TY - JOUR
AU - Cifuentes, Víctor
AB - Abstract Xanthophyllomyces dendrorhous is a basidiomycetous yeast of considerable biotechnological interest because it synthesizes astaxanthin as its main carotenoid. The carotenoid production increases when it is grown using nonfermentable compounds as the sole carbon source. This work analyzes the expression of the carotenogenic genes and their relationship with the amount and types of carotenoids produced when X. dendrorhous is grown using a nonfermentable (succinate) or a fermentable carbon source (glucose). When X. dendrorhous is grown in succinate, carotenoid production is approximately three times higher than when it is grown in glucose. Moreover, carotenoid biosynthesis occurs at the start of the growth cycle when X. dendrorhous is grown in succinate, whereas when it is grown in glucose, carotenoids are produced at the end of the exponential phase. Additionally, we observed that some carotenogenic genes, such as alternative transcripts of crtYB and crtI, are differentially expressed when the yeast is grown in these carbon sources; other genes, such as crtS, exhibit a similar pattern of expression. Our data indicate that transcriptional regulation is not sufficient to explain the differences in carotenoid production between the two culture conditions, indicating that additional regulatory mechanisms may be operating in the carotenogenic pathway of X. dendrorhous. carotenogenesis, astaxanthin, nonfermentable carbon source, fermentation Introduction Astaxanthin is a carotenoid pigment that has grown in popularity due to its use as a food additive for farmed salmon and trout (Higuera-Ciapara, 2006). However, as synthetic carotenoids are poorly absorbed by fish flesh compared with other biological sources, the green microalgae Haematococcus pluvialis (Lorenz & Cysewski, 2000) and the basidiomycetous yeast Xanthophyllomyces dendrorhous (Calo & Gonzalez, 1995) have been identified as the best biological sources of astaxanthin. Previous work has demonstrated astaxanthin to be a strong antioxidant that can protect the organisms producing it from oxidative damage caused by reactive oxygen species (ROS) (Schroeder & Johnson, 1993; Wu, 2006) or by peroxide radicals (Schroeder & Johnson, 1995), which are commonly found in the natural habitat of X. dendrorhous. Xanthophyllomyces dendrorhous is a carotenoid-producing fermentative basidiomycetous yeast that predominantly synthesizes astaxanthin, producing minor amounts of β-carotene as well (Andrewes, 1976; Frengova & Beshkova, 2009). However, the specific production of astaxanthin by wild-type strains of X. dendrorhous is too low (200–400 μg g−1 of dry yeast) to provide a natural source of the pigment. Therefore, many researchers have attempted to improve the production of astaxanthin through various methods: optimization of culture conditions, such as modifying the glucose concentration (Yamane, 1997b; Hu, 2005), pH (Hu, 2006), oxygen content (Yamane, 1997b; Liu, 2006) or carbon/nitrogen ratio (Flores-Cotera, 2001; Vustin, 2004); supplementation of the culture medium with different additives (Wang, 2006; Kim, 2007); illumination with white and UV light (de la Fuente, 2010); and classic random mutagenesis methods (An, 1989; Lewis, 1990; Retamales, 1998; Ukibe, 2008; Rodríguez-Saiz, 2010). While a detailed understanding of the regulation of the carotenogenic pathway would be of considerable help in the development of a natural astaxanthin source, it remains largely unknown. The first step in the biosynthesis of astaxanthin by X. dendrorhous is the isomerization of isopentenyl pyrophosphate (IPP) into its isomer, dimethylallyl pyrophosphate, by IPP isomerase, which is encoded by the idi gene (Kajiwara, 1997) (Fig. 1). The next step is catalyzed by geranylgeranyl pyrophosphate (GGPP) synthase (encoded by the crtE gene), generating GGPP (Niklitschek, 2008). Two GGPP molecules are then condensed to form phytoene by phytoene-β-carotene synthase (PBS), a bifunctional enzyme encoded by the crtYB gene (Verdoes, 1999a). Phytoene is the first carotenoid synthesized in the pathway and undergoes four desaturation reactions catalyzed by phytoene desaturase (PDS), which is encoded by the crtI gene (Verdoes, 1999b). Lycopene is produced by PDS and is converted into β-carotene by PBS, which is encoded by the crtYB gene. Importantly, the crtI and crtYB genes produce alternatively spliced transcripts throughout the growth cycle (Lodato, 2003), but their role in carotenogenesis is not yet fully understood. Finally, β-carotene is oxidized to astaxanthin by astaxanthin synthase (CrtS), which is the product of the crtS gene (Ojima, 2006). Recently, a crtR gene was isolated from X. dendrorhous, encoding a cytochrome P450 reductase that provides CrtS with the necessary electrons for substrate oxygenation (Alcaíno, 2008). 1 View largeDownload slide Diagram of the astaxanthin biosynthetic pathway in Xanthophyllomyces dendrorhous, proposed by Andrewes (1976). Acetyl-CoA is an early intermediary of the pathway and it is converted into isopentenyl pyrophosphate (IPP). Next, IPP-isomerase (idi gene) isomerizes IPP into dimethylallyl pyrophosphate (DMAPP). Then, three molecules of IPP are sequentially added to DMAPP to yield geranylgeranyl pyrophosphate (GGPP) by GGPP synthase (crtE gene). GGPP is then converted into phytoene by PBS (crtYB gene). PDS (crtI gene) converts phytoene into lycopene, which is subsequently converted into β-carotene by PBS. Neurosporene can be converted in torulene by PDS and PBS. Torulene is a monocyclic carotenoid that can be converted into hydroxy-ceto-torulene (HDCO). β-Carotene is converted into astaxanthin by astaxanthin synthase (crtS gene) with the aid of cytochrome P450 reductase enzyme (crtR gene). 1 View largeDownload slide Diagram of the astaxanthin biosynthetic pathway in Xanthophyllomyces dendrorhous, proposed by Andrewes (1976). Acetyl-CoA is an early intermediary of the pathway and it is converted into isopentenyl pyrophosphate (IPP). Next, IPP-isomerase (idi gene) isomerizes IPP into dimethylallyl pyrophosphate (DMAPP). Then, three molecules of IPP are sequentially added to DMAPP to yield geranylgeranyl pyrophosphate (GGPP) by GGPP synthase (crtE gene). GGPP is then converted into phytoene by PBS (crtYB gene). PDS (crtI gene) converts phytoene into lycopene, which is subsequently converted into β-carotene by PBS. Neurosporene can be converted in torulene by PDS and PBS. Torulene is a monocyclic carotenoid that can be converted into hydroxy-ceto-torulene (HDCO). β-Carotene is converted into astaxanthin by astaxanthin synthase (crtS gene) with the aid of cytochrome P450 reductase enzyme (crtR gene). Xanthophyllomyces dendrorhous is unusual among carotenogenic yeasts because it is the only one capable of fermenting glucose through the production of ethanol. However, it can use certain nonfermentable compounds as its sole carbon and energy sources, such as ethanol, glycerol, citrate or succinate (Vázquez, 1997; Kusdiyantini, 1998; Flores-Cotera, 2001; Palágyi, 2001; Liu & Wu, 2008). It has been demonstrated that astaxanthin production decreases during fermentative metabolism and increases during aerobic metabolism (Yamane, 1997b). In fact, we have previously determined that, during growth of wild-type X. dendrorhous in complete medium (YM) supplemented with glucose (a fermentable carbon source), carotenogenesis is induced at the stationary phase (Lodato, 2003, 2007). This induction coincides with glucose depletion in the culture medium and with the beginning of ethanol consumption, which is a nonfermentable carbon source that was previously produced by glucose fermentation (Lodato, 2003, 2007). These results questioned the role of nonfermentable carbon sources in carotenogenesis. In this study, we examined the relationship between carotenoid production and carotenogenic gene expression in wild-type X. dendrorhous that was grown in either glucose or succinate (fermentable and nonfermentable carbon sources, respectively). Materials and methods Strain, media and culture conditions The yeast used in this study is wild-type