TY - JOUR
AU - Balment, Richard, J.
AB - Urotensin II (UII) is a potent vasoconstrictor in mammals, but the source of circulating UII remains unclear. Investigations of the caudal neurosecretory system (CNSS), considered the major source of UII in fish, alongside target tissue expression of UII receptor (UT), can provide valuable insights into this highly conserved regulatory system. We report UII gene characterization, expression of the first fish UT, and responses to salinity challenge in flounder. The 12-aa UII peptide shares 73% sequence identity with pig and human UII. Flounder UT receptor shares 56.7% identity with rat. Although the CNSS is the major site of UII expression, RT-PCR revealed expression of UII and UT in all tissues tested. Around 30–40% of large CNSS Dahlgren cells expressed UII, alone or in combination with urotensin I and/or corticotrophin releasing hormone. Immunolocalization of UT in osmoregulatory tissues (gill, kidney) was associated with vascular elements. There were no consistent differences in CNSS UII expression or plasma UII between seawater (SW)- and freshwater (FW)-adapted fish, although gill and kidney UT expression was lower in FW animals. After acute transfer from SW to FW, plasma UII and kidney and gill UT expression were reduced, whereas UT expression in kidney was increased after reverse transfer. UII appears to be more important to combat dehydration and salt-loading in SW than the hemodilution faced in FW. Potentially, altered target tissue sensitivity through changes in UT expression, is an important physiological controlling mechanism, not only relevant for migratory fish but also likely conserved in mammals. UROTENSIN II (UII) is a cyclic peptide originally isolated from the caudal neurosecretory system (CNSS) of the teleost fish, Gillichthys mirabilis (1), on the basis of its smooth-muscle-stimulating activity. Recently it has become apparent that UII is the natural ligand of the GPR14 orphan receptor (2) now renamed UII receptor (UT receptor). Although it had been known since the 1970s that fish UII peptides were potent vasoconstrictors of mammalian arteries (3), it is now evident that homologous peptides are also effective. Indeed, the work of Ames et al. (2) in the anesthetized primate led to the assertion that UII is the most potent mammalian vasoconstrictor to date, triggering a rapid growth in research in this field. Several studies have now linked elevation in plasma or urinary UII with cardiovascular diseases such as essential hypertension (4), end-stage heart failure, and renal disease. The UII peptide has been isolated and characterized in several teleosts, other fish groups, and the frog (5). Cloning the cDNA for UII precursor has more recently confirmed the presence of this highly conserved cyclic peptide in mammals including mice, rats, pigs, monkey, and humans (see Ref. 6). Further interest in UII peptides was stimulated by the demonstration of pre-pro UII mRNA expression and UII immunoreactivity in the ventral horn of the spinal cord and in brain stem motor nuclei in mice (7) and in humans (8). Although UII is present in specific brain regions in both fish and mammals, a major source of the circulating UII in fish is proposed to be the CNSS. This unique fish neuroendocrine structure, in the terminal vertebral segments, comprises large peptide-synthesizing neurons, Dahlgren cells, which project axons to a neurohaemal organ, the urophysis. Here the peptides, urotensin I (UI), CRH, and UII are stored before secretion into the general circulation (9). UII and other urophysial peptides have been implicated in various aspects of fish physiology including osmoregulation and reproduction. We have shown that UI and UII may modulate cortisol secretion, and suggest that the CNSS affords stress-specific stimulation of cortisol secretion (10) independent of the hypothalamic pituitary input (11). However, it is the potential osmoregulatory role for UII in fish that has received the greatest interest. Urophysial UII content varies in accordance with external salinity in euryhaline fish like the European flounder (12). Plasma UII levels fall abruptly upon transfer of fish from seawater (SW) to freshwater (FW) (13). This implies a role in water conservation and ion excretion. Consistent with this notion, UII has been shown to modulate ion fluxes across isolated opercular skin (14), gut (15, 16), and urinary bladder (17). However, functional receptors for UII remain to be demonstrated in the major osmoregulatory tissues in fish. Using probe designs from mammalian UT receptor, it is now feasible to clone the first fish UT receptor and examine its distribution and regulation in specific tissues. The discrete neuroendocrine organization of the CNSS permits study of the regulation of UII secretion in response to defined physiological (osmotic) challenges. In contrast, the source and control of circulating UII in mammals remains unknown, and this is a major limitation to further understanding the role of this hormone system in support of body fluid homeostasis in higher vertebrates. The remarkable adaptive osmoregulatory physiology of euryhaline fish, like the flounder, thus affords an excellent opportunity to examine both UII hormonal secretion and target tissue responses to defined osmotic challenge: the hemodilution vs. dehydration and salt loading faced in FW vs. SW. Accordingly, we report in this study the isolation and characterization of cDNAs encoding UII and UT receptor for the European flounder, along with preliminary analysis of gene organization for UII and tissue distribution of UII and UT transcripts. The CNSS has been confirmed as the major site of UII expression and the predominant source of circulating peptide. Changes in CNSS UII expression and plasma UII have been examined coincident with quantitative RT-PCR (qPCR) measures of UT receptor mRNA expression in key osmoregulatory tissues (kidney and gill) in chronically FW- and SW-adapted fish and in response to acute transfer of fish between SW and FW. Materials and Methods Animals Adult flounders (Platichthys flesus, 300–800 g) were obtained from Morecambe Bay (Cumbria, UK) and maintained at the University of Manchester in recirculating, filtered 100% SW tanks at 10–12 C under a 12-h light/12-h dark photoperiod for at least 2 wk before experimental treatment. All experiments were carried out in accordance with UK Home Office Regulatory requirements and local Ethics Committee approval. Experimental series To establish the steady-state condition of animals fully acclimated to either SW or FW, fish were held for at least 2 wk in either medium before sampling. To examine the effect of acute osmotic challenge and control for the handling and disturbance of fish, SW-adapted fish were removed from 100% SW tanks and transferred directly to equivalent FW tanks (experimental transfer) or new 100% SW tanks (time-matched control). This experiment was carried out in July. A second group of fish were fully adapted to FW (at least 2 wk) and then removed from 100% FW tanks and transferred directly to equivalent SW tanks (experimental transfer) or new 100% FW tanks (time-matched control). This experiment was carried out in September. Groups of eight fish were sampled 8 and 24 h after transfer. Blood samples (3–5 ml) were taken within 90 sec by direct needle puncture of caudal blood vessels. Fish were humanely killed using a standard protocol detailed under UK Home Office license procedures, and tissues were removed and snap frozen in liquid nitrogen. All samples were taken during the daytime. To examine the effect of urophysis removal on plasma UII levels and pituitary UII content, a group of SW-adapted flounder were urophysectomized under MS-222 anesthesia (3-aminobenzoic acid ethyl ester; Sigma Chemical Co., Ltd., Dorset, UK) at a concentration of 0.1 g/liter SW. After loss of voluntary opercular movement, the terminal portion of the caudal spinal cord and the urophysis were exposed and the urophysis was removed; sham-operated animals were treated similarly, but the urophysis was left in place before suture of skin. Blood was collected 48 h after surgery as above, animals were killed, and pituitary gland was removed and snap frozen in liquid nitrogen. RNA preparation Fifteen tissues were dissected out from 20 SW-adapted fish. These included the CNSS (the caudal eight segments of the spinal cord) and separate urophysis. Brain tissue was further separated into five regions (fore-brain, mid-brain, hind-brain, hypothalamus, and pituitary). Tissues were homogenized in 4 m guanidium thiocyanate buffer (pH 7.5) containing 1% β-mercaptoethanol. Total RNA was extracted by ultracentrifugation at 27,000 × g for 20 h on a bed of 5.7 m CsTFA (Amersham Pharmacia Biotech, Amersham, Buckinghamshire, UK). RNA for both RT-PCR and library construction was treated with deoxyribonuclease (DNase) (Roche, East Sussex, UK). mRNA was purified from 20 CNSS using a Dynabeads mRNA direct kit (Dynal, Wirral, UK). For chronically SW- or FW-adapted groups and SW/FW transfer experiment samples, total RNA was extracted from individual fish CNSS, gill, and kidney by TRIzol (Invitrogen, Paisley, Scotland, UK). cDNA library construction A full-length CNSS cDNA library was constructed into the phage vector λTriplEx2 using SMART cDNA library construction Kit (CLONTECH, Oxford, UK) and gigapack III gold packaging kit (Stratagene, Amsterdam, The Netherlands), following the protocols provided. The primary library contained 2 million plaque forming units. Cloning of the UII and UT receptor cDNAs Cloning of the coding regions of UII and UT receptor. From the known amino acid sequences of UII for P. flesus (18), two degenerate primers were designed for use in PCR, an upstream sense primer, ps-1 (UII) 5′-GCNGARATGCCNTAYCCNGG-3′ encoding AEMPYP(G), and a downstream antisense primer, pas-1 (UII) 5′-CCAGAARCAYTCNGTNGTNCC-3′ encoding GTTECF(W), covering nucleotides 156–449 of the UII sequence. From the conserved amino acid sequence alignment of a range of vertebrate UT receptors, two degenerate primers were designed for use in PCR. The upstream sense primer sequence (ps-1) was: 5′-GGCAYTTYGGNGAYGTNGGNTG-3′ and encoded the peptide (W)HFGDVG(C). The downstream antisense primer (pas-1) sequence was: 5′-CCARAANGGNARRAARCANGC-3′, and encoded the peptide ACFLPFW. These UT receptor primers amplified the nucleotide region 1–482 of the flounder UT receptor sequence. Using mRNA equivalent to one CNSS, the first-strand cDNA synthesis and PCR were performed as described in the SuperScript II cDNA kit (Invitrogen) using oligo deoxythymidine12–18 (Invitrogen). The reaction mixture was stored at −20 C (oligo deoxythymidine-cDNA). Thirty-five cycles of PCR were performed using ps-1 and pas-1 degenerate primers with the following temperature profile: 95 C for 30 sec, 55 C for 30 sec, 72 C for 2 min, using the step-cycle program on an ABI 9700 DNA Thermal Cycler (Applied Biosystems, Foster City, CA) in 100 μl of 50 mm KCl, 10 mm Tris/HCl (pH 8.3), 1.5 mm MgCl2, 200 μm of each 5′-nucleotide triphosphate, containing 2 μl oligo dT-cDNA and 100 pmol of each primer. After gel purification, approximately 20 ng of the PCR product was used to clone into pGEM T easy vector (Promega, Southampton, UK). Three clones were isolated, sequenced, and found to be identical, containing a 294-bp fragment with an open reading frame (ORF) of 98 amino acids corresponding to UII peptide. In a second round, a further clone was isolated containing a 482-bp fragment with an ORF of 160 amino acids, corresponding to UT receptor. Cloning of full-length cDNAs. The full-length cDNA of UII and 3′-end UT receptor were isolated by screening the CNSS cDNA library. A total of 1.0 × 105 plaques from the amplified library were plated out and transferred onto duplicate nitrocellulose membranes (Pall Life Sciences, Hampshire, UK). The membranes were hybridized at high stringency (described in the manufacturer’s protocol) using specific UII and UT receptor probes obtained from degenerate RT-PCR. Positive plaques were isolated, and two further rounds of screening were used to identify single-positive plaques. The pTriplEx2 plasmid containing the positive insert was excised and circularized from the recombinant phage. Three isolates (full length) for the UII gene and one isolate for UT receptor (without 5′-end) were sequenced. 5′-End cDNA amplification. 5′-End cDNA amplification for UT receptor was performed using CLONTECH 5′-RACE system for rapid amplification of cDNA ends. The cDNA for 5′-RACE was synthesized using a modified lock-docking oligo(dT) primer and the BD SMART II A oligonucleotide. The target cDNA was amplified by four-step RACE PCR protocol (94 C for 2 min; five cycles of 94 C for 30 sec and 72 C for 3 min; five cycles of 94 C for 30 sec, 70 C for 30 sec, and 72 C for 3 min; 25 cycles of 94 C for 30 sec, 68 C for 30 sec, and 72 C for 3 min). The PCR was performed using the primer 5′-GATCAGTCCTGGAGCGACGATGCTTGTGC-3′ and universal primer A mix (UPM), which recognizes the BD SMART sequence. The amplified product was cloned using pGEM T easy vector (Promega). Three isolates were sequenced and each had a 666-bp sequence corresponding to 5′-end of UT receptor. Genomic organization of UII Southern blot analysis. High molecular weight genomic DNA was isolated from fish muscle tissue using established protocols (19). Ten-microgram samples of DNA were digested to completion with BamHI, HindIII, PvuII, or PstI, and the digested DNAs were electrophoresed on a 0.7% agarose gel. The gel samples were treated as previously described (9) and the DNAs were transferred to Hybond N nylon membrane using 10× standard saline citrate (SSC) and cross-linked by UV radiation. Prehybridization was performed with QuickHyb solution (Stratagene) followed by hybridization with P. flesus UII cDNA probes (full-length, 5′-BamHI fragment and 3′-BamHI fragment) at 68 C for 1 h. After washing, autoradiographs were exposed at −70 C overnight. Genomic DNA amplification. Twenty-five cycles of PCR were performed using gene specific primers (UIIf5-UIIr420; UIIf412-UIIr700; for sequence see Table 1) with the following temperature profile: 95 C for 30 sec, 55 C for 30 sec, 72 C for 2 min, using the step-cycle program on a ABI 9700 DNA Thermal Cycler in 50 μl of 50 mm KCl, 10 mm Tris/HCl (pH 8.3), 1.5 mm MgCl2, 200 μm of each 5′-nucleotide triphosphate, containing 100 ng genomic DNA and 10 pmol of each primer. After gel purification, approximately 20–50 ng of the PCR product was used to clone into pGEM T easy vector (Promega). Three isolates were sequenced. Table 1 Gene-specific primers and probes for UII, UT, receptor, β -actin, and 18S rRNA Name of primer Sequence of primer (5′–3′) ActinF CATGAAGTGTGACGTCGACATCCG ActinR TAGAAGCATTTGCGGTGGACGATG UIIf5 AACAAGTCTTCTTCTTTCCTGCC UIIf84 AACCATCTCCTGTCCTGGGC UIIf412 AGCAGTTCAGGAAGAGAGCG UIIr420 TGAACTGCTTCCGGATCCC UIIr700 AATCGGCTTTAACCTTTCACATC UII sense-170F TCCTGGACCTGCGTCATTAGA UII antisense-269R TCTGAGACCAGCTCCGTCCT UII TaqMan probe-222T 6-FAM-TCTCTCTCCGAGCAGAACTACCCCCCT-TAMRA UT sense-228F ACCGTGGGCAAGAAAGTCAT UT antisense-297R GGACGGAGATGTAGGCCTTGT UT TaqMan probe-249T 6-FAM-TGTCAGCCCACCTTGTCCCCACTC-TAMRA Actin sense-352F AAGATGACCCAGATCATGTTCGA Actin antisense-454R CGATACCAGTGGTACGACCAGA Actin TaqMan probe-382T 6-FAM-AACACCCCCGCCATGTACGTTGC-TAMRA 18S sense-625F TCGTAGTTCCGACCGTAAACG 18S antisense-691R GCCCGGCGGGTCAT 18S TaqMan probe-649T 6-FAM-CCAACTAGCGATCCGGCGG-TAMRA Name of primer Sequence of primer (5′–3′) ActinF CATGAAGTGTGACGTCGACATCCG ActinR TAGAAGCATTTGCGGTGGACGATG UIIf5 AACAAGTCTTCTTCTTTCCTGCC UIIf84 AACCATCTCCTGTCCTGGGC UIIf412 AGCAGTTCAGGAAGAGAGCG UIIr420 TGAACTGCTTCCGGATCCC UIIr700 AATCGGCTTTAACCTTTCACATC UII sense-170F TCCTGGACCTGCGTCATTAGA UII antisense-269R TCTGAGACCAGCTCCGTCCT UII TaqMan probe-222T 6-FAM-TCTCTCTCCGAGCAGAACTACCCCCCT-TAMRA UT sense-228F ACCGTGGGCAAGAAAGTCAT UT antisense-297R GGACGGAGATGTAGGCCTTGT UT TaqMan probe-249T 6-FAM-TGTCAGCCCACCTTGTCCCCACTC-TAMRA Actin sense-352F AAGATGACCCAGATCATGTTCGA Actin antisense-454R CGATACCAGTGGTACGACCAGA Actin TaqMan probe-382T 6-FAM-AACACCCCCGCCATGTACGTTGC-TAMRA 18S sense-625F TCGTAGTTCCGACCGTAAACG 18S antisense-691R GCCCGGCGGGTCAT 18S TaqMan probe-649T 6-FAM-CCAACTAGCGATCCGGCGG-TAMRA Open in new tab Table 1 Gene-specific primers and probes for UII, UT, receptor, β -actin, and 18S rRNA Name of primer Sequence of primer (5′–3′) ActinF CATGAAGTGTGACGTCGACATCCG ActinR TAGAAGCATTTGCGGTGGACGATG UIIf5 AACAAGTCTTCTTCTTTCCTGCC UIIf84 AACCATCTCCTGTCCTGGGC UIIf412 AGCAGTTCAGGAAGAGAGCG UIIr420 TGAACTGCTTCCGGATCCC UIIr700 AATCGGCTTTAACCTTTCACATC UII sense-170F TCCTGGACCTGCGTCATTAGA UII antisense-269R TCTGAGACCAGCTCCGTCCT UII TaqMan probe-222T 6-FAM-TCTCTCTCCGAGCAGAACTACCCCCCT-TAMRA UT sense-228F ACCGTGGGCAAGAAAGTCAT UT antisense-297R GGACGGAGATGTAGGCCTTGT UT TaqMan probe-249T 6-FAM-TGTCAGCCCACCTTGTCCCCACTC-TAMRA Actin sense-352F AAGATGACCCAGATCATGTTCGA Actin antisense-454R CGATACCAGTGGTACGACCAGA Actin TaqMan probe-382T 6-FAM-AACACCCCCGCCATGTACGTTGC-TAMRA 18S sense-625F TCGTAGTTCCGACCGTAAACG 18S antisense-691R GCCCGGCGGGTCAT 18S TaqMan probe-649T 6-FAM-CCAACTAGCGATCCGGCGG-TAMRA Name of primer Sequence of primer (5′–3′) ActinF CATGAAGTGTGACGTCGACATCCG ActinR TAGAAGCATTTGCGGTGGACGATG UIIf5 AACAAGTCTTCTTCTTTCCTGCC UIIf84 AACCATCTCCTGTCCTGGGC UIIf412 AGCAGTTCAGGAAGAGAGCG UIIr420 TGAACTGCTTCCGGATCCC UIIr700 AATCGGCTTTAACCTTTCACATC UII sense-170F TCCTGGACCTGCGTCATTAGA UII antisense-269R TCTGAGACCAGCTCCGTCCT UII TaqMan probe-222T 6-FAM-TCTCTCTCCGAGCAGAACTACCCCCCT-TAMRA UT sense-228F ACCGTGGGCAAGAAAGTCAT UT antisense-297R GGACGGAGATGTAGGCCTTGT UT TaqMan probe-249T 6-FAM-TGTCAGCCCACCTTGTCCCCACTC-TAMRA Actin sense-352F AAGATGACCCAGATCATGTTCGA Actin antisense-454R CGATACCAGTGGTACGACCAGA Actin TaqMan probe-382T 6-FAM-AACACCCCCGCCATGTACGTTGC-TAMRA 18S sense-625F TCGTAGTTCCGACCGTAAACG 18S antisense-691R GCCCGGCGGGTCAT 18S TaqMan probe-649T 6-FAM-CCAACTAGCGATCCGGCGG-TAMRA Open in new tab DNA sequencing and analysis Double-stranded DNA sequencing was carried out using the Bigdye version 1.0 DNA sequencing kit (ABI, Warrington, UK). DNA, and deduced protein sequences were aligned and compared using BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/) and HGMP-RC Fugu (http://fugu.hgmp.mrc.ac.uk/) databases. The presence and location of signal peptide cleavage sites in amino acid sequences were predicted using SignalP version 2.0 (http://www.cbs.dtu.dk/services/SignalP/). DNA and protein sequences were aligned using DNAMAN software (Lynnon Biosoft, Canada), and the transcription factor binding site search was performed using the GenomeNet WWW server (http://pdap1.trc.rwcp.or.jp/research/db/TFSEARCH.html) and PatSearch version 1.1 software through the TRANSFAC transcription factor database (http://transfac.gbf-braunschweig.de/TRANSFAC/). Sequence homology trees were constructed using DNAMAN software based on distance matrix and neighbor joining methods. Distribution of UII mRNA Northern blot analysis. Ten micrograms of total RNA from 15 flounder tissues (optic nerve, brain, spinal cord, CNSS, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, and ovary) were electrophoresed on a 1% agarose gel for 2.5 h at 150 V. The RNA was transferred onto Hybond N nylon membrane (Amersham Pharmacia Biotech), using 20× SSC prepared with diethyl pyrocarbonate-treated water, and cross-linked to the membrane using UV radiation. The UII cDNA probe obtained from degenerate RT-PCR was prepared by random labeling with [32P]dCTP (Amersham Pharmacia Biotech). Hybridization was carried out in QuickHyb solution (Stratagene) at 68 C for 1 h. The blot was washed twice with 2× SSC containing 0.1% (wt/vol) SDS at room temperature for 15 min and once with 0.1× SSC containing 0.1% (wt/vol) SDS at 55 