TY - JOUR
AU - Frazer, Sarah, E
AB - Abstract A reporter gene encoding green fluorescent protein (GFP) was introduced into the ascomycete Coniochaeta ligniaria NRRL30616, and fluorescence of cultures was monitored as a measure of cell growth. Fluorescence in the GFP-expressing strain was measured during growth of cells in defined and complex media as well as in the liquor derived from pretreatment of corn stover, an agricultural residue. Fluorescence mirrored growth of cultures, as measured by optical density and counts of colony forming units. Because traditional methods to monitor growth cannot be used in biomass liquors due to its fibrous, dark-colored nature, the speed and convenience of using GFP to monitor growth is advantageous. Fluorescence of cultures in biomass hydrolysate also correlated with the concentration of furfural in hydrolysate. Furfural and other compounds, present in hydrolysate due to physico-chemical pretreatment of biomass, are inhibitory to fermenting microbes. Therefore, measurement of fluorescence in GFP-expressing C. ligniaria is a proxy for measures of microbial growth and furfural consumption, and serves as a convenient indicator of metabolism of fermentation inhibitors in biomass hydrolysate. Introduction Lignocellulosic biomass is a potential source of sugars for conversion to fuels and chemicals. Energy crops such as perennial grasses and agricultural residues such as wheat straw, corn stover, and rice hulls comprise cellulose and hemicellulose polymers that can be converted by microbial action to biofuels and chemicals. An important early step in biomass conversion is recovery of fermentable sugars using physical and chemical pretreatment of the fibrous biomass feedstocks [1, 2]. Due to the necessarily harsh pretreatment conditions, however, the sugars obtained from biomass are typically contaminated with inhibitory compounds, which present an obstacle to the use of biomass as fermentation feedstock [3–5]. Inhibitors arising from lignin solubilization and sugar degradation include aromatic, aliphatic, and furanic compounds that hinder microbial growth and fermentation [6]. One approach to mitigating fermentation inhibitors present in biomass liquors is a bioabatement strategy, in which a microbe is used to detoxify inhibitors prior to conversion of sugars to fuel or another end product [7–9]. Biological inhibitor abatement is promising for treating liquid–solid mixtures, such as biomass liquors containing fibrous material, without chemical inputs or generation of chemical waste. The bioabatement strain Coniochaeta ligniaria NRRL30616 was isolated from soil [10] in a selection and screen to identify microbes effective for depleting furan and aromatic compounds commonly present in pretreated biomass. Coniochaetaligniaria is an ascomycete that is facile to grow both in liquid culture and on solid medium. Liquid cultures contain hyphae but exhibit primarily a yeast-like appearance due to formation of conidia on reduced conidiophores [11] (Figure 1). Figure 1: Open in new tabDownload slide Coniochaeta ligniaria NRRL30616 grown (A) in liquid defined mineral medium containing 10 mM furfural as carbon source and (B) on solid mineral medium containing corn stover dilute-acid hydrolysate. Figure 1: Open in new tabDownload slide Coniochaeta ligniaria NRRL30616 grown (A) in liquid defined mineral medium containing 10 mM furfural as carbon source and (B) on solid mineral medium containing corn stover dilute-acid hydrolysate. Strain NRRL30616 has potential utility for detoxifying biomass hydrolysates, enabling subsequent conversion of sugars to product (ethanol) using a fermenting yeast or bacterium [8, 12]. Removal of fermentation inhibitors from biomass liquors occurs as a result of metabolism by the bioabatement microbe. Myriad inhibitory compounds are present in hydrolyzed biomass [13], and C. ligniaria NRRL30616 has been shown to metabolize furfural, 5-hydroxymethylfurfural (HMF), acetate, benzaldehyde, and many more aromatic and