upstream of LINC0460 transcription initiating site. Figure 4 Open in new tabDownload slide The essential region, which regulates LINC00460 transcription in response to irradiation, is located −145 and −44 bp upstream of LINC00460. (A) A schematic representation of the full-length LINC00460 promoter and pGL3-basic, inserted upstream of the luciferase reporter plasmid. The indicated plasmids were transfected into HCT116 cells. Luciferase assays were performed according to the manufacturer’s instructions. The percentage of luciferase activity elicited by a particular deletion construct is presented relative to the activity of the full-length LINC00460 promoter-luciferase construct. Each bar represents the mean and SD of at least three independent experiments. Deletion of −2576/+66-bp caused a moderate enhancement of luciferase activity, whereas deletions of −352/+66-, −240/+66-, −819/+66-, −145/+66-, and −44/+66-bp caused modest-to-severe decreases in luciferase activity. (B) Mutations at the −145/−44-bp region of the LINC00460 promoter. (C) Luciferase expression is depicted as percent intensity, relative to the expression of the −145/−44-bp construct. All data are presented as the means ± SDs (n = 3). *P < 0.05 Figure 4 Open in new tabDownload slide The essential region, which regulates LINC00460 transcription in response to irradiation, is located −145 and −44 bp upstream of LINC00460. (A) A schematic representation of the full-length LINC00460 promoter and pGL3-basic, inserted upstream of the luciferase reporter plasmid. The indicated plasmids were transfected into HCT116 cells. Luciferase assays were performed according to the manufacturer’s instructions. The percentage of luciferase activity elicited by a particular deletion construct is presented relative to the activity of the full-length LINC00460 promoter-luciferase construct. Each bar represents the mean and SD of at least three independent experiments. Deletion of −2576/+66-bp caused a moderate enhancement of luciferase activity, whereas deletions of −352/+66-, −240/+66-, −819/+66-, −145/+66-, and −44/+66-bp caused modest-to-severe decreases in luciferase activity. (B) Mutations at the −145/−44-bp region of the LINC00460 promoter. (C) Luciferase expression is depicted as percent intensity, relative to the expression of the −145/−44-bp construct. All data are presented as the means ± SDs (n = 3). *P < 0.05 To further investigate the potential transcription factors that may regulate LINC00460 expression post-irradiation, we used two online databases, JASPAR (http://jaspar.genereg.net/) and PROMO (http://alggen.lsi.upc.es/), to predict potential transcription factor-binding sites. Among the various transcription factor-binding sites identified, c-jun was chosen as a candidate for further analysis. To verify its effect on LINC00460 transcription activity, we mutated the c-jun binding site from TGACTCA to GCCTTCA in the reporter vector of the truncated promoter −145/+66. Significant decreases in luciferase activity were observed in the c-jun binding site mutants, relative to controls (Fig. 4C), indicating that c-jun is a positive regulator of LINC00460 expression. To determine the effects of c-jun expression on LINC00460 transcription, we transfected the HCT116 cancer cells with the c-jun-expressing vector pcDNA3.1 (+)*FLAG-jun, incubated for 24 h, and then transfected with reporters -145_WT, or -145_Mut/c-jun, or -44_WT (Fig. 5A). Cells were subsequently incubated for an additional 24 h, after which luciferase activity was measured. Significantly increased luciferase activity by pcDNA3.1 (+)*FLAG-jun was detected in the cells transfected with the reporter vector -145WT. However, transfection of c-jun-expressing vectors could not increase the activity of both −145-mut/c-jun and −44-wt driving luciferase expression, relative to controls (Fig. 5A). Finally, we have detected the effect of irradiation on the activity of these reporter vectors. The results indicated that irradiation increased the activity of the reporters −548/+66, −352/+66-, −240/+66, −145/+66-, except −44/+66-bp (Fig. 5B). However, mutation of c-jun binding element abrogated the activation of irradiation on −145/+66- promoter (Fig. 5C). These observations suggest that c-jun is a critical regulator of LINC00460 expression post-irradiation (Fig. 5D). Figure 5 Open in new tabDownload slide