X. dendrorhous ATCC 24230 (UCD 67-385 strain). Xanthophyllomyces dendrorhous was grown in a 12-L batch culture fermentor (New Brunswick) containing 9 L of minimal medium (MM) supplemented with 2% glucose or 2% succinate as the carbon source. The MM used was based on the medium N described previously (Vogel, 1956), adapted to X. dendrorhous growth requirements according to Retamales (2002), and it was prepared as a 50 × stock solution as indicated. The following reagents were successively dissolved in 750 mL distilled water with shaking at room temperature, taking care to completely dissolve each reagent: 150 g trisodium citrate pentahydrate, 250 g potassium dihydrogen phosphate anhydrous, 100 g ammonium nitrate anhydrous, 10 g magnesium sulfate heptahydrate, 5 g calcium chloride dihydrate, 5 mL of trace elements, 2.5 mL biotin solution, and finally 2 mL of chloroform were added. The trace element solution was prepared as follows: in 300 mL distilled water, the reagents were successively dissolved with shaking at room temperature – 9 mg boric acid anhydrous, 58.5 mg cupric sulfate pentahydrate, 1.95 mg potassium iodine neutral, 9 mg manganese sulfate tetrahydrate, 5 mg ammonium heptamolybdate tetrahydrate, 139 mg iron(III) chloride hexahydrate and 822 mg zinc sulfate heptahydrate. The biotin solution was prepared by dissolving 1 mg biotin in 55 mL ethanol (p.a.) and by the addition of distilled water to a final volume of 100 mL. The fermentor was inoculated with 500 mL of a 4-day-old culture that had been prepared in a baffled 1-L flask. The culture was grown under the following settings: growth at 22 °C, shaking at 300 r.p.m. and 13 L min−1 sterile air injection. Antifoam agent (1520 US, Dow Corning) was automatically added when required. Samples were collected at different time points and cells were counted using a Neubauer chamber. For the calculation of percentage of growth, the maximum cell number reached was considered as 100% of growth and the value for each time point was calculated as a percentage of maximum growth. After centrifugation at 12 100 g for 10 min, the cell pellets were frozen in liquid nitrogen and stored at −80 °C until carotenoid and RNA extraction. For cultures prepared in flasks, 50 mL of YM medium supplemented with different carbon sources was inoculated with 500 μL of a 2-day culture and incubated at 22 °C and 200 r.p.m. agitation for 5 days. Carotenoid extraction and analysis by HPLC Total carotenoids were extracted from cell pellets using the acetone extraction method (An, 1989). Carotenoids were quantified by A465 nm using an absorption coefficient of A1%=2100. The pigments were normalized relative to the dry weight of the yeast. Carotenoids were separated by HPLC using a reverse-phase RP-18 Lichrocart 125-4 (Merck) column with acetonitrile : methanol : isopropanol (85 : 10 : 5 v/v) as the mobile phase and a 1 mL min−1 flux under isocratic conditions. The elution spectra were obtained using a diode array detector. The pigments were identified based on their absorption spectra and retention times. RNA extraction Total RNA extraction was performed according to a modified protocol of Chomczynski & Sacchi (1987). Briefly, 5 mL of Chomczynski solution in phenol (Ch-P solution) and 1 vol of glass beads (Sigma, 425–600 μm) were added to the cell pellet. The Ch solution is composed of 4 M guanidinium thiocyanate, 25 mM sodium citrate, 0.5% lauryl sarcosyl and 0.1 M β-mercaptoethanol. The Ch-P solution contains 10 mL of phenol and 1 mL of 2 M sodium acetate (pH 4.0) for each 10 mL of Ch solution. To induce cellular breakage, the tubes were shaken on a vortex at a maximum speed for 10 min. The mixture was incubated for 10 min at room temperature, followed by the addition of 0.2 mL chloroform for each milliliter of Ch-P solution and an additional 5 min incubation period at room temperature. After centrifugation at 12 100 g, the RNA in the aqueous phase was washed twice with phenol and phenol : chloroform solution. The clean aqueous phase was transferred to a sterile tube, and 1 vol of isopropanol was added. After incubation for 10 min at room temperature, the RNA was precipitated by centrifugation at 12 100 g for 10 min at 4 °C. The RNA pellet was washed with 1 mL of 75% ethanol. The RNA was resuspended in water (diethylpyrocarbonate treated) and then stored at −20 °C. The RNA concentration was determined spectrophotometrically at 260 nm, according to the methodology described by Sambrook (2001). cDNA synthesis and amplification The relative level of carotenogenic gene mRNAs was determined using a semi-quantitative reverse transcriptase (RT)-PCR method. The total RNA was retrotranscribed into cDNA. The reverse transcription reaction was performed in a final volume of 25 μL containing 3–6 μg of RNA, 75 pmol oligo dT15, 0.5 mM dNTPs and 200 U M-MLV reverse transcriptase (Fermentas). The reaction mixture was incubated for 60 min at 42 °C and then heated for 10 min at 65 °C. Amplification of the cDNA was performed with primers that were designed according to the published gene sequences of the strains CBS 6938 (Verdoes, 1999b, 2003) and ATCC 24230 (Kajiwara, 1997; Lodato, 2007). To make sure that only cDNA and not genomic DNA was amplified, all the primers were designed to span an exon–exon linkage. The primers used for gene amplification are listed in Table 1. The PCR amplification was performed in a 25-μL reaction mixture with the following composition: 2.5 μL 10 ×Taq buffer, 0.5 μL of a dNTP mixture containing 10 mM of each nucleotide, 1 μL of 50 mM MgCl2, 1 μL of each 25 mM primer, 2 μL of RT reaction, 2 U Taq pol (Promega) and water. The amplification was performed in a Perkin Elmer 2400 with the following program: 95 °C for 3 min, 28 cycles at 94 °C for 30 s, 55 °C for 30 s and 72 °C for 3 min, followed by a final extension at 72 °C for 10 min. 1 Primers used in this work Gene  Primer  5′→3′ Sequence  Accession No. (GenBank)  Localization  act  ACT3  F actcctacgttggtgacgag  X89898  1345  ACT4  R tcaagtctcgaccggccaag    1801  crtI  CRTI2  F agctatcatcgtgggatgtgg (specific for mature mRNA)  DQ028748  764  CRTI4  F agctatcatcgtggtttaatcc (specific for alternative mRNA)    764  CRTI8  R tgtccagatagactcgaagg (specific for mature mRNA)    1991  crtYB  CRTYB11  F gcatattaccagatccatctg (specific for mature mRNA)  DQ016503  1603  CRTYB12  F gtgtgcatatgtgttgcaacc (specific for alternative mRNA)    1658  CRTYB16  R ttgaccgacagcaacataatc (specific for mature mRNA)    2405  crtS  AST1  F catcctctcagctcgtacagg  DQ002006  775  AST2  R gtctccgtttcatagttcgg    1857  Gene  Primer  5′→3′ Sequence  Accession No. (GenBank)  Localization  act  ACT3  F actcctacgttggtgacgag  X89898  1345  ACT4  R tcaagtctcgaccggccaag    1801  crtI  CRTI2  F agctatcatcgtgggatgtgg (specific for mature mRNA)  DQ028748  764  CRTI4  F agctatcatcgtggtttaatcc (specific for alternative mRNA)    764  CRTI8  R tgtccagatagactcgaagg (specific for mature mRNA)    1991  crtYB  CRTYB11  F gcatattaccagatccatctg (specific for mature mRNA)  DQ016503  1603  CRTYB12  F gtgtgcatatgtgttgcaacc (specific for alternative mRNA)    1658  CRTYB16  R ttgaccgacagcaacataatc (specific for mature mRNA)    2405  crtS  AST1  F catcctctcagctcgtacagg  DQ002006  775  AST2  R gtctccgtttcatagttcgg    1857  * Primer position in base pairs within the GenBank sequence. F, forward; R, reverse. View Large 1 Primers used in this work Gene  Primer  5′→3′ Sequence  Accession No. (GenBank)  Localization  act  ACT3  F actcctacgttggtgacgag  X89898  1345  ACT4  R tcaagtctcgaccggccaag    1801  crtI  CRTI2  F agctatcatcgtgggatgtgg (specific for mature mRNA)  DQ028748  764  CRTI4  F agctatcatcgtggtttaatcc (specific for alternative mRNA)    764  CRTI8  R tgtccagatagactcgaagg (specific for mature mRNA)    1991  crtYB  CRTYB11  F gcatattaccagatccatctg (specific for mature mRNA)  DQ016503  1603  CRTYB12  F gtgtgcatatgtgttgcaacc (specific for alternative mRNA)    1658  CRTYB16  R ttgaccgacagcaacataatc (specific for mature mRNA)    2405  crtS  AST1  F catcctctcagctcgtacagg  DQ002006  775  AST2  R gtctccgtttcatagttcgg    1857  Gene  Primer  5′→3′ Sequence  Accession No. (GenBank)  