TY - JOUR
AU - Stephanopoulos, Gregory
AB - Abstract Strains of Yarrowia lipolytica were engineered to express the poly-3-hydroxybutyrate (PHB) biosynthetic pathway. The genes for β-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase, and PHB synthase were cloned and inserted into the chromosome of Y. lipolytica. In shake flasks, the engineered strain accumulated PHB to 1.50 and 3.84% of cell dry weight in complex medium supplemented with glucose and acetate as carbon source, respectively. In fed-batch fermentation using acetate as sole carbon source, 7.35 g/l PHB (10.2% of cell dry weight) was produced. Selection of Y. lipolytica as host for PHB synthesis was motivated by the fact that this organism is a good lipids producer, which suggests robust acetyl-CoA supply also the precursor of the PHB pathway. Acetic acid could be supplied by gas fermentation, anaerobic digestion, and other low-cost supply route. Z.-J. Li and K. Qiao contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s10295-016-1864-1) contains supplementary material, which is available to authorized users. Introduction Microbial production of biodegradable polymers from renewable feedstock draws increasing attention due to the growing concerns about the negative environmental impact of petroleum-derived plastics and depletion of fossil fuels [11]. Polyhydroxyalkanoates (PHAs) are a family of the most promising bio-based and biodegradable polyesters that possess diverse material properties. A series of recombinant hosts have been constructed to express PHA biosynthetic genes to explore their potential as bio-based plastic producers [15]. Acetyl-CoA is a central metabolite in carbon and energy metabolism which connects glycolysis, tricarboxylic acid cycle, β-oxidation, and de novo biosynthesis of fatty acids. Starting from acetyl-CoA, the biosynthesis of poly-3-hydroxybutyrate (PHB), the simplest and most well-studied member of PHA family, is catalyzed by three enzymes: β-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase, and PHA synthase [15]. Intracellular availability of acetyl-CoA enables PHB accumulation in a variety of non-natural producers, including Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, Arabidopsis thaliana, cotton, maize, tobacco, and insect culture cells [1]. PHA are produced as intracellular inclusion bodies, thus the cell size is regarded as an important factor limiting the amount of PHA granules and the total quantity of PHA that can be accumulated in each cell [5]. In general, most bacteria cells have the size ranging from 0.5 to 2 μm. The manipulation of cell morphology related genes was reported to enlarge bacterial shapes and improve PHB accumulation in E. coli, and PHB could reach more than 80% of cell dry weight (CDW) [17, 18]. In terms of cell size, yeast cells are much bigger than bacteria cells, which might help to store more inclusion bodies. S. cerevisiae, one of the most attractive cell factory platform for industrial production of fuels and chemicals, has been well studied to evaluate its potential for PHB production. When PHA synthase was expressed, recombinant S. cerevisiae was able to accumulate 0.5% PHB of CDW in bioreactor cultivations [8]. Co-expression of β-ketothiolase and acetoacetyl-CoA reductase was found to improve PHB content to 7.5% of CDW [1]. Overexpression of the ethanol degradation pathway [6] and phosphoketolase pathway [7] was also demonstrated to increase the cytosolic acetyl-CoA pools and boost PHB production. However, the best performance of PHB titer achieved in S. cerevisiae was below 0.2 mg/l in shake flask cultivations [7]. Acetyl-CoA serves as the precursor for PHB biosynthesis and efficient supply of acetyl-CoA is crucial for increasing PHB production [1]. The carbon metabolic flux of S. cerevisiae on glucose or xylose may be naturally regulated to favor ethanol production, which limits its metabolic potential for efficient PHB accumulation [7, 13]. Yarrowia lipolytica is an obligate aerobic, oleaginous yeast which can grow on broad substrates, including carbohydrates, alkanes, fatty acids, and triglycerides. It is categorized