C-jun is a crucial regulator of LINC00460 transcription post-radiation. (A) HCT116 cells were transfected with −145-wt, −145-mut/c-jun, and −44-wt plasmid constructs; (B) −548, −352, −240, −145, and −44 constructs with or without irradiation or (C) −145-wt and −145-mut/c-jun constructs with or without irradiation. Cells were incubated for 24 h, after which luciferase activity was detected. All data are presented as the means ± SDs (n = 3). *P < 0.05. (D) Schematic diagram of the regulation of LINC00460 in colorectal cancer cells Figure 5 Open in new tabDownload slide C-jun is a crucial regulator of LINC00460 transcription post-radiation. (A) HCT116 cells were transfected with −145-wt, −145-mut/c-jun, and −44-wt plasmid constructs; (B) −548, −352, −240, −145, and −44 constructs with or without irradiation or (C) −145-wt and −145-mut/c-jun constructs with or without irradiation. Cells were incubated for 24 h, after which luciferase activity was detected. All data are presented as the means ± SDs (n = 3). *P < 0.05. (D) Schematic diagram of the regulation of LINC00460 in colorectal cancer cells Discussion Radiotherapy plays a major role in the management of CRC. Although acquired resistance to ionizing radiation is common, the mechanisms underlying this resistance remain poorly understood [28]. Moreover, radioresistance is extremely unpredictable, rendering therapy significantly less effective, and increasing the likelihood of metastasis and tumor recurrence. A better understanding of the mechanisms underlying radioresistance is therefore necessary to improve treatment outcomes for patients. In this study, we found that LINC00460 expression was significantly higher in HCT116 cells relative to other cancers. LINC00460 was shown to significantly affect HCT116 cancer cell proliferation and migration. Subsequent knockdown of LINC00460 was shown to inhibit EMT development in HCT116 cells via regulation of ZEB1 expression. More importantly, c-jun transcription factor-binding sites found in the LINC0460 promoter were identified as key regulators of LINC00460 expression in response to radiation. Our results suggest that LINC00460 could serve as a state-of-the art candidate for improving IR-induced radioresistance in colorectal cancers. In recent years, lncRNAs have gained significant attention as potential regulators of radiotherapy resistance in cancer [11, 29, 30]. LINC00460 is among the most widely studied lncRNAs, due in part to its strong association with radioresistance in cancers. First discovered by Liang et al. [31] in 2017 using microarrays, LINC00460 was identified as a novel long coding RNA in esophageal squamous cancer cells. Overexpression of LINC00460 was positively correlated with metastasis of esophageal squamous cancer cells and a predictor of poor prognosis. Based on these findings, LINC00460 was subsequently identified in several other cancers, including lung cancer, nasopharyngeal cancer, and meningioma progression and metastasis [24, 32, 33]. Investigations into the role of LINC00460 in CRC identified strong associations with both proliferation and metastasis, with LINC00460 serving as a sponge for various miRNAs, as well as a key regulator of various transcription factors, such as Krüppel-like factor 2 [2, 34]. However, a subsequent study by Wang et al. found that upregulation of LINC00460 in CRC cells and tissues could exert the opposite effect, resulting in the suppression of CRC proliferation [27]. Possible reasons for this discrepancy include the use of the SW620 cell line, with cell proliferation determined via an MTT assay. Our study is consistent with previous studies suggesting that LINC00460 serves as an oncogenic lncRNA in CRC development and may be an important molecular target for therapeutic intervention. However, further studies examining additional parameters in a more diverse set of CRC cell lines will be necessary to fully elucidate the role of LINC00460 in CRC. Next, we explored other potential functions of LINC00460, such as the promotion of EMT and radioresistance. EMT has previously been identified as a contributor to cancer progression and metastasis, as well as a primary driver of therapeutic resistance to anticancer agents and radiotherapy [35]. E-cadherin, N-cadherin, vimentin, and α-SMA are all commonly used biomarkers of EMT. Progression of EMT is characterized