Localization  act  ACT3  F actcctacgttggtgacgag  X89898  1345  ACT4  R tcaagtctcgaccggccaag    1801  crtI  CRTI2  F agctatcatcgtgggatgtgg (specific for mature mRNA)  DQ028748  764  CRTI4  F agctatcatcgtggtttaatcc (specific for alternative mRNA)    764  CRTI8  R tgtccagatagactcgaagg (specific for mature mRNA)    1991  crtYB  CRTYB11  F gcatattaccagatccatctg (specific for mature mRNA)  DQ016503  1603  CRTYB12  F gtgtgcatatgtgttgcaacc (specific for alternative mRNA)    1658  CRTYB16  R ttgaccgacagcaacataatc (specific for mature mRNA)    2405  crtS  AST1  F catcctctcagctcgtacagg  DQ002006  775  AST2  R gtctccgtttcatagttcgg    1857  * Primer position in base pairs within the GenBank sequence. F, forward; R, reverse. View Large For accurate quantification of RT-PCR products, all PCR amplifications were made in triplicate and the linear range of the reaction was determined according to the method described by Lodato (2004). Briefly, we tested the linearity of the increase of the PCR product with different amounts of initial RNA in the RT reaction, different numbers of PCR cycles and different volumes of RT reaction in the PCR. We thus used 3 μg of RNA in the RT reaction, 2 μL of RT reaction and 28 cycles of amplification in all of the subsequent PCR amplifications. In order to quantify the RT-PCR products, equal volumes of the PCR reaction products were loaded on 2% agarose gels containing ethidium bromide. After agarose gel electrophoresis, the mass of the bands were quantified using a 100-bp DNA ladder (Fermentas) as a molecular weight standard of known concentration by image j 1.40 Software (Rasband, 2008). To normalize for sample-to-sample variation in RT and PCR efficiency, relative expression values were obtained by comparing the intensity of the carotenoid gene product band with the intensity of the actin product band used as a control (Lodato, 2007). Quantification of ethanol Ethanol was quantified using the UV method (Boehringer Mannheim). Briefly, this method is based on the oxidation of ethanol to form acetate, which is catalyzed by the enzymes alcohol dehydrogenase and aldehyde dehydrogenase. This reaction produces reduced NAD, which is a measure of the amount of ethanol in the sample. NAD can be determined by measuring the A340 nm. The reactions were performed according to the instructions of the supplier, using suitable substrate dilutions of the samples. Quantification of glucose Glucose was quantified using the UV method (Boehringer Mannheim), based on the oxidation of glucose to form d-gluconate-6-phosphate in a reaction that is catalyzed by the enzymes hexokinase and glucose-6P dehydrogenase. This reaction produces reduced NADP, which is a measure of the amount of glucose in the sample. The level of NADP can be determined by measuring the A340 nm. These reactions were performed according to the instructions of the supplier, using suitable substrate dilutions of the samples. Results Differential growth and carotenoid production during growth in MM supplemented with succinate or glucose To select a suitable nonfermentable carbon source, we first evaluated the cellular carotenoid content during growth in YM medium supplemented with various nonfermentable carbon sources (xylose, succinate, sodium acetate, glycerol and ethanol). We found that all of these sources induced a significantly higher carotenoid content than glucose and that succinate sustained the highest carotenoid production (Fig. 2). However, YM is a complete medium that contains many compounds other than glucose that can be used as a carbon source. Therefore, to compare the use of succinate and glucose as the sole carbon sources, wild-type X. dendrorhous was cultured in a fermentor with 9 L of MM (which is chemically defined and is a relatively poor medium) supplemented either with glucose (MM glucose) or with succinate (MM succinate). We studied carotenoid gene expression and carotenoid production during aerobic (succinate grown) and fermentative (glucose grown) growth because nonfermentable carbon sources such as succinate can only be metabolized by aerobic respiration (Nelson & Cox, 2000). 2 View largeDownload slide Cellular carotenoid content of Xanthophyllomyces dendrorhous grown in different nonfermentable carbon sources. The yeast was grown in YM medium supplemented with glucose, glycerol, succinate, sodium acetate, xylose and ethanol. Cellular carotenoid content was measured after 5 days of incubation. Data are means of two independent experiments. Bars are SE. Student's t-test: *P=0.05; **P=0.01. 2 View largeDownload slide Cellular carotenoid content of Xanthophyllomyces dendrorhous grown in different nonfermentable carbon sources. The yeast was grown in YM medium supplemented with glucose, glycerol, succinate, sodium acetate, xylose and ethanol. Cellular carotenoid content was measured after 5 days of incubation. Data are means of two independent experiments. Bars are SE. Student's t-test: *P=0.05; **P=0.01. During the exponential growth phase in MM glucose, the growth of X. dendrorhous was accompanied by glucose consumption and ethanol production as a result of fermentative metabolism (Fig. 3a). However, during this phase, carotenoid production was low and tended to decrease as a function of time. Carotenoid synthesis in MM glucose had a lag phase and was induced at the end of the exponential growth phase. Therefore, in this scenario, carotenogenesis was not associated with growth. In contrast, carotenoid production in MM succinate had no initial lag phase, and there was no ethanol production (Fig. 3b). In MM succinate, carotenoid production started at the beginning of the growth cycle and steadily increased until the stationary phase. Although carotenoids did not increase during the exponential phase in MM glucose, the majority of carotenoids were produced in this phase in MM succinate. This result clearly shows that carotenogenesis is associated with growth. The biomass and carotenoid production in MM succinate were approximately two and three times greater, respectively, than they were in MM glucose (Table 2). In both culture conditions, astaxanthin was the major carotenoid produced (88% and 81% of the total carotenoids in glucose and succinate, respectively). Interestingly, the carotenoid yield per substrate unit was more than five times greater in MM succinate than it was in MM glucose. The same finding was observed for volumetric carotenoid productivity. This is because the cellular carotenoid content and biomass production are higher in MM succinate compared with glucose. These results demonstrate that carotenoid production begins earlier in the growth cycle and is greater when a nonfermentable carbon source such as succinate is used. 3 View largeDownload slide Growth, glucose consumption and ethanol and carotenoid production during the growth cycle of Xanthophyllomyces dendrorhous. The wild-type UCD 67-385 strain was grown in a batch fermentor in MM supplemented with glucose (a) or succinate (b), and aliquots were taken for the determination of cell number, glucose and ethanol concentration and carotenoid production. For the calculation of percentage of growth, the maximum cell number reached was considered as 100% of growth and the value for each time point was calculated as a percentage of maximum growth. The arrow indicates the induction of carotenoid biosynthesis. Data represent the mean of two independent experiments. 3 View largeDownload slide Growth, glucose consumption and ethanol and carotenoid production during the growth cycle of Xanthophyllomyces dendrorhous. The wild-type UCD 67-385 strain was grown in a batch fermentor in MM supplemented with glucose (a) or succinate (b), and aliquots were taken for the determination of cell number, glucose and ethanol concentration and carotenoid production. For the calculation of percentage of growth, the maximum cell number reached was considered as 100% of growth and the value for each time point was calculated as a percentage of maximum growth. The arrow indicates the induction of carotenoid biosynthesis. Data represent the mean of two independent experiments. 