as GRAS (generally recognized as safe) host and has been engineered for the commercial production of omega-3 eicosapentaenoic acid (EPA) [19]. The engineered Y. lipolytica was recently proved to be a superior lipid cell factory with high yield (84.7% of theoretical yield), titer (55 g/l), and productivity (1 g/l/h within the stationary phase) [12]. Both lipid biosynthesis and PHB production are highly dependent on intracellular availability of acetyl-CoA and reducing equivalent NADPH. This is the basis for investigating Y. lipolytica for biopolymer production. In this study, the PHB synthetic pathway was built in Y. lipolytica, and the engineered strain exhibited promising PHB producing ability when acetate was employed as carbon source. Materials and methods Bacterial strains, media, and culture conditions The bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli NEB-5α was cultivated in Luria–Bertani (LB) medium (5 g/l yeast extract, 10 g/l Bacto tryptone, and 10 g/l NaCl) at 37 °C and used as host strain for plasmids construction. Yarrowia lipolytica Po1 g was purchased from Yeastern Biotech Corporation (Taiwan, China) and cultivated in YPD media (10 g/l yeast extract, 20 g/l peptone and 20 g/l glucose) at 30 °C. Strains and plasmids used in this study Name . Description . Reference . Strains E. coli NEB-5α fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi- 1 hsdR17 New England Biolabs Y. lipolytica Po1 g MATa, leu2-270, ura3-302::URA3, xpr2-3 Yeastern Y. lipolytica CAB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC, pGPD-phaA, pEXP1-phaB This study Y. lipolytica C1AB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Plasmids pQK1 pGPD, tPOX1, pUC19 backbone This study pQK3 pEXP1, tPOX1, pUC19 This study pMT15 YLEX php4d::TEFin [12] pQK1-phaA phaA inserted into pQK1 This study pQK3-phaB phaB inserted into pQK3 This study pMT15-phaC phaC inserted into pMT15 This study pMT15-phaC1 phaC1 inserted into pMT15 This study pMT15-phaCAB pTEF-phaC, pGPD-phaA, pEXP1-phaB This study pMT15-phaC1AB pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Name . Description . Reference . Strains E. coli NEB-5α fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi- 1 hsdR17 New England Biolabs Y. lipolytica Po1 g MATa, leu2-270, ura3-302::URA3, xpr2-3 Yeastern Y. lipolytica CAB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC, pGPD-phaA, pEXP1-phaB This study Y. lipolytica C1AB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Plasmids pQK1 pGPD, tPOX1, pUC19 backbone This study pQK3 pEXP1, tPOX1, pUC19 This study pMT15 YLEX php4d::TEFin [12] pQK1-phaA phaA inserted into pQK1 This study pQK3-phaB phaB inserted into pQK3 This study pMT15-phaC phaC inserted into pMT15 This study pMT15-phaC1 phaC1 inserted into pMT15 This study pMT15-phaCAB pTEF-phaC, pGPD-phaA, pEXP1-phaB This study pMT15-phaC1AB pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Open in new tab Strains and plasmids used in this study Name . Description . Reference . Strains E. coli NEB-5α fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi- 1 hsdR17 New England Biolabs Y. lipolytica Po1 g MATa, leu2-270, ura3-302::URA3, xpr2-3 Yeastern Y. lipolytica CAB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC, pGPD-phaA, pEXP1-phaB This study Y. lipolytica C1AB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Plasmids pQK1 pGPD, tPOX1, pUC19 backbone This study pQK3 pEXP1, tPOX1, pUC19 This study pMT15 YLEX php4d::TEFin [12] pQK1-phaA phaA inserted into pQK1 This study pQK3-phaB phaB inserted into pQK3 This study pMT15-phaC phaC inserted into pMT15 This study pMT15-phaC1 phaC1 inserted into pMT15 This study pMT15-phaCAB pTEF-phaC, pGPD-phaA, pEXP1-phaB This study pMT15-phaC1AB pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Name . Description . Reference . Strains E. coli NEB-5α fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi- 1 hsdR17 New England Biolabs Y. lipolytica Po1 g MATa, leu2-270, ura3-302::URA3, xpr2-3 Yeastern Y. lipolytica CAB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC, pGPD-phaA, pEXP1-phaB This study Y. lipolytica C1AB