TY - JOUR
AU1 - Hirota, Yuki
AU2 - Sawada, Masato
AU3 - Kida, Yasuyuki S.
AU4 - Huang, Shih‐hui
AU5 - Yamada, Osamu
AU6 - Sakaguchi, Masanori
AU7 - Ogura, Toshihiko
AU8 - Okano, Hideyuki
AU9 - Sawamoto, Kazunobu
AB - Abstract Neuronal precursor cells generated by stem cells in the subventricular zone (SVZ) migrate and differentiate into mature interneurons in the olfactory bulb (OB). The mechanisms responsible for the dynamic morphological changes in cells during this process are largely unknown. Wnt/planar cell polarity (PCP) signaling regulates various developmental events, including neuronal migration and neurite formation. Here, we studied the function of two components of the PCP pathway, Dishevelled2 and Van Gogh like‐2, in the newborn neurons in the postnatal mouse OB. Electroporation‐ or lentivirus‐mediated introduction of vectors carrying a knockdown or dominant‐negative construct of these genes into the SVZ altered the distribution and dendrite formation of newborn neurons in the OB, suggesting that PCP signaling is involved in regulating the maturation of new neurons in the OB. Dishevelled2, Van Gogh like‐2, Planar cell polarity pathway, Subventricular zone, Olfactory bulb, Neurogenesis, Mouse Introduction Neurogenesis is continuous throughout the life span. In the adult rodent brain, the largest germinal region for new neurons is the subventricular zone (SVZ) of the lateral ventricle [1]. Within the SVZ, astrocytes (also referred to as type B cells) function as neural stem cells (NSCs) and give rise to rapidly dividing transit‐amplifying progenitor cells (type C cells) [2]. The type C cells generate immature neuronal precursor cells (NPCs) (type A cells or neuroblasts) that migrate to the olfactory bulb (OB) through the rostral migratory stream (RMS). Upon reaching the OB, NPCs migrate radially and differentiate into local interneurons, that is, granule cells (GCs) or periglomerular cells (PGCs), in the granular and periglomerular layers (PGLs), respectively [3, 4]. Neurogenesis in this region is regulated by complex molecular mechanisms mediated by both intrinsic and extrinsic factors; these factors control cellular events that include the self‐renewal of NSCs, the migration of NPCs, and the differentiation, survival, and maturation of new neurons [5–9]. The signaling pathways activated by the secreted Wnt proteins control a number of important biological events in the developing and mature nervous system [10]. Wnt‐signaling components, including ligands (Wnt1, Wnt5a, and Wnt7a), receptors (Fz3, Fz7, Fz10 sFrp1, and sFrp2), and down‐stream effector molecules (Dvl1, Dvl2, Celsr2, Celsr3, Tcf3, Vangl2, and Diversin), are broadly expressed in the postnatal forebrain including the SVZ, RMS, and OB [11–14]. There are two major Wnt‐signaling pathways, the β‐catenin‐dependent (canonical) Wnt/β‐catenin pathway, which regulates embryonic patterning, tumorigenesis, cell proliferation, and the self‐renewal of stem cells, and the β‐catenin‐independent (noncanonical) planar cell polarity (PCP) pathway, which controls the cell movement and polarity of various tissues, mainly via c‐Jun N‐terminal kinase (JNK) and Rho GTPase, during the development of many animal species, including mouse, frog, and zebrafish [15, 16]. The proliferation and differentiation of NSCs and NPCs in both the developing and adult brain are regulated by the Wnt/β‐catenin [17–22] and Wnt/PCP [11, 23] pathways. Furthermore, the migration of facial branchiomotor (FBM) neurons [24–31] and neural crest cells [32] depends on the function of the PCP genes, as does neuronal morphogenesis in the postnatal hippocampus [33, 34] and OB [35], indicating that PCP signaling is involved in the migration and differentiation of many types of neural cells [36–38]. However, the function of this signaling pathway in the postnatal migration and differentiation of neurons in the OB has not been clearly demonstrated. In this study, we investigated the in vivo effects of inhibiting two core components of the Wnt/PCP pathway, the Fz‐binding intracellular protein Dishevelled2 (Dvl2) and the four‐pass transmembrane protein Van Gogh like‐2 (Vangl2), on the newborn OB neurons. Materials and Methods Animals Wild‐type institute of cancer research (ICR) mice were purchased from SLC (Shizuoka, Japan, /jslc.co.jp/). All animal experimental procedures were in compliance with National Regulations and Guidelines, reviewed by the Institutional Laboratory Animal Care and Use Committee, and approved by the President of Nagoya City University. Histological Analysis Brains were perfusion‐fixed with 4% paraformaldehyde, postfixed in the same fixative