2 Maximum biomass, astaxanthin and carotenoid production of Xanthophyllomyces dendrorhous after 6 days of growth in MM glucose and MM succinate   Glucose  Succinate  Biomass (mg mL–1)  2.46 ± 0.01  5.39 ± 0.09  Cellular carotenoid content (μg g−1 dry weight)  137.9 ± 14.5  373.8 ± 17.6  Astaxanthin content (μg g−1 dry weight)  122.3 ± 20.9  304.1 ± 43.3  Carotenoid yield per substrate unit (μg g−1)  17.5 ± 2.0  102.9 ± 2.0  Volumetric carotenoid productivity (μg mL−1 culture medium)  0.34 ± 0.03  2.01 ± 0.06    Glucose  Succinate  Biomass (mg mL–1)  2.46 ± 0.01  5.39 ± 0.09  Cellular carotenoid content (μg g−1 dry weight)  137.9 ± 14.5  373.8 ± 17.6  Astaxanthin content (μg g−1 dry weight)  122.3 ± 20.9  304.1 ± 43.3  Carotenoid yield per substrate unit (μg g−1)  17.5 ± 2.0  102.9 ± 2.0  Volumetric carotenoid productivity (μg mL−1 culture medium)  0.34 ± 0.03  2.01 ± 0.06  View Large 2 Maximum biomass, astaxanthin and carotenoid production of Xanthophyllomyces dendrorhous after 6 days of growth in MM glucose and MM succinate   Glucose  Succinate  Biomass (mg mL–1)  2.46 ± 0.01  5.39 ± 0.09  Cellular carotenoid content (μg g−1 dry weight)  137.9 ± 14.5  373.8 ± 17.6  Astaxanthin content (μg g−1 dry weight)  122.3 ± 20.9  304.1 ± 43.3  Carotenoid yield per substrate unit (μg g−1)  17.5 ± 2.0  102.9 ± 2.0  Volumetric carotenoid productivity (μg mL−1 culture medium)  0.34 ± 0.03  2.01 ± 0.06    Glucose  Succinate  Biomass (mg mL–1)  2.46 ± 0.01  5.39 ± 0.09  Cellular carotenoid content (μg g−1 dry weight)  137.9 ± 14.5  373.8 ± 17.6  Astaxanthin content (μg g−1 dry weight)  122.3 ± 20.9  304.1 ± 43.3  Carotenoid yield per substrate unit (μg g−1)  17.5 ± 2.0  102.9 ± 2.0  Volumetric carotenoid productivity (μg mL−1 culture medium)  0.34 ± 0.03  2.01 ± 0.06  View Large Expression of carotenogenic genes and their relationship with carotenoid synthesis The carotenogenic gene expression profiles and the intermediary carotenoid profiles were determined and analyzed for each growth condition (MM succinate and MM glucose) through RT-PCR and HPLC analysis, respectively. The RT-PCR technique has proven to be very reliable, provided the appropriate standardizations are performed (Marone, 2001). To make a semi-quantitative determination of the mRNA levels of carotenoid genes, we determined the linear interval in which the amount of PCR product increased before reaching a plateau, according to the procedure described previously by Lodato (2004). The crtE and idi genes are early genes in the carotenogenic pathway. They are not exclusive to the carotenogenic pathway; they are involved in other metabolic processes necessary for yeast survival (Stryer, 1999). The expression pattern of the idi gene was similar in MM glucose and MM succinate; it increased during the exponential growth phase and reached a maximum expression level at the end of the exponential phase (Table 3A and B). After the end of the exponential phase, the expression pattern of the idi gene remained relatively constant. The crtE gene is the next gene in the pathway, and it shows an expression pattern that is similar to the idi gene (data not shown). 3 Expression profile of Xanthophyllomyces dendrorhous grown in glucose (A) and succinate (B) Growth phase  Idi  mcrtYB  acrtYB  mcrtI  acrtI  mcrtI/acrtI ratio  crtS  (A) Relative mRNA expression in glucose*  Early exponential  63.5 ± 2.3  31.1 ± 7.6  1.6 ± 0.14  100 ± 0  25.4 ± 9.3  3.9  33.4 ± 2.5  Late exponential (&)  85.4 ± 7.0  84.1 ± 8.0  81.2 ± 12.0  57.1 ± 11.3  72.0 ± 11.8  0.8  79.4 ± 11.9  Early stationary  69.9 ± 6.4  47.9 ± 5.3  17.5 ± 5.4  44.7 ± 3.2  48.9 ± 9.8  0.9  65.7 ± 8.1  Late stationary  86.4 ± 13.5  15.3 ± 0  11.8 ± 6.5  44.1 ± 0  29.7 ± 21.8  1.5  47.9 ± 13.5  (B) Relative mRNA expression in succinate*  Early exponential (&)  76.1 ± 23.9  16.7 ± 7.1  0.0 ± 0.0  85.4 ± 4.4  0.0 ± 0.0  –  50.3 ± 2.5  Late exponential  80.6 ± 5.2  76.4 ± 7.1  17.1 ± 4.3  71.0 ± 4.8  42.1 ± 9.5  1.7  62.5 ± 4.2  Early stationary  62.4 ± 5.2  74.3 ± 5.6  78.7 ± 3.7  44.8 ± 4.1  83.7 ± 5.7  0.5  85.8 ± 6.3  Late stationary  60.2 ± 1.7  50.7 ± 5.5  50.1 ± 4.2  3.7 ± 1.9  55.1 ± 9.0  0.1  38.2 ± 2.9  Growth phase  Idi  mcrtYB  acrtYB  mcrtI  acrtI  mcrtI/acrtI ratio  crtS  (A) Relative mRNA expression in glucose*  Early exponential  63.5 ± 2.3  31.1 ± 7.6  1.6 ± 0.14  100 ± 0  25.4 ± 9.3  3.9  33.4 ± 2.5  Late exponential (&)  85.4 ± 7.0  84.1 ± 8.0  81.2 ± 12.0  57.1 ± 11.3  72.0 ± 11.8  0.8  79.4 ± 11.9  Early stationary  69.9 ± 6.4  47.9 ± 5.3  17.5 ± 5.4  44.7 ± 3.2  48.9 ± 9.8  0.9  65.7 ± 8.1  Late stationary  86.4 ± 13.5  15.3 ± 0  11.8 ± 6.5  44.1 ± 0  29.7 ± 21.8  1.5  47.9 ± 13.5  (B) Relative mRNA expression in succinate*  Early exponential (&)  76.1 ± 23.9  16.7 ± 7.1  0.0 ± 0.0  85.4 ± 4.4  0.0 ± 0.0  –  50.3 ± 2.5  Late exponential  80.6 ± 5.2  76.4 ± 7.1  17.1 ± 4.3  71.0 ± 4.8  42.1 ± 9.5  1.7  62.5 ± 4.2  Early stationary  62.4 ± 5.2  74.3 ± 5.6  78.7 ± 3.7  44.8 ± 4.1  83.7 ± 5.7  0.5  85.8 ± 6.3  Late stationary  60.2 ± 1.7  50.7 ± 5.5  50.1 ± 4.2  3.7 ± 1.9  55.1 ± 9.0  0.1  38.2 ± 2.9  * The wild-type UCD 67-385 strain was grown in a batch fermentor in MM supplemented with glucose (A) or succinate (B), and aliquots were taken for the determination of transcript level, as described in Materials and methods. The level of each messenger was normalized to the level of the actin transcript. Each value is relative to the highest value of the curve, which was defined as 100%. In order to facilitate the analysis, the mean value of expression for each defined growth period was calculated. Exponential and stationary growth phases were divided into early and late phases. The expression peaks of transcripts are shown as bold underlined letters. The data represent the mean of two independent experiments. (&) indicates the induction of carotenoid biosynthesis. View Large 3 Expression profile of Xanthophyllomyces dendrorhous grown in glucose (A) and succinate (B) Growth phase  Idi  mcrtYB  acrtYB  mcrtI  acrtI  mcrtI/acrtI ratio  crtS  (A) Relative mRNA expression in glucose*  Early exponential  63.5 ± 2.3  31.1 ± 7.6  1.6 ± 0.14  100 ± 0  25.4 ± 9.3  3.9  33.4 ± 2.5  Late exponential (&)  85.4 ± 7.0  84.1 ± 8.0  81.2 ± 12.0  57.1 ± 11.3  72.0 ± 11.8  0.8  79.4 ± 11.9  Early stationary  69.9 ± 6.4  47.9 ± 5.3  17.5 ± 5.4  44.7 ± 3.2  48.9 ± 9.8  0.9  65.7 ± 8.1  Late stationary  86.4 ± 13.5  15.3 ± 0  11.8 ± 6.5  44.1 ± 0  29.7 ± 21.8  1.5  47.9 ± 13.5  (B) Relative mRNA expression in succinate*  Early exponential (&)  76.1 ± 23.9  16.7 ± 7.1  0.0 ± 0.0  85.4 ± 4.4  0.0 ± 0.0  –  50.3 ± 2.5  Late exponential  80.6 ± 5.2  76.4 ± 7.1  17.1 ± 4.3  71.0 ± 4.8  42.1 ± 9.5  1.7  62.5 ± 4.2  Early stationary  62.4 ± 5.2  74.3 ± 5.6  78.7 ± 3.7  44.8 ± 4.1  83.7 ± 5.7  0.5  85.8 ± 6.3  Late stationary  60.2 ± 1.7  50.7 ± 5.5  50.1 ± 4.2  3.7 ± 1.9  55.1 ± 9.0  0.1  38.2 ± 2.9  Growth phase  Idi  mcrtYB  acrtYB  mcrtI  acrtI  mcrtI/acrtI ratio  crtS  (A) Relative mRNA expression in glucose*  Early exponential  63.5 ± 2.3  31.1 ± 7.6  1.6 ± 0.14  100 ± 0  25.4 ± 9.3  3.9  33.4 ± 2.5  Late exponential (&)  85.4 ± 7.0  84.1 ± 8.0  81.2 ± 12.0  57.1 ± 11.3  72.0 ± 11.8  0.8  79.4 ± 11.9  Early stationary  69.9 ± 6.4  47.9 ± 5.3  17.5 ± 5.4  44.7 ± 3.2  48.9 ± 9.8  0.9  65.7 ± 8.1  Late stationary  86.4 ± 13.5  15.3 ± 0  11.8 ± 6.5  44.1 ± 0  29.7 ± 21.8  1.5  47.9 ± 13.5  (B) Relative mRNA expression in succinate*  Early exponential (&)  76.1 ± 23.9  16.7 ± 7.1  0.0 ± 0.0  85.4 ± 4.4  0.0 ± 0.0  –  50.3 ± 2.5  Late exponential  80.6 ± 5.2  76.4 ± 7.1  17.1 ± 4.3  71.0 ± 4.8  42.1 ± 9.5  1.7  62.5 ± 4.2  Early stationary  62.4 ± 5.2  74.3 ± 5.6  78.7 ± 3.7  44.8 ± 4.1  83.7 ± 5.7  0.5  85.8 ± 6.3  Late stationary  60.2 ± 1.7  50.7 ± 5.5  50.1 ± 4.2  3.7 ± 1.9  55.1 ± 9.0  0.1  38.2 ± 2.9  * The wild-type UCD 67-385 strain was grown in a batch fermentor in MM supplemented with glucose (A) or succinate (B), and aliquots were taken for the determination of transcript level, as described in Materials and methods. The level of each messenger was normalized to the level of the actin transcript. Each value is relative to the