TY - JOUR
AU - Monget,, Philippe
AB - Abstract In this study, we aimed to determine the origin of the difference, in terms of anti-Müllerian hormone production, existing between the bovine and porcine ovaries. We first confirmed by quantitative real-time-Polymerase-Chain Reaction, ELISA assay and immunohistochemistry that anti-Müllerian hormone mRNA and protein production are very low in porcine ovarian growing follicles compared to bovine ones. We then have transfected porcine and bovine granulosa cells with vectors containing the luciferase gene driven by the porcine or the bovine anti-Müllerian hormone promoter. These transfection experiments showed that the porcine anti-Müllerian hormone promoter is less active and less responsive to bone morphogenetic protein stimulations than the bovine promoter in both porcine and bovine cells. Moreover, bovine but not porcine granulosa cells were responsive to bone morphogenetic protein stimulation after transfection of a plasmidic construction including a strong response element to the bone morphogenetic proteins (12 repetitions of the GCCG sequence) upstream of the luciferase reporter gene. We also showed that SMAD6, an inhibitor of the SMAD1-5-8 pathway, is strongly expressed in porcine compared to the bovine granulosa cells. Overall, these results suggest that the low expression of anti-Müllerian hormone in porcine growing follicles is due to both a lack of activity/sensitivity of the porcine anti-Müllerian hormone promoter, and to the lack of responsiveness of porcine granulosa cells to bone morphogenetic protein signaling, potentially due to an overexpression of SMAD6 compared to bovine granulosa cells. We propose that the low levels of anti-Müllerian hormone in the pig would explain the poly-ovulatory phenotype in this species. Introduction In mammalian females, the anti-Müllerian hormone (AMH) plays an inhibitory role in the activation of primordial ovarian follicles, the growth of small preantral follicles, and modulates the FSH sensitivity of antral follicles, thus inhibiting their maturation into preovulatory follicles [1–3]. In males, AMH secreted by Sertoli cells of the testis is known to inhibit müllerian ducts development during sexual differentiation. Following the deletion of Amh, female mice exhibit a short period of overdevelopment of ovarian follicles leading to the early depletion of their stock of primordial follicles [4]. Moreover, in humans, a decrease in AMH bioactivity due to a loss of function mutation has been associated with premature ovarian failure [5]. Anti-Müllerian hormone is expressed and secreted specifically by the granulosa cells of growing ovarian follicles as early as the primary follicle stage, as shown in sheep [6], humans [7–9], mouse [10], cattle [11] and pigs [12], and its expression is known to be stimulated by the bone morphogenetic proteins (BMP) [13–16]. The maximal expression level of AMH is observed in the granulosa cells of small antral follicles of 1–3 mm diameter in sheep and pigs, and 3–5 mm diameter in cattle and humans [17, 18]. The current assumption is that AMH mediates the inhibition exerted by the growing follicles on the primordial follicles, and is thus considered as the guardian of ovarian reserve. In mammals, the development of ovarian follicles exhibits important differences between species with a low ovulation rate (or = 1–2) such as humans, cattle and sheep, and species with natural poly-ovulation such as mice (or = 6–10) and pigs (or = 15–25). In particular, there are huge differences between a cow and a sow, the ovaries of the latter presenting a very large number of growing follicles compared to the former [19, 20]. Preliminary experiments suggested that the pig ovarian follicular fluid of growing follicles contains low concentrations of AMH in comparison with cattle and sheep [17], and with humans [18, 21]. We, therefore, hypothesized that AMH mRNA and protein production would be decreased in porcine ovarian follicles compared to bovine ovarian follicles. The objective of the present study was to confirm that the expression of AMH mRNA and protein is truly lower in porcine compared to bovine granulosa cells. We aimed also to study if this difference could be due to a difference between species in the functionality of AMH promoters, and/or in the ability of granulosa cells to sustain the activity of the AMH promoter and to respond to a BMP stimulation. For this purpose, we have cloned promoters of the AMH gene of both species upstream of the luciferase reporter gene, and we have transfected bovine and porcine granulosa cells with each of these two plasmids. Materials and methods Animals and tissue collection All procedures were approved by the Agricultural and Scientific Research Government Committees (approval number C37-175-2) in accordance with the guidelines for Care and Use of Agricultural Animals in Agricultural Research and Teaching. All the organs used in this study were collected from animals at a local slaughterhouse. Bovine ovaries were recovered from crossbred adult cows and porcine ovaries from Large White adult gilts. Porcine fetal testes were obtained from a Large White sow slaughtered at day 30 of gestation. The organs were collected immediately after slaughtering. Ovarian and testicular fragments were fixed in Bouin fixative for further AMH immunohistochemistry experiments. Then, the ovaries were dissected to isolate antral follicles equal to or larger than 1 mm in diameter. Follicles were allocated to 4 size classes in cattle, corresponding to follicle growth (1–3 mm and 3–5 mm follicles), selection (5–10 mm follicles), and dominance stage (follicles > 10 mm, including follicles up to 15 mm in diameter). In pig, 3 size classes were defined, corresponding to follicle growth (1–3 mm follicles), selection (3–5 mm follicles), and dominance stage (follicles > 5 mm, including follicles up to 8 mm in diameter). For follicular fluid recovery, the ovaries of eight cows and five pigs were used. Follicular fluids from large follicles (>5 mm) were recovered individually by puncture. For smaller follicles, due to their small size, the follicular fluids recovered from each ovary were pooled. Granulosa cells were also recovered in McCoy’s 5A medium (Sigma-Aldrich France) from 3–5 mm bovine follicles and 1–3 mm follicles porcine follicles by gently scraping the interior surfaces of the slit open follicles with a platinum loop, as previously described [22], before their immediate use for real-time quantitative PCR (RT-qPCR) experiments to measure the levels of gene expression and for transfection experiments. Follicular fluid and granulosa cell samples were stored at −80°C for further analysis. Anti-Müllerian hormone assay Anti-Müllerian hormone concentrations in follicular fluids were determined using the AMH Gen II ELISA kit (Beckman Coulter France), which was validated for the analysis of bovine and porcine samples [17, 23, 24]. Anti-Müllerian hormone concentrations were determined in 20 μl of follicular fluid diluted 1:1000 for bovine follicles < 5 mm, 1:100 or 1:10 for bovine follicles > 5 mm in diameter, and 1:10 or undiluted for all porcine follicles. In our working conditions, the limit of detection of the assay was found to be 50 pg/ml. The intra-assay coefficients of variation (SEM/mean) were 11.8% and 3.6%, for quality control bovine plasma samples containing 33- and 125-pg/ml AMH, respectively. Anti-Müllerian hormone immunohistochemistry The fragments of bovine and porcine ovaries and the porcine fetal testes were embedded in paraffin and serially sectioned at a thickness of 7 μm with a microtome. Histological and AMH immunohistochemistry analyses were performed on adjacent sections. In histological analysis of hematoxylin-stained ovarian sections, follicles were judged healthy when no pyknosis was found in granulosa cells. Immunohistochemistry experiments were run concomitantly on bovine and porcine ovarian sections, after incubation of the sections in citrate-based antigen unmasking solution (Vector Laboratories, Burlingame, VT) for 4 min in a microwave, as previously described [25]. The rabbit polyclonal antibody raised against human AMH (antibody L40), previously shown to recognize the N-terminal region of AMH [26, 27], was used as the primary antibody suitable for the bovine and the porcine species after dilution at 1:16 000. The secondary antibody was the biotinylated horse anti-mouse/rabbit IgG (Vector Laboratories) diluted 1:800. The avidin-peroxidase conjugate from Vectastain Elite ABC kit (Vector Laboratories) was used for signal amplification before staining revelation. Negative control sections involved the replacement of the primary antibody by rabbit IgG. Sections of porcine fetal testes were used as positive control sections for the porcine species. Quantification of immunostaining was performed using ImageJ (Rasband, WS, ImageJ, U.S. National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997–2015) on photomicrographs of ovarian sections by measuring absorbance in the granulosa layers of different healthy bovine and porcine follicles and in the Sertoli cells of porcine fetal testes. Real-time quantitative PCR (RT-qPCR) Samples of granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were analyzed for mRNA content of AMH and factors involved in BMP signaling. Total RNA was extracted from granulosa cell samples with a Nucleospin RNA II kit (Macherey-Nagel) according to the protocol of the manufacturer. Then, 1 μg of RNA was reverse transcribed, and RT-qPCRs were run using SYBR Green Supermix on an iCycler iQ multicolor detection system (Bio-Rad) as previously described [23]. The specific primer sequences used for amplification are listed in Table 1. For each primer pair, amplification efficiency (E) was measured as described (Monniaux et al., 2008). Amplification efficiencies of the primer pairs chosen for the studied genes varied between 1.8 and 2.2. The cycle threshold (Ct) of the target gene was compared with that of the RPL19 internal reference mRNA encoding a ubiquitous ribosomal protein, and the mRNA relative level was estimated by the ratio R = 100 × [ERPL19Ct (RPL19)/EtargetCt (target)]. Table 1 Quantitative PCR primer sequences Species . Cow . Pig . Gene . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . AMH GTGGTGCTGCTGCTAAAGATG TCGGACAGGCTGATGAGGAG GACATATCAAGCCAACAAC ATCTTAAGCAGAAGCACC BMPR1A TGTCGGACCAACTTATGTAACC TGAGCAAAGCCAGCCATCG GTATCACAGGAGGAATAGTAG TTCAACCATCTTAGCAAGT BMPR1B AGATTGGAAAAGGTCGCTATG CGAGTGTTGGGTGGTATG CAGACAGTGTTGATGAGG GGTGGACTTCAGGTAATC BMPR2 GATGAAGGTGTTCTGGAT GATTGCTGTTGTTGTTGT TTAATTCCAGTCCTGATGAG GGATTGCTGTTGTTGTTAT SMAD1 GCCTTCAGAAATCAACAG GTAGACAATAGAGCACCAG CCCTCAGAAATCAACAGA GTAGACAATAGAGCACCAG SMAD6 TCTGATTCCACATTGTCTTA CTGAGGTAGGTCGTAGAA CCACATTGTCTTACACTGA CTGAGGTAGGTCGTAGAA STAMBP AACACCGAGAATGAAGAAG TAGGTCAACACTGGAGAG GCAACACTGAGAATGAAG TATAGACTCTGGCAACATC UBE2O CCACTTCTGCTACCTCTC GTTCGTTCACCAGGATTAG CTGTATGACAACGGGAAG CATTCACCAGGATGAGAC RPL19 ATCGCCAATGCCAACTC CCTTTCGCTTACCTATACC AAGAAGGAGGAAATCATCAA ATCTATGTAACTGCCAAGG Species . Cow . Pig . Gene . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . AMH GTGGTGCTGCTGCTAAAGATG TCGGACAGGCTGATGAGGAG GACATATCAAGCCAACAAC ATCTTAAGCAGAAGCACC BMPR1A TGTCGGACCAACTTATGTAACC TGAGCAAAGCCAGCCATCG GTATCACAGGAGGAATAGTAG TTCAACCATCTTAGCAAGT BMPR1B AGATTGGAAAAGGTCGCTATG CGAGTGTTGGGTGGTATG CAGACAGTGTTGATGAGG GGTGGACTTCAGGTAATC BMPR2 GATGAAGGTGTTCTGGAT GATTGCTGTTGTTGTTGT TTAATTCCAGTCCTGATGAG GGATTGCTGTTGTTGTTAT SMAD1 GCCTTCAGAAATCAACAG GTAGACAATAGAGCACCAG CCCTCAGAAATCAACAGA GTAGACAATAGAGCACCAG SMAD6 TCTGATTCCACATTGTCTTA CTGAGGTAGGTCGTAGAA CCACATTGTCTTACACTGA CTGAGGTAGGTCGTAGAA STAMBP AACACCGAGAATGAAGAAG TAGGTCAACACTGGAGAG GCAACACTGAGAATGAAG TATAGACTCTGGCAACATC UBE2O CCACTTCTGCTACCTCTC GTTCGTTCACCAGGATTAG CTGTATGACAACGGGAAG CATTCACCAGGATGAGAC RPL19 ATCGCCAATGCCAACTC CCTTTCGCTTACCTATACC AAGAAGGAGGAAATCATCAA ATCTATGTAACTGCCAAGG Open in new tab Table 1 Quantitative PCR primer sequences Species . Cow . Pig . Gene . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . AMH GTGGTGCTGCTGCTAAAGATG TCGGACAGGCTGATGAGGAG GACATATCAAGCCAACAAC ATCTTAAGCAGAAGCACC BMPR1A TGTCGGACCAACTTATGTAACC TGAGCAAAGCCAGCCATCG GTATCACAGGAGGAATAGTAG TTCAACCATCTTAGCAAGT BMPR1B AGATTGGAAAAGGTCGCTATG CGAGTGTTGGGTGGTATG CAGACAGTGTTGATGAGG GGTGGACTTCAGGTAATC BMPR2 GATGAAGGTGTTCTGGAT GATTGCTGTTGTTGTTGT TTAATTCCAGTCCTGATGAG GGATTGCTGTTGTTGTTAT SMAD1 GCCTTCAGAAATCAACAG GTAGACAATAGAGCACCAG CCCTCAGAAATCAACAGA GTAGACAATAGAGCACCAG SMAD6 TCTGATTCCACATTGTCTTA CTGAGGTAGGTCGTAGAA CCACATTGTCTTACACTGA CTGAGGTAGGTCGTAGAA STAMBP AACACCGAGAATGAAGAAG TAGGTCAACACTGGAGAG GCAACACTGAGAATGAAG TATAGACTCTGGCAACATC UBE2O CCACTTCTGCTACCTCTC GTTCGTTCACCAGGATTAG CTGTATGACAACGGGAAG CATTCACCAGGATGAGAC RPL19 ATCGCCAATGCCAACTC CCTTTCGCTTACCTATACC AAGAAGGAGGAAATCATCAA ATCTATGTAACTGCCAAGG Species . Cow . Pig . Gene . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . Forward sequence 5′ → 3’ . Reverse sequence 5′ → 3’ . AMH GTGGTGCTGCTGCTAAAGATG TCGGACAGGCTGATGAGGAG GACATATCAAGCCAACAAC ATCTTAAGCAGAAGCACC BMPR1A TGTCGGACCAACTTATGTAACC TGAGCAAAGCCAGCCATCG GTATCACAGGAGGAATAGTAG TTCAACCATCTTAGCAAGT BMPR1B AGATTGGAAAAGGTCGCTATG CGAGTGTTGGGTGGTATG CAGACAGTGTTGATGAGG GGTGGACTTCAGGTAATC BMPR2 GATGAAGGTGTTCTGGAT GATTGCTGTTGTTGTTGT TTAATTCCAGTCCTGATGAG GGATTGCTGTTGTTGTTAT SMAD1 GCCTTCAGAAATCAACAG GTAGACAATAGAGCACCAG CCCTCAGAAATCAACAGA GTAGACAATAGAGCACCAG SMAD6 TCTGATTCCACATTGTCTTA CTGAGGTAGGTCGTAGAA CCACATTGTCTTACACTGA CTGAGGTAGGTCGTAGAA STAMBP AACACCGAGAATGAAGAAG TAGGTCAACACTGGAGAG GCAACACTGAGAATGAAG TATAGACTCTGGCAACATC UBE2O CCACTTCTGCTACCTCTC GTTCGTTCACCAGGATTAG CTGTATGACAACGGGAAG CATTCACCAGGATGAGAC RPL19 ATCGCCAATGCCAACTC CCTTTCGCTTACCTATACC AAGAAGGAGGAAATCATCAA ATCTATGTAACTGCCAAGG Open in new tab Figure 1 Open in new tabDownload slide Expression of AMH in bovine and porcine ovaries. (A) Intra-follicular concentrations of AMH in antral follicles. Cow and pig ovaries were dissected to recover follicles at least 1 mm in diameter. Follicles were allocated to 4 size classes in cow (the last class including follicles up to 15 mm in diameter) and 3 size classes in pig (the last class including follicles up to 8 mm in diameter). Within each species, intra-follicular AMH concentrations between the different size classes of follicles were compared using ANOVA after log transformation to homogenize variances; different letters indicate significant differences (P < 0.05) between follicular classes within cow (n = 8) and pig (n = 5) species. (B) Immunostaining of AMH in follicular wall of antral follicles. Immunohistochemistry experiments (top row) were performed simultaneously on cow and pig ovarian sections. The figure shows AMH immunostaining in the granulosa cells of two representative 3–5 mm cow healthy follicles and two representative 1–3 mm pig healthy follicles, and in the Sertoli cells of a testis recovered on a 30-days-old pig fetus (positive control). The negative controls are not shown. Bottom row: hematoxylin-stained sections. A: antrum, G: granulosa, T: theca, and S: Sertoli cells. Bar = 100 μm. (C) Immunostaining levels of AMH in granulosa cells. Quantification was performed on photomicrographs of ovarian sections by measuring absorbance in the granulosa layers (G) of different healthy cow and pig follicles. Non-specific labeling (ns) was measured on granulosa layers in sections incubated with non-specific IgG (negative control) and the measurement of labeling in Sertoli cells (S) served as positive control in pig. AMH immunostaining was compared between the different cell types using ANOVA; no common letters indicate significant differences (P < 0.05). (D) Levels of AMH mRNA, determined in 9 and 12 pools of granulosa cells recovered, respectively, from 3 to 5 mm follicles in cow and 1–3 mm follicles in pig ovaries. In each species, AMH mRNA accumulation was studied by reverse transcription and quantitative PCR and represented as mRNA relative level, using RPL19 as an internal reference. Comparison between species was done using t-test, with Welch’s correction for variance heterogeneity; ***P < 0.001, pig vs. cow. Figure 1 Open in new tabDownload slide Expression of AMH in bovine and porcine ovaries. (A) Intra-follicular concentrations of AMH in antral follicles. Cow and pig ovaries were dissected to recover follicles at least 1 mm in diameter. Follicles were allocated