overnight, and cut into 50‐μm sections on a Vibratome sectioning system (VT1200S; Leica, Heidelberg, Germany, www.leica‐microsystems.com/). For immunostaining, after being rinsed three times in phosphate buffered saline (PBS), the sections were incubated for 1 hour in blocking solution (10% donkey serum and 0.5% Triton X‐100 in PBS), then overnight with the primary antibodies, and then for 2 hours at room temperature with a biotinylated secondary antibody (1:500; Jackson, West Grove, PA, www. jacksonimmuno.com) or an Alexa Fluor‐conjugated secondary antibody (1:300; Invitrogen, Carlsbad, CA, www.invitrogen.com). The biotinylated antibodies were visualized using streptavidin‐Alexa 568 (1:500; Invitrogen). The following primary antibodies were used: rabbit anti‐Dvl2 (1:300; Santa Cruz Biotechnology, Santa Cruz, CA, www.scbt.com/, sc‐13974); rabbit anti‐Vangl2 (1:300; MBL, Aichi, Japan, www.mbl.co.jp, a custom purified antibody against the peptide corresponding to residues 16‐43 of Vangl2); chick anti‐green fluorescent protein (GFP) (1:500; Aves Labs, Tigard, OR, www.aveslab.com, 2‐P004‐07D); rat anti‐GFP (1:500; Nacalai, Kyoto, Japan, www.nacalai.co.jp/, GF090R); monoclonal anti‐Mash1 (1:100; BD Pharmingen, San Diego, CA, www.bdbiosciences.com/, 556604); goat antidoublecortin (Dcx) (1:200; Santa Cruz Biotechnology; sc‐8066); and mouse anti‐NeuN (1:100; Millipore, Billerica, MA, www.millipore.com, MAB377). Confocal images were obtained using an LSM5‐Pascal or LSM710 laser‐scanning microscope (Zeiss, Jena, Germany, www.zeiss.com). They were analyzed using NIH Fiji/ImageJ version 1.36 and Photoshop (Adobe Systems, San Jose, CA, www.adobe.com/). For quantitative analyses of NPC distribution in the OB, the GC layer (GCL) was divided into the inner and outer regions, based on the nuclear staining pattern. For quantitative analyses of neuronal morphology, reconstructions were performed from confocal z‐series stacks (20–35 μm). The total dendrite length, primary dendrite length, and number of dendritic branch points were analyzed using the “simple neurite tracer” plugin of Fiji/ImageJ software. DNA Constructs The mouse Dvl2ΔPDZ construct was described previously [39]. The C terminus of Dvl2 (Dvl2‐C), spanning amino acids 508–736, was amplified by PCR. Plasmids encoding GFP fusion proteins (Dvl2ΔPDZ‐GFP and Dvl2‐C‐GFP) were described previously [40]. pEGFP‐N1 (Clontech, Mountain View, CA, www.clontech.com/) was used as the control vector. Self‐inactivating lentivirus vectors (CSII‐EF‐MCS), the Rev‐expressing plasmid pCMV‐VSV‐G‐RSV‐Rev, and the packaging construct pCAG‐HIVgp were provided by Dr. H. Miyoshi, Riken Tsukuba BioResource Center [41]. Dvl2ΔPDZ‐GFP and Dvl2‐C‐GFP were subcloned into CSII‐EF‐MCS to produce CSII‐EF‐Dvl2ΔPDZ‐GFP and CSII‐EF‐Dvl2ΔPDZ‐GFP, respectively. Vangl2 and Vangl2ΔC were subcloned into CSII‐EF‐MCS‐IRES‐GFP to produce CSII‐EF‐Vangl2‐IRES‐GFP and CSII‐EF‐Vangl2ΔC‐IRES‐GFP, respectively. For the knockdown (KD) of mouse Vangl2 using a miRNA system (Invitrogen), the targeting sequence of Vangl2 (antisense target sequence: AAGACAAGCACCATGAGCAGA, miR RNAi Select Mmi581648, Invitrogen) and lacZ (control) were cloned into a modified Block‐iT Pol II miR RNAi expression vector (Invitrogen). DNA cassettes containing GFP or DsRed‐Express and the miRNA sequence were cloned into pCAGGS vectors [42] using the Gateway system (Invitrogen). KD Verification HEK293T cells were cotransfected with pCAGGS‐HA‐Vangl2‐GFP and the shRNA expression vector against Vangl2 (pCAGGS‐DsRed‐miVangl2) or lacZ (pCAGGS‐DsRed‐milacZ, as a control) using the Fugene transfection reagent (Roche Diagnostics, Basel, Switzerland, www.roche‐applied‐science.com). Two days later, cell lysates were separated by SDS‐PAGE and then immunoblotted with anti‐Flag (1:500; Sigma, St. Louis, MO, www.sigmaaldrich.com F7425) and rabbit anti‐β‐actin (1:2,000; Abcam, Cambridge, U.K., www.abcam.com, ab8227) antibodies. Preparation and Injection of Lentivirus Lentiviruses were produced by the transient transfection of 293T cells with the lentiviral constructs, pCMV‐VSV‐G‐RSV‐Rev and pCAG‐HIVgp, using the GeneJuice transfection reagent (Novagen, Madison, WI, www.merckgroup.com). High‐titer, concentrated stocks prepared by ultracentrifugation and resuspension in PBS were used to achieve efficient infection. For the injection of lentivirus, mice were anesthetized by hypothermia and placed on the platform of a stereotaxic injection apparatus (David Kopf Instruments, Tujunga, CA, www.kopfinstruments.com) using vinyl tape. For the injection of lentivirus, 1 μl of the lentivirus‐containing solution was stereotaxically injected into the lateral