aliphatic carbon sources [14]. In hydrolysates prepared using dilute-acid pretreatment, furfural and HMF are potent inhibitors, and reduction in their concentrations is advantageous for successful fermentation of biomass sugars to ethanol [15, 16]. Thus, the concentration of furfural and/or HMF in hydrolysate can be monitored in order to determine when the overall inhibitory load has been reduced by bioabatement to a level acceptable for fermentation [7–9, 17]. Furan concentration is routinely measured in culture supernatants by use of high-performance liquid chromatography (HPLC) coupled with UV detection. However, furan quantification using HPLC is fairly time-consuming and low-throughput because samples are processed individually and LC separation of furfural and HMF requires ∼25 min per sample. Because the concentration of inhibitors is closely related to growth of the bioabatement microbe, it should instead be possible to monitor microbial growth as a more expedient means to infer concentration of furans and other inhibitors in the hydrolysate. Thus, a convenient method to track microbial growth and corresponding consumption of inhibitors during incubation of bioabatement cultures is needed. Green fluorescent protein (GFP) is a useful tool of molecular biology for a variety of applications including visualizing cells and protein localization. GFP is a small protein that emits fluorescence when exposed to blue or ultraviolet (UV) light, without need for cellular cofactors or substrates other than molecular oxygen [18]. Here, we introduced a GFP reporter gene into the bioabatement microbe C. ligniaria NRRL30616, and monitored culture fluorescence as an alternative to measuring cell growth and inhibitor concentrations in biomass hydrolysate. Materials and methods Dilute acid pretreatment of corn stover Corn stover was air-dried, milled (Wiley Model 4, Thomas Scientific, Swedesboro, NJ, USA) to pass through a 2 mm screen, and stored at room temperature. Stover was pretreated in rotating (50 r.p.m.) stainless steel reactors equipped with infrared heating (Labomat BFA-12 v200, Werner Mathis, Concord, NC, USA) [8]. Dilute acid [100 ml 0.5% (v/v) H2SO4] containing 10 g corn stover was incubated for 15 min at 160°C with heating and cooling times of ∼45 and 35 min, respectively. Solids were removed by centrifugation (20 min, 15 000 g) and washed with a 10% volume of sterile water. The supernatant resulting from pretreatment was combined with the wash liquid and the pH was adjusted with Ca(OH)2 to 6.5, then sterilized by filtration. Strains and growth conditions Yarrowia lipolytica strain W29 (= CBS 7504) was obtained from the CBS-KNAW Culture Collection (Utrecht, the Netherlands). Coniochaetaligniaria NRRL30616 was isolated from soil based on its ability to withstand and metabolize a variety of fermentation inhibitors [10]. Media components were purchased from BD (Franklin Lakes, NJ, USA). Yarrowialipolytica was cultured in yeast extract-peptone-dextrose medium (YPD) (10 g/l yeast extract, 20 g/l peptone, and 20 g/l glucose) at 28°C, with shaking at 250 r.p.m. (Innova 4230 incubator, New Brunswick Scientific, New Brunswick, NJ, USA). Coniochaetaligniaria was grown in defined mineral medium [10] with 20 g/l glucose filter-sterilized and added separately, or in YPD medium, at 30°C, with shaking at 225 r.p.m. Growth was measured using optical density, GFP fluorescence, or dilution plating. Solid mineral medium contained 15 g/l Noble agar (autoclaved separately in water and added after sterilization) and solid YPD medium contained 15 g/l Bacto agar. Construction of GFP expression plasmid pJQ7 for use in C. ligniaria DNA assembly was performed using the Gibson assembly cloning kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions. DNA fragments for assembly were amplified in standard 50 μl PCR reactions using the Phusion High Fidelity Master Mix with High Fidelity buffer (NEB). Primers used are described in Supplementary Table S1. Promoter and terminator sequences were