C for 30 min. Autoradiographs were exposed at −70 C overnight. RT-PCR analysis. Using 1 μg total RNA from the aforementioned fish tissues and five brain regions, first-strand cDNA was synthesized and PCR was performed as described in the SuperScript II cDNA kit (Invitrogen) using oligo d(T)12–18. The reaction mixture (oligo dT-cDNA) was stored at −20 C. Forty cycles of PCR were performed using cDNA-specific UII primers and UT receptor primers (UIIf84-UIIr420; UTR sense-228F and UTR antisense-297R; for sequence see Table 1) with the following temperature profile: 95 C for 15 sec, 55 C for 15 sec, 72 C for 1 min, using the step-cycle program on a ABI 9700 DNA Thermal Cycler in 25 μl of 50 mm KCl, 10 mm Tris/HCl (pH 8.3), 1.5 mm MgCl2, 200 μm of each 5′-nucleotide triphosphate, containing 1 μl oligo dT-cDNA and 10 pmol of each primer. In situ hybridization Preparation of CNSS sections. The terminal region of the spinal cord (approximately the region of the final eight vertebrae, with the urophysis attached) was dissected and fixed in 4% paraformaldehyde overnight. Tissues were dehydrated through graded concentrations of ethanol and embedded in paraffin wax. Longitudinal 4-μm-thick sections were cut, mounted on positively charged slides, and incubated at 60 C for 5 d. Preparation of labeled probes. Gene expression in tissue sections was detected by in situ hybridization using 35S-labeled RNA probe. cDNA clones that contained 294 bp UII (153–446) were digested with single restriction enzyme NcoI or SpeI. In the presence of the T7 or SP6 RNA polymerase (Promega) and 35S-UTP and unlabeled nucleotides, single-stranded RNA probes (riboprobes) were synthesized, with the coding (sense) as negative control. Contaminant plasmid DNA template was removed with a ribonuclease (RNase)-free DNase (Promega) digestion, according to the manufacturer’s instructions. Hybridization procedure. After dewaxing in three changes of xylene, the sections were rehydrated through a series of ethanols and finally into water. All samples were then permeabilized by immersion in 0.2 m HCl for 20 min at room temperature. The samples were then incubated for 1 h in 2.5 g/ml proteinase K at 37 C. All samples were then postfixed in 4% paraformaldehyde overnight. After prehybridization in 50% formamide and 0.6 m NaCl at 50 C for 1 h, each sample was then hybridized in 50% formamide and 0.6 m NaCl at 50 C overnight. Approximately 1.0 × 105 cpm of riboprobe were added to each sample. After overnight hybridization, the samples were washed twice at room temperature for 5 min in 2× SSC and 10 mm DTT, then transferred to fresh 2× SSC for 1 h, 4 h in wash buffer (50% formamide, 0.3 m NaCl, 20 mm Tris-HCl, 0.1 mm EDTA, and 10 mm DTT) at 50 C, once in NTE buffer (0.5 m NaCl, 10 mm Tris-HCl, 0.1 mm EDTA) for 5 min, RNase treatment (RNase A 20 μg/ml and RNase T1 100 U/ml) in NTE for 30 min at 37 C, then washed in NTE 30 min at 37 C; washed overnight in wash buffer at 50 C, then 30 min in 2× SSC, and finally 30 min at room temperature in 0.1× SSC. Slides were then dehydrated in 99% ethanol and air dried. Autoradiography was performed with Ilford K5 emulsion diluted 1:1 with distilled water. The slides were exposed for 7 d at 4 C and then developed in Ilford phenisol developer for 5 min, rinsed, fixed for 5 min, and counterstained with hematoxylin and eosin. Immunocytochemistry Full-length UII peptide was commercially synthesized and cyclised (Severn Biotech Ltd., Worcestershire, UK) based on the amino acid sequence of flounder UII (18). The antiserum was raised in rabbit against flounder UII by Dr P. Ingleton (University of Sheffield, Sheffield, UK). We have previously described the specific antibodies for CRH and UI (9). The UT (GPR14:E-18) antibody was obtained from Santa Cruz Biotechology Inc. (Santa Cruz, CA). This was raised in goat against rat GPR14 N terminus and affinity purified. Sections were dewaxed in xylene, and endogenous peroxidase activity was blocked with methanol before slides were placed in TEG buffer (10 mm Tris, 0.55 mm EGTA) and heated for 8 min in a microwave oven. After cooling, sections were incubated in 50 mm NH4Cl in PBS. The sections were then incubated with 1:1000 UT receptor and UII antibodies (primary) in PBS/0.1% BSA/0.3% Triton X-100 at 4 C overnight. The samples were then washed three times at room temperature in PBS/0.1% BSA/0.2% gelatin/0.05% saponin, and then incubated with 1:500 horseradish peroxidase conjugated rabbit antigoat and goat antirabbit secondary IgG (Dako, Cambridgeshire, UK) in PBS/0.3% Triton X-100 for 1 h. The slides were washed twice in PBS/0.1% BSA/0.2% gelatin/0.05% saponin for 10 min, incubated in diaminobenzadine for 5 min and washed twice in PBS for 10 min. The slides were then counterstained with hematoxylin. Control experiments were carried out by omission of the primary antibody and preabsorption of the antibody with an excess of antigenic peptide. Hormone assays UII content of isolated urophyses and pituitaries and plasma UII levels were determined by RIA as described previously (20). UII was extracted from the urophysis and pituitaries using 0.25% acetic acid, and from the plasma samples using Sep-Pak C18 cartridges (Millipore Ltd., UK). The antiserum was used at a final dilution of 1:18,000. The radioligand (125I-flounder UII) was generated by iodination of synthetic flounder UII using the iodogen method and purified by reverse-phase high performance liquid chromatography. A range of synthetic UII standards was established from 0.15 pg to 100 ng UII per assay tube. Intraassay and interassay coefficients of variation were 11.2 and 16.7% (n = 8 for both) and least detection level was 2 pg/tube. Plasma osmolality was determined by freezing point depression (Roebling Osmometer, Berlin, Germany), sodium concentration by flame photometry (Corning 480; Corning Ltd., Essex, UK) and chloride by electrometric titration (Chloride Analyzer 925; Corning Ltd.). qPCR The quantitative real-time PCR was carried out in 96-well qPCR plates on an ABI PRISM 7000 detector (Applied Biosystems). The primers and TaqMan probe set were designed using Primer Express software (Applied Biosystems). TaqMan probe and primers were synthesized commercially (Eurogentec, Seraing, Belgium), and the sequences are given in Table 1. The optimization and validation of primers and probe were performed using standard ABI protocols. One microgram of total RNA of fish CNSS tissues from the salinity transfer experiments were treated with DNase (Invitrogen), and then first-strand cDNA was synthesized (SuperScript II cDNA kit; Invitrogen) according to the manufacturer’s instructions using random primers. The real-time PCR was performed in a final volume of 25 μl consisting of optimal concentration (12.5 ng) of reverse transcribed cDNA mixed with optimal concentrations of primers (300 nm) and TaqMan probe (100 nm for actin and UII gene; 200 nm for 18S and UT receptor gene) and qPCR Master mix plus kit (Eurogentec, Belgium), using a standard amplification profile (2 min at 50 C, 10 min at 95 C, and then 40 cycles of the following: 15 sec at 95 C and 1 min at 60 C). Flounder β-actin and 18S rRNA were used as reference genes. Relative quantitation values were expressed using the 2−ΔCt method as fold changes in the target gene normalized to the reference gene and related to the expression of a control sample (9). Statistical analysis Results from measurements of plasma osmolality, plasma and urophysial UII levels and of the UII and UT relative mRNA levels are expressed as means ± se. Differences between groups were analyzed by ANOVA and Student’s t test. Significance levels were set at P < 0.05. Results Isolation and characterization of UII cDNA Screening the CNSS cDNA library using a partial UII cDNA (ps1/pas1 degenerate PCR product) probe identified three positive clones. They were characterized by nucleotide sequence analysis. These clones (714 and 722 bp; EMBL accession no. AJ517173) contained identical sequences except that one of them was 8 bp shorter at the 3′-end. An ATG triplet at nucleotide position 75 of preproUII cDNA corresponds to the predicted initiation codon. The UII cDNA sequences contained a 387-bp ORF encoding a putative protein of 129 amino acids and a 259-bp 3′-UTR, which included a common (AATAAA) polyadenylation signal upstream of the poly(A) tail. Conceptual translation of the cDNA sequence showed the ORF encodes a 21-amino-acid putative signal peptide, a 96-amino-acid propeptide, and a 12-amino-acid mature UII peptide sequence. The residues Lys-Arg adjacent to the UII N terminus indicate a potential enzymatic cleavage site (Fig. 1A). Fig. 1 Open in new tabDownload slide Nucleotide and deduced amino acid sequences of the flounder preproUII cDNA and homology tree for vertebrate pro UII sequences. A, Deduced amino acid sequence (single capital letters) begins at nucleotide 75 for UII (accession no. AJ517173). The signal peptide is indicated in bold italics, the propeptide is indicated in normal letters, and the mature UII peptide is indicated in bold letters. The stop codon is indicated by an asterisk. The polyadenylation signals (AATAAA) are in bold letters. The exon-intron-exon boundaries are underlined in bold letters. cDNA-specific PCR primers are marked with an arrow. The restriction sites are labeled in italics. B, Homology tree for the vertebrate pro UII amino acid sequences from flounder (accession no. AJ517173), Fugu (accession no. AJ879894), carp (accession no. M14084), zebrafish (accession no. AY305004), rat (accession no. NM019150), pig (accession no. AB063246), mouse (accession no. NP 036040), human (accession no. AF104118), frog (accession no. AF104117), and chicken (accession no. AY563615) is given. The sequence alignment and identity analysis was performed using DNAMAN software using distance matrix and neighbor joining methods. Fig. 1 Open in new tabDownload