MATa, leu2-270, ura3-302::URA3, xpr2-332, axp-2, pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Plasmids pQK1 pGPD, tPOX1, pUC19 backbone This study pQK3 pEXP1, tPOX1, pUC19 This study pMT15 YLEX php4d::TEFin [12] pQK1-phaA phaA inserted into pQK1 This study pQK3-phaB phaB inserted into pQK3 This study pMT15-phaC phaC inserted into pMT15 This study pMT15-phaC1 phaC1 inserted into pMT15 This study pMT15-phaCAB pTEF-phaC, pGPD-phaA, pEXP1-phaB This study pMT15-phaC1AB pTEF-phaC1, pGPD-phaA, pEXP1-phaB This study Open in new tab Plasmid construction Standard procedures or manufacturers’ instructions were followed for plasmid construction. Oligonucleotides were synthesized by Sigma-Aldrich (St. Louis, MO) and are listed in Table 2. PHB biosynthetic genes phaA, phaB, and phaC were cloned from the genomic DNA of Ralstonia eutropha. The type II PHA synthase gene phaC1 from Pseudomonas sp. 61-3 with Ser325Thr/Gln481Lys mutations was custom-synthesized by Life Technologies (Grand Island, NY). Oligonucleotides used in this study Primers . Sequence (5′–3′) . pMT15-phaC-f CGACCAGCACTTTTTGCAGTACTAACCGCAGGCGACCGGCAAAGGCGCG pMT15-phaC-r CAAGACCGGCAACGTGGGGTCATGCCTTGGCTTTGACGTAT pMT15-phaC2-f CGACCAGCACTTTTTGCAGTACTAACCGCAGAGCAACAAAAACAGCGACGACCT pMT15-phaC2-r CAAGACCGGCAACGTGGGGTTAGCGTTCATGAACATAGGTGCC pQK1-phaA-f TCTTGAATTAAACACACATCAACAATGACTGACGTTGTCATCGTAT pQK1-phaA-r TGCATAGCACGCGTGTAGATACTTATTTGCGCTCGACTGCCA pQK3-phaB-f CACAAGACATATCTACAGCAATGACTCAGCGCATTGCGTA pQK3-phaB-r CATAGCACGCGTGTAGATACTCAGCCCATATGCAGGCCGC phaCv-phaA-f AGATGCCCGTGTCCGAATTCCGCAGTAGGATGTCCTGCAC phaA-phaCv-r GTGCAGGACATCCTACTGCGGAATTCGGACACGGGCATCT phaA-phaB-f ACAATAAGTCATTCGAGCAAGGTAGGGAGTTTGGCGCCCGTTTTT phaB-phaA-r AAAAACGGGCGCCAAACTCCCTACCTTGCTCGAATGACTTATTGT phaB-phaCv-f CAAAGAATGTATCTCATAATTACTAACATTGACAGCTTATCATCGATGATAAGC phaCv-phaB-r GCTTATCATCGATGATAAGCTGTCAATGTTAGTAATTATGAGATACATTCTTTG Primers . Sequence (5′–3′) . pMT15-phaC-f CGACCAGCACTTTTTGCAGTACTAACCGCAGGCGACCGGCAAAGGCGCG pMT15-phaC-r CAAGACCGGCAACGTGGGGTCATGCCTTGGCTTTGACGTAT pMT15-phaC2-f CGACCAGCACTTTTTGCAGTACTAACCGCAGAGCAACAAAAACAGCGACGACCT pMT15-phaC2-r CAAGACCGGCAACGTGGGGTTAGCGTTCATGAACATAGGTGCC pQK1-phaA-f TCTTGAATTAAACACACATCAACAATGACTGACGTTGTCATCGTAT pQK1-phaA-r TGCATAGCACGCGTGTAGATACTTATTTGCGCTCGACTGCCA pQK3-phaB-f CACAAGACATATCTACAGCAATGACTCAGCGCATTGCGTA pQK3-phaB-r CATAGCACGCGTGTAGATACTCAGCCCATATGCAGGCCGC phaCv-phaA-f AGATGCCCGTGTCCGAATTCCGCAGTAGGATGTCCTGCAC phaA-phaCv-r GTGCAGGACATCCTACTGCGGAATTCGGACACGGGCATCT phaA-phaB-f ACAATAAGTCATTCGAGCAAGGTAGGGAGTTTGGCGCCCGTTTTT phaB-phaA-r AAAAACGGGCGCCAAACTCCCTACCTTGCTCGAATGACTTATTGT phaB-phaCv-f CAAAGAATGTATCTCATAATTACTAACATTGACAGCTTATCATCGATGATAAGC phaCv-phaB-r GCTTATCATCGATGATAAGCTGTCAATGTTAGTAATTATGAGATACATTCTTTG Open in new tab Oligonucleotides used in this study Primers . Sequence (5′–3′) . pMT15-phaC-f CGACCAGCACTTTTTGCAGTACTAACCGCAGGCGACCGGCAAAGGCGCG pMT15-phaC-r CAAGACCGGCAACGTGGGGTCATGCCTTGGCTTTGACGTAT pMT15-phaC2-f CGACCAGCACTTTTTGCAGTACTAACCGCAGAGCAACAAAAACAGCGACGACCT pMT15-phaC2-r CAAGACCGGCAACGTGGGGTTAGCGTTCATGAACATAGGTGCC pQK1-phaA-f TCTTGAATTAAACACACATCAACAATGACTGACGTTGTCATCGTAT pQK1-phaA-r TGCATAGCACGCGTGTAGATACTTATTTGCGCTCGACTGCCA pQK3-phaB-f CACAAGACATATCTACAGCAATGACTCAGCGCATTGCGTA pQK3-phaB-r CATAGCACGCGTGTAGATACTCAGCCCATATGCAGGCCGC phaCv-phaA-f AGATGCCCGTGTCCGAATTCCGCAGTAGGATGTCCTGCAC phaA-phaCv-r GTGCAGGACATCCTACTGCGGAATTCGGACACGGGCATCT phaA-phaB-f ACAATAAGTCATTCGAGCAAGGTAGGGAGTTTGGCGCCCGTTTTT phaB-phaA-r AAAAACGGGCGCCAAACTCCCTACCTTGCTCGAATGACTTATTGT phaB-phaCv-f CAAAGAATGTATCTCATAATTACTAACATTGACAGCTTATCATCGATGATAAGC phaCv-phaB-r GCTTATCATCGATGATAAGCTGTCAATGTTAGTAATTATGAGATACATTCTTTG Primers . Sequence (5′–3′) . pMT15-phaC-f CGACCAGCACTTTTTGCAGTACTAACCGCAGGCGACCGGCAAAGGCGCG pMT15-phaC-r CAAGACCGGCAACGTGGGGTCATGCCTTGGCTTTGACGTAT pMT15-phaC2-f CGACCAGCACTTTTTGCAGTACTAACCGCAGAGCAACAAAAACAGCGACGACCT pMT15-phaC2-r CAAGACCGGCAACGTGGGGTTAGCGTTCATGAACATAGGTGCC pQK1-phaA-f TCTTGAATTAAACACACATCAACAATGACTGACGTTGTCATCGTAT pQK1-phaA-r TGCATAGCACGCGTGTAGATACTTATTTGCGCTCGACTGCCA pQK3-phaB-f CACAAGACATATCTACAGCAATGACTCAGCGCATTGCGTA pQK3-phaB-r CATAGCACGCGTGTAGATACTCAGCCCATATGCAGGCCGC phaCv-phaA-f