to 4 size classes in cow (the last class including follicles up to 15 mm in diameter) and 3 size classes in pig (the last class including follicles up to 8 mm in diameter). Within each species, intra-follicular AMH concentrations between the different size classes of follicles were compared using ANOVA after log transformation to homogenize variances; different letters indicate significant differences (P < 0.05) between follicular classes within cow (n = 8) and pig (n = 5) species. (B) Immunostaining of AMH in follicular wall of antral follicles. Immunohistochemistry experiments (top row) were performed simultaneously on cow and pig ovarian sections. The figure shows AMH immunostaining in the granulosa cells of two representative 3–5 mm cow healthy follicles and two representative 1–3 mm pig healthy follicles, and in the Sertoli cells of a testis recovered on a 30-days-old pig fetus (positive control). The negative controls are not shown. Bottom row: hematoxylin-stained sections. A: antrum, G: granulosa, T: theca, and S: Sertoli cells. Bar = 100 μm. (C) Immunostaining levels of AMH in granulosa cells. Quantification was performed on photomicrographs of ovarian sections by measuring absorbance in the granulosa layers (G) of different healthy cow and pig follicles. Non-specific labeling (ns) was measured on granulosa layers in sections incubated with non-specific IgG (negative control) and the measurement of labeling in Sertoli cells (S) served as positive control in pig. AMH immunostaining was compared between the different cell types using ANOVA; no common letters indicate significant differences (P < 0.05). (D) Levels of AMH mRNA, determined in 9 and 12 pools of granulosa cells recovered, respectively, from 3 to 5 mm follicles in cow and 1–3 mm follicles in pig ovaries. In each species, AMH mRNA accumulation was studied by reverse transcription and quantitative PCR and represented as mRNA relative level, using RPL19 as an internal reference. Comparison between species was done using t-test, with Welch’s correction for variance heterogeneity; ***P < 0.001, pig vs. cow. Gene constructs The bovine AMH proximal promoter (−703, +1) bp upstream of the AMH transcription start site, hereafter named bovine AMH promoter, was inserted upstream of a luciferase (Luc) reporter gene as previously described [28]. Briefly, A 703-bp fragment of the 5′-flanking region of the bovine AMH gene (position −703 relative to the major transcriptional initiation site) was obtained by PCR from a bacterial artificial chromosome (BAC) containing the AMH gene (kindly provided by the CRB GADIE; http://abridge.inra.fr/crb-gadie/). The promoter was subcloned in the pGEMT plasmid (pGEM®-T Easy Vector Systems; Promega) using primers with SacI and NheI restriction sites (indicated in underlined characters in the primer sequences), respectively, in the 5′ and the 3’ AMH promoter sequence (Primer Up with SacI: CGCGAGCTCGAACTGGACTGCTGTGTCAACCTG and Primer Dn with NheI: GCCCCTGGAAGCTGCTAGCTAG). From this plasmidic construct, the sequence was isolated by restriction enzyme digestion using SacI and NheI, and the resulting construct was subcloned between SacI and NheI sites of the Luc reporter vector pGL3 (Promega Corp., Madison, WI) to obtain (−703, +1) bovine AMH-Luc plasmids. The same procedure was applied for the porcine AMH proximal promoter (−766, +1), by using the Primer up: CGCGAGCTCTTCCTGTGTTCCACCCTTGG and the Primer Down: ATCCTGGCACTTTGAGGGGCGCTAGCTAG, and the insert obtained after PCR from the BAC was directly cloned in the pGL3 vector. We have not cloned promoters of longer size because, in both species, above 750 bp is located an upstream gene (SF3A2). The human AMH proximal promoter (−423, +1) inserted upstream of a luciferase reporter gene, as designed previously [28], was used as an AMH promoter control in transfection experiments. The CMV-GFP (human cytomegalovirus-driven expression of enhanced green fluorescent protein), CMV-Luc (human cytomegalovirus-driven expression of luciferase), and TK-Luc (thymidine kinase-driven expression of luciferase) constructs were used as control constructs to validate the transfection conditions and their efficiency for bovine and porcine granulosa cells. The BMP-sensitive reporter construct 12GCCG-Luc (12xGCCG inserted upstream of the luciferase reporter gene, [29]) and a SMAD1 expression vector encoding a flag-tagged murine Smad1 inserted into the pcdef3 vector [30] were used as control constructs when co-transfected to test the responsiveness of bovine and porcine granulosa cells to BMP4, as previously described [31]. Figure 2 Open in new tabDownload slide Transfection efficiency in bovine and porcine granulosa cells. Granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were seeded in 24-well plates at 250 000 cells/well. After 48 h of culture, cells were transfected with CMV-GFP, CMV-Luc or TK-Luc constructs. After transfection, cells were cultured in serum-free conditions for 24 h before counting (A), flow cytometry analysis for the determination of the percentage of GFP positive cells (B), or the measurement of their luciferase activity, which was then normalized using the percentage of GFP positive cells and expressed per 10 000 effectively transfected cells (C and D). The figure depicts the results of 12 independent experiments. Comparisons between species were done using t-test, with Welch’s correction for variance heterogeneity. For comparison of percentages, data were analyzed using t-test after arcsine transformation. **P < 0.01, pig vs. cow. Figure 2 Open in new tabDownload slide Transfection efficiency in bovine and porcine granulosa cells. Granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were seeded in 24-well plates at 250 000 cells/well. After 48 h of culture, cells were transfected with CMV-GFP, CMV-Luc or TK-Luc constructs. After transfection, cells were cultured in serum-free conditions for 24 h before counting (A), flow cytometry analysis for the determination of the percentage of GFP positive cells (B), or the measurement of their luciferase activity, which was then normalized using the percentage of GFP positive cells and expressed per 10 000 effectively transfected cells (C and D). The figure depicts the results of 12 independent experiments. Comparisons between species were done using t-test, with Welch’s correction for variance heterogeneity. For comparison of percentages, data were analyzed using t-test after arcsine transformation. **P < 0.01, pig vs. cow. Figure 3 Open in new tabDownload slide Functionality of the bovine and porcine AMH promoters, transfected in bovine and porcine granulosa cells. Granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were seeded in 24-well plates at 250 000 cells/well. After 48 h of culture, cells were transfected with a bovine or a porcine AMH reporter gene construct. The constructs consisted of 703 bp from the bovine AMH promoter and 766 bp from the porcine AMH promoter, both inserted upstream of the luciferase reporter gene. Homologous (cells transfected with the promoter from the same animal species) and heterologous (porcine cells transfected with bovine promoter, and the reverse) transfections were performed in each experiment. After transfection, cells were cultured in serum-free conditions for 24 h in control medium (Ctrl, cells cultured without ligand) or with human BMP4 (50 ng/ml) in triplicate, before the measurement of their luciferase activity. Results represent the mean luciferase activity, expressed per 10 000 effectively transfected cells, of eight independent culture experiments with bovine and porcine granulosa cells. Within each panel, results were analyzed by two-way ANOVA, in order to estimate the BMP4 and the culture effect; *P < 0.05, BMP4 vs. Ctrl. Figure 3 Open in new tabDownload slide Functionality of the bovine and porcine AMH promoters, transfected in bovine and porcine granulosa cells. Granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were seeded in 24-well plates at 250 000 cells/well. After 48 h of culture, cells were transfected with a bovine or a porcine AMH reporter gene construct. The constructs consisted of 703 bp from the bovine AMH promoter