highest value of the curve, which was defined as 100%. In order to facilitate the analysis, the mean value of expression for each defined growth period was calculated. Exponential and stationary growth phases were divided into early and late phases. The expression peaks of transcripts are shown as bold underlined letters. The data represent the mean of two independent experiments. (&) indicates the induction of carotenoid biosynthesis. View Large The carotenogenic genes crtYB, crtI and crtS are involved only in carotenoid synthesis. The mature mRNA of crtYB gene is translated into the functional protein PBS, whereas the alternative form cannot theoretically be translated because it has many termination codons in its sequence (Lodato, 2003). The alternatively spliced mRNA conserves 55 bp of the first intron and lacks 111 bp of the second exon (Lodato, 2003). We measured the relative expression level of each type of crtYB mRNA. During the growth phase in MM glucose, the expression level of both the mature and the alternative crtYB mRNAs peaked simultaneously at the end of the exponential phase (Table 3A and B). Later, during the stationary phase, the expression of both mRNAs decreased considerably. In MM glucose, the amount of phytoene, the product of phytoene synthase activity of the PBS enzyme, increased throughout the growth cycle (Table 4A), despite the fact that the levels of both crtYB mRNAs decreased during the stationary phase. β-Carotene is the product of the lycopene cyclase activity of PBS, and it remained at a low level throughout the growth cycle (Table 4A), even during the expression peak of the crtYB transcripts. These results demonstrate a lack of correlation between mRNA levels and the corresponding enzyme activity. In contrast, in MM succinate, the expression of the alternative crtYB mRNA was delayed compared with that of the mature mRNA (Table 3B). 4 Distribution of carotenoids produced by UCD 67-385, grown on glucose (A) and succinate (B) Growth phase  Intermediary carotenoids (μg g−1 dry weight)  Total Carotenoids (μg g−1 dry weight)  Astaxanthin  Xanthophyll precursors  Astaxanthin/precursors  β-Carotene  Monocyclic carotenoids  Phytoene  (A)  Early exponential  62.5 ± 35  54 ± 28  <2  42  <2  2.6 ± 2.0  1.3  Late exponential  69 ± 28  63.5 ± 11  <2  98  <2  4.5 ± 0.5  4.6 ± 1.9  Early stationary  115 ± 38.5  105.5 ± 32  <2  85  <2  14.5 ± 4.8  6.7 ± 2.5  Late stationary  133 ± 26  122 ± 21  <2  72  <2  7.7 ± 3.8  7.9  (B)  Early exponential  107.0 ± 15  66.5 ± 25  19.5 ± 6  3.2  10.5 ± 5  8.5 ± 2  <2.5  Late exponential  111.6 ± 27  134.3 ± 19.6  14.6 ± 4.6  10.3  5 ± 2.4  10.3 ± 2  <1  Early stationary  284.3 ± 31.6  214.6 ± 31.6  28.6 ± 6.6  9  7.3 ± 1.8  33.6 ± 2.3  <1  Late stationary  368.5 ± 46.5  309.5 ± 34  14.5 ± 2.5  22  4.7 ± 0.1  40.5 ± 8.5  <1  Growth phase  Intermediary carotenoids (μg g−1 dry weight)  Total Carotenoids (μg g−1 dry weight)  Astaxanthin  Xanthophyll precursors  Astaxanthin/precursors  β-Carotene  Monocyclic carotenoids  Phytoene  (A)  Early exponential  62.5 ± 35  54 ± 28  <2  42  <2  2.6 ± 2.0  1.3  Late exponential  69 ± 28  63.5 ± 11  <2  98  <2  4.5 ± 0.5  4.6 ± 1.9  Early stationary  115 ± 38.5  105.5 ± 32  <2  85  <2  14.5 ± 4.8  6.7 ± 2.5  Late stationary  133 ± 26  122 ± 21  <2  72  <2  7.7 ± 3.8  7.9  (B)  Early exponential  107.0 ± 15  66.5 ± 25  19.5 ± 6  3.2  10.5 ± 5  8.5 ± 2  <2.5  Late exponential  111.6 ± 27  134.3 ± 19.6  14.6 ± 4.6  10.3  5 ± 2.4  10.3 ± 2  <1  Early stationary  284.3 ± 31.6  214.6 ± 31.6  28.6 ± 6.6  9  7.3 ± 1.8  33.6 ± 2.3  <1  Late stationary  368.5 ± 46.5  309.5 ± 34  14.5 ± 2.5  22  4.7 ± 0.1  40.5 ± 8.5  <1  * The total carotenoids were HPLC analyzed as described in Materials and methods. Intermediary carotenoids were identified according to their absorption spectra and retention time with appropriate purified standards. In order to facilitate the analysis, the mean value of carotenoids for each defined growth period was calculated. Exponential and stationary growth phases were divided into early and late phases. The data represent the mean of two independent experiments. † Equinenone+hydroxyequinenone+phoenicoxanthin. ‡ HDCO+torulene. View Large 4 Distribution of carotenoids produced by UCD 67-385, grown on glucose (A) and succinate (B) Growth phase  Intermediary carotenoids (μg g−1 dry weight)  Total Carotenoids (μg g−1 dry weight)  Astaxanthin  Xanthophyll precursors  Astaxanthin/precursors  β-Carotene  Monocyclic carotenoids  Phytoene  (A)  Early exponential  62.5 ± 35  54 ± 28  <2  42  <2  2.6 ± 2.0  1.3  Late exponential  69 ± 28  63.5 ± 11  <2  98  <2  4.5 ± 0.5  4.6 ± 1.9  Early stationary  115 ± 38.5  105.5 ± 32  <2  85  <2  14.5 ± 4.8  6.7 ± 2.5  Late stationary  133 ± 26  122 ± 21  <2  72  <2  7.7 ± 3.8  7.9  (B)  Early exponential  107.0 ± 15  66.5 ± 25  19.5 ± 6  3.2  10.5 ± 5  8.5 ± 2  <2.5  Late exponential  111.6 ± 27  134.3 ± 19.6  14.6 ± 4.6  10.3  5 ± 2.4  10.3 ± 2  <1  Early stationary  284.3 ± 31.6  214.6 ± 31.6  28.6 ± 6.6  9  7.3 ± 1.8  33.6 ± 2.3  <1  Late stationary  368.5 ± 46.5  309.5 ± 34  14.5 ± 2.5  22  4.7 ± 0.1  40.5 ± 8.5  <1  Growth phase  Intermediary carotenoids (μg g−1 dry weight)  Total Carotenoids (μg g−1 dry weight)  Astaxanthin  Xanthophyll precursors  Astaxanthin/precursors  β-Carotene  Monocyclic carotenoids  Phytoene  (A)  Early exponential  62.5 ± 35  54 ± 28  <2  42  <2  2.6 ± 2.0  1.3  Late exponential  69 ± 28  63.5 ± 11  <2  98  <2  4.5 ± 0.5  4.6 ± 1.9  Early stationary  115 ± 38.5  105.5 ± 32  <2  85  <2  14.5 ± 4.8  6.7 ± 2.5  Late stationary  133 ± 26  122 ± 21  <2  72  <2  7.7 ± 3.8  7.9  (B)  Early exponential  107.0 ± 15  66.5 ± 25  19.5 ± 6  3.2  10.5 ± 5  8.5 ± 2  <2.5  Late exponential  111.6 ± 27  134.3 ± 19.6  14.6 ± 4.6  10.3  5 ± 2.4  10.3 ± 2  <1  Early stationary  284.3 ± 31.6  214.6 ± 31.6  28.6 ± 6.6  9  7.3 ± 1.8  33.6 ± 2.3  <1  Late stationary  368.5 ± 46.5  309.5 ± 34  14.5 ± 2.5  22  4.7 ± 0.1  40.5 ± 8.5  <1  * The total carotenoids were HPLC analyzed as described in Materials and methods. Intermediary carotenoids were identified according to their absorption spectra and retention time with appropriate purified standards. In order to facilitate the analysis, the mean value of carotenoids for each defined growth period was calculated. Exponential and stationary growth phases were divided into early and late phases. The data represent the mean of two independent experiments. † Equinenone+hydroxyequinenone+phoenicoxanthin. ‡ HDCO+torulene. View Large The crtI gene is also transcribed into a mature mRNA and an alternatively spliced mRNA. The alternative mRNA of the crtI gene conserves 80 bp of the first intron (Lodato, 2003). Only the mature transcript can be translated into a functional protein that can catalyze the next step of carotenogenesis: phytoene desaturation with lycopene formation (Fig. 1) (Lodato, 2003). The mature form of the crtI gene showed a similar expression pattern in both yeast grown in glucose and yeast grown in succinate. In contrast, the expression of the alternative crtI mRNA was delayed in yeast grown in succinate with respect to yeast grown in glucose. This difference became more evident upon an analysis of the mature/alternative crtI mRNA ratio (Table 3A and B). Because only the mature mRNA can be translated into a functional protein, a higher mature/alternative crtI mRNA ratio indicates that a higher amount of PDS is available. A decreasing ratio was observed during growth in MM succinate when the amount of carotenoids increased, and an increasing ratio was observed during growth in MM glucose when the amount of carotenoids did not increase considerably. Again, no correlation was observed between mRNA levels and enzyme activity. The expression pattern of the crtS gene is similar in MM glucose and MM succinate; however, the maximum crtS mRNA expression was delayed in MM succinate with respect to MM glucose. The expression of the crtS gene in MM glucose began to increase simultaneously with the synthesis of carotenoids (Table 3A). In contrast, in MM succinate, crtS gene expression reached its maximum level after