AGATGCCCGTGTCCGAATTCCGCAGTAGGATGTCCTGCAC phaA-phaCv-r GTGCAGGACATCCTACTGCGGAATTCGGACACGGGCATCT phaA-phaB-f ACAATAAGTCATTCGAGCAAGGTAGGGAGTTTGGCGCCCGTTTTT phaB-phaA-r AAAAACGGGCGCCAAACTCCCTACCTTGCTCGAATGACTTATTGT phaB-phaCv-f CAAAGAATGTATCTCATAATTACTAACATTGACAGCTTATCATCGATGATAAGC phaCv-phaB-r GCTTATCATCGATGATAAGCTGTCAATGTTAGTAATTATGAGATACATTCTTTG Open in new tab To construct pQK1, the GPD promoter (1 kb region upstream to Y. lipolytica glyceraldehyde-3-phosphate dehydrogenase gene) and POX1 terminator (500 bp region downstream to Y. lipolytica lipase 1 gene) were amplified and combined in pUC19 vector. The same cloning strategy was applied to make pQK3, featuring EXP1 promoter and POX1 terminator. PHB biosynthetic genes phaA and phaB were, respectively, introduced into pQK1 and pQK3 to generate pQK1-phaA and pQK3-phaB. The pMT15-phaC and pMT15-phaC1 were, respectively, constructed by inserting phaC and phaC1 into pMT15 vector. The entire PHB synthetic operons were constructed via assembling the transcription units (promoter-gene-terminator) from pQK1-phaA, pQK3-phaB, and pMT15-phaC or pMT15-phaC. Gibson assembly was exclusively applied to link DNA fragments. Yeast transformation Yarrowia lipolytica Po1 g was transformed with the linearized plasmid pMT15-CAB (AseI digestion) or pMT15-C1AB (NotI digestion) according to the protocol reported previously [12], which allowed for the chromosomal integration of PHB biosynthetic operon and generated Y. lipolytica CAB and Y. lipolytica C1AB, respectively. Transformants were selected on defined medium (6.7 g/l yeast nitrogen base without amino acids supplemented with 0.67 g/l CSM-leucine, 20 g/l glucose, and 16 g/l agar). The successful engineered colonies were validated by PCR amplification of the integrated gene, using extracted genomic DNA as template. PHB production in shake flask and bioreactor cultures For PHB production in shake flasks, the engineered Y. lipolytica strain was cultivated at 30 °C for 24 h and then inoculated into 250 ml conical flasks containing 25 ml cultivation medium at an inoculation volume of 1%. Three different kinds of media were employed, including YNB (6.7 g/l yeast nitrogen base without amino acids and 20 g/l glucose), YPD50 (10 g/l yeast extract, 20 g/l peptone and 50 g/l glucose), and YPA (10 g/l yeast extract, 20 g/l peptone, and 20 g/l sodium acetate). For PHB production in bioreactors, seed culture of Y. lipolytica CAB was inoculated into a 3-l fermentor (Bioflo 115, Eppendorf) at 1% inoculation volume with an operating volume of 1.5 l. The starting cultivation medium was defined medium (13.4 g/l yeast nitrogen base without amino acids) or complex medium (10 g/l yeast extract and 20 g/l peptone) supplemented with 50 g/l sodium acetate as carbon source. Oxygen was provided by sparging filtered air at a flow rate of 2 l min−1 and maintained at 20% of air saturation by adjusting the agitation rate in the 200–800 rpm range. The temperature was maintained at 28 °C and the pH and concentration of acetate in the bioreactor were maintained at 6.5 and ~27 g/L by automatic addition of 500 g/l acetic acid solution. Analytical methods Yarrowia lipolytica cells were collected by centrifugation at 8000 g for 10 min. Cell pellets were washed with distilled water and lyophilized for cell dry weight (CDW) measurement. For intracellular PHB content analysis, the polymer was degraded and converted to methy-3-hydroxybutyrate by methanolysis at 100 °C for 4 h in the presence of 3% (v/v) H2SO4 and then quantified by gas chromatograph (GC). PHB purchased from Sigma-Aldrich was used as standard. Intracellular PHB polymers were isolated from the lyophilized Y. lipolytica cells with chloroform in screw-capped tubes at 100 °C for 4 h. The chloroform solution of PHB was collected by centrifugation and subsequently precipitated in an excess of ten volumes of ice-cold n-hexane. For the molecular weight assay of PHB, the extracted samples were applied to analytical gel permeation chromatography (GPC) (LC-20AD, Shimadzu, Japan) equipped with Shodex K-804 column (Waters, USA). Polystyrene standards purchased from Sigma-Aldrich were used for calibration. Total RNA isolation and quantitative PCR analysis The total RNA (approximately 100 μg) was isolated from Y. lipolytica cells obtained from shaking flask cultures at proper culturing time (36 h) using the RiboPure-Yeast kit (Thermo Fisher Scientific). The RNA was digested with DNase I to remove the residual DNAs. RNA was quantified using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE) and samples were stored at −80 °C until the qPCR analysis. 