TY - JOUR
AU - Rohrer, G. A.
AB - Abstract Ovulation rate is an integral component of litter size in swine, but is difficult to directly select for in commercial swine production. Because a QTL has been detected for ovulation rate at the terminal end of chromosome 8p, genetic markers for this QTL would enable direct selection for ovulation rate in both males and females. Eleven genes from human chromosome 4p16-p15, as well as one physiological candidate gene, were genetically mapped in the pig. Large insert swine genomic libraries were screened, clones were isolated and then screened for microsatellite repeats, and informative microsatellite markers were developed for seven genes (GNRHR, IDUA, MAN2B2, MSX1, PDE6B, PPP2R2C, and RGS12). Three genes (LRPAP1, GPRK2L, and FLJ20425) were mapped using genotyping assays developed from single nucleotide polymorphisms. Two genes were assigned since they were present in clones that contained mapped markers (HGFAC and HMX1). The resulting linkage map of pig chromosome 8 contains markers associated with 14 genes in the first 27 cM. One inversion spanning at least 3 Mb in the human genome was detected; all other differences could be explained by resolution of mapping techniques used. Fourteen of the most informative microsatellite markers in the first 27 cM of the map were genotyped across the entire MARC swine resource population, increasing the number of markers typed from 2 to 14 and more than doubling the number of genotyped animals with ovulation rate data (295 to 600). Results from the revised data set for the QTL analysis, assuming breed specific QTL alleles, indicated that the most likely position of the QTL resided at 4.85 cM on the new linkage map (F1,592 = 20.5150, genome-wide probability less than 0.015). The updated estimate of the effect of an allele substitution was −1.65 ova for the Meishan allele. The F-ratio peak was closest to markers for MAN2B2 (4.80 cM) and was flanked on the other side by markers for PPP2R2C. Two positional candidate genes included in this study are MAN2B2 and RGS12. These results validate the presence of a QTL affecting ovulation rate on chromosome 8 and facilitate selection of positional candidate genes to be evaluated. Introduction Because litter size is extremely important to the swine industry, it would be advantageous for swine producers to be able to select replacement gilts that had the potential to have larger litters than their peers. Although the heritability for litter size is low (Lamberson, 1990), it has been proposed that a greater response in litter size could be achieved by selecting for increased ovulation rate and increased uterine capacity (Bennett and Leymaster, 1989). However, neither of these traits can be easily measured. Selection for ovulation rate and uterine capacity could be facilitated by the identification of genetic markers associated with DNA variants affecting these traits. Rohrer et al. (1999) reported a QTL for ovulation rate on the p arm of porcine chromosome 8 (SSC8), along with a QTL affecting plasma FSH in pubertal boars (Rohrer et al., 2001). Porcine chromosome 8 is orthologous to human chromosome 4 based on bidirectional fluorescent in situ hybridization (Goureau et al., 1996). Rohrer (1999) mapped the gene PDE6B, which resides at HSA4p16.3, to the region where the QTL for ovulation rate exists at SSC8p2.3. In order to further characterize the area surrounding these QTL and to increase the precision of the estimates for the ovulation rate QTL parameters, genes located on HSA4p16 were mapped in the porcine genome and the most highly informative markers from the updated map were genotyped across animals of the original analysis (Rohrer et al., 1999), as well as 305 additional F3 gilts. Materials and Methods A total of 12 genes located on HSA 4 were studied. The selected genes, their acronym, and location in the human genome are presented in Table 1. Eleven of the genes were selected based on their assignment to HSA 4p16 or 4p15 (base positions of 0 to 11.7 Mb for 4p16, 11.7 to 37.3 Mb for 4p15) to determine the boundaries of the ovulation rate QTL on the human genome map, as well as to study the conservation of gene order. A genetic marker for GNRH receptor (GNRHR; Table 1) was developed because a yeast artificial chromosome (YAC) clone was available from our previous study (Rohrer, 1999). To increase marker density for this region, a YAC clone that contained S0098 and cosmid clones that yielded SW2410 and SW2611 were screened for additional microsatellites. Table 1. Data for genes known or predicted to map to SSC8 Gene acronym  Gene name  Location, Mba  FLJ20425  Hypothetical protein  4.2  GPRK2L  G-protein coupled receptor kinase 2-like  3.0  GNRHR  Gonadotropin releasing hormone receptor  68.5  HGFAC  Hepatocyte growth factor activator  3.4  HMX1  Homeobox (H6 family) 1  21.2  IDUA  α-L-iduronidase  1.0  LRPAP1  Low-density lipoprotein-related protein-associated protein 1  3.5  MAN2B2  α-Mannosidase 2, B2 (also KIAA 0935)  6.5  MSX1  msh homeobox homolog 1 (formerly HOX7)  4.7  PDE6B  Phosphodiesterase 6B  0.6  PPP2R2C  Protein phosphatase 2, regulatory subunit B, γ isoform  6.3  RGS12  Regulator of G-protein signaling 12  3.3  Gene acronym  Gene name  Location, Mba  FLJ20425  Hypothetical protein  4.2  GPRK2L  G-protein coupled receptor kinase 2-like  3.0  GNRHR  Gonadotropin releasing hormone receptor  68.5  HGFAC  Hepatocyte growth factor activator  3.4  HMX1  Homeobox (H6 family) 1  21.2  IDUA  α-L-iduronidase  1.0  LRPAP1  Low-density lipoprotein-related protein-associated protein 1  3.5  MAN2B2  α-Mannosidase 2, B2 (also KIAA 0935)  6.5  MSX1  msh homeobox homolog 1 (formerly HOX7)  4.7  PDE6B  Phosphodiesterase 6B  0.6  PPP2R2C  Protein phosphatase 2, regulatory subunit B, γ isoform  6.3  RGS12  Regulator of G-protein signaling 12  3.3  a Position was determined from the June 2002 build of the human genome as presented on the GoldenPath viewer (http://genome.ucsc.edu/). View Large Table 1. Data for genes known or predicted to map to SSC8 Gene acronym  Gene name  Location, Mba  FLJ20425  Hypothetical protein  4.2  GPRK2L  G-protein coupled receptor kinase 2-like  3.0  GNRHR  Gonadotropin releasing hormone receptor  68.5  HGFAC  Hepatocyte growth factor activator  3.4  HMX1  Homeobox (H6 family) 1  21.2  IDUA  α-L-iduronidase  1.0  LRPAP1  Low-density lipoprotein-related protein-associated protein 1  