slide Nucleotide and deduced amino acid sequences of the flounder preproUII cDNA and homology tree for vertebrate pro UII sequences. A, Deduced amino acid sequence (single capital letters) begins at nucleotide 75 for UII (accession no. AJ517173). The signal peptide is indicated in bold italics, the propeptide is indicated in normal letters, and the mature UII peptide is indicated in bold letters. The stop codon is indicated by an asterisk. The polyadenylation signals (AATAAA) are in bold letters. The exon-intron-exon boundaries are underlined in bold letters. cDNA-specific PCR primers are marked with an arrow. The restriction sites are labeled in italics. B, Homology tree for the vertebrate pro UII amino acid sequences from flounder (accession no. AJ517173), Fugu (accession no. AJ879894), carp (accession no. M14084), zebrafish (accession no. AY305004), rat (accession no. NM019150), pig (accession no. AB063246), mouse (accession no. NP 036040), human (accession no. AF104118), frog (accession no. AF104117), and chicken (accession no. AY563615) is given. The sequence alignment and identity analysis was performed using DNAMAN software using distance matrix and neighbor joining methods. Alignment of UII sequences and database searches The deduced peptide sequence of flounder UII precursor is more closely related to other teleost UII than to orthologous vertebrate peptides, sharing 60.8, 36.8, and 43.2% identity with Fugu, zebrafish, and carp, respectively. Comparison of flounder pro UII with orthologous vertebrate pro UII (Fig. 1B) showed that flounder pro UII shares only 15.6% identity with human pro UII, whereas mature flounder UII peptide shares 73% sequence identity with pig and human UII. The cyclic region (-Cys-Phe-Trp-Lys-Tyr-Cys-) of the mature peptide is conserved in all UII peptides (data not shown). Gene organization of UII Southern blot analysis of flounder genomic DNA yielded bands similar to those predicted from the restriction map of the UII gene, indicating that a single UII gene is present in the flounder genome (Fig. 2A). Comparison of the UII genomic sequences with their cDNA sequences suggested the existence of four exons for the UII gene. The whole mature peptide sequence of UII is located in the fourth exon (Fig. 2B; EMBL accession no. AJ517174). There are three introns, 255, 164, and 81 bp, with consensus splice signals following the “GT—AG rule” (21) for the splice donor and acceptor sequences, which separate the four exons of the UII gene in the propeptide region. After searches of the data bases, it is evident that Fugu rubripes (accession no. AJ889825) and human (accession no. Z98884) UII genes show the same genomic organization with all three introns in the propeptide region (Fig. 2B). It is also evident that a similar arrangement of genes associated with UII gene is conserved between Fugu and human. Fig. 2 Open in new tabDownload slide Southern blot analysis and genomic organization of flounder UII. A, Southern blot analysis of flounder UII. A total of 10 μg of flounder genomic DNA was digested with restriction enzymes (BamHI, HindIII, PstI, and PvuII), separated by 0.7% agarose gel electrophoresis, and blotted onto a nylon membrane. Three 32P radiolabeled UII cDNA probes, full-length, BamHI 5′-end (nucleotides 1–400) and BamHI 3′-end (nucleotides 401–748) were used in hybridization. B, Schematic presentation of flounder (accession no. AJ517174), Fugu (accession no. AJ889825), and human (accession no. Z98884) UII genomic DNA organization. Start and stop codons are shown in capital letters. Fig. 2 Open in new tabDownload slide Southern blot analysis and genomic organization of flounder UII. A, Southern blot analysis of flounder UII. A total of 10 μg of flounder genomic DNA was digested with restriction enzymes (BamHI, HindIII, PstI, and PvuII), separated by 0.7% agarose gel electrophoresis, and blotted onto a nylon membrane. Three 32P radiolabeled UII cDNA probes, full-length, BamHI 5′-end (nucleotides 1–400) and BamHI 3′-end (nucleotides 401–748) were used in hybridization. B, Schematic presentation of flounder (accession no. AJ517174), Fugu (accession no. AJ889825), and human (accession no. Z98884) UII genomic DNA organization. Start and stop codons are shown in capital letters. Isolation and characterization of flounder UT receptor cDNA The UT receptor cDNA sequence (EMBL accession no. AJ 867606) contains a 1092-bp ORF encoding a putative protein of 363 amino acids and a stop codon, a 1061-bp 3′-UTR that contains only three common (AATAAA) polyadenylation signals upstream of the poly(A) tail. An ATG triplet at nucleotide position 43 of preproUT receptor cDNA corresponds to the predicted initiation codon. The translation of the cDNA sequence (Fig 3A) showed the ORF to contain seven transmembrane regions (TM1–TM7). The predicted flounder UT receptor amino acid sequence shares a high degree of sequence identity with other vertebrate UT receptors (GPR14) (Fig. 3B). The flounder UT receptor is more closely related to other teleost UT receptors than orthologous vertebrates, sharing 83.1% identity with zebra fish, and only 51.5, 57.5, and 56.7% sequence identity with human, mouse, and rat, respectively. Fig. 3 Open in new tabDownload slide Deduced amino acid sequence of flounder UT receptor and homology tree for vertebrate UT sequences. A, Direct alignment of predicted amino acid sequences of UT receptor from flounder (accession no. AJ867606) with zebrafish (accession no. XM 682448), human (accession no. AF140631), rat (accession no. U32673), and mouse (accession no AF441863). A gap (dot) has been introduced to maximize alignment. B, Homology tree of the same group of UT receptor sequences. The sequence alignment and identity analysis were performed using DNAMAN software, using distance matrix and neighbor joining methods. Fig. 3 Open in new tabDownload slide Deduced amino acid sequence of flounder UT receptor and homology tree for vertebrate UT sequences. A, Direct alignment of predicted amino acid sequences of UT receptor from flounder (accession no. AJ867606) with zebrafish (accession no. XM 682448), human (accession no. AF140631), rat (accession no. U32673), and mouse (accession no AF441863). A gap (dot) has been introduced to maximize alignment. B, Homology tree of the same group of UT receptor sequences. The sequence alignment and identity analysis were performed using DNAMAN software, using distance matrix and neighbor joining methods. Expression of UII and UT genes Tissue distribution of flounder UII and UT receptor mRNA. Northern analysis on a range of flounder tissues showed the presence of several UII transcripts only in CNSS RNA samples (Fig. 4A), including one major band (approximately 750 nucleotides) and four minor bands (2370, 3800, 5500, and 7100 nucleotides). This is consistent both with the predicted length for the major band, based on the cDNA clones obtained, and the predicted major tissue localization of UII mRNA. Fig. 4 Open in new tabDownload slide Tissue distribution of UII and UT mRNA. A, Northern blot showing tissue distribution and size of the P. flesus UII transcripts. B, RT-PCR amplification of flounder UII, UT receptor, and β-actin, using cDNA-specific PCR primers showing tissue distribution and dissection of the brain regions used for RNA extraction: a, forebrain (olfactory bulbs and telencephalon-preoptic region); b, midbrain (optic tectum-thalamus region); c, hindbrain (cerebella, medulla, and spinal cord); d, hypothalamus; e, pituitary. Fig. 4 Open in new tabDownload slide Tissue distribution of UII and UT mRNA. A, Northern blot showing tissue distribution and size of the P. flesus UII transcripts. B, RT-PCR amplification of flounder UII, UT receptor, and β-actin, using cDNA-specific PCR primers showing tissue distribution and dissection of the brain regions used for RNA extraction: a, forebrain (olfactory bulbs and telencephalon-preoptic region); b, midbrain (optic tectum-thalamus region); c, hindbrain (cerebella, medulla, and spinal cord); d, hypothalamus; e, pituitary. RT-PCR using specific intron-flanking primers indicated the presence of transcripts for UII and its cognate receptor in all the tissues tested (Fig. 4B). Figure 4B also shows that the UII and UT transcripts were detected in all the brain regions. The relative mRNA expression levels in different tissues for UII and UT receptor were determined by real-time PCR (Fig. 5). The results indicate that UII mRNA expression level in brain, spinal cord, rectum, intestine, bladder, and ovary are greater than in other non-CNSS tissues, whereas the hind-brain appeared to express more UII transcripts than other regions of the brain (Fig. 5A). The UT receptor mRNA level in ovary, heart, spinal cord, CNSS, and brain appeared greater than in other non-CNS tissues, whereas the mid-brain appeared to express more UT receptor transcripts than other brain regions (Fig. 5B). Fig. 5 Open in new tabDownload slide Relative mRNA expression levels for UII and UT receptor in different tissues. Tissues examined as for Fig. 4 and analyzed by real-time qPCR with 18s rRNA as reference gene. Values are estimates for pooled samples from 20 fish. A, The relative UII mRNA expression level (CNSS > spinal cord > rectum > intestine > brain > bladder > ovary > head kidney > stomach > heart > liver); (hind-brain > hypothalamus > mid-brain > fore-brain > optic nerve > pituitary). B, The relative mRNA expression level of UT receptor (brain > CNSS > spinal cord > ovary > heart > bladder > kidney > gill > intestine > rectum > head kidney); (mid-brain > optic nerve > hind-brain > fore-brain > hypothalamus > pituitary). Fig. 5 Open in new tabDownload slide Relative mRNA expression levels for UII and UT receptor in different tissues. Tissues examined as for Fig. 4 and analyzed by real-time qPCR with 18s rRNA as reference gene. Values are estimates for pooled samples from 20 fish. A, The