carotenoid synthesis had already started at the beginning of the growth cycle (Table 3B). These results show that an increase in the expression of the astaxanthin synthase gene does not precede the increase in carotenoid synthesis, suggesting the existence of carotenoid synthesis regulation mechanisms other than transcriptional regulation. Xanthophyll precursors are intermediary carotenoids that are the product of astaxanthin synthase (Verdoes, 2003; Ojima, 2006). The conversion of these precursors into astaxanthin is a measure of astaxanthin synthase activity and is reflected in the ratio of astaxanthin/precursors (Table 4A and B). Based on this ratio, the final astaxanthin synthase activity is higher in glucose than in succinate. This result demonstrates that xanthophyll precursors are being efficiently consumed in glucose, whereas they accumulate to relatively higher levels in succinate. It must be noted that the astaxanthin and xanthophyll precursor profiles are different under both culture conditions, despite the fact that the crtS gene expression patterns are very similar. This observation suggests that regulatory mechanisms that affect enzymatic activity could play a role at this point. Monocyclic carotenoid synthesis In certain situations, PDS can further desaturate lycopene, leading to the production of monocyclic carotenoids, such as didehydrolycopene, hydroxyl-ceto-torulene (HDCO) and torulene (Fig. 1) (An, 1999; Verdoes, 2003). PDS is a key enzyme in the carotenogenic pathway because it competes with PBS for lycopene and directs the flux towards astaxanthin or HDCO synthesis (Verdoes, 2003). High levels of the crtI gene product could be correlated with high amounts of monocyclic carotenoids. As shown in Table 4A and B, monocyclic carotenoids began to increase after the induction of carotenogenesis under both culture conditions. As the amount of monocyclic carotenoids is greater in succinate than in glucose, PDS activity should also be greater in succinate than in glucose. However, PDS activity does not correlate with the expression of the mature crtI transcript. Bioinformatic analysis of carotenoid gene promoters During growth in MM succinate, the production of carotenoids was greater compared with growth in MM glucose. Moreover, during growth in the presence of glucose, carotenogenesis was low and was triggered once glucose had been consumed. Therefore, we hypothesized that the expression of carotenogenic genes could be regulated by glucose. A transcription factor that plays a major role in glucose repression in yeast is Mig1 (MADS-box Transcription Factor Mig1). It binds to upstream sequences of glucose-repressed genes and specifically blocks their transcription in the presence of glucose (Rolland, 2002). We used the bioinformatics tool promo 2.0 (Farré, 2003) to analyze the region 1500 bp upstream of the translation initiation site (ATG) of each carotenogenic gene, in order to search for regulatory sequences. The database used was Transfac (Wingender, 1996). The bioinformatic analysis identified one Mig1-binding sequence in each of the regulatory regions of the crtYB and crtI genes (Fig. 4); this binding sequence was coincidently at equivalent distance from the translation initiation site of each gene. Moreover, two Mig1-binding sequences were found in the regulatory region of the crtS gene (Fig. 4). 4 View largeDownload slide Regulatory sequences found in the region upstream of the translation initiation site of the carotenogenic genes. The region 1500 bp upstream of the translation initiation site (ATG) of each gene was analyzed using the bioinformatics tool promo 2.0, in order to search for regulatory sequences. Distances are expressed in base pairs (bp). 4 View largeDownload slide Regulatory sequences found in the region upstream of the translation initiation site of the carotenogenic genes. The region 1500 bp upstream of the translation initiation site (ATG) of each gene was analyzed using the bioinformatics tool promo 2.0, in order to search for regulatory sequences. Distances are expressed in base pairs (bp). Discussion The present report demonstrates that, during the growth of X. dendrorhous in succinate, carotenogenesis starts at the beginning of the growth cycle, whereas in glucose, carotenogenesis is triggered once growth has ceased. These results demonstrate that the association of carotenogenesis with growth depends on the culture conditions. On the other hand, carotenoid production was enhanced by the addition of nonfermentable compounds such as succinate and ethanol to the culture medium. These results suggest that X. dendrorhous is sensitive to environmental factors such as the culture medium and are in agreement with published data demonstrating that nonfermentable carbon sources enhance carotenogenesis (Vázquez, 1997; Yamane, 1997a; An, 2001; Palágyi, 2001). The lower carotenoid content observed during fermentative growth in glucose can be related to glucose repression. The presence of Mig1 sequences in the promoter regions of exclusive carotenogenic genes suggests that catabolic repression could be operating in the carotenogenesis of this yeast. Moreover, although other compounds such as glycogen or acetic acid formed during fermentative growth began to be used after glucose exhaustion (Kruckeberg & Dickinson, 2004), they are not able to act as repressors and the glucose repression effect would be released anyway (Rolland, 2002). The catabolic pathway of nonfermentable carbon sources produces ROS as a consequence of aerobic metabolism (Nelson & Cox, 2000). Ethanol is produced by the fermentation of glucose, and once glucose is depleted from the culture medium, ethanol is metabolized by the yeast with the subsequent production of ROS (Kruckeberg & Dickinson, 2004). Xanthophyllomyces dendrorhous does not possess the cytosolic version of superoxide dismutase, and carotenoids may help to compensate for the lack of this enzyme by acting as scavengers of toxic oxidative compounds such as ROS (Schroeder & Johnson, 1993). Succinate is aerobically metabolized by the succinate dehydrogenase enzyme (Nelson & Cox, 2000). Guo & Lemire (2003) have both shown that the quinine-binding domain of this enzyme is itself a source of superoxide anions in vitro and demonstrated that an increased concentration of succinate resulted in greater production of superoxide anions. Furthermore, succinate is a central intermediate in the synthesis of the porphyrin ring of heme groups, which are oxygen carriers in hemoglobin and cytochromes of the electron transport chain (Nelson & Cox, 2000). Astaxanthin synthase is a cytochrome P450-type enzyme, and its synthesis can be stimulated by the presence of succinate. The expression of the carotenogenic genes in X. dendrorhous reaches a maximum between the end of the exponential phase and the beginning of the stationary phase. Maximum expression levels coincide with the induction of carotenoid biosynthesis in MM glucose but not in MM succinate. In MM glucose, the level of expression of carotenogenic genes decreases during the stationary phase, despite the fact that carotenoid production increases during this period. This pattern is not observed in the expression of the crtE and idi genes, which continue to be expressed at a high level during the stationary phase, most likely because these genes are not unique to the synthesis of carotenoids and their expression is required throughout the growth cycle (Stryer, 1999). Concerning the expression of crtI and crtYB genes in both carbon sources (glucose and succinate), the main differences in expression were identified in the expression of the alternatively spliced variants, which are notoriously delayed in MM succinate with respect to MM glucose. The expression of alternative transcripts could play a role in the regulation of carotenogenesis during growth in different carbon sources, for example by regulating the cellular concentration of carotenogenic enzymes in response to various physiological conditions. The crtYB ORF is restored downstream of the first ATG codon in the alternative transcript. In a previous work, we