and 766 bp from the porcine AMH promoter, both inserted upstream of the luciferase reporter gene. Homologous (cells transfected with the promoter from the same animal species) and heterologous (porcine cells transfected with bovine promoter, and the reverse) transfections were performed in each experiment. After transfection, cells were cultured in serum-free conditions for 24 h in control medium (Ctrl, cells cultured without ligand) or with human BMP4 (50 ng/ml) in triplicate, before the measurement of their luciferase activity. Results represent the mean luciferase activity, expressed per 10 000 effectively transfected cells, of eight independent culture experiments with bovine and porcine granulosa cells. Within each panel, results were analyzed by two-way ANOVA, in order to estimate the BMP4 and the culture effect; *P < 0.05, BMP4 vs. Ctrl. Transient transfection studies Granulosa cells recovered from 3–5 mm diameter bovine follicles and 1–3 mm diameter porcine follicles were seeded at 250 000 cells/well in 24-well plates and cultured for 48 h in McCoy’s 5A supplemented with 10% fetal calf serum. Then serum was removed and the reporter gene constructs (750 ng/well for each construct) were transfected into cells for 6 h using Lipofectamine PLUS transfection reagent (Fisher Scientific) in Modified Eagle Medium (Opti-MEM) culture medium. Granulosa cells transfected with Luc reporter constructs were then cultured for 24 h in serum-free McCoy’s 5A with or without 50 ng/ml of BMP4 before luciferase assay (Luciferase Assay System; Promega). As only transfected cells produce a signal, luciferase activity was normalized by the efficiency of transfection as described below and expressed per 10 000 effectively transfected bovine or porcine cells. Each construct was tested in triplicate for BMP4-stimulated and control cells in each experiment and in several (n = 8–12) independent experiments performed in both bovine and porcine granulosa cells. To assess the efficiency of transfection, the CMV-GFP construct was tested in triplicate in 12 independent experiments performed in both bovine and porcine granulosa cells. After transfection, the cells recovered from triplicate wells were pooled, counted and fixed with paraformaldehyde 1% before analysis by flow cytometry to assess the percentage of GFP positive cells. Flow cytometry The percentage of transfected cells from bovine and porcine granulosa cells was determined by flow cytometry using a MoFlo Legacy cell sorter (Beckman Coulter, Fort Collins, Co, USA) equipped with a blue laser operating at 488 nm and 100 mW. Damaged cells and debris were eliminated using morphological criteria and the percentage of transfected cells was evaluated on the basis of the percentage of GFP positive cells. Statistical analysis All data are presented as mean ± SEM. Data were analyzed using the GraphPad Prism 7 Software. For each species, intra-follicular AMH concentrations were nested within animal, then compared between the different size classes of follicles using ANOVA after log transformation to homogenize variances. In immunohistochemistry experiments, AMH immunostaining was compared between the different cell types using ANOVA. In quantitative PCR experiments, relative levels of mRNA were compared between the bovine and porcine species using t-test, with Welch’s correction when variances were heterogeneous. The percentage of transfected cells was compared using t-test, after arcsine transformation. For experiments with transfected cells, data from BMP4-stimulated and their corresponding control cells were compared by two-way ANOVA, in order to estimate the BMP4 and the culture effect. For all analyses, a probability lower than 0.05 was required for significance. Results Expression of AMH in bovine and porcine ovarian follicles Average intra-follicular concentrations of AMH ranged from about 500 ng/ml in 1–3 and 3–5 mm diameter to 50 ng/ml in >10 mm diameter bovine follicles, whereas they ranged from 0.6 ng/ml in 1–3 mm diameter to less than 0.03 ng/ml in >5 mm diameter porcine follicles (Figure 1A). The species were then compared for AMH expression in the granulosa cells from their small antral growing follicles, i.e., 3–5 mm diameter bovine follicles and 1–3 mm diameter porcine follicles. Immunohistochemistry experiments confirmed the presence of a strong AMH staining in the granulosa cells of small antral bovine follicles, but AMH staining was non-detectable in porcine follicles (Figure 1B and C). It is specified that the antibody that we used was able to visualize a strong signal in the Sertoli cells of fetal porcine testes, validating its use in this species. RT-qPCR experiments confirmed the very low amount of AMH mRNA in porcine in comparison to bovine granulosa cells from small antral growing follicles (Figure 1D). Transfection of granulosa cells of both species with bovine and porcine AMH promoters Efficiency of transfection and activity of control gene constructs in bovine and porcine granulosa cells Granulosa cells recovered from small antral follicles of both species were compared for their ability to be transfected in our culture conditions. With 300 000 granulosa cells in both species at the end of the transfection procedure, on average 2.5% of bovine granulosa cells were found to be GFP positive after transfection with the CMV-GFP plasmid, and only 0.9% of porcine cells. Then, for comparisons of promoter activities, luciferase activity was normalized using the percentage of GFP positive cells in each species, as only transfected cells produce a signal. A 2.4 times lower expression of CMV-Luc and 3.0 times lower expression of TK-Luc expression vector was observed in effectively transfected porcine, compared to bovine granulosa cells (Figure 2), indicating that porcine cells were less efficient in activating these gene constructs. Functionality of the bovine and porcine AMH promoters in bovine and porcine granulosa cells When transfected in bovine granulosa cells, the bovine AMH promoter was approximately 100 times more active than the porcine AMH promoter, and was responsive to BMP4, in contrast to the porcine promoter. In porcine granulosa cells, the activity of both promoters was low but only the bovine AMH promoter was responsive to BMP4 stimulation (Figure 3). From these experiments, a possible difference in BMP4 responsiveness between bovine and porcine granulosa cells was difficult to assess, due to the low efficiency of porcine granulosa cells to activate bovine and porcine AMH promoters. In further experiments, the human AMH promoter that we used in a previous study [30] was found to be responsive to BMP4 only when transfected in bovine cells. Moreover, in the presence of SMAD1, BMP-sensitive reporter construct (12GCCG-Luc) responded to BMP4 only in bovine granulosa cells, not in porcine granulosa cells (Figure 4). Figure 4 Open in new tabDownload slide Responsiveness to BMP4 of bovine and porcine transfected granulosa cells. Granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were seeded in 24-well plates at 250 000 cells/well. After 48 h of culture, cells were co-transfected with the BMP-sensitive reporter construct 12GCCG-Luc and a SMAD1 expression vector, or with the human AMH reporter gene construct (423 bp from the human AMH promoter inserted upstream of the luciferase reporter gene, Lukas-Croisier et al., 2003). After transfection, cells were cultured in serum-free conditions for 24 h in control medium (Ctrl, cells cultured without ligand) or with human BMP4 (50 ng/ml) in triplicate, before the measurement of their luciferase activity. Results represent the mean luciferase activity, expressed per 10 000 effectively transfected cells, of 8 independent culture experiments with bovine and porcine granulosa cells. Within each panel, results were analyzed by two-way ANOVA, in order to estimate the BMP4 and the culture effect; ***P < 0.001, BMP4 vs. Ctrl. Figure 4 Open in new tabDownload slide Responsiveness to BMP4 of bovine and porcine transfected granulosa cells. Granulosa cells recovered from 3 to 5 mm bovine follicles and 1 to 3 mm porcine follicles were seeded in 24-well plates at 250 000 cells/well. After 