by significant decreases in epithelial biomarker E-cadherin protein expression, along with increases in mesenchymal N-cadherin, vimentin, and α-SMA [36]. Furthermore, the transcription factor ZEB1 has been shown to promote cancer cell proliferation and metastasis by inducing EMT [10]. Direct links between LINC0460 and EMT have been reported in non-small cell lung cancer, with LINC00460 expression shown to promote invasion and migration of cancer cells, along with alterations in EMT-related biomarkers [37, 38]. Similarly, Xing et al. revealed that LINC00460 promoted meningioma progression and metastasis and increased ZEB1 expression in two malignant meningioma cancer cell lines (IOMM_Lee and CH157-MN) [32]. A recent study by Ma et al. indicated that LINC00460 plays a pivotal role in gefitinib resistance of non-small cell lung cancer via the sponging of miR-769-5p [39]. ZEB1 has been reported to be association with radiation resistance. Zhong et al. indicated that increasing ZEB1 promoted nasopharyngeal carcinoma radiation resistance [40]. LINC00460 is a newly discovered lncRNA. Links between LINC00460 expression, EMT development, and radioresistance have been reported, although the role of LINC00460 in CRC remains poorly understood. Our data show that LINC00460 promotes CRC proliferation via the regulation of EMT. More importantly, we found that LINC00460 is involved in the regulation of IR-induced radioresistance, as evidenced by significant increases in LINC00460 expression in IR-induced CRC cells relative to parental cells. Furthermore, functional experiments indicated that the alterations in LINC00460 expression were directly associated with EMT development. As IR-induced resistance is a serious limitation to radiotherapy in CRC patients, these findings suggest that LINC00460 may serve as a potential molecular target for radiotherapy intervention in CRC patients. The mechanisms by which lncRNAs are regulated by irradiation in cancer cells remain poorly understood. Microarray-based investigations examining changes in gene expression following low-dose ionizing radiation predicted that a variety of transcription factors, including NF-κB, may be involved in the overexpression of lncRNA post-irradiation [41]. In a similar study, Zhang et al. showed that the expression of the lncRNA GAS5 was upregulated in response to irradiation via the activation of IRF1 transcription factor-binding sites located in its promoter region (−2000 bp) [42]. Current research into the association between lncRNA regulation and irradiation exposure focuses primarily on the downstream signaling pathways of lncRNAs rather than the mechanisms by which lncRNAs are regulated by irradiation [43, 44]. As emerging data have shown, many lncRNAs are widely expressed, with precise methods of regulation. A greater understanding of the mechanism regulating expression of these genes post-irradiation may provide important insights into their role in radioresistance, with significant implications for patients. As Schmitt et al. pointed out in their study, an inducible lncRNA can create a feedback loop with its cognate transcription factors leading to an amplification of cellular signaling networks [45]. C-jun is a member of the AP-1 transcription factor family, which is known to play a critical role in cancer progression and development [46]. For example, the expression of the lncRNA RAIN was shown to be regulated by RUNX2 with the cooperation of a non-redundant enhancer under the control of c-jun [47]. Our study suggests that c-jun binding sites located in the LINC00460 promoter were activated by irradiation, resulting in the upregulation of LINC00460 in HCT116 cells. Our data may serve as a foundation for further studies of the underlying mechanisms of radiation-induced regulation of LINC00460 expression. A few limitations in this study should be mentioned. First, only one CRC cell line was used in this study. This may influence the interpretation of our results. Further studies will be performed on additional CRC lines. Second, although our data indicated that LINC00460 deficiency should decrease the activation of ZEB1, a key transcription factor in EMT development in cancer cells, additional experiments examining the molecular mechanisms by which ZEB1 is regulated by LINC00460 were not performed. Further investigations will be necessary