0.5 μg of DNase-treated RNA samples were used to make cDNA using ImProm-II™ Reverse Transcription kit (Promega) and random hexamer for 60 min at 42 °C according to the manufacturer’s instruction (Fig. 1). Fig. 1 Open in new tabDownload slide Poly-3-hydroxybutyrate producing pathway from glucose or acetate in engineered Y. lipolytica. Genes: phaA β-ketothiolase, phaB acetoacetyl-CoA reductase, phaC PHA synthase The cDNA levels were quantified using a Biorad iCycler 4 Real-Time PCR Detection System (Bio-Rad) with SYBR Green I detection. Each sample was prepared in triplicate in a 96-well plate (VWR) and the reaction mixture (30 μL final volume) contains 1 × XtensaMix-SG (BioWORKS), 200 nM primer, 2.5 mM MgCl2, and 0.75 U of Taq DNA polymerase (New England Biolabs). Real-time PCR was performed with an initial denaturation of 3 min at 95 °C, followed by 30 cycles of 20 s at 95 °C, 20 s at 60 °C, and 20 s at 72 °C. The threshold cycles (Ct) were calculated using the iCycler software. Primer dimers in all the assays showed distinct melt characteristics from the desired amplicons. The real-time PCR primers used in this study were presented in Supplementary Table 1. Results and discussion Construction of integrative PHB expression vectors Wild-type oleaginous yeast Y. lipolytica is not capable of producing PHB. To impart the ability of PHB accumulation in Y. lipolytica, three heterologous enzymes, namely, β-ketothiolase (encoded by phaA), acetoacetyl-CoA reductase (encoded by phaB), and PHA synthase (encoded by phaC) need to be expressed. To this end, the PHB biosynthetic operon of R. eutropha H16 was chosen due to its demonstrated effectiveness in enabling PHB production in S. cerevisiae previously. Moreover, the representative Class II PHA synthase, Ser325Thr/Gln481Lys mutant of PHA synthase from Pseudomonas sp. 61-3 (encoded by phaC1), which possesses broad substrate specificity ranging from C3–C12 carbon atoms [10, 16], was also chosen to be expressed in Y. lipolytica. All genes were cloned with a strong constitutive promoter (pGPD, pEXP1, and pTEF for phaA, phaB, and phaC/phaC1, respectively) into a single integrative vector, named pMT15-CAB or pMT15-C1AB (Fig. 2). All plasmids were sequenced and validated. Fig. 2 Open in new tabDownload slide Schematic maps of plasmids pMT15-CAB and pMT15-C1AB Strain engineering Yarrowia lipolytica strain Po1 g was used as the parent host for PHB synthesis. Seven colonies were selected for pMT15-CAB and pMT15-C1AB transformation, respectively, followed by 72 h cultivation in 50 ml Falcon tubes containing 5 ml YPD medium to evaluate their PHB production capacity (Fig. 3a). Fig. 3 Open in new tabDownload slide PHB production by recombinant Y. lipolytica cultivated with different media. a Screening of Y. lipolytica strains for PHB accumulation in YPD medium. b–d CDW, PHB content, and PHB titer profiles of Y. lipolytica CAB grown in shake flasks All strains were capable of accumulating intracellular PHB biopolymers, and the PHB content with phaC from R. eutropha was much higher than that obtained with phaC1 from Pseudomonas sp. 61-3. Subsequently, quantitative real-time PCR of PHA synthase genes was performed to study the transcriptional level of phaC1 and phaC in different Y. lipolytica strains (Supplementary Fig. 1). As shown, the transcriptional level of phaC was significantly higher than that of phaC1, which might lead to the phenomenon of improved PHB production. Consequently, Y. lipolytica CAB was selected for the following PHB producing experiments. PHB production in shake flask cultures The engineered Y. lipolytica CAB was cultivated in shake flasks with YNB, YPD50, and YPA medium to