relative UII mRNA expression level (CNSS > spinal cord > rectum > intestine > brain > bladder > ovary > head kidney > stomach > heart > liver); (hind-brain > hypothalamus > mid-brain > fore-brain > optic nerve > pituitary). B, The relative mRNA expression level of UT receptor (brain > CNSS > spinal cord > ovary > heart > bladder > kidney > gill > intestine > rectum > head kidney); (mid-brain > optic nerve > hind-brain > fore-brain > hypothalamus > pituitary). UII in the CNSS. Further study of the CNSS, the major site of UII expression, by in situ hybridization of serial sections using 35S-labeled UII RNA probe (antisense), indicated that about 30% of 300 large Dahlgren cells examined in three SW fish showed abundant gene expression for UII (Fig. 6A; solid arrows). It was also evident that there was clear variation in expression level. UII gene expression was not detectable in nerve axons, capillaries, ependymal cells of the central canal (Fig. 6A), or urophysis (Fig. 6E). Figure 6C shows that hybridization with the sense probe (negative control) produced no signal. Fig. 6 Open in new tabDownload slide Immunocytochemistry and in situ hybridization for UII in spinal cord. A, Abundant UII gene expression around the nucleus in a group of Dahlgren cells (d) shown with antisense UII 35S RNA probe. B, UII immunoreactivity in the cytoplasm of the same group of Dahlgren cells (d) and in a nerve axon (a) nearby. C, A negative control in situ hybridization of the same group of Dahlgren cells (d) with a UII sense 35S RNA probe. a, Axon; e, ependymal cells. D, The same group of Dahlgren cells did not react with normal rabbit serum, which replaced the specific primary antiserum used in B and F. E, UII mRNA was absent in urophysis (u) with an antisense UII 35S RNA probe. F, The antiserum to UII detected peptide in the urophysis (u) and small Dahlgren cells (d). Dahlgren cells with abundant UII expression are indicated by solid arrows, the dashed arrows indicate Dahlgren cells with lower or absent UII expression. Fig. 6 Open in new tabDownload slide Immunocytochemistry and in situ hybridization for UII in spinal cord. A, Abundant UII gene expression around the nucleus in a group of Dahlgren cells (d) shown with antisense UII 35S RNA probe. B, UII immunoreactivity in the cytoplasm of the same group of Dahlgren cells (d) and in a nerve axon (a) nearby. C, A negative control in situ hybridization of the same group of Dahlgren cells (d) with a UII sense 35S RNA probe. a, Axon; e, ependymal cells. D, The same group of Dahlgren cells did not react with normal rabbit serum, which replaced the specific primary antiserum used in B and F. E, UII mRNA was absent in urophysis (u) with an antisense UII 35S RNA probe. F, The antiserum to UII detected peptide in the urophysis (u) and small Dahlgren cells (d). Dahlgren cells with abundant UII expression are indicated by solid arrows, the dashed arrows indicate Dahlgren cells with lower or absent UII expression. In serial sections of CNSS, antiserum for flounder UII detected peptide in about 40% of the large Dahlgren cells. Figure 6B shows UII immunoreactivity in the cytoplasm of large Dahlgren perikaryon (solid arrows) and in nearby nerve axons; Figure 6D shows a negative reaction using normal rabbit serum as the primary antibody. Many small and 60% of large Dahlgren cells did not appear to contain UII peptide detectable by immunocytochemistry. There was strong immunoreactivity for UII in urophysis (Fig. 6F). Immunocytochemistry for UI, UII, and CRH in these serial sections showed that each Dahlgren cell may differentially express none, one, two, or all three peptides (Fig. 7). Fig. 7 Open in new tabDownload slide Immunocytochemistry for UII, UI, and CRH in spinal cord serial sections. A, UII in the cytoplasm of a group of Dahlgren cells (d). B, CRH in the cytoplasm of the same group of Dahlgren cells (d) and in nerve axons nearby. C, UI in the cytoplasm of same group of Dahlgren cells (d) and in nerve axons nearby. D, The same group of cells showed no immunoreactivity when the specific primary antiserum was replaced with preimmune rabbit serum. Dahlgren cells with colocalization of CRH, UI, and UII are indicated by solid arrows; the dashed arrows indicate Dahlgren cells with lower or absent UII expression. e, Ependymal cells. Fig. 7 Open in new tabDownload slide Immunocytochemistry for UII, UI, and CRH in spinal cord serial sections. A, UII in the cytoplasm of a group of Dahlgren cells (d). B, CRH in the cytoplasm of the same group of Dahlgren cells (d) and in nerve axons nearby. C, UI in the cytoplasm of same group of Dahlgren cells (d) and in nerve axons nearby. D, The same group of cells showed no immunoreactivity when the specific primary antiserum was replaced with preimmune rabbit serum. Dahlgren cells with colocalization of CRH, UI, and UII are indicated by solid arrows; the dashed arrows indicate Dahlgren cells with lower or absent UII expression. e, Ependymal cells. UT receptor in osmoregulatory tissues. As background for the functional study of the role of UII in body fluid homeostasis, UT receptor expression was examined by immunocytochemistry in the major osmoregulatory epithelia of flounder, the gill, and kidney. To demonstrate the specificity of the heterologous antibody for flounder UT, a Western blot of flounder and rat kidney proteins was undertaken (data not shown). The UT receptor antibody detected a 42.7-kDa band in rat crude and membrane-enriched protein and strong 41- and 43-kDa bands for flounder. The 41-kDa band is clearly in accord with the 41.07-kDa predicted molecular weight of flounder UT receptor, based on the deduced peptide sequence. Immunoreactive signals for both rat and flounder proteins were abolished by preabsorption of antibody with antigenic peptide. Specificity of the UT receptor antibody use for immunocytochemistry was further demonstrated by lack of immunoreactivity when preimmune serum was used or when preabsorption of the antibody with the antigenic peptide was performed before application (Fig. 8). In kidney, UT receptor immunoreactivity was evident in arterioles associated with the glomerulus (Fig. 8A) and in the small blood vessels around the collecting duct. In the gill, UT receptor immunoreactivity was also present again largely associated with the vascular elements in the primary and secondary lamellae (Fig. 8B). Fig. 8 Open in new tabDownload slide Immunocytochemistry for UT receptor in kidney and gill. A, Immunocytochemical staining for UT receptor in arterioles associated with glomerulus (i) and blood vessels surrounding the collecting duct (ii). iii, No immunoreactivity was evident in the presence of primary antibody preadsorbed with antigenic peptide. B, Immunocytochemical staining for UT receptor was largely associated with vascular elements in primary and secondary gill lamellae (i). ii, No immunoreactivity was evident in the presence of primary antibody preabsorbed with antigenic peptide. Fig. 8 Open in new tabDownload slide Immunocytochemistry for UT receptor in kidney and gill. A, Immunocytochemical staining for UT receptor in arterioles associated with glomerulus (i) and blood vessels surrounding the collecting duct (ii). iii, No immunoreactivity was evident in the presence of primary antibody preadsorbed with antigenic peptide. B, Immunocytochemical staining for UT receptor was largely associated with vascular elements in primary and secondary gill lamellae (i). ii, No immunoreactivity was evident in the presence of primary antibody preabsorbed with antigenic peptide. Experimental series To establish whether the CNSS is the major source of circulatory UII in flounder, plasma UII levels were measured 48 h after removal of the urophysis. Plasma UII levels were significantly lower 48 h after urophysectomy (2.9 ± 0.6 vs. 50.0 ± 19.4 pg/ml) compared with sham-operated animals (n = 6; P < 0.05). The residual circulating UII level in urophysectomized animals is likely released from the remaining tissues shown to express the peptide and damaged axons of the caudal spinal cord after urophysectomy. Notably pituitary UII content was higher in urophysectomized fish compared with sham-operated animals (21.7 ± 3.5 vs. 7.4 ± 2.7 pg per 100 g body weight, P < 0.05). Plasma composition of chronically FW- and SW-adapted flounder is shown in Table 2. Plasma sodium, chloride, and osmolality were higher in SW- than in FW-adapted fish in both the July and September experimental series. No differences were evident for circulating levels of UII between long-term SW- and FW-adapted fish (Fig. 9). There were also no consistent differences in urophysial UII content, which was higher in SW- than in FW-adapted fish in September samples but higher in FW than SW fish in July. No differences in relative CNSS UII mRNA expression levels were evident in either September or July samples. Notably, the urophysial-stored UII content in all July samples was significantly higher than in the September samples, indicative of the seasonal variation in urophysial peptide content that we have previously observed (22). Fig. 9 Open in new tabDownload slide Open in new tabDownload slide Changes in plasma UII level, CNSS UII mRNA expression, and urophysial UII content after transfer between SW and FW. A, Plasma UII, CNSS UII mRNA expression, and urophysial UII content in July for chronically adapted SW and FW flounder and in fish 8 and 24 h after experimental transfer from SW to FW and control SW to SW transfer. B, Plasma UII level, CNSS UII mRNA expression, and urophysial UII content in September for chronically adapted SW and FW flounder and in fish 8 and 24 h after experimental transfer from FW to SW and control FW to FW transfer. Independent samples t test was used to assess differences between chronically adapted fish and between experimental and time-matched controls at each time point. Significant differences are denoted: *, P < 0.05 (n = 7–8). Fig. 9 Open in new tabDownload slide Open in new tabDownload slide Changes in plasma UII level, CNSS UII mRNA expression, and urophysial UII content after transfer between SW and FW. A, Plasma UII, CNSS UII mRNA expression, and urophysial UII content in July for chronically adapted SW and FW flounder and in fish 8 and 24 h after experimental transfer from SW to FW and control SW to SW transfer. B, Plasma UII level, CNSS UII mRNA expression, and urophysial UII content in September for chronically adapted SW and FW flounder and in fish 8 and 24 h after experimental transfer from FW to SW and control FW to FW transfer. Independent samples t test was used to assess differences between chronically adapted fish and between experimental and time-matched controls at each time point. Significant differences are denoted: *, P < 0.05 (n = 7–8). Table 2 Plasma composition of flounder chronically adapted to SW or FW and after acute transfer from SW to FW and transfer from FW to SW Plasma composition Osmolality (mosmo/kg H2O) Na+ (mmol/liter) Cl− (mmol/liter) Transfer from SW to FW (July)     Chronic         SW 316.1 ± 1.6 164.2 ± 1.1 150.8 ± 1.1         FW 270.1 ± 11.3a 137.1 ± 7.2a 118.8 ± 6.2b     8 h         SW-SW 321.8 ± 1.8 162.8 ± 1.4 151.1 ± 1.5         SW-FW 306.2 ± 3.8a 146.0 ± 1.5b 143.4 ± 1.5a     24 h         SW-SW 322.2 ± 2.0 163.5 ± 0.5 152.0 ± 1.4         SW-FW 300.1 ± 3.8b 153.6 ± 2.1b 140.4 ± 3.4a Transfer from FW to SW (September)     Chronic         FW 261.1 ± 38.4 156.6 ± 4.7 114.8 ± 17.4         SW 324.6 ±1.5c 175.8 ± 1.4a 149.5 ± 1.0a     8 h         FW-FW 311.0 ± 3.3 163.7 ± 2.8 140.9 ± 2.1         FW-SW 323.3 ± 1.9c 173.1 ± 1.1c 149.4 ± 1.0a     24 h         FW-FW 314.7 ± 3.5 168.8 ± 2.0 140.8 ± 2.8         FW-SW 323.3 ± 0.8c 171.7 ± 1.4 148.0 ± 1.1c Plasma composition Osmolality (mosmo/kg H2O) Na+ (mmol/liter) Cl− (mmol/liter) Transfer from SW to FW (July)     Chronic         SW 316.1 ± 1.6 164.2 ± 1.1 150.8 ± 1.1         FW 270.1 ± 11.3a 137.1 ± 7.2a 118.8 ± 6.2b     8 h         SW-SW 321.8 ± 1.8 162.8 ± 1.4 151.1 ± 1.5         SW-FW 306.2 ± 3.8a 146.0 ± 1.5b 143.4 ± 1.5a     24 h         SW-SW 322.2 ± 2.0 163.5 ± 0.5 152.0 ± 1.4         SW-FW 300.1 ± 3.8b 153.6 ± 2.1b 140.4 ± 3.4a Transfer from FW to SW (September)     Chronic         FW 261.1 ± 38.4 156.6 ± 4.7 114.8 ± 17.4         SW 324.6 ±1.5c 175.8 ± 1.4a 149.5 ± 1.0a     8 h         FW-FW 311.0 ± 3.3 163.7 ± 2.8 140.9 ± 2.1         FW-SW 323.3 ± 1.9c 173.1 ± 1.1c 149.4 ± 1.0a     24 h         FW-FW 314.7 ± 3.5 168.8 ± 2.0 140.8 ± 2.8         FW-SW 323.3 ± 0.8c 171.7 ± 1.4 148.0 ± 1.1c An independent-samples t test was used to assess differences between chronically adapted FW and SW flounder and between experimental and time-matched controls at each time point (n = 7–8). a P < 0.005. b P < 0.0005 c P < 0.05. Open in new tab Table 2 Plasma composition of flounder chronically adapted to SW or FW and after acute transfer from SW to FW and transfer from FW to SW Plasma composition Osmolality (mosmo/kg H2O) Na+ (mmol/liter) Cl− (mmol/liter) Transfer from SW to FW (July)     Chronic         SW 316.1 ± 1.6 164.2 ± 1.1 150.8 ± 1.1         FW 270.1 ± 11.3a 137.1 ± 7.2a 118.8 ± 6.2b     8 h         SW-SW 321.8 ± 1.8 162.8 ± 1.4 151.1 ± 1.5         SW-FW 306.2 ± 3.8a 146.0 ± 1.5b 143.4 ± 1.5a     24 h         SW-SW 322.2 ± 2.0 163.5 ± 0.5 152.0 ± 1.4         SW-FW 300.1 ± 3.8b 153.6 ± 2.1b 140.4 ± 3.4a Transfer from FW to SW (September)     Chronic         FW 261.1 ± 38.4 156.6 ± 4.7 114.8 ± 17.4         SW 324.6 ±1.5c 175.8 ± 1.4a 149.5 ± 1.0a     8 h         FW-FW 311.0 ± 3.3 163.7 ± 2.8 140.9 ± 2.1         FW-SW 323.3 ± 1.9c 173.1 ± 1.1c 149.4 ± 1.0a     24 h         FW-FW 314.7 ± 3.5 168.8 ± 2.0 140.8 ± 2.8         FW-SW 323.3 ± 0.8c 171.7 ± 1.4 148.0 ± 1.1c Plasma composition Osmolality (mosmo/kg H2O) Na+ (mmol/liter) Cl− (mmol/liter) Transfer from SW to FW (July)     Chronic         SW 316.1 ± 1.6 164.2 ± 1.1 150.8 ± 1.1         FW 270.1 ± 11.3a 137.1 ± 7.2a 118.8 ± 6.2b     8 h         SW-SW 321.8 ± 1.8 162.8 ± 1.4 151.1 ± 1.5         SW-FW 306.2 ± 3.8a 146.0 ± 1.5b 143.4 ± 1.5a     24 h         SW-SW 322.2 ± 2.0 163.5 ± 0.5 152.0 ± 1.4         SW-FW 300.1 ± 3.8b 153.6 ± 2.1b 140.4 ± 3.4a Transfer from FW to SW (September)     Chronic         FW 261.1 ± 38.4 156.6 ± 4.7 114.8 ± 17.4         SW 324.6 ±1.5c 175.8 ± 1.4a 149.5 ± 1.0a     8 h         FW-FW 311.0 ± 3.3 163.7 ± 2.8 140.9 ± 2.1         FW-SW 323.3 ± 1.9c 173.1 ± 1.1c 149.4 ± 1.0a     24 h         FW-FW 314.7 ± 3.5 168.8 ± 2.0 140.8 ± 2.8         FW-SW 323.3 ± 0.8c 171.7 ± 1.4 148.0 ± 1.1c An independent-samples t test was used to assess differences between chronically adapted FW and SW flounder and between experimental and time-matched controls at each time point (n = 7–8). a P < 0.005. b P < 0.0005 c P < 0.05. Open in new tab After transfer of fish from SW to FW, plasma sodium, chloride, and osmolality were significantly lower at 8 and 24 h compared with time-matched SW-maintained controls [Table 2, Transfer from SW to FW (July)]. This was associated at 8 h with lower plasma UII and raised CNSS UII mRNA expression in FW-transferred relative to SW-maintained flounder (Fig. 9A). At 24 h, CNSS UII mRNA expression remained elevated and urophysial-stored UII was higher in FW transferred fish relative to time-matched SW controls. After the reverse transfer from FW to hypertonic SW increased plasma sodium, chloride and osmolality were apparent at 8 and 24 h compared with time-matched FW to FW controls [Table 2, Transfer from FW to SW (September)]. Although there were no statistically significant changes in circulating or stored levels of UII after transfer, CNSS UII mRNA expression was lower at 8 h in SW transferred relative to FW-maintained flounder but was comparable at the later sampling time (Fig. 9B). In contrast to these equivocal changes in plasma UII levels in chronically adapted fish and at the 8- and 24-h sampling points after transfer of fish between SW and FW, changes in target tissue expression of UT receptor mRNA were much more apparent. In the kidney, chronically adapted FW fish had apparently lower UT mRNA expression than SW fish in both the July and September series, although this failed to achieve statistical significance (Fig. 10A). After acute transfer of SW fish to FW UT mRNA expression at both 8 and 24 h, sampling points were markedly lower by comparison with time-matched SW controls. After the reverse transfer from FW to SW, the converse pattern was seen, with greatly increased UT mRNA expression evident at 24 h in the SW transferred animals. Fig. 10 Open in new tabDownload slide Altered UT receptor mRNA expression in response to changes in salinity for kidney and gill. A, qPCR measures of relative UT receptor mRNA expression in kidney from chronically adapted SW and FW fish and for fish after SW to FW transfer (upper panel) or FW to SW transfer (lower panel). B, qPCR measures of relative UT receptor mRNA expression in gill from chronically adapted SW and FW fish and for fish after SW to FW transfer (upper panel) or FW to SW transfer (lower panel). Independent samples t test was used to assess differences between chronically SW- and FW-adapted fish and between experimental and time-matched controls at each time point. Significant differences are denoted: *, P < 0.05 (n = 7–8). Fig. 10 Open in new tabDownload slide Altered UT receptor mRNA expression in response to changes in salinity for kidney and gill. A, qPCR measures of relative UT receptor mRNA expression in kidney from chronically adapted SW and FW fish and for fish after SW to FW transfer (upper panel) or FW to SW transfer (lower panel). B, qPCR measures of relative UT receptor mRNA expression in gill from chronically adapted SW and FW fish and for fish after SW to FW transfer (upper panel) or FW to SW transfer (lower panel). Independent samples t test was used to assess differences between chronically SW- and FW-adapted fish and between experimental and time-matched controls at each time point. Significant differences are denoted: *, P < 0.05 (n = 7–8). A similar pattern was evident in the gill (Fig. 10B), where UT mRNA expression was lower in FW than SW chronically adapted fish. There was also a tendency for lower UT mRNA expression after transfer from SW to FW compared with SW-maintained animals. Discussion From this study, we conclude that the CNSS is the major site of production/storage of UII and it is the neuroendocrine source of circulating UII, although we cannot rule out additional extra-CNSS sites of production. The first cloning of a fish UT receptor has allowed identification of target tissues for UII and some initial insights into factors that may alter UT expression. It is now evident that UII and UT receptor mRNAs are widely distributed, and that UII is likely involved in tissue-specific autocrine and paracrine roles in addition to endocrine effects. The colocalization of UII, CRH, and UI peptides within the same magnocellular neurons of the CNSS, raises the possibility that, in fish, these peptides share roles in the neuroendocrine mediation of homeostasis (9). Molecular identification and characterization of UII gene The C-terminal region of the UII precursor, which includes the UII peptide, is the only domain that exhibits significant amino acid sequence identity among different species. All UII peptides and the recently identified UII related peptide (23) share a common cyclic sequence (-Cys-Phe-Trp-Lys-Tyr-Cys-), whereas the amino acid sequence at the N terminus of pro UII is highly variable. The Lys-Arg dibasic site flanking UII and UII related peptide at the N terminus has been conserved from fish to human. It has been reported previously that prohormone-converting enzymes more efficiently cleave the Lys-Arg dibasic site than any other pairs of basic residues (24). Comparison of flounder UII gene structure with