amplified from Y. lipolytica W29 genomic DNA, which was prepared using the Yeastar Genomic DNA kit (Zymo Research, Irvine, CA, USA). The bacterial hph gene conferring hygromycin resistance was amplified from pCSN43 (Fungal Genetics Stock Center, Manhattan, KS, USA). The Renilla reniformis hrGFP sequence was obtained from pIRES-hrGFP-1a (Agilent Technologies, Santa Clara, CA, USA). PCR products were purified with the PCR Purification kit (Qiagen, Valencia, CA, USA) before assembly. Construction of the GFP expression plasmid, pJQ7, was conducted in two steps by Gibson assembly; each step involved four DNA fragments with 25 bp overlap between adjacent fragments. First, the hph gene sequence flanked by the strong, constitutive EXP1 promoter and xpr2 terminator from Y. lipolytica was inserted into a PCR-generated product from pUC19 [19]. Second, the hrGFP gene flanked by the strong, constitutive TEF promoter and cyc1 terminator was inserted into the pUC19-Hph product from the previous step. After each round of Gibson assembly, the sequence of constructed plasmids was verified. Transformation of C. ligniaria Coniochaetaligniaria protoplasts were prepared from early log-phase cultures grown in liquid YPD medium (20). Cells were collected by centrifugation at 4°C and washed twice with protoplasting buffer (0.5 M sorbitol, 20 mM KH2P04, pH 6.4), then resuspended in the same buffer and incubated with 1% (v/v) β-mercaptoethanol at 30°C for 45 min. Cell pellets were collected and resuspended in protoplasting buffer containing 20 mg/ml cell wall lysing enzymes (L1412, Sigma-Aldrich, St Louis, MO, USA). Formation of protoplasts was monitored using light microscopy after incubation for 30–60 min at 30°C. Protoplasts were harvested, washed twice with STC buffer (1.0 M sorbitol, 10 mM Tris pH 7.5, 50 mM CaCl2) and resuspended in STC. Plasmid DNA (1.0 µg in water) and 50 µl of STC buffer containing 25% w/v PEG8000 were added to 0.2 ml of protoplast suspension and incubated on ice for 20 min. Then, 2 ml of STC buffer containing 25% (w/v) PEG8000 was added and the mixture was incubated at room temperature for 20 min. Regeneration buffer (4 ml of 1 M sorbitol, 0.1% yeast extract, 0.1% K2HPO4, 0.05% MgSO4) was added and the mixture was incubated overnight at 30°C with shaking. Transformants were selected by plating on solid YPD medium containing 100 µg/ml hygromycin (Sigma-Aldrich). Genomic DNA was prepared from C. ligniaria by treatment of cells with β-mercaptoethanol and cell-wall lysing enzymes as described for protoplast preparation, followed by processing with the OmniPrep for Fungus genomic DNA isolation kit (G Biosciences, St Louis, MO, USA). Transformation of C. ligniaria was verified by PCR-amplification of genomic DNA using oligonucleotide primers 5ʹCGTCTGTCGAGAAGTTTC3ʹ and 5ʹCATTGTTGGAGCCGAAATC3ʹ for detection of the hph gene and 5ʹGCACTTTTTGCAGTACTAACCGCAG3ʹ and 5ʹ AGGCTAAGGGTCCAGTTGTAGACG3ʹ for amplification of the hrGFP gene. GFP detection and quantitation Cells of C. ligniaria carrying pJQ7 were collected by centrifugation, washed twice with mineral medium, and resuspended in an equal volume of mineral medium. GFP fluorescence was measured in 200 μl samples at room temperature in a Synergy HTX microplate reader (BioTek Instruments, Inc., Winooski, VT, USA) using Gen5 software (BioTek). Excitation and emission were 485 and 528 nm, respectively. Fluorescence was measured from the bottom of wells, using a gain of 50. GFP protein concentration was determined from a standard curve using the GFP Fluorometric Quantitation Kit (Cell Biolabs, Inc., San Diego, CA, USA). Analytical methods Optical density of fungal cultures in YPD or mineral medium was measured as absorbance at 600 nm (1.0 cm pathlength) using a DU 640 spectrophotometer (Beckman Instruments, Fullerton, CA, USA). The concentration of furfural in hydrolysate was measured by using reverse-phase HPLC with UV detection at 277 nm [10]. Protein concentration in fungal cultures was determined by using the Bio-Rad protein