3.5  MAN2B2  α-Mannosidase 2, B2 (also KIAA 0935)  6.5  MSX1  msh homeobox homolog 1 (formerly HOX7)  4.7  PDE6B  Phosphodiesterase 6B  0.6  PPP2R2C  Protein phosphatase 2, regulatory subunit B, γ isoform  6.3  RGS12  Regulator of G-protein signaling 12  3.3  Gene acronym  Gene name  Location, Mba  FLJ20425  Hypothetical protein  4.2  GPRK2L  G-protein coupled receptor kinase 2-like  3.0  GNRHR  Gonadotropin releasing hormone receptor  68.5  HGFAC  Hepatocyte growth factor activator  3.4  HMX1  Homeobox (H6 family) 1  21.2  IDUA  α-L-iduronidase  1.0  LRPAP1  Low-density lipoprotein-related protein-associated protein 1  3.5  MAN2B2  α-Mannosidase 2, B2 (also KIAA 0935)  6.5  MSX1  msh homeobox homolog 1 (formerly HOX7)  4.7  PDE6B  Phosphodiesterase 6B  0.6  PPP2R2C  Protein phosphatase 2, regulatory subunit B, γ isoform  6.3  RGS12  Regulator of G-protein signaling 12  3.3  a Position was determined from the June 2002 build of the human genome as presented on the GoldenPath viewer (http://genome.ucsc.edu/). View Large Microsatellite Marker Development and Genotyping Microsatellite (CA/GT) repetitive elements were isolated from large swine genomic clones determined to contain genes of interest. Yeast artificial chromosome clones were identified by PCR using pooled DNA from the porcine YAC library described by Alexander et al. (1997), whereas cosmid clones were identified from a purchased porcine cosmid library by an iterative PCR technique (Smith et al., 1995). The bacterial artificial chromosome (BAC) clones were isolated from the Roswell Park Cancer Institute (Buffalo, NY) (RPCI)-44 porcine BAC library by hybridization with 1 × 106 counts/filter of each [α32P] dATP-labeled probe. Probes were generated either by labeling PCR amplicons with the MegaPrime DNA Labeling System (Amersham Pharmacia Biotech, Piscataway, NJ) or direct incorporation of radioisotope, and were then cleaned with a GS-25 sephadex column (5Prime3′, Boulder, CO). Positive clones were grown overnight, and DNA was extracted using a Qiagen miniprep kit (Qiagen, Valencia, CA). For BAC DNA, the Qiagen procedure was modified by adding overnight room temperature incubation after the elution of the BAC DNA from the columns and the addition of isopropanol before centrifugation. Microsatellite repeats were identified by digestion of the BAC, YAC, or cosmid clone DNA with either Tsp509I or Sau3AI and were ligated into EcoRI or BamHI digested pBluescript transformed into XL1 BLU Escherichia coli (Stratagene, La Jolla, CA) plated out and grown overnight. Colony lifts were probed with [γ32P] dATP kinased (GT)11, four or five positive colonies (when possible) were grown in 5 mL of Luria-Bertani medium with 50 μg/mL of ampicillin overnight, and then DNA was prepared using QIAprep miniprep kits (Qiagen). The sequencing reactions were performed with 2 μL of prepared plasmid DNA, 1 μL of 3.2 μM M13 primer, and 2 μL of ABI Big Dye (Perkin Elmer Corp., Foster City, CA) and run on an ABI-377 (Perkin Elmer Corp.). Sequences were deposited into GenBank. Primers were designed to amplify the region containing the GT repeat (Table 2). Table 2. New microsatellite markers developed from genomic clones Marker  Gene probea  Primers  Annealing temperature, °C  Number alleles  Informative meioses  Product size, bp  PDE6B  PDE6BC  caagagtcgctgcagaag  60  4  79  135 to 143      cataccccttcacacacgc          MANMS  MAN2B2C  agacctgcaacctgcagtg  58  5b  62  181 to 211      tgaatgggaaagggagagg          SW2651  SW2410C  tggctcagaggctgtcaac  58  3  116  100 to 106      actgtttacacaggcagggg          SW2652  SW2611C  ctccctttccagcccttc  58  6  137  235 to 297      atacaagcaatgtagcaatgttcc          SY12  IDUAY  tcggattctttcctcctgtg  58  4  64  185 to 224      tcacttgtgatggaacatgatg          SY13  IDUAY  tgcaaagttaccacacggac  58  2  47  118 to 122      cgtgcatgacatacctctgg          SY14  GNRHRY  cagagatgtttgaatgtgtctgc  58  3  108  106 to 112      gctcagtttccatattgtgc          SY20  MSX1Y  tgcctgctctactaccagagtg  55  6  65  133 to 155      agttgagaacctcagtgcagtg          SY21  S0098Y  tcaggaccagcttgaatgc  55  4  79  178 to 195      agttgagaacctcagtgcagtg          SY22  S0098Y  gctagagatggagaggcgg  55  4  123  157 to 165      gtatgggtacgcacatgagc          SY23  MSX1Y  aactatgacggccgctactg  55  6  127      90 to 124      ccccataatttcaccagcag          SY27  MSX1Y  ccaggttgtagcaaatggtg  60  5  138  132 to 156      agcccctcaacagatgaatg          SY30  MAN2B2Y  tgtgttagtttcaggtggatgg  58  3  46  174 to 192      ccaaggacctactgcagagc          SY35  MSX1Y  tgtcagtaacaatggctatggc  58  6  85  120 to 146      ggaaagcaagtgtgggagag          SY36  MSX1Y  gtctcacatcaaggctcaaatg  58  3  77  206 to 220      agaaagatagctgcaggtgtcc          SB37  MAN2B2B  gaatggataagcagtgaggtcc  55  6  77  248 to 288      ttgagtggcacctgtttttg          SB60  PPP2R2CB  ttctgggtggacacaacattc  58  3  136  223 to 231      atttgtcgtggctgtgtgc          SB62  PPP2R2CB  tcgctggaatatttatttattagga  55  6  145  126 to 139      accactggagtaccacgaag          SB73  RGS12B  ctcacgcttcctcacttagca  55  6  158  240 to 262      acgggtttctgtggagttttt          SB74  RGS12B  tcacggctcttgatggcacag  58  3  115  164 to 190      tctttcccctgtatctcccac          Marker  Gene probea  Primers  Annealing temperature, °C  Number alleles  Informative meioses  Product size, bp  PDE6B  PDE6BC  caagagtcgctgcagaag  60  4  79  135 to 143      cataccccttcacacacgc          MANMS  MAN2B2C  agacctgcaacctgcagtg  58  5b  62  181 to 211      tgaatgggaaagggagagg          SW2651  SW2410C  tggctcagaggctgtcaac  58  3  116  100 to 106      actgtttacacaggcagggg          SW2652  SW2611C  ctccctttccagcccttc  58  6  137  235 to 297      atacaagcaatgtagcaatgttcc          SY12  IDUAY  tcggattctttcctcctgtg  58  4  64  185 to 224      tcacttgtgatggaacatgatg          SY13  IDUAY  tgcaaagttaccacacggac  58  2  47  118 to 122      cgtgcatgacatacctctgg          SY14  GNRHRY  cagagatgtttgaatgtgtctgc  58  3  108  106 to 112      gctcagtttccatattgtgc          SY20  MSX1Y  tgcctgctctactaccagagtg  55  6  65  133 to 155      agttgagaacctcagtgcagtg          SY21  S0098Y  tcaggaccagcttgaatgc  55  4  79  178 to 195      agttgagaacctcagtgcagtg          SY22  S0098Y  gctagagatggagaggcgg  55  4  123  157 to 165      gtatgggtacgcacatgagc          SY23  MSX1Y  aactatgacggccgctactg  55  6  127      90 to 124      ccccataatttcaccagcag          SY27  MSX1Y  ccaggttgtagcaaatggtg  60  5  138  132 to 156      