48 h of culture, cells were co-transfected with the BMP-sensitive reporter construct 12GCCG-Luc and a SMAD1 expression vector, or with the human AMH reporter gene construct (423 bp from the human AMH promoter inserted upstream of the luciferase reporter gene, Lukas-Croisier et al., 2003). After transfection, cells were cultured in serum-free conditions for 24 h in control medium (Ctrl, cells cultured without ligand) or with human BMP4 (50 ng/ml) in triplicate, before the measurement of their luciferase activity. Results represent the mean luciferase activity, expressed per 10 000 effectively transfected cells, of 8 independent culture experiments with bovine and porcine granulosa cells. Within each panel, results were analyzed by two-way ANOVA, in order to estimate the BMP4 and the culture effect; ***P < 0.001, BMP4 vs. Ctrl. Figure 5 Open in new tabDownload slide Expression of BMP receptors and signaling factors in bovine and porcine granulosa cells. Expression levels of BMP receptors (BMPR1A, BMPR1B, BMPR2), SMAD factors (SMAD1, SMAD6) and other intracellular regulators of BMP signaling (STAMBP, UBE2O) were determined in 9 and 12 pools of granulosa cells recovered, respectively, from 3 to 5 mm follicles in cow and 1 to 3 mm follicles in pig ovaries. In each animal species, mRNA accumulation was studied by reverse transcription and quantitative PCR and represented as mRNA relative level, using RPL19 as an internal reference. Within each panel, comparison between species was done using t-test, with Welch’s correction for variance heterogeneity; **P < 0.01, pig vs. cow. Figure 5 Open in new tabDownload slide Expression of BMP receptors and signaling factors in bovine and porcine granulosa cells. Expression levels of BMP receptors (BMPR1A, BMPR1B, BMPR2), SMAD factors (SMAD1, SMAD6) and other intracellular regulators of BMP signaling (STAMBP, UBE2O) were determined in 9 and 12 pools of granulosa cells recovered, respectively, from 3 to 5 mm follicles in cow and 1 to 3 mm follicles in pig ovaries. In each animal species, mRNA accumulation was studied by reverse transcription and quantitative PCR and represented as mRNA relative level, using RPL19 as an internal reference. Within each panel, comparison between species was done using t-test, with Welch’s correction for variance heterogeneity; **P < 0.01, pig vs. cow. Expression of elements of BMP signaling in bovine and porcine granulosa cells We looked at whether the difference in BMP4 responsiveness observed between bovine and porcine granulosa cells could be associated with any difference in the expression of factors involved in BMP4 signaling. We have previously shown that BMP4 enhances AMH production in granulosa cells through the preferential activation of BMPR1B (also called ALK6) [30] and the phosphorylation of SMAD1/5/8, but not SMAD2/3 [32]. Therefore, we compared the bovine and the porcine species for the expression of mRNAs encoding their BMP types 1 and 2 receptors, SMAD1, SMAD6 (a co-SMAD inhibitor of BMP4 signaling [33]), and two downstream regulators of the SMAD pathway, which are STAMBP (also called AMSH, encoding a direct binding inhibitor for SMAD6, [34]) and UBE2O (encoding an enzyme involved in the mono-ubiquitination and inactivation of SMAD6, [35]). By RT-qPCR, we did not observe any difference between bovine and porcine granulosa cells from small antral follicles in the levels of mRNA for BMPR1A, BMPR1B, BMPR2, STAMBP and UBE2O. However, SMAD1 and SMAD6 were both expressed nine times higher in porcine than in bovine granulosa cells (Figure 5). Figure 6 Open in new tabDownload slide Alignment of the bovine, porcine and human AMH proximal promoters. The alignment was done using MUltiple Sequence Comparison by Log- Expectation (MUSCLE, EMBM-EBI). The sequences well conserved between species and their binding sites of transcription factors are indicated in the figure. Arrows indicate the presence of differences between the porcine sequence and the other ones within these well-conserved sites. Figure 6 Open in new tabDownload slide Alignment of the bovine, porcine and human AMH proximal promoters. The alignment was done using MUltiple Sequence Comparison by Log- Expectation (MUSCLE, EMBM-EBI). The sequences well conserved between species and their binding sites of transcription factors are indicated in the figure. Arrows indicate the presence of differences between the porcine sequence and the other ones within these well-conserved sites. Figure 7 Open in new tabDownload slide Differences between the bovine and porcine species in terms of AMH production that could explain the regulation of ovulation number. We propose this model to explain a potential role of AMH in the regulation of ovulation rate in porcine compared to bovine ovaries. Porcine AMH promoter and porcine granulosa cells are less sensitive to BMP stimulation leading to a low production of AMH by porcine compared to bovine growing antral follicles. As AMH is known to be an inhibitor primordial follicle activation, this low level of AMH in the pig would lead to a huge number of growing follicles in the porcine compared to the bovine species. The reduced BMP sensitivity of granulosa cells and the low intra-follicular AMH concentrations of antral follicles could contribute to sensitizing granulosa cells to FSH, resulting in a high follicular survival rate in the cohort of terminally developing follicles and a higher ovulation rate in the porcine, compared to the bovine species. Figure made with BioRender.com website. Figure 7 Open in new tabDownload slide Differences between the bovine and porcine species in terms of AMH production that could explain the regulation of ovulation number. We propose this model to explain a potential role of AMH in the regulation of ovulation rate in porcine compared to bovine ovaries. Porcine AMH promoter and porcine granulosa cells are less sensitive to BMP stimulation leading to a low production of AMH by porcine compared to bovine growing antral follicles. As AMH is known to be an inhibitor primordial follicle activation, this low level of AMH in the pig would lead to a huge number of growing follicles in the porcine compared to the bovine species. The reduced BMP sensitivity of granulosa cells and the low intra-follicular AMH concentrations of antral follicles could contribute to sensitizing granulosa cells to FSH, resulting in a high follicular survival rate in the cohort of terminally developing follicles and a higher ovulation rate in the porcine, compared to the bovine species. Figure made with BioRender.com website. Discussion In this study, we have compared for the first time the production of AMH in bovine and porcine antral follicles using three different methods, namely, ELISA, immunohistochemistry, and RT-qPCR. Using AMH ELISA, we found that porcine follicular fluid contains almost 1000 times less AMH than bovine follicular fluid, whatever the developmental stage of the follicle, confirming our previously published observations [17]. Using immunohistochemistry, different studies have previously demonstrated that the granulosa cells of all bovine [11, 25] and porcine [12] healthy growing follicles express AMH, but a comparison of production levels between both species had not been performed up to now. Our immunohistochemistry experiments, run concomitantly on bovine and porcine ovaries, have detected a low staining of AMH in porcine granulosa cells, whereas the signal was clear in bovine ones and very strong in fetal porcine testes, confirming that our antibody was able to recognize porcine AMH. Ultimately, RT-qPCR experiments showed that the amount of mRNA encoding AMH was almost 30 times lower in porcine than in bovine granulosa cells of small antral growing follicles. Overall, this study establishes that pig ovarian follicles express very low levels of AMH compared to follicles of cattle. In various vertebrate species, AMH production in granulosa cells is known to be stimulated by members of the BMP family, such as BMP4 [25, 30], BMP6 [13, 14, 36], BMP15 [14, 16, 32] and particularly by the combination of the oocyte-derived factors BMP15 and GDF9 [32, 37, 38]. The level of production of these latter