other vertebrates indicates stability of the four exon and three intron structures, with the mature UII peptide sequence located in the fourth exon. These gene structural similarities implicate conservation in UII evolution among vertebrates, which includes associated genes, when comparisons of Fugu and human databases were considered. Expression of UII gene Restriction map analysis of genomic UII sequence and Southern blot analysis indicated that a single form of the UII gene is present in the flounder genome. This differs from carp and sucker, which have multiple forms of UII, differing slightly in amino acid sequence (25–27). Our studies revealed the presence of multiple UII gene transcripts in the CNSS, suggesting the possibility of multiple polyadenylation signals in the 3′-UTR region of the UII gene. In contrast, a similar analysis of UII gene transcripts from carp and frog spinal cord revealed single UII mRNA species (8, 27). Tissue distribution of UII mRNA Northern blot analysis of total RNA prepared from a range of flounder tissues revealed that the CNSS is the major site of expression of the UII transcript. The urophysectomy data also confirmed the CNSS as the major source of UII for circulating peptide and endocrine function. Although UII was originally regarded as a product exclusively of the teleost urophysis, the presence of UII transcripts in all tissues tested outside the CNSS indicates that UII is widely expressed in peripheral tissues. The detection of UII transcript in the mid-brain, hind-brain, and pituitary region in flounder is consistent with results from frog (8). Purification and characterization of UII from extracts of the whole brain of the rainbow trout and the long-nosed skate (28) are consistent with previous immunohistochemical demonstration of UII peptides in the central nervous system (29). The expression of UII mRNAs in many fish tissues alongside the UT receptor suggests that this peptide is also involved in tissue-specific autocrine and paracrine roles. This could possibly include growth as there are, for example, reports of the mitogenic action of UII in porcine renal epithelial cells, and vascular smooth muscle cells (30–32). Expression of UII gene in the CNSS In the current study, we used both antibody and radiolabeled RNA probe for flounder UII to show colocalization of UII mRNA and expressed peptide in a large proportion of Dahlgren cells in the CNSS. UII immunoreactivity, although not UII mRNA, was also detected in axons of the Dahlgren cells and in the urophysis, suggesting that UII peptide is synthesized in Dahlgren cells, and it reaches the urophysis by axonal transport for storage and subsequent secretion into the general circulation (11). Combined immunocytochemistry and in situ hybridization for UI, UII, and CRH mRNAs in serial sections indicated that each Dahlgren cell may differentially express none, one, two, or all three peptides. The differences in the proportion of Dahlgren cells positive for in situ hybridization (mRNA distribution) and immunocytochemistry (protein) UII expression suggests that functional subtypes of Dahlgren cells may exist with differential rates of peptide secretion. This correlates well with our recent electrophysiological studies of Dahlgren cells (33, 34), which support recruitment and removal of subpopulations of Dahlgren cells from the functional group. This idea also has parallels with observations of recruitment/derecruitment within the population of hypothalamic oxytocin magnocellular neuroendocrine cells in mammals (35). Expression of UII gene in pituitary The detection of UII expression in the pituitary region of flounder is consistent with results from other fish species and frog (8). Pituitary UII content may reflect local or hypothalamic secretion, which appeared to be affected by removal of the urophysial source. The increase in pituitary UII peptide clearly did not compensate for the decrease in circulating UII level in urophysectomized fish, further confirming that the urophysis is the major source of circulating peptide and control of UII endocrine function. Nonetheless, it remains to be established whether pituitary UII can contribute to circulating peptide or simply acts locally. Transfer of fish between SW and FW Flounders are able to survive in both FW and SW but, in common with other euryhaline fish species, maintain a lower blood tonicity (36) and also reduced urine osmolality (data not shown) in FW. This reflects the long term adjustments in renal ion and water homeostatic mechanisms that fish require to survive in hypotonic and hypertonic environments. The UT mRNA expression in kidney and gill was lower in FW- than SW-adapted animals, indicating lower tissue responsiveness to UII in FW-adapted animals. These first observations of UT receptor mRNA expression dynamics in fish are concordant with our previous (13) and current observations of lowered plasma UII levels on transfer of fish from SW to FW. Clearly, these data imply profound changes in potential tissue responses to UII, reduced in hypotonic FW and increased on exposure to hypertonic SW. It would appear that the direct renal and gill effects of UII are more important to combat the dehydration and salt loading in SW media than the hemodilution and salt wasting that occur in FW. Indeed, several studies have implicated UII in the conservation of water (13, 15) and altered sodium and chloride transport (14, 37, 38) in a number of fish species. In absorptive tissues, such as urinary bladder and intestine, UII has been shown to stimulate active sodium and chloride uptake from luminal fluid. In contrast, UII is reported to inhibit active transport in secretory tissues like the opercular membrane, which is considered a model of gill epithelial transport (39). It was notable that there appeared to be no consistent difference in the CNSS neuroendocrine system between chronically SW- and FW-adapted fish in terms of UII content, mRNA expression or plasma UII levels. Water and ion transport in both gill and kidney is very sensitive to changes in blood pressure and tissue blood flow. Immunocytochemical observations in this study clearly highlight the vascular locations of UT receptor. Accordingly, it is likely that vasoactive effects at gill and kidney combine with UII-specific direct effects on ion transport, to profoundly alter ion and water fluxes across these epithelia. This emerging picture of roles for UII in water and electrolyte homeostasis in euryhaline fish, like the flounder, is instructive as attempts are being made to establish the contribution of UII in the regulation of mammalian renal function. UII has been implicated in the pathophysiology of human cardiovascular and renal disease (40–42). In the rat, intrarenal infusion of human UII induced an increase in renal blood flow that was accompanied by a diuresis and natriuresis (43). UII mRNA expression is abundant in mammalian kidney, with immunoreactive UII present in renal blood vessels and epithelial cells (44). Our own work in the rat indicates the presence of UT receptor in both vascular and tubular elements of the kidney and that UT mRNA expression is elevated in models of hypertension (4, 45). From this study in flounder, it is apparent that altered sensitivity of target tissues to UII, through changes in UT receptor expression, is a potentially important physiological controlling mechanism for the actions of UII. This may be particularly relevant for migratory fish such as flounder and salmonids as they move between media of different salinities but is also likely to be a conserved mechanism of importance in mammals. Acknowledgments This work was supported by a Biotechnology and Biological Sciences Research Council “Neurone Initiative” Grant 34/NEU15399. Disclosure statement: None of the authors have anything to declare. Abbreviations: CNSS Caudal neurosecretory system DNase deoxyribonuclease FW freshwater ORF open reading frame qPCR quantitative RT-PCR RNase ribonuclease SSC standard saline citrate SW seawater UII urotensin II UI urotensin I UT UII receptor 1 Pearson D , Shively JE , Clark BR , Geschwind II , Barkley M , Nishioka RS , Bern HA 1980 Urotensin II: a somatostatin-like peptide in the caudal neurosecretory system of fishes . Proc Natl Acad Sci USA 77 : 5021 – 5024 Google Scholar Crossref Search ADS PubMed WorldCat 2 Ames RS , Sarau HM , Chambers JK , Willette RN , Aiyar NV , Romanic AM , Louden CS , Foley JJ , Sauermelch CF , Coatney RW , Ao Z , Disa J , Holmes SD , Stadel JM , Martin JD , Liu WS , Glover GI , Wilson S , McNulty DE , Ellis CE , Elshourbagy NA , Shabon U , Trill JJ , Hay DWP , Ohlstein EH , Bergsma DJ , Douglas SA 1999 Human urotensin-II is a potent vasoconstrictor and agonist for the orphan receptor GPR14 . Nature 401 : 282 – 286 Google Scholar Crossref Search ADS PubMed WorldCat 3 Lederis K 1984 The fish urotensins: hypophyseal and peripheral actions in fishes and mammals . In: Martini L and Ganong WF , eds. Frontiers in neuroendocrinology . New York : Raven Press ; 247 – 263 Google Preview WorldCat COPAC 4 Balment RJ , Song W , Ashton N 2005 Urotensin II—ancient hormone with new function in vertebrate body fluid regulation . Ann NY Acad of Sci 1040 : 66 – 73 Google Scholar Crossref Search ADS WorldCat 5 Conlon, JM , Tostivint H , Vaudry H 1997 Somatostatin- and urotensin II-related peptides: molecular diversity and evolutionary perspectives . Regul Pept 69 : 95 – 103 Google Scholar Crossref Search ADS PubMed WorldCat 6 Douglas SA , Ohlstein EH 2000 Urotensin receptors . In: Girdlestone D , ed. The IUPHAR compendium of receptor characterisation and classification . London : IUPHAR Media ; 365 – 372 Google Preview WorldCat COPAC 7 Coulouarn Y , Jegou S , Tostivint H , Vaudry H , Lihrmann I 1999 Cloning, sequence analysis and tissue distribution of the mouse and rat urotensin II precursors . FEBS Lett 457 : 28 – 32 