agcccctcaacagatgaatg          SY30  MAN2B2Y  tgtgttagtttcaggtggatgg  58  3  46  174 to 192      ccaaggacctactgcagagc          SY35  MSX1Y  tgtcagtaacaatggctatggc  58  6  85  120 to 146      ggaaagcaagtgtgggagag          SY36  MSX1Y  gtctcacatcaaggctcaaatg  58  3  77  206 to 220      agaaagatagctgcaggtgtcc          SB37  MAN2B2B  gaatggataagcagtgaggtcc  55  6  77  248 to 288      ttgagtggcacctgtttttg          SB60  PPP2R2CB  ttctgggtggacacaacattc  58  3  136  223 to 231      atttgtcgtggctgtgtgc          SB62  PPP2R2CB  tcgctggaatatttatttattagga  55  6  145  126 to 139      accactggagtaccacgaag          SB73  RGS12B  ctcacgcttcctcacttagca  55  6  158  240 to 262      acgggtttctgtggagttttt          SB74  RGS12B  tcacggctcttgatggcacag  58  3  115  164 to 190      tctttcccctgtatctcccac          a Type of genomic clone is represented by a superscript letter. B = BAC clone, C = cosmid clone, and Y = YAC clone. See Table 1 for gene names. b Number of alleles includes a null allele. View Large Table 2. New microsatellite markers developed from genomic clones Marker  Gene probea  Primers  Annealing temperature, °C  Number alleles  Informative meioses  Product size, bp  PDE6B  PDE6BC  caagagtcgctgcagaag  60  4  79  135 to 143      cataccccttcacacacgc          MANMS  MAN2B2C  agacctgcaacctgcagtg  58  5b  62  181 to 211      tgaatgggaaagggagagg          SW2651  SW2410C  tggctcagaggctgtcaac  58  3  116  100 to 106      actgtttacacaggcagggg          SW2652  SW2611C  ctccctttccagcccttc  58  6  137  235 to 297      atacaagcaatgtagcaatgttcc          SY12  IDUAY  tcggattctttcctcctgtg  58  4  64  185 to 224      tcacttgtgatggaacatgatg          SY13  IDUAY  tgcaaagttaccacacggac  58  2  47  118 to 122      cgtgcatgacatacctctgg          SY14  GNRHRY  cagagatgtttgaatgtgtctgc  58  3  108  106 to 112      gctcagtttccatattgtgc          SY20  MSX1Y  tgcctgctctactaccagagtg  55  6  65  133 to 155      agttgagaacctcagtgcagtg          SY21  S0098Y  tcaggaccagcttgaatgc  55  4  79  178 to 195      agttgagaacctcagtgcagtg          SY22  S0098Y  gctagagatggagaggcgg  55  4  123  157 to 165      gtatgggtacgcacatgagc          SY23  MSX1Y  aactatgacggccgctactg  55  6  127      90 to 124      ccccataatttcaccagcag          SY27  MSX1Y  ccaggttgtagcaaatggtg  60  5  138  132 to 156      agcccctcaacagatgaatg          SY30  MAN2B2Y  tgtgttagtttcaggtggatgg  58  3  46  174 to 192      ccaaggacctactgcagagc          SY35  MSX1Y  tgtcagtaacaatggctatggc  58  6  85  120 to 146      ggaaagcaagtgtgggagag          SY36  MSX1Y  gtctcacatcaaggctcaaatg  58  3  77  206 to 220      agaaagatagctgcaggtgtcc          SB37  MAN2B2B  gaatggataagcagtgaggtcc  55  6  77  248 to 288      ttgagtggcacctgtttttg          SB60  PPP2R2CB  ttctgggtggacacaacattc  58  3  136  223 to 231      atttgtcgtggctgtgtgc          SB62  PPP2R2CB  tcgctggaatatttatttattagga  55  6  145  126 to 139      accactggagtaccacgaag          SB73  RGS12B  ctcacgcttcctcacttagca  55  6  158  240 to 262      acgggtttctgtggagttttt          SB74  RGS12B  tcacggctcttgatggcacag  58  3  115  164 to 190      tctttcccctgtatctcccac          Marker  Gene probea  Primers  Annealing temperature, °C  Number alleles  Informative meioses  Product size, bp  PDE6B  PDE6BC  caagagtcgctgcagaag  60  4  79  135 to 143      cataccccttcacacacgc          MANMS  MAN2B2C  agacctgcaacctgcagtg  58  5b  62  181 to 211      tgaatgggaaagggagagg          SW2651  SW2410C  tggctcagaggctgtcaac  58  3  116  100 to 106      actgtttacacaggcagggg          SW2652  SW2611C  ctccctttccagcccttc  58  6  137  235 to 297      atacaagcaatgtagcaatgttcc          SY12  IDUAY  tcggattctttcctcctgtg  58  4  64  185 to 224      tcacttgtgatggaacatgatg          SY13  IDUAY  tgcaaagttaccacacggac  58  2  47  118 to 122      cgtgcatgacatacctctgg          SY14  GNRHRY  cagagatgtttgaatgtgtctgc  58  3  108  106 to 112      gctcagtttccatattgtgc          SY20  MSX1Y  tgcctgctctactaccagagtg  55  6  65  133 to 155      agttgagaacctcagtgcagtg          SY21  S0098Y  tcaggaccagcttgaatgc  55  4  79  178 to 195      agttgagaacctcagtgcagtg          SY22  S0098Y  gctagagatggagaggcgg  55  4  123  157 to 165      gtatgggtacgcacatgagc          SY23  MSX1Y  aactatgacggccgctactg  55  6  127      90 to 124      ccccataatttcaccagcag          SY27  MSX1Y  ccaggttgtagcaaatggtg  60  5  138  132 to 156      agcccctcaacagatgaatg          SY30  MAN2B2Y  tgtgttagtttcaggtggatgg  58  3  46  174 to 192      ccaaggacctactgcagagc          SY35  MSX1Y  tgtcagtaacaatggctatggc  58  6  85  120 to 146      ggaaagcaagtgtgggagag          SY36  MSX1Y  gtctcacatcaaggctcaaatg  58  3  77  206 to 220      agaaagatagctgcaggtgtcc          SB37  MAN2B2B  gaatggataagcagtgaggtcc  55  6  77  248 to 288      ttgagtggcacctgtttttg          SB60  PPP2R2CB  ttctgggtggacacaacattc  58  3  136  223 to 231      atttgtcgtggctgtgtgc          SB62  PPP2R2CB  tcgctggaatatttatttattagga  55  6  145  126 to 139      accactggagtaccacgaag          SB73  RGS12B  ctcacgcttcctcacttagca  55  6  158  240 to 262      acgggtttctgtggagttttt          SB74  RGS12B  tcacggctcttgatggcacag  58  3  115  164 to 190      tctttcccctgtatctcccac          a Type of genomic clone is represented by a superscript letter. B = BAC clone, C = cosmid clone, and Y = YAC clone. See Table 1 for gene names. b Number of alleles includes a null allele. View Large Microsatellite markers were genotyped in the USDA, ARS, U.S. Meat Animal Research Center's (MARC) swine reference population (Rohrer et al., 1994) and linkage analysis was performed with all SSC 8 genetic markers located in the MARC genome database using CRI-MAP (version 2.4; Green et al., 1990). Once the final marker order was determined, the CHROMPIC option of CRI-MAP was implemented to determine suspect genotypes. All suspect genotypes were evaluated and corrections were made when necessary. Selected microsatellite markers were also genotyped on the MARC swine resource population—which is comprised of a Meishan and White Composite cross—using the same methods (Rohrer et al., 1999). Single Nucleotide Polymorphism Marker Development and Genotyping Single nucleotide polymorphism (SNP) markers were developed for G-protein coupled receptor kinase 2-like (GPRK2L) and a hypothetical protein designated as FLJ20425. Amplicons were designed to amplify across an intron or 3′ untranslated regions; PCR was conducted on the parents of the MARC reference family and the products were sequenced; SNP was tagged as described by Fahrenkrug et al. (2002), and