evaluate the effect of medium composition to cell growth and PHB accumulation (Fig. 3b–d). When glucose was employed as the sole carbon source, the use of complex medium led to significantly higher cell growth than that achieved in defined medium. In YPD medium, cell dry weight reached 24.87 g/l, containing 1.50% PHB, while the use of defined medium resulted in 4.35 g/l cell dry weight with 2.88% PHB. When acetate was supplemented as the sole carbon source, the engineered strain produced 6.29 g/l cell dry weight with 3.84% PHB, which was the highest PHB content. As the synthetic precursor, cytosolic acetyl-CoA is proved to be essential for PHB production. In yeast, there are two potential routes for the generation of cytosolic acetyl-CoA: from citrate by ATP-citrate lyase (ACL) and from acetate via acetyl-CoA synthetase (ACS). The citrate is exported from the mitochondrion, while acetate can be externally supplied or generated from acetaldehyde. In S. cerevisiae, cytosolic acetyl-CoA is mainly generated from the pyruvate–acetaldehyde–acetate pathway. During glucose fermentation, the majority of carbon flux goes to ethanol, resulting in limited acetyl-CoA availability for biosynthetic pathways [9]. In Y. lipolytica, cytosolic acetyl-CoA is generated from citrate when cultivated on glucose. This flux of acetyl-CoA is likely superior in Y. lipolytica compared to S. cerevisiae resulting in better PHB producing performance. Moreover, compared with the glucose metabolic pathway, acetate was assimilated and directly converted to acetyl-CoA in cytosol. Thus, the intracellular acetyl-CoA availability would be higher than that obtained from glucose metabolism, leading to the highest PHB content in the three cultivation conditions tested. PHB production from acetate in bioreactors Fermentation was carried out under aerobic conditions using Y. lipolytica CAB strain. Acetate was used as sole carbon source and fed by pH control. With defined medium, cell dry weight reached 26.7 with 2.85 g/l PHB accumulation (Fig. 4a). In contrast, complex medium yielded much higher cell growth and PHB accumulation: cell dry weight and PHB titer reached 72.01 and 7.35 g/l, respectively (Fig. 4b). The polymer content was almost the same in both defined medium and complex medium, which suggests that PHB accumulation capacity of engineered Y. lipolytica might be restricted by the expression level of heterologous PHB synthetic genes. In previous studies, E. coli strain harboring single-copy phaCAB operon was unable to accumulate detectable amounts of polymer, and increasing genomic operon copies to 11 led to 5.2% of cell dry weight PHB production [20]. In this study, PHB reached approximate by 10% of cell dry weight in engineered Y. lipolytica CAB harboring a single-copy of phaCAB. Therefore, in comparison to E. coli harboring single-copy phaCAB operon, the Y. lipolytica CAB constructed here shows superior PHB producing ability. Fig. 4 Open in new tabDownload slide PHB production from acetate by Y. lipolytica CAB grown in 3-l bioreactors with defined medium (a) and complex medium (b) However, the PHB content of engineered Y. lipolytica was much lower than that of recombinant E. coli harboring high-copy phaCAB expression plasmids [17, 18]. In general, the cells possess a variety of regulatory mechanisms to maintain intracellular homeostasis. Yeasts are eukaryotic microorganisms and may have much more complicated regulatory mechanisms than that of prokaryotes, such as E. coli. The flux of carbon toward PHB is probably restricted by the intracellular availability of acetyl-CoA and cofactor pool in the oleaginous yeasts Y. lipolytica. Strategies for further increasing PHB production include examining how carbon flux towards the PHB production can be improved by reinforcing the expression level of PHB biosynthetic enzymes, for instance, integrating more copies of phaCAB into the genome or optimizing the codon usage. In addition, the native lipids accumulation pathway can be weakened to alleviate the competition of acetyl-CoA precursors and reducing equivalent NADPH. The molecular weight of the PHB produced by