factors as well as the GDF9/BMP15 ratio are of the same order in pig and in other mono- and poly-ovulating species [39], suggesting that a default of production of these oocyte-derived factors is not responsible for the very low production level of AMH by porcine granulosa cells. With the aim to understand the origin of the differences in levels of AMH and its mRNA between bovine and porcine follicles, we compared the activities of AMH proximal promoters of similar length (703 and 766 bp upstream of the AMH transcription start site, for the bovine and porcine promoter, respectively) after transfection in bovine and porcine granulosa cells, using a Latin square design. With transfection experiments, we show here that the porcine promoter of AMH gene is less functional than the bovine promoter. Indeed, the production of luciferase driven by the porcine promoter was about 100 times lower than when driven by the bovine promoter in bovine granulosa cells, and the bovine but not porcine promoter was sensitive to BMP4 stimulation. Even, in porcine granulosa cells, the activity of the bovine promoter was low and similar to the activity of the porcine promoter, but the former was sensitive to BMP4 stimulation, not the latter. So there must be mutations/deletions/insertions in the porcine sequence that would explain why the porcine promoter is less active than the bovine one and does not respond to BMP4 stimulation. The AMH promoter is known to contain GATA, SOX/SRY, SF1 and FOXL2 binding sites, and various interactions between the transcription factors able to bind these sites have been shown to regulate AMH transcription [40–47]. In a previous study, using the human AMH promoter transfected in ovine granulosa cells, we showed that two SF1 binding sites are involved in the regulation of the basal activity of the promoter, the interaction between SMAD1 and SF1 bound on the most proximal SF1 binding site being critical for ensuring the response of the AMH promoter to BMP4 [30]. Sequence alignments of the human, bovine and porcine AMH promoter sequences, however, did not show any difference between species at these SF1 binding sites (Figure 6). Further studies are needed to know whether the differences observed between the porcine and the bovine/human promoter sequences in the SOX/SRY or FOXL2 binding sites (Figure 6) could explain the difference observed in AMH expression between these species. A distal regulation could also be involved, since BMP-stimulated AMH expression in KGN cells was recently shown to occur through transcription activation of the human AMH promoter involving p300 binding sites likely beyond 2.2 kb of the AMH promoter region [38]. The activity of both TK and CMV promoters was 2–3 times less in porcine than in bovine granulosa cells. In the absence of a gene construct more active in porcine than in bovine cells, the difference in AMH promoter activation observed between species could be due to a lower cellular activity of the cultured porcine granulosa cells, compared to the bovine ones. The bovine AMH promoter as well as the human AMH promoter and the 12-GCCG-Luc construct were all sensitive to BMP4 stimulation when transfected in bovine but not in porcine granulosa cells, showing that at least something is missing in porcine granulosa cells that would make them sensitive to BMP4 stimulation. This difference in sensitivity of porcine and bovine granulosa cells could be due to the overexpression of SMAD6 we observed in the former compared to the latter species, as SMAD6 is known to inhibit SMAD1, −5 and − 8 signaling, when activated by a ligand (such as BMP4) of the type 1 BMP receptors, BMPR1A and BMPR1B [48]. Interestingly, the overexpression of SMAD6 has been recently associated with a high ovulation rate in cows carrying the high fecundity allele “Trio” [49]. In porcine granulosa cells, SMAD6 overexpression would not be counteracted by the overexpression of downstream regulators, since both STAMBP (encoding a direct binding inhibitor for SMAD6, [34]) and UBE2O (encoding an enzyme involved in the mono-ubiquitination and inactivation of SMAD6, [35]) had a similar production level in porcine and bovine granulosa cells. Experiments aiming to block the production or the activity of SMAD6 in porcine granulosa cells could be done to demonstrate its possible role in modulating their sensitivity to BMP4. Of note, SMAD1 is also overexpressed in porcine compared to bovine granulosa cells. That would not likely counteract the effect of the higher SMAD6, since SMAD6 inhibits BMP signaling through interactions with activated type 1 receptors and activated receptor-regulated SMADs such as SMAD1 [33]. From data in rodents, it is currently assumed that AMH mediates the negative feedback exerted by the growing follicles on the primordial follicles and has an inhibitory effect on the responsiveness of growing follicles to FSH [2, 3]. One hypothesis would be that the low production of AMH in porcine follicles is likely, at least partly, responsible for the huge number of growing antral follicles in the sow ovaries compared to ruminants, since AMH does not exert its role as a brake on the activation of primordial follicles. Moreover, in porcine antral follicles, both the reduced BMP sensitivity of granulosa cells and the low intra-follicular AMH concentrations could contribute to sensitizing granulosa cells to FSH and accelerating their final differentiation. By these mechanisms, the selection pressure exerted by FSH fluctuations on the development of the follicular cohort toward ovulation could be decreased, resulting in a high follicular survival rate in the cohort and a high ovulation rate in the porcine, compared to the bovine species (Figure 7). The pig is not the only mammalian species which is poly-ovulatory, however, the mouse is another example. Given their evolutionary distance, the comparison between porcine and bovine ovarian folliculogenesis is relevant (both are ungulates). The comparison between murine and bovine ovarian folliculogenesis is less relevant than the comparison between the murine and human one because these latter two species have a closer common ancestor than with ungulates. The question is raised to evaluate the consequences of a higher activation rate of primordial follicles in pigs, compared to cattle, on the consumption of their ovarian reserve of follicles. Do pigs use their ovarian reserve up to its complete exhaustion during their life? Of note, the presence of germ stem cells in adult pig ovaries has not been convincingly demonstrated, and we do not think that the “Tilly hypothesis” of renewal of the ovarian reserve of follicles during the life is realistic. Indeed, in humans also, recent data did not support the existence of germline stem cells in adult ovaries, thereby reinforcing the dogma of a limited ovarian reserve [50]. Interestingly, the pioneer works of Erickson have shown that the reserve of primordial follicles in neonatal ovaries is on average twice larger in pigs (about 400 000 primordial follicles at day 30 after birth) than in cattle (about 160 000 primordial follicles at days 1–14 after birth) [51, 52]. The total lifespan of pigs is shorter than the one of cattle (12 years vs. 20 years, respectively) and, due to species differences in livestock management, the reproductive lifespan of pigs is clearly shorter (less than 3 years, compared to 7–10 years in cattle). From these observations, we speculate that pigs, like cows [53], would not use all their ovarian reserve of follicles during their reproductive lifespan, even if this hypothesis should be sustained by some mathematical models of follicle consumption. In summary, we have established that pig ovarian follicles express very low levels of AMH compared to follicles of cattle. Results of transfection experiments suggested that the porcine AMH promoter is less active than the bovine AMH promoter and does not respond to a BMP stimulation. In the pig, the low AMH amounts secreted by the growing follicles could lead to an enhanced growth activation of primordial follicles. Moreover, both the low intra-follicular AMH concentrations and the reduced BMP sensitivity of granulosa