to fully elucidate the mechanism underlying this interaction. However, despite these limitations, our study demonstrated a clear effect of LINC00460 on radiation-induced resistance, with c-jun transcription factor-binding sites identified as a key factor driving upregulation of LINC00460 post-irradiation. Conclusions In conclusion, our study demonstrated that LINC00460 was upregulated in response to radiation exposure in HCT116 cells, resulting in increased EMT development via the activation of ZEB1 expression, which consequently contributes to HCT116 cell proliferation. In addition, radiation-induced upregulation of LINC00460 was shown to be driven by c-jun transcription factor-binding sites located in the LINC00460 promoter. Our study indicates that LINC00460 may be a potential target for improving radiation-induced resistance for CRC radiotherapy. Availability of data and supporting materials section Data sharing not applicable to this article as no datasets were generated or analysed during the current study. Author Contributions R.H. conceived and designed the study. G.S., J.Z., and H.N. performed cell experiments. L.D. analyzed the data and performed the statistical analysis. R.H. drafted the initial manuscript and critically reviewed and revised the manuscript. Conflict of interest statement The authors declare that they have no competing interests. Funding This study was supported by the National Natural Science Foundation of China (Grant No. U1803124) and the Natural Science Foundation of Hunan Province (Grant No. 2019JJ40396). References 1. Favoriti P , Carbone G, Greco M, et al. Worldwide burden of colorectal cancer: a review . Updates Surg 2016 ; 68 : 7 – 11 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Lian Y , Yan C, Xu H, et al. A novel lncRNA, LINC00460, affects cell proliferation and apoptosis by regulating KLF2 and CUL4A expression in colorectal cancer . Mol Ther Nucleic Acids 2018 ; 12 : 684 – 97 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Douaiher J , Ravipati A, Grams B, et al. Colorectal cancer-global burden, trends, and geographical variations . J Surg Oncol 2017 ; 115 : 619 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Zhang S , Wang Q, Zhou C, et al. Colorectal cancer, radiotherapy and gut microbiota . Chinese J Cancer Res 2019 ; 31 : 212 – 22 . Google Scholar Crossref Search ADS WorldCat 5. Tahover E , Bar-Shalom R, Sapir E, et al. Chemo-radiotherapy of oligometastases of colorectal cancer with pegylated liposomal mitomycin-C prodrug (promitil): mechanistic basis and preliminary clinical experience . Front Oncol 2018 ; 8 : 544 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Petrelli F , Comito T, Barni S, et al. Stereotactic body radiotherapy for colorectal cancer liver metastases: a systematic review . Radiother Oncol: J Eur Soc Ther Radiol Oncol 2018 ; 129 : 427 – 34 . Google Scholar Crossref Search ADS WorldCat 7. Tam SY , Wu VWC. A review on the special radiotherapy techniques of colorectal cancer . Front Oncol 2019 ; 9 : 208 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Wu QB , Sheng X, Zhang N, et al. Role of microRNAs in the resistance of colorectal cancer to chemoradiotherapy . Mol Clin Oncol 2018 ; 8 : 528 – 32 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 9. Zhou PK , Huang RX. Targeting of the respiratory chain by toxicants: beyond the toxicities to mitochondrial morphology . Toxicol Res 2018 ; 7 : 1008 – 11 . Google Scholar Crossref Search ADS WorldCat 10. Zhang P , Sun Y, Ma L. ZEB1: at the crossroads of epithelial-mesenchymal transition, metastasis and therapy resistance . Cell Cycle 2015 ; 14 : 481 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Liu XD , Xie DF, Wang YL, et al. Integrated analysis of lncRNA-mRNA co-expression networks in the alpha-particle induced carcinogenesis of human branchial epithelial cells . Int J Radiat Biol 2019 ; 95 : 144 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Huang R , Yu T, Li Y, et al. Upregulated has-miR-4516 as a potential biomarker for early diagnosis of dust-induced pulmonary fibrosis in patients with pneumoconiosis . Toxicol Res 2018 ; 7 : 415 – 22 . Google Scholar Crossref Search ADS WorldCat 13. Yu X , Liu Y, Yin L, et al. Radiation-promoted CDC6 protein stability contributes to radioresistance by regulating senescence and epithelial to mesenchymal transition . Oncogene 2019 ; 38 : 549 – 63 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Shao M , Bi T, Ding W, et al. OCT4 potentiates radio-resistance and migration activity of rectal cancer cells by improving epithelial-mesenchymal transition in a ZEB1 dependent manner . Biomed Res Int 2018 ; 2018 : 3424956 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 15. Lee SY , Jeong EK, Ju MK, et al. Induction of metastasis, cancer stem cell phenotype, and oncogenic metabolism in cancer cells by ionizing radiation . Mol Cancer 2017 ; 16 : 10 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Lei H , Gao Y, Xu X. LncRNA TUG1 influences papillary thyroid cancer cell proliferation, migration and EMT formation through targeting miR-145 . Acta Biochim Biophys Sin 2017 ; 49 : 588 – 97 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Zeng L , Liao Q, Zou Z, et al. Long non-coding RNA XLOC_006753 promotes the development of multidrug resistance in gastric cancer cells through the PI3K/AKT/mTOR signaling pathway . Cell Physiol Biochem 2018 ; 51 : 1221 – 36 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Guo X , Xiao H, Guo S, et al. Long noncoding RNA HOTAIR knockdown inhibits autophagy and epithelial-mesenchymal transition through the Wnt signaling pathway in radioresistant human cervical cancer HeLa cells . J Cell Physiol 2019 ; 234 : 3478 – 89 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Liu Z , Liang X, Li X, et al. MiRNA-21 functions in ionizing radiation-induced epithelium-to-mesenchymal transition (EMT) by downregulating PTEN . Toxicol Res 2019 ; 8 : 328 – 40 . Google Scholar Crossref Search ADS WorldCat 20. Nie YH , Liu XD, Huang R, et al. Analysis of mRNA expression patterns in peripheral blood cells of 3 patients with cancer after the first fraction of 2 Gy irradiation: an integrated case report and systematic review . Dose-Response: A Publ Int Hormesis Soc 2019 ; 17 . doi: 10.1177/1559325819833474 . OpenURL Placeholder Text WorldCat Crossref 21. Huang R , Zhou P. Double-edged effects of noncoding RNAs in responses to environmental genotoxic insults: perspectives with regards to molecule-ecology network . Environ Pollut 2019 ; 247 : 64 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Qin J , Ning H, Zhou Y, et al. LncRNA MIR31HG overexpression serves as poor prognostic biomarker and promotes cells proliferation in lung adenocarcinoma . Biomed Pharmacother 2018 ; 99 : 363 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Yin R , Chen X. Regulatory effect of miR-144-3p on the function of human trabecular meshwork cells and fibronectin-1 . Exp Ther Med 2019 ; 18 : 647 – 53 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 24. Li K , Sun D, Gou Q, et al. Long non-coding RNA linc00460 promotes epithelial-mesenchymal transition and cell migration in lung cancer cells . Cancer Lett 2018 ; 420 : 80 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Mo LJ , Song M, Huang QH, et al. Exosome-packaged miR-1246 contributes to bystander DNA damage by targeting LIG4 . Br J Cancer 2018 ; 119 : 492 – 502 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Li B , Shang ZF, Yin JJ, et al. PIG3 functions in DNA damage response through regulating DNA-PKcs homeostasis . Int J Biol Sci 2013 ; 9 : 425 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Wang X , Mo FM, Bo H, et al. Upregulated expression of long non-coding RNA, LINC00460, suppresses proliferation of colorectal cancer . J Cancer 2018 ; 9 : 2834 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Chaiswing L , Weiss HL, Jayswal RD, et al. Profiles of radioresistance mechanisms in prostate cancer . Crit Rev Oncog 2018 ; 23 : 39 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Han PB , Ji XJ, Zhang M, et al. Upregulation of lncRNA LINC00473 promotes radioresistance of HNSCC cells through activating Wnt/beta-catenin signaling pathway . Eur Rev Med Pharmacol Sci 2018 ; 22 : 7305 – 13 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 30. Qin J , Ning H, Zhou Y, et al. LncRNA Uc.173 is a key molecule for the regulation of lead-induced renal tubular epithelial cell apoptosis . Biomed Pharmacother 2018 ; 100 : 101 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Liang Y , Wu Y, Chen X, et al. A novel long noncoding RNA linc00460 up-regulated by CBP/P300 promotes carcinogenesis in esophageal squamous cell carcinoma . Biosci Rep 2017 ; 37 . OpenURL Placeholder Text WorldCat 32. Xing H , Wang S, Li Q, et al. Long noncoding RNA LINC00460 targets miR-539/MMP-9 to promote meningioma progression and metastasis . Biomed Pharmacother 2018 ; 105 : 677 – 82 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Kong YG , Cui M, Chen SM, et al. LncRNA-LINC00460 facilitates nasopharyngeal carcinoma tumorigenesis through sponging miR-149-5p to up-regulate IL6 . Gene 2018 ; 639 : 77 – 84 . Google Scholar Crossref Search ADS PubMed WorldCat 34. Zhang Y , Liu X, Li Q, et al. lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging . Cancer Manage Res 2019 ; 11 : 1779 – 89 . Google Scholar Crossref Search ADS WorldCat 35. Stark TW , Hensley PJ, Spear A, et al. Predictive value of epithelial-mesenchymal-transition (EMT) signature and PARP-1 in prostate cancer radioresistance . Prostate 2017 ; 77 : 1583 – 91 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Zhou Y , He L, Liu XD, et al. Integrated analysis of lncRNA and mRNA transcriptomes reveals new regulators of ubiquitination and the immune response in silica-induced pulmonary fibrosis . Biomed Res Int 2019 ; 2019 : 6305065 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 37. Li C , McLinden C, Fioletov V, et al. Author correction: India is overtaking China as the world's largest emitter of anthropogenic sulfur dioxide . Sci Rep 2018 ; 8 : 8892 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Yue QY , Zhang Y. Effects of Linc00460 on cell migration and invasion through regulating epithelial-mesenchymal transition (EMT) in non-small cell lung cancer . Eur Rev Med Pharmacol Sci 2018 ; 22 : 1003 – 10 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 39. Ma G , Zhu J, Liu F, et al. Long noncoding RNA LINC00460 promotes the Gefitinib resistance of nonsmall cell lung cancer through epidermal growth factor receptor by sponging miR-769-5p . DNA Cell Biol 2019 ; 38 : 176 – 83 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Zhong Q , Chen Y, Chen Z. LncRNA MINCR regulates irradiation resistance in nasopharyngeal carcinoma cells via the microRNA-223/ZEB1 axis . Cell Cycle 2020 ; 19 : 53 – 66 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Ding X , Cheng L, Chen W, et al. Integrative analysis of gene expression in response to low-dose ionizing radiation in a human skin model . Med Oncol 2015 ; 32 : 621 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 42. Zhang X , Du K, Lou Z, et al. The CtBP1-HDAC1/2-IRF1 transcriptional complex represses the expression of the long noncoding RNA GAS5 in human osteosarcoma cells . Int J Biol Sci 2019 ; 15 : 1460 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Jiang D , Zhang Y, Yang L, et al. Long noncoding RNA HCG22 suppresses proliferation and metastasis of bladder cancer cells by regulation of PTBP1 . J Cell Physiol 2019 . OpenURL Placeholder Text WorldCat 44. Wang J , Cai H, Dai Z, et al. Down-regulation of lncRNA XIST inhibits cell proliferation via regulating miR-744/RING1 axis in non-small cell lung cancer . Clin Sci 2019 ; 133 : 1567 – 79 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Schmitt AM , Garcia JT, Hung T, et al. An inducible long noncoding RNA amplifies DNA damage signaling . Nat Genet 2016 ; 48 : 1370 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Kappelmann M , Bosserhoff A, Kuphal S. AP-1/c-Jun transcription factors: regulation and function in malignant melanoma . Eur J Cell Biol 2014 ; 93 : 76 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Sancisi V , Manzotti G, Gugnoni M, et al. RUNX2 expression in thyroid and breast cancer requires the cooperation of three non-redundant enhancers under the control of BRD4 and c-JUN . Nucleic Acids Res 2017 ; 45 : 11249 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Jiani Zhang and Lixin Ding contributed to the study equally. © The Author(s) 2020. Published by Oxford University Press. For permissions, please email: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Suppression of LINC00460 mediated the sensitization of HCT116 cells to ionizing radiation by inhibiting epithelial–mesenchymal transition
JF - Toxicology Research
DO - 10.1093/toxres/tfaa010
DA - 2020-05-08
UR - https://www.deepdyve.com/lp/oxford-university-press/suppression-of-linc00460-mediated-the-sensitization-of-hct116-cells-to-8wXDFd890V
SP - 107
EP - 116
VL - 9
IS - 2
DP - DeepDyve
ER -