Y. lipolytica CAB cultivated with acetate in bioreactors was determined by GPC. The weight-average molecular weight (M w) and number-average molecular weight (M n) were 2.0 × 105 and 1.3 × 105 g/mol, respectively, which is lower than that of PHB produced by the natural producer R. eutropha. The polydispersity index (M w/M n) was 1.5, indicating narrow molecular weight distributions. It has been proposed that polyhydroxyalkanoate synthase activity and host microorganisms are major determinants controlling the polymer molecular weight and polydispersity [14]. Improving PhaC expression level in Y. lipolytica would probably help to increase the molecular weight of the produced PHB. Although acetate is currently produced by fossil-derived methanol carbonylation, it is very abundant in wastewater as a primary component of volatile fatty acids [2]. Besides, recent studies have demonstrated that acetate can be obtained from waste substrates via biochemical processes, for example, anaerobic digestion of food waste [4] or syngas fermentation by acetogenic bacteria Moorella thermoacetica from carbon dioxide [3]. In this regard, compared with glucose, acetate would be a promising cost effective bio-renewable carbon source for microbial fermentation. Our results showed that engineered Y. lipolytica can accumulate 7.35 g/l PHB from acetate in 3-l bioreactor fermentation without process optimization. Further strain engineering and process optimization should be able to develop a low-cost PHB production route. Conclusion In this study, we constructed recombinant Y. lipolytica harboring the PHB biosynthetic pathway on its genome. The engineered strain Y. lipolytica CAB accumulated 1.50 and 3.84% PHB of cell dry weight in shake flask cultures when cultivated with glucose and acetate, respectively. In pH controlled acetate fed-batch fermentation, cell dry weight reached 72.01 g/l with 10.2% PHB accumulation. This is the first study reporting PHB production from acetate in Y. lipolytica and achieved the best performance in terms of PHB production titer in yeast. Acknowledgements We thank Ms. Xue-Mei Che of the School of Life Sciences of Tsinghua University for the assistance of PHB molecular weight assays. This research was financially supported by Grants from the Department of Energy (DE-SC0008744). ZJL was funded by the National Natural Science Foundation of China (21476014 and 31100025). References 1. Carlson R , Srienc F Effects of recombinant precursor pathway variations on poly [(R)-3-hydroxybutyrate] synthesis in Saccharomyces cerevisiae J Biotechnol 2006 124 561 573 10.1016/j.jbiotec.2006.01.035 Google Scholar Crossref Search ADS PubMed WorldCat 2. Chu A , Mavinic DS, Ramey WD, Kelly HG A biochemical model describing volatile fatty acid metabolism in thermophilic aerobic digestion of wastewater sludge Water Res 1996 30 1759 1770 10.1016/0043-1354(96)00051-6 Google Scholar Crossref Search ADS WorldCat 3. Hu P , Rismani-Yazdi H, Stephanopoulos G Anaerobic CO2 fixation by the acetogenic bacterium Moorella thermoacetica AIChE J 2013 59 3176 3183 10.1002/aic.14127 Google Scholar Crossref Search ADS WorldCat 4. Jiang JG , Zhang YJ, Li KM, Wang Q, Gong CX, Li ML Volatile fatty acids production from food waste: effects of pH, temperature, and organic loading rate Bioresour Technol 2013 143 525 530 10.1016/j.biortech.2013.06.025 Google Scholar Crossref Search ADS PubMed WorldCat 5. Jiang XR , Wang H, Shen R, Chen GQ Engineering the bacterial shapes for enhanced inclusion bodies accumulation Metab Eng 2015 29 227 237 10.1016/j.ymben.2015.03.017 Google Scholar Crossref Search ADS PubMed WorldCat 6. Kocharin K , Chen Y, Siewers V, Nielsen J Engineering of acetyl-CoA metabolism for the improved production of polyhydroxybutyrate in Saccharomyces cerevisiae AMB Express 2012 2 52 10.1186/2191-0855-2-52 3519744 Google Scholar Crossref Search ADS PubMed WorldCat 7. Kocharin K , Siewers V, Nielsen J Improved polyhydroxybutyrate production by Saccharomyces cerevisiae through the use of the phosphoketolase pathway Biotechnol Bioeng 2013 110 2216 2224 10.1002/bit.24888 Google Scholar Crossref Search ADS PubMed