assay (Bio-Rad Laboratories, Richmond, CA, USA) with bovine serum albumin as the standard. Cell pellets were collected from 0.1 ml culture medium by centrifugation and washed in mineral medium, then resuspended in 5% trichloroacetic acid and incubated on ice for 5 min. The resulting precipitate was collected by centrifugation at 21 000 g, suspended in 1.0 ml of 0.1 M NaOH and placed in a boiling water bath for 10 min, then cooled to room temperature prior to protein assay. Results Expression of GFP in C. ligniaria Transforming plasmid pJQ7 was constructed for expression of GFP in a standard cloning vector (pUC19) with a hygromycin-resistance gene that has previously-demonstrated utility for transformation of C. ligniaria (20). The mammalian codon-optimized (hrGFP) protein was previously shown to be superior for use in the oleaginous yeast Y. lipolytica (21), and was found in this work to also be well-expressed in C. ligniaria. After incubation with pJQ7 and overnight recovery, C. ligniaria protoplasts were plated onto solid YPD medium containing hygromycin for selection of transformants. A colony was selected that grew in the presence of 100 μg/ml hygromycin and exhibited fluorescence upon exposure to a UV light source. The presence of both the hph and GFP genes in the fluorescent transformant was verified by PCR amplification from genomic DNA (data not shown). GFP fluorescence was quantitated in whole cell suspensions by comparison to a standard curve generated for purified GFP. Fluorescence of C. ligniaria transformed with pJQ7 and grown in liquid YPD medium equated to 20.7 ± 3.6 μg of GFP per mg of cellular protein. GFP was not detected in untransformed C. ligniaria. To determine the utility of measuring GFP as an indicator of growth in C. ligniaria, fluorescence was measured in time courses for cultures grown in two types of culture media. Coniochaetaligniaria NRRL30616 carrying pJQ7 was cultured in a defined, phosphate-buffered mineral medium with glucose as carbon source and in a rich growth medium (YPD) consisting of yeast extract, peptone, and glucose. Because sterile YPD medium exhibited background fluorescence, cell pellets were collected, washed, and suspended in mineral medium prior to measurement of fluorescence. Figure 2 shows the GFP fluorescence of cultures grown in mineral medium and YPD medium. Fluorescence generally mirrored microbial growth as measured by optical density (OD) and counting of colony forming units (CFU) over 24 h. At later time points, however, the increased fluorescence was not reflected in measurements of growth. This is likely due to the filamentous growth of the fungal strain, which is observed particularly in older cultures. Filamentous growth cannot be accurately captured by measurements of OD, and is also likely to be under-reported in dilution and plating of cultures for quantitation of CFUs. Figure 2: Open in new tabDownload slide Growth and fluorescence of C. ligniaria NRRL30616 transformed with pJQ7 in (A) mineral medium and (B) YPD medium. (Filled diamond) Fluorescence (μg GFP/ml) is compared to cellular growth as measured by (filled triangle) optical density (OD at 600 nm), and (filled square) measurement of colony forming units (CFU × 107/ml). Lines represent the average of duplicate cultures. Error bars show standard deviation. Figure 2: Open in new tabDownload slide Growth and fluorescence of C. ligniaria NRRL30616 transformed with pJQ7 in (A) mineral medium and (B) YPD medium. (Filled diamond) Fluorescence (μg GFP/ml) is compared to cellular growth as measured by (filled triangle) optical density (OD at 600 nm), and (filled square) measurement of colony forming units (CFU × 107/ml). Lines represent the average of duplicate cultures. Error bars show standard deviation. Stability of GFP in C. ligniaria Southern analysis of the fluorescent C. ligniaria transformant (data not shown) indicated that pJQ7 was integrated in the C. ligniaria chromosome; therefore, antibiotic selection should not be required for