cells, perhaps due to the overexpression of SMAD6, could sensitize the antral follicles to FSH, leading to a huge number of growing follicles in the porcine compared to the bovine species. Acknowledgements The authors thank the PAO Experimental Unit for providing experimental animals, Jean-Philippe Dubois and the staff of the slaughterhouse for animal slaughtering, and Albert Arnould and Thierry Delpuech at the PRC Unit for their technical help in ovary collection. Author contributions Conceptualization, DM, NdC and PhM; Methodology, DM, PhM, AE; Investigation, AE, PJ, YLV, DM & PhM; Resources, CS, EV; Data Curation, DM & PhM; Writing—Original Draft Preparation, AE, CS, EV, NdC, DM & PhM; Writing—Review & Editing, AE, DM & PhM; Funding Acquisition, DM, NdC & PhM. PhM had primary responsibility for the final content. Conflict of interest The authors have declared that no conflict of interest exists. References 1. Josso N , Racine C, di Clemente N, Rey R, Xavier F. The role of anti-Mullerian hormone in gonadal development . Mol Cell Endocrinol 1998 ; 145 : 3 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Visser JA , Themmen AP. Anti-Mullerian hormone and folliculogenesis . Mol Cell Endocrinol 2005 ; 234 : 81 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Visser JA , Themmen AP. Role of Anti-Mullerian hormone and bone morphogenetic proteins in the regulation of FSH sensitivity . Mol Cell Endocrinol 2014 ; 382 : 460 – 465 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Durlinger AL , Kramer P, Karels B, de Jong FH, Uilenbroek JT, Grootegoed JA, Themmen AP. Control of primordial follicle recruitment by anti-Mullerian hormone in the mouse ovary . Endocrinology 1999 ; 140 : 5789 – 5796 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Alvaro Mercadal B , Imbert R, Demeestere I, Gervy C, De Leener A, Englert Y, Costagliola S, Delbaere A. AMH mutations with reduced in vitro bioactivity are related to premature ovarian insufficiency . Hum Reprod 2015 ; 30 : 1196 – 1202 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Bezard J , Vigier B, Tran D, Mauleon P, Josso N. Immunocytochemical study of anti-Mullerian hormone in sheep ovarian follicles during fetal and post-natal development . J Reprod Fertil 1987 ; 80 : 509 – 516 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Rey R , Sabourin JC, Venara M, Long WQ, Jaubert F, Zeller WP, Duvillard P, Chemes H, Bidart JM. Anti-Mullerian hormone is a specific marker of sertoli- and granulosa-cell origin in gonadal tumors . Hum Pathol 2000 ; 31 : 1202 – 1208 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Weenen C , Laven JS, Von Bergh AR, Cranfield M, Groome NP, Visser JA, Kramer P, Fauser BC, Themmen AP. Anti-Mullerian hormone expression pattern in the human ovary: Potential implications for initial and cyclic follicle recruitment . Mol Hum Reprod 2004 ; 10 : 77 – 83 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Stubbs SA , Hardy K, Da Silva-Buttkus P, Stark J, Webber LJ, Flanagan AM, Themmen AP, Visser JA, Groome NP, Franks S. Anti-mullerian hormone protein expression is reduced during the initial stages of follicle development in human polycystic ovaries . J Clin Endocrinol Metab 2005 ; 90 : 5536 – 5543 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Durlinger AL , Gruijters MJ, Kramer P, Karels B, Ingraham HA, Nachtigal MW, Uilenbroek JT, Grootegoed JA, Themmen AP. Anti-Mullerian hormone inhibits initiation of primordial follicle growth in the mouse ovary . Endocrinology 2002 ; 143 : 1076 – 1084 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Yang MY , Cushman RA, Fortune JE. Anti-Mullerian hormone inhibits activation and growth of bovine ovarian follicles in vitro and is localized to growing follicles . Mol Hum Reprod 2017 ; 23 : 282 – 291 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Almeida F , Costermans NGJ, Soede NM, Bunschoten A, Keijer J, Kemp B, Teerds KJ. Presence of anti-Mullerian hormone (AMH) during follicular development in the porcine ovary . PLoS One 2018 ; 13 :e0197894. OpenURL Placeholder Text WorldCat 13. Shi J , Yoshino O, Osuga Y, Koga K, Hirota Y, Hirata T, Yano T, Nishii O, Taketani Y. Bone morphogenetic protein-6 stimulates gene expression of follicle-stimulating hormone receptor, inhibin/activin beta subunits, and anti-Mullerian hormone in human granulosa cells . Fertil Steril 2009 ; 92 : 1794 – 1798 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Ogura-Nose S , Yoshino O, Osuga Y, Shi J, Hiroi H, Yano T, Taketani Y. Anti-Mullerian hormone (AMH) is induced by bone morphogenetic protein (BMP) cytokines in human granulosa cells . Eur J Obstet Gynecol Reprod Biol 2012 ; 164 : 44 – 47 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Pierre A , Taieb J, Giton F, Grynberg M, Touleimat S, El Hachem H, Fanchin R, Monniaux D, Cohen-Tannoudji J, di Clemente N, Racine C. Dysregulation of the anti-Mullerian hormone system by steroids in women with polycystic ovary syndrome . J Clin Endocrinol Metab 2017 ; 102 : 3970 – 3978 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Zhao Z , Guo F, Sun X, He Q, Dai Z, Chen X, Zhao Y, Wang J. BMP15 regulates AMH expression via the p38 MAPK pathway in granulosa cells from goat . Theriogenology 2018 ; 118 : 72 – 79 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Monniaux D , Drouilhet L, Rico C, Estienne A, Jarrier P, Touzé JL, Sapa J, Phocas F, Dupont J, Dalbies-Tran R, Fabre S. Regulation of anti-Mullerian hormone production in domestic animals . Reprod Fertil Dev 2013 ; 25 : 1 – 16 . Google Scholar Crossref Search ADS WorldCat 18. Jeppesen JV , Anderson RA, Kelsey TW, Christiansen SL, Kristensen SG, Jayaprakasan K, Raine-Fenning N, Campbell BK, Yding AC. Which follicles make the most anti-Mullerian hormone in humans? Evidence for an abrupt decline in AMH production at the time of follicle selection . Mol Hum Reprod 2013 ; 19 : 519 – 527 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Evans AC . Characteristics of ovarian follicle development in domestic animals . Reprod Domest Anim 2003 ; 38 : 240 – 246 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Warren L , Murawski M, Wilk K, Zieba DA, Bartlewski PM. Suitability of antral follicle counts and computer-assisted analysis of ultrasonographic and magnetic resonance images for estimating follicular reserve in porcine, ovine and bovine ovaries ex situ . Exp Biol Med (Maywood) 2015 ; 240 : 576 – 584 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Andersen CY , Schmidt KT, Kristensen SG, Rosendahl M, Byskov AG, Ernst E. Concentrations of AMH and inhibin-B in relation to follicular diameter in normal human small antral follicles . Hum Reprod 2010 ; 25 : 1282 – 1287 . Google Scholar Crossref Search ADS PubMed WorldCat 22. McNatty KP , Smith DM, Makris A, Osathanondh R, Ryan KJ. The microenvironment of the human antral follicle: interrelationships among the steroid levels in antral fluid, the population of granulosa cells, and the status of the oocyte in vivo and in vitro . J Clin Endocrinol Metab 1979 ; 49 : 851 – 860 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Monniaux D , di Clemente N, Touzé JL, Belville C, Rico C, Bontoux M, Picard JY, Fabre S. Intrafollicular steroids and anti-Mullerian hormone during normal and cystic ovarian follicular development in the cow . Biol Reprod 2008 ; 79 : 387 – 396 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Luca G , Mancuso F, Calvitti M, Arato I, Falabella G, Bufalari A, De Monte V, Tresoldi E, Nastruzzi C, Basta Get al. Long-term stability, functional competence, and safety of microencapsulated specific pathogen-free neonatal porcine Sertoli cells: a potential product for cell transplant therapy . Xenotransplantation 2015 ; 22 : 273 – 283 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Rico C , Médigue C, Fabre S, Jarrier P, Bontoux M, Clément F, Monniaux D. Regulation of anti-Mullerian hormone production in the cow: a multiscale study at endocrine, ovarian, follicular, and granulosa cell levels . Biol Reprod 2011 ; 84 : 560 – 571 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Rey R , al-Attar L, Louis F, Jaubert F, Barbet P, Nihoul-Fekete C, Chaussain JL, Josso N. Testicular