WorldCat 8. Leaf TA , Peterson MS, Stoup SK, Somers D, Srienc F Saccharomyces cerevisiae expressing bacterial polyhydroxybutyrate synthase produces poly-3-hydroxybutyrate Microbiol 1996 142 1169 1180 10.1099/13500872-142-5-1169 Google Scholar Crossref Search ADS WorldCat 9. Lian JZ , Si T, Nair NU, Zhao HM Design and construction of acetyl-CoA overproducing Saccharomyces cerevisiae strains Metab Eng 2014 24 139 149 10.1016/j.ymben.2014.05.010 Google Scholar Crossref Search ADS PubMed WorldCat 10. Matsusaki H , Abe H, Taguchi K, Fukui T, Doi Y Biosynthesis of poly(3-hydroxybutyrate-co-3-hydroxyalkanoates) by recombinant bacteria expressing the PHA synthase gene phaC1 from Pseudomonas sp 61-3 Appl Microbiol Biotechnol 2000 53 401 409 10.1007/s002530051633 Google Scholar Crossref Search ADS PubMed WorldCat 11. Philip S , Keshavarz T, Roy I Polyhydroxyalkanoates: biodegradable polymers with a range of applications J Chem Technol Biotechnol 2007 82 233 247 10.1002/jctb.1667 Google Scholar Crossref Search ADS WorldCat 12. Qiao K , Imam Abidi SH, Liu H, Zhang H, Chakraborty S, Watson N, Kumaran Ajikumar P, Stephanopoulos G Engineering lipid overproduction in the oleaginous yeast Yarrowia lipolytica Metab Eng 2015 29 56 65 10.1016/j.ymben.2015.02.005 Google Scholar Crossref Search ADS PubMed WorldCat 13. Sandstrom AG , de Las Munoz, Heras A, Portugal-Nunes D, Gorwa-Grauslund MF Engineering of Saccharomyces cerevisiae for the production of poly-3-hydroxybutyrate from xylose AMB Express 2015 5 14 10.1186/s13568-015-0100-0 4385036 Google Scholar Crossref Search ADS PubMed WorldCat 14. Sim SJ , Snell KD, Hogan SA, Stubbe J, Rha C, Sinskey AJ PHA synthase activity controls the molecular weight and polydispersity of polyhydroxybutyrate in vivo Nat Biotech 1997 15 63 67 10.1038/nbt0197-63 Google Scholar Crossref Search ADS WorldCat 15. Suriyamongkol P , Weselake R, Narine S, Moloney M, Shah S Biotechnological approaches for the production of polyhydroxyalkanoates in microorganisms and plants–a review Biotechnol Adv 2007 25 148 175 10.1016/j.biotechadv.2006.11.007 Google Scholar Crossref Search ADS PubMed WorldCat 16. Taguchi S , Yamadaa M, Matsumoto K, Tajima K, Satoh Y, Munekata M, Ohno K, Kohda K, Shimamura T, Kambe H, Obata S A microbial factory for lactate-based polyesters using a lactate-polymerizing enzyme Proc Natl Acad Sci USA 2008 105 17323 17327 10.1073/pnas.0805653105 2582312 Google Scholar Crossref Search ADS PubMed WorldCat 17. Wu H , Chen J, Chen GQ Engineering the growth pattern and cell morphology for enhanced PHB production by Escherichia coli Appl Microbiol Biotechnol 2016 Google Scholar OpenURL Placeholder Text WorldCat 18. Wu H , Fan Z, Jiang X, Chen J, Chen GQ Enhanced production of polyhydroxybutyrate by multiple dividing E. coli Microb Cell Fact 2016 15 128 10.1186/s12934-016-0531-6 4964105 Google Scholar Crossref Search ADS PubMed WorldCat 19. Xue ZX , Sharpe PL, Hong SP, Yadav NS, Xie DM, Short DR, Damude HG, Rupert RA, Seip JE, Wang J, Pollak DW, Bostick MW, Bosak MD, Macool DJ, Hollerbach DH, Zhang HX, Arcilla DM, Bledsoe SA, Croker K, McCord EF, Tyreus BD, Jackson EN, Zhu Q Production of omega-3 eicosapentaenoic acid by metabolic engineering of Yarrowia lipolytica Nat Biotechnol 2013 31 734 740 10.1038/nbt.2622 Google Scholar Crossref Search ADS PubMed WorldCat 20. Yin J , Wang H, Fu XZ, Gao X, Wu Q, Chen GQ Effects of chromosomal gene copy number and locations on polyhydroxyalkanoate synthesis by Escherichia coli and Halomonas sp Appl Microbiol Biotechnol 2015 99 5523 5534 10.1007/s00253-015-6510-8 Google Scholar Crossref Search ADS PubMed WorldCat © Society for Industrial Microbiology 2017 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model) © Society for Industrial Microbiology 2017
TI - Engineering Yarrowia lipolytica for poly-3-hydroxybutyrate production
JF - Journal of Industrial Microbiology and Biotechnology
DO - 10.1007/s10295-016-1864-1
DA - 2017-05-01
UR - https://www.deepdyve.com/lp/oxford-university-press/engineering-yarrowia-lipolytica-for-poly-3-hydroxybutyrate-production-6dVt57FK40
SP - 605
EP - 612
VL - 44
IS - 4-5
DP - DeepDyve
ER -