maintenance of the GFP determinant in C. ligniaria NRRL30616 harboring pJQ7. To establish the stability of GFP fluorescence in C. ligniaria, the hygromycin-resistant, fluorescing transformant was subcultured in liquid YPD in the absence of hygromycin and plated onto solid YPD medium without hygromycin. As a measure of stability of pJQ7 in C. ligniaria, 10 colonies resulting from plating onto YPD without hygromycin were tested for hygromycin resistance; all of the colonies fluoresced when exposed to a UV light source and maintained the ability to grow when re-cultured in medium containing hygromycin. To compare GFP fluorescence, the colonies were inoculated into liquid YPD medium with or without hygromycin, incubated overnight, and diluted to 0.1 OD units. Fluorescence measured in cells incubated without hygromycin was 108 ± 26% of cultures grown with hygromycin present. This result indicates that fluorescence of GFP in pJQ7-transformed C. ligniaria is phenotypically stable without need for antibiotic selection. Comparison of fluorescence and inhibitor metabolism in corn stover hydrolysate After the utility and stability of GFP expression during growth of C. ligniaria were established, the utility of GFP to follow growth of the strain in biomass hydrolysate was examined. GFP fluorescence was measured during growth in hydrolysate prepared from dilute sulfuric acid pretreatment of corn stover. The liquor, with the solid fraction removed for these experiments, contained (w/v) 0.41% glucose, 1.98% xylose, 0.33% arabinose, and 0.16% galactose, along with 7.0 mM furfural and 1.7 mM HMF. Coniochaetaligniaria grown in corn stover hydrolysate metabolizes furfural, HMF, and other inhibitory compounds and, after extended incubation, consumes glucose, xylose, and other monosaccharides. In three experiments, consumption of furfural was measured and compared to fluorescence and to cell growth as measured by dilution plating and counting of CFUs. Figure 3A shows measurements of GFP fluorescence in cell pellets that were washed and suspended in mineral medium. Figure 3B shows cellular growth as CFUs counted. In the hydrolysate, the initial concentration of the microbial inhibitors furfural and 5-hydroxymethylfurfural was 7.0 and 1.7 mM, respectively. Figure 3C shows consumption of furfural during growth of the cultures. Similar trends were observed for HMF concentrations (data not shown). These results show that fluorescence of C. ligniaria expressing GFP mirrors cell growth and reflects metabolism of furanic inhibitors in corn stover liquor. Figure 3: Open in new tabDownload slide (A) GFP fluorescence, (B) growth as measured by dilution plating, and (C) furfural consumption by C. ligniaria NRRL30616 carrying pJQ7 growing in corn stover dilute-acid hydrolysate. Lines represent three separate experiments, each carried out in duplicate cultures. Error bars show standard deviation. Figure 3: Open in new tabDownload slide (A) GFP fluorescence, (B) growth as measured by dilution plating, and (C) furfural consumption by C. ligniaria NRRL30616 carrying pJQ7 growing in corn stover dilute-acid hydrolysate. Lines represent three separate experiments, each carried out in duplicate cultures. Error bars show standard deviation. As observed for culture OD and CFUs in traditional growth media (Figure 2), the plating efficiency observed during growth in corn stover hydrolysate (Figure 3) appeared to be inconsistent, relative to fluorescence, at later time points. Thus, Figure 4 examines GFP fluorescence and CFU quantification for their utility in predicting concentration of inhibitor in hydrolysate and shows that GFP is better-correlated than is CFU with furfural concentration. Figure 4: Open in new tabDownload slide A. GFP fluorescence and B. dilution colony counts associated with furfural concentration during growth of C. ligniaria NRRL30616 carrying pJQ7 in corn stover hydrolysate. Figure 4: Open in new tabDownload slide A. GFP fluorescence and B. dilution colony counts associated with furfural