the sequences were submitted to GenBank. Genotyping assays were designed for the most informative SNP within each amplicon. The MassArray Genolyzer (Sequenom Inc., San Diego, CA) system was used for SNP genotyping. Assays were based on the addition of one or two nucleotides to an oligonucleotide primer adjacent to the polymorphic base. Extended products were separated with a time-of-flight mass spectrometer (Bruker Biflex III Linear Time of Flight Mass Spectrometer; Bruker Daltonics, Bremen, Germany) and genotypes were called. QTL Data and Analysis The swine population was described in Rohrer et al. (1999). Briefly, White Composite (a four-breed composite developed at MARC) and Meishan animals were mated to produce F1 females. The F1 females were mated to parental breed sires to produce both backcross genotypes (BC generation); BC animals were reciprocally mated to produce 1/2 Meishan, 1/2 White composite animals in the F3 generation, and F3 animals were inter se-mated to produce the F4 generation. Rohrer et al. (1999) used all females with phenotypic measurements in the BC and F4 generations, but only 25% of the females in the F3 generation. For this study, all females with phenotypic measurements for ovulation rate were used, which included 101 BC, 389 F3, and 110 F4 females. The additional 305 F3 females were genotyped for the markers used for the genome scan (SW2611 and SW1117). Based on the total number of alleles and the distribution of alleles within each breed, 12 additional microsatellite makers were genotyped across the entire population. These 14 markers spanned 27 cM. Marker density was greatest in the area where the original QTL was detected (nine markers located in the first 7 cM of the linkage group). Statistical analyses were conducted using the same model described by Rohrer et al. (1999). Regression coefficients for the probability that an allele originated from the Meishan breed (Haley et al., 1994) were used. All four genotypic combinations were initially evaluated, and genotypic effects were removed as described by Rohrer et al. (1999). Fixed effects included in the model were contemporary group and breed composition. Nominal and genome-wide significance values are reported (Lander and Kruglyak, 1995). Results New Marker Development Clones from the BAC, YAC, and cosmid libraries were identified, which contained α-mannosidase 2B2 (MAN2B2). Informative microsatellite markers were developed from all vectors; however, all microsatellites that mapped to SSC 8p were derived from the cosmid and BAC clones. Clones from the BAC library were identified that contained protein phosphatase 2 regulatory subunit B γ-isoform (PPP2R2C), regulator of G-protein signaling 12 (RGS12), and one clone that contained both low-density lipoprotein-related protein-associated protein 1 (LRPAP1) and hepatocyte growth factor activator (HGFAC). Clones from the YAC library were identified for homeo box 7 (MSX1), S0098, α-L-iduronidase (IDUA), and GNRHR (Rohrer, 1999). The cosmids for phosphodiesterase 6B (PDE6B; Rohrer, 1999), SW2410, and SW2611 (Alexander et al., 1996) previously identified were included. A total of 13 microsatellite markers were added to SSC 8 from these clones. The number of alleles and number of informative meioses in the MARC reference population for the informative microsatellite markers are presented in Table 2. Only one marker was developed from each of the cosmid clones. The number of microsatellite markers successfully developed from each BAC and YAC clone ranged from one to five, depending on the quality of sequence obtained and the number of unique subclones sequenced. Three out of the five selected YAC clones were chimeric since SY12 from the IDUA YAC mapped to SSC 5q, SY30 from the MAN2B2 YAC mapped to SSC 10q, and microsatellite markers SY20, SY27, SY35, and SY36 from the MSX1 YAC all mapped to the centromeric region of SSC 4 (for specific locations, see http://www.marc.usda.gov/). No informative microsatellite markers were developed from the BAC containing LRPAP1, HGFAC and a portion of RGS12. Table 3 presents information for the SNP markers developed and the number of informative meioses in the MARC reference population. Assays were designed for SNP associated with three genes. Table 3. Single nucleotide polymorphism markers developed Marker  Gene  Sequencea  Location  Informative meioses  SNP13033  GPRK2L  GCCCTGACGC[A/G]TGCCTGCTGC  Intron 14  84  SNP16873  FLJ20425  CCTTGAAGTT[A/G]CTAAAGGATA  3′UTR  124      CTTCCTTTCA[C/T]GACTGCTTGT      SNP21953  LRPAP1  GGCACCAGCG[A/G]GCTGGGGTTC  3′UTR  65      CAGTGGAGGC[A/G]TGACGGGGAC          GGACCAGCCA[C/T]GGGGGCCCGG      Marker  Gene  Sequencea  Location  Informative meioses  SNP13033  GPRK2L  GCCCTGACGC[A/G]TGCCTGCTGC  Intron 14  84  SNP16873  FLJ20425  CCTTGAAGTT[A/G]CTAAAGGATA  3′UTR  124      CTTCCTTTCA[C/T]GACTGCTTGT      SNP21953  LRPAP1  GGCACCAGCG[A/G]GCTGGGGTTC  3′UTR  65      CAGTGGAGGC[A/G]TGACGGGGAC          GGACCAGCCA[C/T]GGGGGCCCGG      a Complete sequence of each amplicon can be obtained from GenBank, accession numbers: AF526390 (FLJ20425), AF526391 (GPRK2L), and AF526393 (LRPAP1). See Table 1 for gene names. View Large Table 3. Single nucleotide polymorphism markers developed Marker  Gene  Sequencea  Location  Informative meioses  SNP13033  GPRK2L  GCCCTGACGC[A/G]TGCCTGCTGC  Intron 14  84  SNP16873  FLJ20425  CCTTGAAGTT[A/G]CTAAAGGATA  3′UTR  124      CTTCCTTTCA[C/T]GACTGCTTGT      SNP21953  LRPAP1  GGCACCAGCG[A/G]GCTGGGGTTC  3′UTR  65      CAGTGGAGGC[A/G]TGACGGGGAC          GGACCAGCCA[C/T]GGGGGCCCGG      Marker  Gene  Sequencea  Location  Informative meioses  SNP13033  GPRK2L  GCCCTGACGC[A/G]TGCCTGCTGC  Intron 14  84  SNP16873  FLJ20425  CCTTGAAGTT[A/G]CTAAAGGATA  3′UTR  124      CTTCCTTTCA[C/T]GACTGCTTGT      SNP21953  LRPAP1  GGCACCAGCG[A/G]GCTGGGGTTC  3′UTR  65      CAGTGGAGGC[A/G]TGACGGGGAC          GGACCAGCCA[C/T]GGGGGCCCGG      a Complete sequence of each amplicon can be obtained from GenBank, accession numbers: AF526390 (FLJ20425), AF526391 (GPRK2L), and AF526393 (LRPAP1). See Table 1 for gene names. View Large The primers designed for H6 homeo box 1 (HMX1) did not give a single product from genomic DNA. However, it was determined that HMX1 was present in the cosmid that contained SW2410. A single PCR product was obtained from the cosmid and sequencing of the amplicon verified that it was HMX1. Likewise, no markers were developed