dysgenesis does not affect expression of anti-mullerian hormone by Sertoli cells in premeiotic seminiferous tubules . Am J Pathol 1996 ; 148 : 1689 – 1698 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 27. Pierre A , Racine C, Rey RA, Fanchin R, Taieb J, Cohen-Tannoudji J, Carmillo P, Pepinsky RB, Cate RL, di Clemente N. Most cleaved anti-Mullerian hormone binds its receptor in human follicular fluid but little is competent in serum . J Clin Endocrinol Metab 2016 ; 101 : 4618 – 4627 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Lukas-Croisier C , Lasala C, Nicaud J, Bedecarras P, Kumar TR, Dutertre M, Matzuk MM, Picard JY, Josso N, Rey R. Follicle-stimulating hormone increases testicular anti-Mullerian hormone (AMH) production through Sertoli cell proliferation and a nonclassical cyclic adenosine 5′-monophosphate-mediated activation of the AMH gene . Mol Endocrinol 2003 ; 17 : 550 – 561 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Kusanagi K , Inoue H, Ishidou Y, Mishima HK, Kawabata M, Miyazono K. Characterization of a bone morphogenetic protein-responsive Smad-binding element . Mol Biol Cell 2000 ; 11 : 555 – 565 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Estienne A , Pierre A, di Clemente N, Picard JY, Jarrier P, Mansanet C, Monniaux D, Fabre S. Anti-Mullerian hormone regulation by the bone morphogenetic proteins in the sheep ovary: Deciphering a direct regulatory pathway . Endocrinology 2015 ; 156 : 301 – 313 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Fabre S , Pierre A, Pisselet C, Mulsant P, Lecerf F, Pohl J, Monget P, Monniaux D. The Booroola mutation in sheep is associated with an alteration of the bone morphogenetic protein receptor-IB functionality . J Endocrinol 2003 ; 177 : 435 – 444 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Pierre A , Estienne A, Racine C, Picard JY, Fanchin R, Lahoz B, Alabart JL, Folch J, Jarrier P, Fabre S et al. The bone morphogenetic protein 15 up-regulates the anti-Mullerian hormone receptor expression in Granulosa cells . J Clin Endocrinol Metab 2016 ; 101 : 2602 – 2611 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Miyazawa K , Miyazono K. Regulation of TGF-beta family signaling by inhibitory Smads . Cold Spring Harb Perspect Biol 2017 ; 9 : a022095 . Google Scholar Crossref Search ADS PubMed WorldCat 34. Itoh F , Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads . EMBO J 2001 ; 20 : 4132 – 4142 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Zhang X , Zhang J, Bauer A, Zhang L, Selinger DW, Lu CX, Ten Dijke P. Fine-tuning BMP7 signalling in adipogenesis by UBE2O/E2-230K-mediated monoubiquitination of SMAD6 . EMBO J 2013 ; 32 : 996 – 1007 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Ocon-Grove OM , Poole DH, Johnson AL. Bone morphogenetic protein 6 promotes FSH receptor and anti-Mullerian hormone mRNA expression in granulosa cells from hen prehierarchal follicles . Reproduction 2012 ; 143 : 825 – 833 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Convissar S , Armouti M, Fierro MA, Winston NJ, Scoccia H, Zamah AM, Stocco C. Regulation of AMH by oocyte-specific growth factors in human primary cumulus cells . Reproduction 2017 ; 154 : 745 – 753 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Roy S , Gandra D, Seger C, Biswas A, Kushnir VA, Gleicher N, Kumar TR, Sen A. Oocyte-derived factors (GDF9 and BMP15) and FSH regulate AMH expression via modulation of H3K27AC in Granulosa cells . Endocrinology 2018 ; 159 : 3433 – 3445 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Crawford JL , McNatty KP. The ratio of growth differentiation factor 9: bone morphogenetic protein 15 mRNA expression is tightly co-regulated and differs between species over a wide range of ovulation rates . Mol Cell Endocrinol 2012 ; 348 : 339 – 343 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Shen WH , Moore CC, Ikeda Y, Parker KL, Ingraham HA. Nuclear receptor steroidogenic factor 1 regulates the mullerian inhibiting substance gene: a link to the sex determination cascade . Cell 1994 ; 77 : 651 – 661 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Giuili G , Shen WH, Ingraham HA. The nuclear receptor SF-1 mediates sexually dimorphic expression of Mullerian inhibiting substance, in vivo . Development 1997 ; 124 : 1799 – 1807 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 42. De Santa BP , Bonneaud N, Boizet B, Desclozeaux M, Moniot B, Sudbeck P, Scherer G, Poulat F, Berta P. Direct interaction of SRY-related protein SOX9 and steroidogenic factor 1 regulates transcription of the human anti-Mullerian hormone gene . Mol Cell Biol 1998 ; 18 : 6653 – 6665 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Arango NA , Lovell-Badge R, Behringer RR. Targeted mutagenesis of the endogenous mouse Mis gene promoter: in vivo definition of genetic pathways of vertebrate sexual development . Cell 1999 ; 99 : 409 – 419 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Tremblay JJ , Viger RS. Transcription factor GATA-4 enhances Mullerian inhibiting substance gene transcription through a direct interaction with the nuclear receptor SF-1 . Mol Endocrinol 1999 ; 13 : 1388 – 1401 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 45. Watanabe K , Clarke TR, Lane AH, Wang X, Donahoe PK. Endogenous expression of Mullerian inhibiting substance in early postnatal rat Sertoli cells requires multiple steroidogenic factor-1 and GATA-4-binding sites . Proc Natl Acad Sci U S A 2000 ; 97 : 1624 – 1629 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Taieb J , Grynberg M, Pierre A, Arouche N, Massart P, Belville C, Hesters L, Frydman R, Catteau-Jonard S, Fanchin R et al. FSH and its second messenger cAMP stimulate the transcription of human anti-Mullerian hormone in cultured granulosa cells . Mol Endocrinol 2011 ; 25 : 645 – 655 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Jin H , Won M, Park SE, Lee S, Park M, Bae J. FOXL2 is an essential activator of SF-1-induced transcriptional regulation of anti-Mullerian hormone in human Granulosa cells . PLoS One 2016 ; 11 :e0159112. OpenURL Placeholder Text WorldCat 48. Goto K , Kamiya Y, Imamura T, Miyazono K, Miyazawa K. Selective inhibitory effects of Smad6 on bone morphogenetic protein type I receptors . J Biol Chem 2007 ; 282 : 20603 – 20611 . Google Scholar Crossref Search ADS PubMed WorldCat 49. Kamalludin MH , Garcia-Guerra A, Wiltbank MC, Kirkpatrick BW. Trio, a novel high fecundity allele: I. Transcriptome analysis of granulosa cells from carriers and noncarriers of a major gene for bovine ovulation rate . Biol Reprod 2018 ; 98 : 323 – 334 . Google Scholar Crossref Search ADS PubMed WorldCat 50. Wagner M , Yoshihara M, Douagi I, Damdimopoulos A, Panula S, Petropoulos S, Lu H, Pettersson K, Palm K, Katayama S et al. Single-cell analysis of human ovarian cortex identifies distinct cell populations but no oogonial stem cells . Nat Commun 2020 ; 11 : 1147 . Google Scholar Crossref Search ADS PubMed WorldCat 51. Erickson BH . Development and senescence of the postnatal bovine ovary . J Anim Sci 1966 ; 25 : 800 – 805 . Google Scholar Crossref Search ADS PubMed WorldCat 52. Black JL , Erickson BH. Oogenesis and ovarian development in the prenatal pig . Anat Rec 1968 ; 161 : 45 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 53. Malhi PS , Adams GP, Singh J. Bovine model for the study of reproductive aging in women: Follicular, luteal, and endocrine characteristics . Biol Reprod 2005 ; 73 : 45 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Grant support: This work was supported by Grants from France via the “Agence Nationale pour la Recherche” (https://anr.fr/) (ANR-12-BSV1-0034-02, AMHAROC). Anthony Estienne was supported by a French Fellowship from the Région Centre and INRAE. © The Author(s) 2020. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Anti-Müllerian hormone production in the ovary: a comparative study in bovine and porcine granulosa cells
JF - Biology of Reproduction
DO - 10.1093/biolre/ioaa077
DA - 2020-08-21
UR - https://www.deepdyve.com/lp/oxford-university-press/anti-m-llerian-hormone-production-in-the-ovary-a-comparative-study-in-7Nvma1Fmg7
SP - 572
EP - 582
VL - 103
IS - 3
DP - DeepDyve
ER -