Google Scholar Crossref Search ADS PubMed WorldCat 8 Coulouarn Y , Lihrmann I , Jegou S , Anouar Y , Tostivint H , Beauvillain JC , Conlon M , Bern H , Vaudry H 1998 Cloning of the cDNA encoding the urotensin II precursor in frog and human reveals intense expression of the urotensin II gene in motoneurons of the spinal cord . Proc Natl Acad Sci USA 95 : 15803 – 15808 Google Scholar Crossref Search ADS PubMed WorldCat 9 Lu W , Dow L , Gumusgoz S , Brierley MJ , Warne JW , McCrohan CR , Balment RJ , Riccardi D 2004 Co-expression of corticotropin-releasing hormone (CRH) and urotensin I (UI) precursor genes in the caudal neurosecretory system of the euryhaline flounder (Platichthys flesus): a possible shared role in peripheral regulation . Endocrinology 145 : 5786 – 5797 Google Scholar Crossref Search ADS PubMed WorldCat 10 Kelsall CJ , Balment RJ 1998 Native urotensins influence cortisol secretion and cortisol concentration in the euryhaline flounder, Platichthys flesus . Gen Comp Endocrinol 112 : 210 – 219 Google Scholar Crossref Search ADS PubMed WorldCat 11 Winter MJ , Ashworth A , Bond H , Brierley MJ , McCrohan CR , Balment RJ 2000 The caudal neurosecretory system: control and function of a novel neuroendocrine system in fish . Biochem Cell Biol 78 : 193 – 203 Google Scholar Crossref Search ADS PubMed WorldCat 12 Arnold-Reed DE , Balment RJ , McCrohan CR , Hackney CM 1991 The caudal neurosecretory system of Platichthys flesus: general morphology and responses to altered salinity . Comp Biochem Physiol 99A : 137 – 143 Google Scholar Crossref Search ADS WorldCat 13 Bond H , Winter MJ , Warne JM , McCrohan CR , Balment RJ 2002 Plasma concentrations of arginine vasotocin and urotensin II are reduced following transfer of the euryhaline flounder (Platichthys flesus) from seawater to fresh water . Gen Comp Endocrinol 125 : 113 – 120 Google Scholar Crossref Search ADS PubMed WorldCat 14 Marshall NS , Bern NA 1979 Teleostean urophysis: urotensin II and ion transport across the isolated skin of a marine teleost . Science 204 : 519 – 520 Google Scholar Crossref Search ADS PubMed WorldCat 15 Loretz CA , Freel RW , Bern HA 1983 Specificity of response of intestinal ion transport systems to a pair of natural peptide hormone analogues: somatostatin and urotensin II . Gen Comp Endocrinol 52 : 198 – 206 Google Scholar Crossref Search ADS PubMed WorldCat 16 Loretz CA , Howard ME , Siegel AJ 1985 Ion transport in the goby intestine: cellular mechanism of urotensin II stimulation . Am J Physiol 249 : G285 – G293 WorldCat 17 Loretz CA , Bern HA 1981 Stimulation of sodium transport across the teleost urinary bladder by urotensin II . Gen Comp Endocrinol 43 : 325 – 330 Google Scholar Crossref Search ADS PubMed WorldCat 18 Conlon JM , Arnold-Reed DE , Balment RJ 1990 Post-translational processing of prepro-urotensin II . FEBS Lett 266 : 37 – 40 Google Scholar Crossref Search ADS PubMed WorldCat 19 Sambrook J , Fritsch EF , Maniatis T 1989 Analysis and cloning of eukaryotic genomic DNA. In: Molecular cloning: a laboratory manual . Plainview, NY : Cold Spring Harbor Laboratory Press Google Preview WorldCat COPAC 20 Winter MJ , Hubbard PC , McCrohan CR , Balment RJ 1999 A homologous radioimmunoassay for the measurement of urotensin II in the euryhaline flounder, Platichthys flesus . Gen Comp Endocrinol 114 : 249 – 256 Google Scholar Crossref Search ADS PubMed WorldCat 21 Mount SM 1982 A catalogue of splice junction sequences . Nucleic Acids Res 10 : 459 – 472 Google Scholar Crossref Search ADS PubMed WorldCat 22 Arnold-Reed DE , Balment RJ 1991 Salinity tolerance and its seasonal variation in the flounder, Platichthys flesus . Comp Biochem Physiol 99A : 145 – 149 Google Scholar Crossref Search ADS WorldCat 23 Sugo T , Murakami Y , Shimomura Y , Harada M , Abe M , Ishibashi Y , Kitada C , Miyajima N , Suzuki N , Mori M , Fujino M 2003 Identification of urotensin II-related peptide as the urotensin II-immunoreactive molecule in the rat brain . Biochem Biophys Res Commun 310 : 860 – 868 Google Scholar Crossref Search ADS PubMed WorldCat 24 Rouille Y , Duguay SJ , Lund K , Furuta M , Gong Q , Lipkind G , Oliva AA , Chan SJ , Steiner DF 1995 Proteolytic processing mechanisms in the biosynthesis of neuroendocrine peptides: the subtilisin-like proprotein convertases . Front Neuroendocrinol 16 : 322 – 361 Google Scholar Crossref Search ADS PubMed WorldCat 25 McMaster D , Lederis K 1983 Isolation and amino acid sequence of two urotensin peptides from Catostomus commersoni urophyses . Peptides 4 : 367 – 373 Google Scholar Crossref Search ADS PubMed WorldCat 26 Ichikawa T , Lederis K , Kobayashi H 1984 primary structures of multiple forms of urotensin II in the urophysis of the carp, Cyprinus carpio . Gen Comp Endocrinol 55 : 133 – 141 Google Scholar Crossref Search ADS PubMed WorldCat 27 Ohsako S , Ishida I , Ichikawa T , Deguchi T 1986 Cloning and sequence analysis of cDNAs encoding precursors of urotensin II-α and -γ . J Neurosci 6 : 2730 – 2735 Google Scholar PubMed WorldCat 28 Waugh D , Conlon JM 1993 Purification and characterization of urotensin II from the brain of a teleost (trout, Oncorhynchus mykiss) and an elasmobranch (skate, Raja rhina) . Gen Comp Endocrinol 92 : 419 – 427 Google Scholar Crossref Search ADS PubMed WorldCat 29 Yulis CR , Lederis K 1988 Occurrence of an anterior spinal, cerebrospinal fluid-contacting, urotensin II neuronal system in various fish species . Gen Comp Endocrinol 70 : 301 – 311 Google Scholar Crossref Search ADS PubMed WorldCat 30 Watanabe T , Pakala R , Katagiri T , Benedict CR 2001 Synergistic effect of urotensin II with mildly oxidized LDL on DNA synthesis in vascular smooth muscle cells . Circulation 104 : 16 – 18 Google Scholar Crossref Search ADS PubMed WorldCat 31 Matsushita M , Shichiri M , Fukai N , Ozawa N , Yoshimoto T , Takasu N , Hirata Y 2003 Urotensin II is an autocrine/paracrine growth factor for the porcine renal epithelial cell . Endocrinology 144 : 1825 – 1831 Google Scholar Crossref Search ADS PubMed WorldCat 32 Yoshimoto T , Matsushita M , Hirata Y 2004 Role of urotensin II in peripheral tissue as an autocrine/paracrine growth factor . Peptides 25 : 1775 – 1781 Google Scholar Crossref Search ADS PubMed WorldCat 33 Brierley MJ , Ashworth AJ , Craven TP , Woodburn M , Banks JR , Lu W , Riccardi D , Balment RJ , McCrohan CR 2003 Electrical activity of caudal neurosecretory neurons in seawater- and freshwater-adapted flounder: responses to cholinergic agonists . J Exp Biol 206 : 4011 – 4020 Google Scholar Crossref Search ADS PubMed WorldCat 34 Ashworth AJ , Banks JR , Brierley MJ , Balment RJ , McCrohan CR 2005 Electrical activity of caudal neurosecretory neurons in seawater and freshwater adapted Platichthys flesus, in vivo . J Exp Biol 208 : 267 – 275 Google Scholar Crossref Search ADS PubMed WorldCat 35 Russell JA , Leng G , Douglas AJ 2003 The magnocellular oxytocin system, the fount of maternity: adaptations in pregnancy . Front Neuroendocrinol 24 : 27 – 61 Google Scholar Crossref Search ADS PubMed WorldCat 36 Provencher L , Munro J , Dutil JD 1993 Osmotic performance and the survival of Atlantic cod (Gadus morhua) at low salinities . Aquaculture 116 : 219 – 231 Google Scholar Crossref Search ADS WorldCat 37 Baldisserotto B , Rakoski RJ , Fernandes CL 1996 Effect of urotensin II on water and ion fluxes in intestine, gall bladder and urinary bladder of the freshwater teleost, Hoplias malabaricus . Cie Nat 18 : 71 – 82 WorldCat 38 Baldisserotto B , Minimura OM 1997 Changes in the electrophysiological parameters of the posterior intestine of Anguilla anguilla (pisces) induced by oxytocin, urotensin II and aldosterone . Braz J Med Biol Res 30 : 35 – 39 Google Scholar Crossref Search ADS PubMed WorldCat 39 Loretz CA 1985 Species specificity and cellular mechanism of action of urotensin II in osmoregulation . In: Kobayashi H , Bern HA , Urano A , eds. Neurosecretion and the biology of neuropeptides . Berlin : Springer-Verlag ; 479 – 485 Google Preview WorldCat COPAC 40 Cheung BM , Leung R , Man YB , Wong LY 2004 Plasma concentration of urotensin II is raised in hypertension . J Hypertens 22 : 1341 – 1344 Google Scholar Crossref Search ADS PubMed WorldCat 41 Matsushita M , Shichiri M , Imai T , Iwashina M , Tanaka H , Takasu N , Hirata Y 2001 Co-expression of urotensin II and its receptor (GPR14) in human cardiovascular and renal tissues . J Hypertens 19 : 2185 – 2190 Google Scholar Crossref Search ADS PubMed WorldCat 42 Totsune K , Takahashi K , Arihara Z , Sone M , Satoh F , Ito S , Kimura Y , Sasano H , Murakami O 2001 Role of urotensin II in patients on dialysis . Lancet 358 : 810 – 811 Google Scholar Crossref Search ADS PubMed WorldCat 43 Zhang AY , Chen YF , Zhang DX , Yi FX , Qi J , Andrade-Gordon P , de Garavilla L , Li PL , Zou AP 2003 Urotensin II is a nitric oxide-dependent vasodilator and natriuretic peptide in the rat kidney . Am J Physiol Renal Physiol 285 : F792 – F798 Google Scholar Crossref Search ADS PubMed WorldCat 44 Shenouda A , Douglas SA , Ohlstein EH , Giaid A 2002 Localisation of urotensin-II immunoreactivity in normal human kidneys and renal carcinoma . J Histochem Cytochem 50 : 885 – 889 Google Scholar Crossref Search ADS PubMed WorldCat 45 Song W , Abdel-Razik, AES , Lu W , Zhaohui AO , Johns DG , Douglas SA , Balment RJ , Ashton N 2005 Urotensin II and renal function in the rat . Kidney Int 69 : 1360 – 1368 Google Scholar Crossref Search ADS WorldCat Copyright © 2006 by The Endocrine Society
TI - Molecular Characterization and Expression of Urotensin II and its Receptor in the Flounder (Platichthys flesus): A Hormone System Supporting Body Fluid Homeostasis in Euryhaline Fish
JF - Endocrinology
DO - 10.1210/en.2005-1457
DA - 2006-08-01
UR - https://www.deepdyve.com/lp/oxford-university-press/molecular-characterization-and-expression-of-urotensin-ii-and-its-5yLjmIziPI
SP - 3692
VL - 147
IS - 8
DP - DeepDyve
ER -