specifically for HGFAC. Because HGFAC was present in a BAC, which also contained LRPAP1 and a portion of RGS12, its location on the swine genetic map can be inferred. The updated linkage map for the MARC swine reference population is presented in Figure 1, along with the map derived from the resource population using selected microsatellite markers. As expected, the marker order is the same in both populations and the estimated interval sizes were comparable. The least robust marker was SWC31. This marker has only two alleles and is not very informative in any population studied at MARC. Its position from the analysis of the MARC reference population was based on only 26 informative meioses, but there were 244 informative meioses in the resource population. Figure 1. View largeDownload slide Genetic linkage map of the first 27 cM of porcine chromosome 8 (SSC) representing SSC 8p2.3. The map on the right is based on the MARC swine reference population described by Rohrer et al. (1994), which has been used as the base mapping family, and results are presented on the Web at http://www.marc.usda.gov/.Markers displayed in bold were mapped in the QTL mapping families (resource population) as described in the text, and the diagram on the left indicates the relative positions for this population. Markers located on the same line or within a box were at the same genetic position in the MARC reference population (mapping family). Figure 1. View largeDownload slide Genetic linkage map of the first 27 cM of porcine chromosome 8 (SSC) representing SSC 8p2.3. The map on the right is based on the MARC swine reference population described by Rohrer et al. (1994), which has been used as the base mapping family, and results are presented on the Web at http://www.marc.usda.gov/.Markers displayed in bold were mapped in the QTL mapping families (resource population) as described in the text, and the diagram on the left indicates the relative positions for this population. Markers located on the same line or within a box were at the same genetic position in the MARC reference population (mapping family). Updated QTL Analysis Using 600 animals with both phenotypic and genotypic data, the maximal F-ratio was F1,592 = 20.5150 at position 4.85 cM (Figure 2). The approximate one log-likelihood support confidence interval is 2.6 to 9.5 cM. The statistical model tested for the presence of a QTL at 0.05-cM intervals. As previously shown, F-ratios decrease sharply when the QTL is positioned directly on top of a genetic marker. Therefore, the F-ratios for analyses where the QTL was positioned over a genetic marker were removed for the plot presented in Figure 2. The peak position is 0.05 cM after marker SB37 (from the MAN2B2 BAC) and 0.25 cM before marker SB62 (from the PPP2R2C BAC). The mode of inheritance remained purely additive, but the magnitude of the effect was much lower than previously reported. Nonetheless, the QTL peak was still significant at the genome-wide level of significance. The estimated effect for each Meishan allele was −1.65 ova, indicating that on average, a female homozygous for the Meishan allele ovulated 3.3 fewer ova than a female homozygous for the White Composite allele. Figure 2. View largeDownload slide A summary of F-ratios (y-axis) computed every 0.05 cM (x-axis) for a QTL affecting the number of ova ovulated. The F-ratio had 1 df for the numerator fitting an additive genetic effect and 592 df for the error term. Arrows on the x-axis indicate positions where a genetic marker was typed in the QTL population. The markers and precise locations are presented in Figure 1. Threshold for genome-wide significance (0.05) was F = 17.23, and the pseudo one log-likelihood drop confidence interval is between 2.6 and 9.5 cM. Figure 2. View largeDownload slide A summary of F-ratios (y-axis) computed every 0.05 cM (x-axis) for a QTL affecting the number of ova ovulated. The F-ratio had 1 df for the numerator fitting an additive genetic effect and 592 df for the error term. Arrows on the x-axis indicate positions where a genetic marker was typed in the QTL population. The markers and precise locations are presented in Figure 1. Threshold for genome-wide significance (0.05) was F = 17.23, and the pseudo one log-likelihood drop confidence interval is between 2.6 and 9.5 cM. Discussion In this study, genetic markers were developed for genes located on human chromosome 4. The SNP markers all reside within the unprocessed RNA molecule transcribed for these genes. However, the location of the microsatellite markers relative to the gene is unknown. For microsatellite markers developed from cosmid clones, the marker is probably no more than 30 kb from the gene. Bacterial artificial chromosome clones can be as large as 200 kb and YAC clones can be as big as 1.5 Mb. Therefore, microsatellite markers developed from BAC and YAC clones may be closer to genes other than the target gene. In fact, the sequence that contained SY14 from a YAC for GNRHR also contained all of exon 2 from the UDP glucosyl transferase 1, polypeptide B15 (UGT2B15) gene, indicating SY14 is in intron 1 of this gene. Since UGT2B15 and GNRHR are 0.8 Mb apart in the human genome and the YAC was estimated to be 1.1 Mb, these results indicate that the distance in the pig genome could be similar. Twelve genes were added to the MARC SSC 8 linkage map, 11 of which map within a region that contains a QTL for ovulation rate. Figure 3 depicts the comparative map for the region surrounding this QTL region. Three additional genes recently mapped and included in Figure 3 are Wolframin syndrome 1 (Rohrer et al., 2002), amino peptidases (Smith et al., 2001), and Huntington's disease (HD; Matsuyama, et al., 2000). One inversion was detected between HSA 4pter-p15 and SSC 8p2.3. The inversion involves five genes separated by 6 cM on the swine genetic map and 3 Mb on the human physical map (based on the June 2002 build displayed at http://genome.ucsc.edu/). Figure 3. View largeDownload slide A comparison of the porcine genetic map of chromosome 8 (right side) vs. the physical map or draft genome sequence for human chromosome 4 based on the June 2002 build; displayed at http://genome.ucsc.edu/. Only gene names are presented (described in Table 1); genetic markers related to specific genes are presented in Tables 2 and 3. When no recombination was detected between genes (genes located in boxes), they were