concentration during growth of C. ligniaria NRRL30616 carrying pJQ7 in corn stover hydrolysate. Discussion Measurement of furfural consumption by C. ligniaria is an indicator of the extent of overall inhibitor abatement in biomass liquor. It is worth noting that extended incubation of bioabatement, beyond the time when inhibitors are consumed, is undesirable because it results in lost product yield due to consumption of sugars present in hydrolysate. Coniochaetaligniaria preferentially metabolizes furfural over glucose; however, the strain will progress to consumption of sugars once the inhibitor load is reduced [7]. Therefore, in order to mitigate fermentation inhibitors while avoiding consumption of fermentable sugars, a convenient method to monitor bioabatement and estimate consumption of inhibitory compounds is needed. Concentration of furfural can be directly measured as an indicator of overall consumption of inhibitory compounds in biomass liquors; however, a rapid measure of growth would be faster and more convenient than HPLC analysis of inhibitor concentration in biomass liquors. Use of biomass hydrolysates as growth medium, unfortunately, complicates most methods for measurement of microbial growth. Measurement of optical absorbance is not reliable in hydrolysates, which are dark in color and which contain particles and/or fibers that impede uniform mixing and interfere with light-scattering measurements. Similarly, direct measurement of fungal dry cell mass is often not practical in fibrous biomass hydrolysates. Measurement of cell growth using culture-based methods is not timely due to the requirement for growth of visible colonies, and is complicated by the presence of hyphae which may result in low plating efficiency relative to cell mass. Estimation of fungal cell mass by assay of chitin or sterol content is time-and labor-intensive [22, 23] and would not be preferable to HPLC analysis of inhibitor concentrations. Viability and nuclear staining coupled with image cytometry (acridine orange-propidium iodide [24]) is a potentially useful method for quantifying cells in particulate media, however individual cells can be difficult to distinguish, and image cytometer cost and availability may limit use of this method. In comparison, GFP fluorescence measurement allows for convenient and timely estimation of fungal growth and metabolism. GFP is an established tool used in yeast and filamentous fungi. GFP has been used for detecting fungal gene expression and protein localization, investigating the molecular basis of cellular morphogenesis, visualizing fungal cells in various environments, and investigating fungal-host interactions, as well as tagging and localizing organelles [25]. Recent reports include use of GFP-tagged Trichoderma harzianum to monitor biological control of the potato cyst nematode [26] and GFP expression in Armillaria mellea using a native promoter, which could be used to understand the Armillaria root disease process [27]. Dual-color imaging of green and red fluorescent proteins was used to monitor development of Sporisorium scitamineum, the sugarcane smut fungus, throughout its life cycle (28). For fungal quantification, Maor et al. [29] followed phytopathogenic development of the fungus Cochliobolus heterostrophus in maize leaves, correlating fluorescence with mycelial mass and disease levels using digital image analysis. Ment et al. [30] used GFP to assess loss of Metarhizium anisopliae viability on resistant tick hosts compared to sensitive ticks. Relevant to biomass conversion, fluorescence of a GFP-modified Escherichia coli strain was used to monitor enzymatic hydrolysis of cellulose and sugar consumption in corn stover hydrolysate [31]. That work demonstrated that fluorescence was proportional to the bacterial growth rate and thus may serve as an indicator of feedstock convertibility. The data presented here shows that fluorescence in a fungal bioabatement strain carrying GFP mirrors growth and furan metabolism, and