observed that the truncated mRNA was translated into an enzyme with residual phytoene synthase activity. This truncated enzyme was able to partially complement an Escherichia coli strain carrying the Erwinia uredovora carotenogenic gene cluster deleted in the crtB gene, which codes for the phytoene synthase (Niklitschek, 2008). This partial restoration suggests that the alternative transcript could be functional. Nevertheless, in vivo experiments are necessary to confirm this phenomenon. In both culture media, the expression of the mature crtI transcript peaks before the expression of the mature crtYB transcript. This result is quite surprising because the crtYB gene product is required before the crtI gene product to produce phytoene during carotenogenesis. Similarly, in MM succinate, the astaxanthin concentration increases before the increase in expression of the crtS gene, despite the fact that the crtS mRNA is detectable from the beginning of the growth cycle. These results suggest that maximal mRNA expression is not required for increasing carotenoid production. Inoculum cells could supply preformed carotenogenic enzymes, and the observed increase in astaxanthin concentration before the induction of crtS gene expression could be due to an increase in the activity of the enzyme already present in the cell or a decrease in the rate of its degradation. In this sense, previous studies have suggested the activation of carotenogenesis by ROS-generating compounds independently of transcription and translation in H. pluvialis (Kobayashi, 1993). This finding suggests that ROS could regulate activation of carotenoid synthesis at the level of enzymatic activity. Another kind of nontranscriptional regulation of carotenoid synthesis has been described in the unicellular alga Dunaliella bardawi. In D. bardawi, the concentration of β-carotene is regulated by end-product inhibition, not by an increase in either DNA transcription or the translation of the mRNA of the carotenogenic enzymes (Rabbani, 1998). The lack of correlation between mRNA expression and enzymatic activity is in marked contrast to many carotenogenic organisms in which carotenogenic genes increase their expression at the mRNA level upon the appropriate stimulation. This kind of transcriptional regulation has been extensively described in H. pluvialis (Steinbrenner & Linden, 2001) and Neurospora crassa (Schmidhauser, 1994). Xanthophyllomyces dendrorhous constitutes an exceptional organism in which transcriptional regulation of carotenoid genes is not at the first line of regulation. An understanding of the mechanisms involved in the genetic regulation of the carotenogenic genes in X. dendrorhous will increase our knowledge regarding the physiology of the carotenogenic process; this knowledge offers a very valuable tool for the development of a natural astaxanthin source for the aquaculture industry. Proteomic analyses need to be performed, and the enzymatic activity of carotenogenic enzymes should be determined in order to answer these questions. This work demonstrates that carotenogenesis of X. dendrorhous could be growth-associated depending on the growth conditions and that carotenogenesis could be considerably enhanced through the use of certain nonfermentable carbon sources, such as succinate. The transcriptional regulation of carotenogenic genes is able to only partially explain the carotenoid production profile: there is a lack of correlation between enhanced mRNA levels and carotenogenesis. Most likely, the data point to the existence of regulatory mechanisms that modulate enzymatic activity. Acknowledgements This work was supported by Fondecyt 1100324 and Deutscher Akademischer Austanschdienst (DAAD) through a graduate scholarship to A.W., MECESUP UCH0106 through a graduate scholarship to MN, and by Fundación María Ghilardi Venegas through a graduate scholarship to C.L. We would like to thank Prof. Gerhard Sandmann for help with the carotenoid HPLC analysis and quantification and Andreas Lück for expert technical assistance. Authors' contributions A.W. and C.L. contributed equally to this work. References Alcaíno J Barahona S Carmona M Lozano C Marcoleta A Niklitschek M Sepulveda D Baeza M Cifuentes V ( 2008) Cloning of the cytochrome p450 reductase (crtR) gene and its involvement in the astaxanthin biosynthesis of Xanthophyllomyces dendrorhous. BMC Microbiol  8: 169. Google Scholar CrossRef Search ADS PubMed  An GH ( 2001) Improved growth of the red yeast, Phaffia rhodozyma (Xanthophyllomyces dendrorhous), in the presence of tricarboxylic acid cycle intermediates. Biotechnol Lett  23: 1005– 1009. Google Scholar CrossRef Search ADS   An GH Schuman DB Johnson EA ( 1989) Isolation of Phaffia rhodozyma mutants with increased astaxanthin content. Appl Environ Microb  55: 116– 124. An GH Cho MH Johnson EA ( 1999) Monocyclic carotenoid biosynthetic pathway in the yeast Phaffia rhodozyma (Xanthophyllomyces dendrorhous). J Biosci Bioeng  88: 189– 193. Google Scholar CrossRef Search ADS PubMed  Andrewes A Phaff J Starr M ( 1976) Carotenoids of Phaffia rhodozyma. A red-pigmented fermenting yeast. Phytochemistry  15: 1003– 1007. Google Scholar CrossRef Search ADS   Calo P Gonzalez T ( 1995) The yeast Phaffia rhodozyma as an industrial source of astaxanthin. Microbiologia  11: 386– 388. Google Scholar PubMed  Chomczynski P Sacchi N ( 1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem  162: 156– 159. Google Scholar CrossRef Search ADS PubMed  de la Fuente JL Rodriguez-Saiz M Schleissner C Diez B Peiro E Barredo JL ( 2010) High-titer production of astaxanthin by the semi-industrial fermentation of Xanthophyllomyces dendrorhous. J Biotechnol  148: 144– 146. Google Scholar CrossRef Search ADS PubMed  Farré D Roset R Huerta M Adsuara J Roselló L Albà M Messeguer X ( 2003) Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res  31: 3651– 3653. Google Scholar CrossRef Search ADS PubMed  Flores-Cotera LB Martin R Sanchez S ( 2001) Citrate, a possible precursor of astaxanthin in Phaffia rhodozyma: influence of varying levels of ammonium, phosphate and citrate in a chemically defined medium. Appl Microbiol Biot  55: 341– 347. Google Scholar CrossRef Search ADS   Frengova GI Beshkova DM ( 2009) Carotenoids from Rhodotorula and Phaffia: yeasts of biotechnological importance. J Ind Microbiol Biot  36: 163– 180. Google Scholar CrossRef Search ADS   Guo J Lemire BD ( 2003) The ubiquinone-binding site of the Saccharomyces cerevisiae succinate–ubiquinone oxidoreductase is a source of superoxide. J Biol Chem  278: 47629– 47635. Google Scholar CrossRef Search ADS PubMed  Higuera-Ciapara I Felix-Valenzuela L Goycoolea FM ( 2006) Astaxanthin: a review of its chemistry and applications. Crit Rev Food Sci  46: 185– 196. Google Scholar CrossRef Search ADS   Hu ZC Zheng YG Wang Z Shen YC ( 2005) Effect of sugar-feeding strategies on astaxanthin production by Xanthophyllomyces dendrorhous. Microbiol Biotechnol  21: 771– 775. Google Scholar CrossRef Search ADS   Hu ZC Zheng YG Wang Z Shen YC ( 2006) pH Control strategy in astaxanthin fermentation bioprocess by Xanthophyllomyces dendrorhous. Enzyme Microb Tech  39: 586– 590. Google Scholar CrossRef Search ADS   Kajiwara S Fraser PD Kondo K Misawa N ( 1997) Expression of an exogenous isopentenyl diphosphate isomerase gene enhances isoprenoid biosynthesis in Escherichia coli. Biochem J  324: 421– 426. Google Scholar CrossRef Search ADS PubMed  Kim SK Lee JH Lee CH Yoon YC ( 2007) Increased carotenoid production in Xanthophyllomyces dendrorhous G276 using plant extracts. J Microbiol  45: 128– 132. Google Scholar PubMed  Kobayashi M Kakizono T Nagai S ( 1993) Enhanced carotenoid biosynthesis by oxidative stress in acetate-induced cyst cells of a green unicellular alga, Haematococcus pluvialis. Appl Environ Microb  59: 867– 873. Kruckeberg A Dickinson R ( 2004) Carbon metabolism. The Metabolism and Molecular Physiology of Sacharomyces cerevisiae  ( Dickinson R Schweizer M, eds), pp. 42– 103. CRC Press, Boca Raton, FL. Google Scholar CrossRef Search ADS   Kusdiyantini E Gaudin P Goma G Blanc P ( 1998) Growth kinetics and