listed in the order in which they appear on the human sequence to minimize the number of rearrangements. The porcine genetic map of chromosome 8 is in recombination units (cM) and the human physical map is in millions of base pairs from the p-terminal end of chromosome 4 (4p16.3). Figure 3. View largeDownload slide A comparison of the porcine genetic map of chromosome 8 (right side) vs. the physical map or draft genome sequence for human chromosome 4 based on the June 2002 build; displayed at http://genome.ucsc.edu/. Only gene names are presented (described in Table 1); genetic markers related to specific genes are presented in Tables 2 and 3. When no recombination was detected between genes (genes located in boxes), they were listed in the order in which they appear on the human sequence to minimize the number of rearrangements. The porcine genetic map of chromosome 8 is in recombination units (cM) and the human physical map is in millions of base pairs from the p-terminal end of chromosome 4 (4p16.3). The only other major difference in gene order between human and pig maps was the location of HMX1. One other difference identified in the gene order, between GPRK2L and HD, was quite small, less than 2 cM on the swine genetic map and a few hundred kilobases on the human genomic sequence. This particular region of the human genome has changed considerably between the August 2001, December 2001, April 2002, and June 2002 builds. The entire region between 4 and 10 Mb has flipped in each subsequent update from August 2001 and April 2002. The HMX1 was removed from the August 2001 map in later builds until it was added in June 2002. Therefore, it is possible that the discrepancy in HMX1 will be resolved in later builds of the human genome data. Jiang et al. (2002) has placed HD, GPRK2L, SW2410, MSX1, and SW1117 on a radiation hybrid panel and obtained the same order for these markers as that found in the present study. Our position of MAN2B2 on the porcine genetic map agrees with its physical assignment to SSC 8p2.3 (Ohata et al., 1997). The results of Lahbib-Mansais et al. (1999) do not agree with the current study since they assigned fibroblast growth factor receptor 3 (FGFR3) to 8p11 using a somatic cell hybrid panel. The corresponding region to SSC 8p1.1 on the linkage map would be position 60 to 65 cM. From the location of FGFR3 on the human genome sequence (1.1 Mb), it should map to the interval between IDUA and GPRK2L located at SSC 8p2.3. Unfortunately, primers able to consistently amplify FGFR3 in porcine genomic DNA were not developed in the current study. The resolution of gene order in the swine genome can be improved by placing these genes and markers on one of the porcine radiation hybrid maps. The order of genes in the human genome will be resolved as the genomic sequence of HSA 4p16 is finished. The current MARC linkage map has 18 markers in the first 10 cM and 24 markers in approximately the first 15 cM of SSC 8. Seven microsatellite markers are located within the 6.9 cM confidence interval for the QTL. This marker density permits selection of informative markers for most swine populations. The markers selected to be genotyped in the resource population were quite informative, and generally there were over 900 informative meioses (exceptions were SWC31, SB60, and SB73). Five markers were within 1 cM of the peak F-ratio; four additional markers extending to the terminal region of SSC 8p and five markers extending toward the centromere of SSC 8p were typed across the entire resource population. Based on the number of highly informative markers typed in a small genomic interval, prediction of breed of origin for chromosomal segments was quite accurate and prediction of founding alleles within each breed is possible. Further improvements in the estimated location of the QTL will require implementing different statistical models to the data set. The statistical model used in the present study assumes that QTL alleles are fixed for alternate alleles in the founding breeds. Additional genetic markers will not improve the resolution of the QTL under the current statistical model since the markers used accurately predict breed of origin. If the QTL alleles were not fixed for alternate alleles in the parental breeds, then the ability to accurately predict the QTL's position and effect are compromised. Because a significant QTL has been detected under the breed specific statistical model, there is a difference in the average allele contributed by the Meishan breed vs. the White Composite line. A statistical model fitting each of the 40 founding alleles of the resource population would be more powerful and able to evaluate the assumptions under the breed specific statistical model. The origin of the high ovulating QTL allele comes from the White Composite line, which is contrary to the average breed effects of the Meishan breed (Haley et al., 1995; Young, 1995). The statistical model fitted in this study included an effect for breed composition because gilts were 1/4, 1/2, or 3/4 Meishan. The estimate for the regression coefficient indicated that 3/4 Meishan:1/4 White Composite gilts ovulated 1.8 more ova than 1/4 Meishan:3/4 White Composite gilts. This difference is smaller than the estimates from Haley et al. (1995) and Young (1995). The phenomenon of desirable alleles being present in the parental line with the undesirable phenotype is defined as transgressive variation. Transgressive alleles have been identified in most comprehensive QTL scans, including a QTL for backfat thickness in swine (Rohrer and Keele, 1998; Bidanel et al., 2001), red color and fruit size in tomatoes (Tanksley and McCouch, 1997), and various other traits. This genomic location has not been detected in other swine populations containing Meishan germplasm for ovulation rate (Wilkie et al., 1999) nor in a scan between selected and control Landrace × Yorkshire pigs (Rathje et al., 1997; Cassady et al., 2001). Whereas this may be due to genetic variation within the Meishan breed, it is also possible that it is due to the occidental breed forming the cross. Of particular interest is the source of the White Composites for this study. Seven of the ten founding White Composite animals were from generations 5 and 6 of a line selected for increased ovulation rate (Leymaster and Bennett, 1994). Therefore, the White Composite animals used in this study may have