measurement of fluorescence serves as a convenient proxy for measurement of inhibitor concentration in carrying out experiments using biomass hydrolysate. Supplementary data Supplementary data is available at Biology Methods and Protocols online. Author contributions N.N.N. devised the project, directed and conducted experiments, and prepared the article. J.C.Q. and S.E.F. conducted experiments and edited the article. Acknowledgements Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture (USDA). USDA is an equal opportunity provider and employer. Conflict of interest statement. None declared. References 1 Hendriks ATWM , Zeeman G. Pretreatments to enhance the digestibility of lignocellulosic biomass . Bioresour Technol 2009 ; 100 : 10 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Mosier N , Wyman C , Dale B et al. Features of promising technologies for pretreatment of lignocellulosic biomass . Bioresour Technol 2005 ; 96 : 673 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Palmqvist E , Hahn-Hägerdal B. Fermentation of lignocellulosic hydrolysates. I: inhibition and detoxification . Bioresour Technol 2000 ; 74 : 17 – 24 . Google Scholar Crossref Search ADS WorldCat 4 Pienkos PT , Zhang M. Role of pretreatment and conditioning processes on toxicity of lignocellulosic biomass hydrolysates . Cellulose 2009 ; 16 : 743 – 62 . Google Scholar Crossref Search ADS WorldCat 5 Ximenes E , Kim Y , Mosier N et al. Deactivation of cellulases by phenols . Enzyme Microb Technol 2011 ; 48 : 54 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Jönsson LJ , Alriksson B , Nilvebrant N-O. Bioconversion of lignocellulose: inhibitors and detoxification . Biotechnol Biofuels 2013 ; 6 : 16 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Nichols NN , Dien BS , Guisado GM et al. Bioabatement to remove inhibitors from biomass-derived sugar hydrolysates . Appl Biochem Biotechnol 2005 ; 121 : 379 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Nichols NN , Dien BS , Cotta MA. Fermentation of bioenergy crops into ethanol using biological abatement for removal of inhibitors . Bioresour Technol 2010 ; 101 : 7545 – 50 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Zhang J , Zhu Z , Wang X et al. Biodetoxification of toxins generated from lignocellulose pretreatment using a newly isolated fungus, Amorphotheca resinae ZN1, and the consequent ethanol fermentation . Biotechnol Biofuels 2010 ; 3 : 26 . Google Scholar Crossref Search ADS PubMed WorldCat 10 López MJ , Nichols NN , Dien BS et al. Isolation of microorganisms for biological detoxification of lignocellulosic hydrolysates . Appl Microbiol Biotechnol 2004 ; 64 : 125 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Damm U , Fourie PH , Crous PW. Coniochaeta (Lecythophora), Collophora gen. nov. and Phaeomoniella species associated with wood necroses of Prunus trees . Persoonia 2010 ; 24 : 60 – 80 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Saha BC , Nichols NN , Cotta MA. Ethanol production from wheat straw by recombinant Escherichia coli strain FBR5 at high solid loading . Bioresour Technol 2011 ; 102 : 10892 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Sharma LN , Becker C , Chambliss CK. Analytical characterization of fermentation inhibitors in biomass pretreatment samples using liquid chromatography, UV-Visible Spectroscopy, and Tandem Mass Spectrometry. In: Mielenz JR (ed.), Biofuels: Methods and Protocols , Methods in Molecular Biology Series, Vol. 581. New York : Humana Press , 2009,125–43. Google Preview WorldCat COPAC 14 Nichols NN , Sharma LN , Mowery RA et al. Fungal metabolism of fermentation inhibitors present in corn stover dilute acid hydrolysate . Enzyme Microbial Technol 2008 ; 42 : 624 – 30 . Google Scholar Crossref Search ADS WorldCat 15 Wang S , Cheng G , Joshua C et al. Furfural tolerance and detoxification mechanism in Candida tropicalis . Biotechnol Biofuels 2016 ; 9 : 250 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Zaldivar J , Martinez A , Ingram LO. Effect