astaxanthin production of Phaffia rhodozyma on glycerol as a carbon source during batch fermentation. Biotechnol Lett  20: 929– 934. Google Scholar CrossRef Search ADS   Lewis MJ Ragot N Berlant MC Miranda M ( 1990) Selection of astaxanthin-overproducing mutants of Phaffia rhodozyma with beta-ionone. Appl Environ Microb  56: 2944– 2945. Liu YS Wu JY ( 2008) Modeling of Xanthophyllomyces dendrorhous growth on glucose and overflow metabolism in batch and fed-batch cultures for astaxanthin production. Biotechnol Bioeng  101: 996– 1004. Google Scholar CrossRef Search ADS PubMed  Liu YS Wu JY Ho KP ( 2006) Characterization of oxygen transfer conditions and their effects on Phaffia rhodozyma growth and carotenoid production in shake-flask cultures. Biochem Eng J  27: 331– 335. Google Scholar CrossRef Search ADS   Lodato P Alcaino J Barahona S Retamales P Cifuentes V ( 2003) Alternative splicing of transcripts from crtI and crtYB genes of Xanthophyllomyces dendrorhous. Appl Environ Microb  69: 4676– 4682. Google Scholar CrossRef Search ADS   Lodato P Alcaino J Barahona S Retamales P Jimenez A Cifuentes V ( 2004) Study of the expression of carotenoid biosynthesis genes in wild-type and deregulated strains of Xanthophyllomyces dendrorhous (Ex.: Phaffia rhodozyma). Biol Res  37: 83– 93. Google Scholar CrossRef Search ADS PubMed  Lodato P Alcaino J Barahona S Niklitschek M Carmona M Wozniak A Baeza M Jimenez A Cifuentes V ( 2007) Expression of the carotenoid biosynthesis genes in Xanthophyllomyces dendrorhous. Biol Res  40: 73– 84. Google Scholar CrossRef Search ADS PubMed  Lorenz RT Cysewski GR ( 2000) Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol  18: 160– 167. Google Scholar CrossRef Search ADS PubMed  Marone M Mozzetti S De Ritis D Pierelli L Scambia G ( 2001) Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample. Biol Proced Online  3: 19– 25. Google Scholar CrossRef Search ADS PubMed  Nelson D Cox M Lehninger AL ( 2000) Principles of Biochemistry . Freeman W.H., New York. Niklitschek M Alcaino J Barahona S et al.   ( 2008) Genomic organization of the structural genes controlling the astaxanthin biosynthesis pathway of Xanthophyllomyces dendrorhous. Biol Res  41: 93– 108. Google Scholar CrossRef Search ADS PubMed  Ojima K Breitenbach J Visser H Setoguchi Y Tabata K Hoshino T van den Berg J Sandmann G ( 2006) Cloning of the astaxanthin synthase gene from Xanthophyllomyces dendrorhous (Phaffia rhodozyma) and its assignment as a beta-carotene 3-hydroxylase/4-ketolase. Mol Genet Genomics  275: 148– 158. Google Scholar CrossRef Search ADS PubMed  Palágyi Z Ferenczy L Vágvölgyi C ( 2001) Carbon-source assimilation pattern of the astaxanthin-producing yeast Phaffia rhodozyma. World J Microb Biot  17: 95– 97. Google Scholar CrossRef Search ADS   Rabbani S Beyer P Lintig J Hugueney P Kleinig H ( 1998) Induced beta-carotene synthesis driven by triacylglycerol deposition in the unicellular alga Dunaliella bardawi. Plant Physiol  116: 1239– 1248. Google Scholar CrossRef Search ADS PubMed  Rasband WS ( 2008) ImageJ. U.S. National Institutes of Health, Bethesda, MD . Retamales P Leon R Martinez C Hermosilla G Pincheira G Cifuentes V ( 1998) Complementation analysis with new genetic markers in Phaffia rhodozyma. Antonie van Leeuwenhoek  73: 229– 236. Google Scholar CrossRef Search ADS PubMed  Retamales P Hermosilla G Leon R Martinez C Jimenez A Cifuentes V ( 2002) Development of the sexual reproductive cycle of Xanthophyllomyces dendrorhous. J Microbiol Meth  48: 87– 93. Google Scholar CrossRef Search ADS   Rodríguez-Saiz M de la Fuente JL Barredo JL ( 2010) Xanthophyllomyces dendrorhous for the industrial production of astaxanthin. Appl Microbiol Biot  88: 645– 658. Google Scholar CrossRef Search ADS   Rolland F Winderickx J Thevelein JM ( 2002) Glucose-sensing and -signalling mechanisms in yeast. FEMS Yeast Res  2: 183– 201. Google Scholar CrossRef Search ADS PubMed  Sambrook J Fritsch E Maniatis T ( 2001) Molecular Cloning: A Laboratory Manual , 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schmidhauser TJ Lauter FR Schumacher M Zhou W Russo VE Yanofsky C ( 1994) Characterization of al-2, the phytoene synthase gene of Neurospora crassa. Cloning, sequence analysis, and photoregulation. J Biol Chem  269: 12060– 12066. Google Scholar PubMed  Schroeder WA Johnson EA ( 1993) Antioxidant role of carotenoids in Phaffia rhodozyma. J Gen Microbiol  139: 907– 912. Google Scholar CrossRef Search ADS   Schroeder WA Johnson EA ( 1995) Singlet oxygen and peroxyl radicals regulate carotenoid biosynthesis in Phaffia rhodozyma. J Biol Chem  270: 18374– 18379. Google Scholar CrossRef Search ADS PubMed  Steinbrenner J Linden H ( 2001) Regulation of two carotenoid biosynthesis genes coding for phytoene synthase and carotenoid hydroxylase during stress-induced astaxanthin formation in the green alga Haematococcus pluvialis. Plant Physiol  125: 810– 817. Google Scholar CrossRef Search ADS PubMed  Stryer L ( 1999) Biochemistry . W. H. Freeman and Company, New York. Ukibe K Katsuragi T Tani Y Takagi H ( 2008) Efficient screening for astaxanthin-overproducing mutants of the yeast Xanthophyllomyces dendrorhous by flow cytometry. FEMS Microbiol Lett  286: 241– 248. Google Scholar CrossRef Search ADS PubMed  Vázquez M Santos V Parajó JC ( 1997) Effect of the carbon source on the carotenoid profiles of Phaffia rhodozyma strains. J Ind Microbiol Biot  19: 263– 268. Google Scholar CrossRef Search ADS   Verdoes JC Krubasik KP Sandmann G van Ooyen AJ ( 1999a) Isolation and functional characterisation of a novel type of carotenoid biosynthetic gene from Xanthophyllomyces dendrorhous. Mol Gen Genet  262: 453– 461. Google Scholar CrossRef Search ADS   Verdoes JC Misawa N van Ooyen AJ ( 1999b) Cloning and characterization of the astaxanthin biosynthetic gene encoding phytoene desaturase of Xanthophyllomyces dendrorhous. Biotechnol Bioeng  63: 750– 755. Google Scholar CrossRef Search ADS   Verdoes JC Sandmann G Visser H Diaz M van Mossel M van Ooyen AJ ( 2003) Metabolic engineering of the carotenoid biosynthetic pathway in the yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma). Appl Environ Microb  69: 3728– 3738. Google Scholar CrossRef Search ADS   Vogel HJ ( 1956) A convenient growth medium for Neurospora (medium N). Microbiol Genet Bull  13: 42– 43. Vustin MM Belykh EN Kishilova SA ( 2004) Relationship between astaxanthin production and the intensity of anabolic processes in the yeast Phaffia rhodozyma. Mikrobiologiia  73: 751– 757. Google Scholar PubMed  Wang W Yu L Zhou P ( 2006) Effects of different fungal elicitors on growth, total carotenoids and astaxanthin formation by Xanthophyllomyces dendrorhous. Bioresource Technol  97: 26– 31. Google Scholar CrossRef Search ADS   Wingender E Dietze P Karas H Knuppel R ( 1996) TRANSFAC: a database on transcription factors and their DNA binding sites. Nucleic Acids Res  24: 238– 241. Google Scholar CrossRef Search ADS PubMed  Wu TH Liao JH Hou WC Huang FY Maher TJ Hu CC ( 2006) Astaxanthin protects against oxidative stress and calcium-induced porcine lens protein degradation. J Agr Food Chem  54: 2418– 2423. Google Scholar CrossRef Search ADS   Yamane Y Higashida K Nakashimada Y Kakizono T Nishio N ( 1997a) Astaxanthin production by Phaffia rhodozyma enhanced in fed-batch culture with glucose and ethanol feeding. Biotechnol Lett  19: 1109– 1111. Google Scholar CrossRef Search ADS   Yamane Y Higashida K Nakashimada Y Kakizono T Nishio N ( 1997b) Influence of oxygen and glucose on primary metabolism and astaxanthin production by Phaffia rhodozyma in batch and fed-batch cultures: kinetic and stoichiometric analysis. Appl Environ Microb  63: 4471– 4478. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved
TI - Differential carotenoid production and gene expression in Xanthophyllomyces dendrorhous grown in a nonfermentable carbon source
JO - FEMS Yeast Research
DO - 10.1111/j.1567-1364.2010.00711.x
DA - 2011-05-01
UR - https://www.deepdyve.com/lp/oxford-university-press/differential-carotenoid-production-and-gene-expression-in-8c8VifjNdb
SP - 252
EP - 262
VL - 11
IS - 3
DP - DeepDyve
ER -