had superior alleles at this QTL than Yorkshire and Landrace pigs used in other studies. Selection of positional candidate genes to study is the next phase of this research. Originally, the bone morphogenetic protein receptor 1B was believed to be a good candidate because it was identified as the gene that causes the Booroola effect in sheep (Mulsant et al., 2001; Souza et al., 2001; Wilson et al., 2001), and it resides on HSA 4. However, it maps to SSC 8q2.5 by linkage analysis and is not contained within the confidence interval of the ovulation rate QTL (Kim et al., 2003). Based on the estimated position from this analysis, MAN2B2 is clearly the closest mapped gene to the location of the maximal F-ratio. Furthermore, α-mannosidases are responsible for cleaving mannose residues off proteins before the addition of other saccharide units to form glycoproteins (Kornfeld and Kornfeld, 1985). Follicle-stimulating and luteinizing hormones are two key glycoprotein hormones involved in ovulation. The type and level of glycosylation of these key hormones has been shown to affect activity and clearance rate (Ulloa-Aguirre et al., 1999). Therefore, variation in MAN2B2 could affect the potency of these key reproductive hormones. Despite its location just outside of the confidence interval, RGS12 could be considered as a positional candidate gene as it is a regulator of G-proteins. Such proteins are important signaling molecules involved in a broad range of cellular regulating activities, such as hormone signaling (Chatterjee and Fisher, 2000). Gladney (2000) determined that RGS12 was expressed at a higher rate in ovarian follicles of gilts that were from a Yorkshire-Landrace line selected for increased ovulation rate (Johnson et al., 1999) than in gilts from the control line. In addition to these genes of known function, there are putative genes (based on sequence analysis and expression of transcripts) in this interval with unknown function that may affect ovulation rate. Implications A quantitative trait locus has been detected affecting ovulation rate on the terminal end of chromosome 8p. Additional genetic markers were developed for this region using a directed comparative mapping approach by selecting genes that mapped to HSA 4p16-15. This approach permitted a high-resolution comparative map for SSC 8p2.3 and provided a sufficient number of markers to determine whether this quantitative trait locus is segregating in commercial swine populations. Nine genes were localized to the first 8 cM of the linkage group but only three are within the confidence interval of the quantitative trait locus in this study. The next phase of this research is to utilize the genetic markers in commercial swine populations where ovulation rates have been measured to determine whether this quantitative trait locus is segregating in commercial pigs. In addition, positional candidate genes can now be selected from the human genome sequence located within the first 10 Mb of HSA 4 and evaluated in the founding animals of the U. S. Meat Animal Research Center swine resource population. Literature Cited Alexander, L. J., T. P. L. Smith, C. W. Beattie, and M. F. Broom 1997. Construction and characterization of a large insert porcine YAC library. Mamm. Genome  8: 50– 51. Google Scholar CrossRef Search ADS PubMed  Alexander, L. J., D. L. Troyer, G. A. Rohrer, T. P. L. Smith, L. B. Schook, and C. W. Beattie 1996. Physical assignments of 68 porcine cosmid and lambda clones containing polymorphic microsatellites. Mamm. Genome  7: 368– 372. Google Scholar CrossRef Search ADS PubMed  Bennett, G. L., and K. A. Leymaster 1989. Integration of ovulation rate, potential embryonic viability and uterine capacity into a model of litter size in swine. J. Anim. Sci.  67: 1230– 1241. Google Scholar CrossRef Search ADS PubMed  Bidanel, J.-P., D. Milan, N. Iannuccelli, Y. Amigues, M.-Y. Boscher, F. Bourgeois, J.-C. Caritez, J. Gruand, P. Le Roy, H. Lagant, R. Quintanilla, C. Renard, J. Gellin, L. Ollivier, and C. Chevalet 2001. Detection of quantitative trait loci for growth and fatness in pigs. Genet. Sel. Evol.  33: 289– 309. Google Scholar CrossRef Search ADS PubMed  Cassady, J. P., R. K. Johnson, D. Pomp, G. A. Rohrer, L. D. Van Vleck, E. K., Spiegel, and K. M. Gilson 2001. Identification of quantitative trait loci affecting reproduction in pigs. J. Anim. Sci.  79: 623– 633. Google Scholar CrossRef Search ADS PubMed  Chatterjee, T. K., and R. A. Fisher 2000. Novel alternative splicing and nuclear localization of human RGS12 gene products. J. Biol. Chem.  275: 29660– 29671. Google Scholar CrossRef Search ADS PubMed  Fahrenkrug, S. C., B. A. Freking, T. P. L. Smith, G. A. Rohrer, and J. W. Keele 2002. Single nucleotide polymorphism (SNP) discovery in porcine expressed genes. Anim. Genet.  33: 186– 195. Google Scholar CrossRef Search ADS PubMed  Gladney, C. D. 2000. Evaluation of gene expression in ovarian follicles of pigs selected for reproduction. M.S. Thesis,  Univ. Nebraska, Lincoln. Goureau, A., M. Yerle, A. Schmitz, J. Riquet, D. Milan, P. Pinton, G. Frelat, and J. Gellin 1996. Human and porcine correspondence of chromosome segments using bidirectional chromosome painting. Genomics  36: 252– 262. Google Scholar CrossRef Search ADS PubMed  Green, P., K. Falls, and S. Crooks 1990. Documentation for CRI-MAP. Version 2.4.  Washington Univ. Sch. Med., St. Louis, MO. Haley, C. S., S. A. Knott, and J.-M. Elsen 1994. Mapping quantitative trait loci in crosses between outbred lines using least squares. Genetics  136: 1195– 1207. Google Scholar PubMed  Haley, C. S., G. J. Lee, and M. Ritchie 1995. Comparative reproductive performance in Meishan and Large White pigs and their crosses. Anim. Sci.  60: 259– 267. Google Scholar CrossRef Search ADS   Jiang, Z., H. He, N. Hamasima, H. Suzuki, and A. M. Verrinder Gibbins 2002. Comparative mapping of Homo sapiens chromosome 4 (HSA4) and Sus scrofa chromosome 8 (SSC8) using orthologous genes representing different cytogenetic bands as landmarks. Genome  45: 147– 156. Google Scholar CrossRef Search ADS PubMed  Johnson, R. K., M. K. Nielsen, and D. S. Casey 1999. Responses in ovulation rate, embryonal survival, and litter traits in swine to 14 generations of selection to increase litter size. J. Anim. Sci.  77: 541– 557. Google Scholar CrossRef Search ADS PubMed  Kim, J. G., J. H. Song, J. L. Vallet, G. A. Rohrer, G. A. Johnson, M. M. Joyce, and R. K. Christenson 2003. Molecular characterization and expression of porcine bone morphogenetic protein receptor-IB in the uterus of cyclic and pregnant gilts. Biol. Reprod.  