of selected aldehydes on the growth and fermentation of ethanologenic Escherichia coli . Biotechnol Bioeng 1999 ; 65 : 24 – 33 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Nichols NN , Hector RE , Saha BC et al. Biological abatement of inhibitors in rice hull hydrolyzate and fermentation to ethanol using conventional and engineered microbes . Biomass Bioenerg 2014 ; 67 : 79 – 88 . Google Scholar Crossref Search ADS WorldCat 18 Stepanenko OV , Verkhusha VV , Kuznetsova IM et al. Fluorescent proteins as biomarkers and biosensors: throwing color lights on molecular and cellular processes . Curr Protein Pept Sci 2008 ; 9 : 338 – 69 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Yanisch-Perron C , Vieira J , Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors . Gene 1985 ; 33 : 103 – 19 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Nichols NN , Szynkarek MP , Skory CD et al. Transformation and electrophoretic karyotyping of Coniochaeta ligniaria NRRL30616 . Curr Genet 2011 ; 57 : 169 – 75 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Blazeck J , Liu L , Redden H , Alper H. Tuning gene expression in Yarrowia lipolytica by a hybrid promoter approach . Appl Environ Microbiol 2011 ; 77 : 7905 – 14 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Braid GH , Line MA. A sensitive chitin assay for the estimation of fungal biomass in hardwoods . Holzforschung 1981 ; 35 : 10 – 5 . Google Scholar Crossref Search ADS WorldCat 23 Güsewell S , Gessner MO. N: P ratios influence litter decomposition and colonization by fungi and bacteria in microcosms . Funct Ecol 2009 ; 23 : 211 – 9 . Google Scholar Crossref Search ADS WorldCat 24 Chan LL , Smith TF , Kumph KA et al. A high-throughput AO/PI-based cell concentration and viability detection method using the Celigo image cytometry . Cytotechnology 2016 ; 68 : 2015 – 25 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Lorang JM , Tuori RP , Martinez JP et al. Green fluorescent protein is lighting up fungal biology . Appl Environ Microbiol 2001 ; 67 : 1987 – 94 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Contina JB , Dandurand LM , Knudsen GR. Use of GFP-tagged Trichoderma harzianum as a tool to study the biological control of the potato cyst nematode Globodera pallida . Appl Soil Ecol 2017 ; 115 : 31 – 7 . Google Scholar Crossref Search ADS WorldCat 27 Ford KL , Baumgartner K , Henricot B et al. A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea . Sci Rep 2016 ; 6 : 29226 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Yan M , Cai E , Zhou J et al. A dual-color imaging system for sugarcane smut fungus Sporisorium scitamineum . Plant Disease 2016 ; 100 : 2357 – 62 . Google Scholar Crossref Search ADS WorldCat 29 Maor R , Puyesky M , Horwitz BA , Sharon A. Use of green fluorescent protein (GFP) for studying development and fungal-plant interaction in Cochliobolus heterostrophus . Mycol Res 1998 ; 102 : 491 – 6 . Google Scholar Crossref Search ADS WorldCat 30 Ment D , Churchill ACL , Gindin G et al. Resistant ticks inhibit Metarhizium infection prior to haemocoel invasion by reducing fungal viability on the cuticle surface . Environ Microbiol 2012 ; 14 : 1570 – 83 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Haney LJ , Coors JG , Lorenz AJ et al. Development of a fluorescence-based method for monitoring glucose catabolism and its potential use in a biomass hydrolysis assay . Biotechnol Biofuels 2008 ; 1 : 17 . Google Scholar Crossref Search ADS PubMed WorldCat Published by Oxford University Press on behalf of Biology Methods and Protocols 2018. This work is written by US Government employees and is in the public domain in the United States.
TI - Use of green fluorescent protein to monitor fungal growth in biomass hydrolysate
JF - Biology Methods and Protocols
DO - 10.1093/biomethods/bpx012
DA - 2018-01-01
UR - https://www.deepdyve.com/lp/oxford-university-press/use-of-green-fluorescent-protein-to-monitor-fungal-growth-in-biomass-3Y2VJReL9R
VL - 3
IS - 1
DP - DeepDyve
ER -