68: 735– 743. Google Scholar CrossRef Search ADS PubMed  Kornfeld, R., and S. Kornfeld 1985. Assembly of asparagine-linked oligo saccharides. Annu. Rev. Biochem.  54: 631– 664. Google Scholar CrossRef Search ADS PubMed  Lahbib-Mansais, Y., G. Dalias, D. Milan, M. Yerle, A. Robic, G. Gyapay, and J. Gellin 1999. A successful strategy for comparative mapping with human ESTs: 65 new regional assignments in the pig. Mamm. Genome  10: 145– 153. Google Scholar CrossRef Search ADS PubMed  Lamberson, W. R. 1990. Genetic parameters for reproductive traits. Pages 70– 76 in Genetics of the Pig.  L. D. Young ed. North Central Regional Res. Proj. NC-103 Report,  USMARC, Clay Center, NE, and Univ. of Nebraska, Lincoln. Lander, E., and L. Kruglyak 1995. Genetic dissection of complex traits: Guidelines for interpreting and reporting linkage results. Nat. Genet.  11: 241– 247. Google Scholar CrossRef Search ADS PubMed  Leymaster, K. A., and G. L. Bennett 1994. An approach to select for litter size in swine: Conceptual, theoretical, and applied aspects. Pages 54– 63 in Proc. 43rd Annu. Natl. Breed.  Roundtable, St. Louis, MO. Matsuyama, N., S. Hadano, K. Onoe, H. Osuga, J. Showguchi-Miyata, Y. Gondo, and J.-E. Ikeda 2000. Identification and characterization of the miniature pig Huntington's disease gene homolog: Evidence for conservation and polymorphism in the CAG triplet repeat. Genomics  69: 72– 85. Google Scholar CrossRef Search ADS PubMed  Mulsant, P., F. Lecerf, S. Fabre, L. Schibler, P. Monget, I. Lanneluc, C. Pisselet, J. Riquet, D. Monniaux, I. Callebaut, E. Cribiu, J. Thimonier, J. Teyssier, L. Bodin, Y. Cognie, N. Chitour, and J.-M. Elsen 2001. Mutation in bone morphogenetic protein receptor-IB is associated with increased ovulation rate in Booroola Mérino ewes. Proc. Natl. Acad. Sci. USA  98: 5104– 5109. Google Scholar CrossRef Search ADS   Ohata, K., N. Okamura, M. Kojima, and H. Yasue 1997. Assignment of alpha-mannosidase gene (MAN2B2) to swine chromosome 8p23-pter by fluorescence in situ hybridization. Mamm. Genome  8: 158– 159. Google Scholar CrossRef Search ADS   Rathje, T. A., G. A. Rohrer, and R. K. Johnson 1997. Evidence of quantitative trait loci affecting ovulation rate in pigs. J. Anim. Sci.  75: 1486– 1494. Google Scholar CrossRef Search ADS PubMed  Rohrer, G. A. 1999. Mapping four genes from human chromosome 4 to porcine chromosome 8 further develops the comparative map for an economically important chromosome of the swine genome. Anim. Genet.  30: 60– 62. Google Scholar CrossRef Search ADS PubMed  Rohrer, G. A., L. J. Alexander, J. W. Keele, T. P. Smith, and C. W. Beattie 1994. A microsatellite linkage map of the porcine genome. Genetics  136: 231– 245. Google Scholar PubMed  Rohrer, G. A., S. C. Fahrenkrug, D. Nonneman, N. Tao, and W. C. Warren 2002. Mapping microsatellite markers identified in porcine EST sequences. Anim. Genet.  33: 1– 5. Google Scholar CrossRef Search ADS   Rohrer, G. A., J. J. Ford, T. H. Wise, J. L. Vallet, and R. K. Christenson 1999. Identification of quantitative trait loci affecting female reproductive traits in a multigeneration Meishan-White Composite swine population. J. Anim. Sci.  77: 1385– 1391. Google Scholar CrossRef Search ADS PubMed  Rohrer, G. A., and J. W. Keele 1998. Identification of quantitative trait loci affecting carcass composition in swine: I. Fat deposition traits. J. Anim. Sci.  76: 2247– 2254. Google Scholar CrossRef Search ADS PubMed  Rohrer, G. A., T. H. Wise, D. D. Lunstra, and J. J. Ford 2001. Identification of genomic regions controlling plasma FSH concentrations in Meishan-White Composite boars. Physiol. Genomics  6: 145– 151. Google Scholar CrossRef Search ADS PubMed  Smith, T. P., S. C. Fahrenkrug, G. A. Rohrer, F. A. Simmen, C. E. Rexroad III, and J. W. Keele 2001. Mapping of expressed sequence tags from a porcine early embryonic cDNA library. Anim. Genet.  32: 66– 72. Google Scholar CrossRef Search ADS PubMed  Smith, T. P. L., G. A. Rohrer, L. J. Alexander, D. L. Troyer, K. R. Kirby-Dobbels, M. A. Janzen, D. L. Cornwell, C. F. Louis, L. B. Schook, and C. W. Beattie 1995. Directed integration of the physical and genetic linkage maps of swine chromosome 7 reveals that the SLA spans the centromere. Genome Res.  5: 259– 271. Google Scholar CrossRef Search ADS PubMed  Souza, C. J. H., C. MacDougall, B. K. Campbell, A. S. McNeilly, and D. T. Baird 2001. The Booroola (FecB) phenotype is associated with a mutation in the bone morphogenetic receptor type 1 B (BMPR1B) gene. J. Endocrinol.  169: R1– R6. Google Scholar CrossRef Search ADS PubMed  Tanksley, S. D., and S. R. McCouch 1997. Seed banks and molecular maps: Unlocking genetic potential from the wild. Science  277: 1063– 1066. Google Scholar CrossRef Search ADS PubMed  Ulloa-Aguirre, A., C. Timossi, P. Damian-Matsumura, and J. A. Dias 1999. Role of glycosylation in function of follicle-stimulating hormone. Endocrine  11: 205– 215. Google Scholar CrossRef Search ADS PubMed  Wilkie, P. J., A. A. Paszek, C. W. Beattie, L. J. Alexander, M. B. Wheeler, and L. B. Schook 1999. A genomic scan of porcine reproductive traits reveals possible quantitative trait loci (QTLs) for number of corpora lutea. Mamm. Genome  10: 573– 578. Google Scholar CrossRef Search ADS PubMed  Wilson, T., X.-Y. Wu, J. L. Juengel, I. K. Ross, J. M. Lumsden, E. A. Lord, K. G. Dodds, G. A. Walling, J. C. McEwan, A. R. O'Connell, K. P. McNatty, and G. W. Montgomery 2001. Highly prolific Booroola sheep have a mutation in the intracellular kinase domain of bone morphogenetic protein 1B receptor (ALK-6) that is expressed in both oocytes and granulosa cells. Biol. Reprod.  64: 1225– 1235. Google Scholar CrossRef Search ADS PubMed  Young, L. D. 1995. Reproduction of F1 Meishan, Fengjing, Minzhu, and Duroc gilts and sows. J. Anim. Sci.  73: 711– 721. Google Scholar CrossRef Search ADS PubMed  Copyright 2003 Journal of Animal Science
TI - Fine mapping a quantitative trait locus affecting ovulation rate in swine on chromosome 8
JO - Journal of Animal Science
DO - 10.2527/2003.8171706x
DA - 2003-07-01
UR - https://www.deepdyve.com/lp/oxford-university-press/fine-mapping-a-quantitative-trait-locus-affecting-ovulation-rate-in-2rd30Sfhgk
SP - 1706
EP - 1714
VL - 81
IS - 7
DP - DeepDyve
ER -