ventricle of P0‐1 mice ([relative to lambda]: anterior, lateral, and depth [in mm]: 1.8, 1.0, and 1.8). Electroporation Electroporations of P0‐1 mice were performed as described previously [43] with some modifications. Briefly, P0‐1 mice were anesthetized by hypothermia and fixed to the platform of a stereotaxic injection apparatus (David Kopf Instruments) by vinyl tape. Approximately, 2 μl of the plasmid solution (3 mg/ml) containing 0.01% fast green solution was injected into the lateral ventricle of the P0‐1 mice, and electronic pulses (90 V, 50 ms, four times) were applied using an electroporator (CUY‐21SC; Nepagene, Chiba, Japan, www.nepagene.jp) with a forceps‐type electrode (CUY650P7). For the experiments involving sequential electroporation, plasmids were introduced into the same ventricle at P0 and again, after a 24‐hour interval, at P1. Organotypic brain slices were prepared from P6‐7 ICR mice after the sequential electroporations, essentially as reported previously [44]. SVZ Monolayer Culture and Morphological Analysis The SVZ cells from neonatal mice (postnatal day 1) were dissociated with trypsin‐EDTA and transfected with plasmids by electroporation using an Amaxa Nucleofector device (Lonza, Switzerland, www.lonza.com). The cells were then cultured in neurobasal medium containing 10% fetal bovine serum (FBS), 50 U/ml penicillin‐streptomycin, 2 mM L‐glutamine, and B27 supplement on coverglasses coated with poly(L‐lysine) and laminin. Six days after seeding, the cells were fixed with 4% paraformaldehyde. To detect GFP+ neurons, double immunostaining using anti‐GFP and anti‐Dcx antibodies (see Histological Analysis) was performed. To analyze the morphology of cultured neurons quantitatively, Neurolucida software (MBF Biosciences, Williston, VT, www.mbfbioscience.com) was used. The Dcx‐expressing GFP+ neurons were traced and analyzed for the number of branch points, number of tips, and total dendritic length. Statistical Analyses All data were expressed as the mean ± SEM. Differences between means were determined by unpaired two‐tailed Student's t tests. A p‐value of <.05 was considered significant. Results Blocking PCP Signaling Alters the Distribution of NPCs in the OB We focused on two PCP core components, Dvl2 and Vangl2, because they are expressed broadly in the SVZ‐RMS‐OB neurogenic region [12, 13] (see also the data in the Allen Brain Atlas database: http://mouse.brain‐map.org/experiment/ivt?id = 68798831&popup = true (Dvl2), http://mouse.brain‐map.org/experiment/ivt?id = 68666834&popup = true (Vangl2), and Supporting Information Fig. S1). To study the possible role of the PCP pathway in the migration and differentiation of OB neurons, we used dominant‐negative constructs of these genes (Supporting Information Fig. S2). First, we examined the effects of dominant‐negative forms of Dvl2 on the migration and differentiation of newborn OB neurons in postnatal mice. We used two deletion constructs of Dvl2, both of which were previously reported to act as specific dominant‐negative inhibitors of the PCP signal, but not of the canonical Wnt signal: Dvl2ΔPDZ, which lacks the PDZ domain [39], and Dvl2‐C, which contains only the conserved C‐terminus of Dvl2 [45] (Supporting Information Fig. S2). We did not perform a KD of Dvl2, because doing so would inhibit the Wnt/β‐catenin pathway [46] as well as the PCP pathway. Plasmids encoding a Dvl2‐C‐GFP or Dvl2ΔPDZ‐GFP fusion protein were introduced into the lateral ventricle of P0‐1 mice by electroporation. One day after the electroporation, most of the GFP‐positive (GFP+) cells were observed at the walls of the lateral ventricles (data not shown). At P7, we quantified the number of GFP+ cells in the OB. The percentage of GFP+ cells observed in the OB, including the most anterior part of the RMS, was significantly decreased by the expression of the dominant‐negative Dvl2 constructs (control, 71.2% ± 2.0%, n = 6,714 cells from three mice; Dvl2‐C, 57.5% ± 2.2%, n = 294 cells from three mice, p = .0179 vs. control; Dvl2ΔPDZ, 36.9% ± 3.4% n = 254 cells from three mice; p = .0015 vs. control) (Fig. 1A–1C), suggesting that the inhibition of Dvl2 disturbed the migration of NPCs into the OB. Consistent with this, the KD of Vangl2 (Supporting Information Fig. S3), another core PCP component, led to a slight decrease in NPCs' migratory speed and altered their directionality in cultured brain slices (Supporting Information Movie 1 and Supporting Information Fig. S4). In contrast, the dominant‐negative forms of Dvl2 did not affect the percentage of GFP+ cells that were also positive for Mash1 (a marker of type C cells) [47, 48] or Dcx (a marker of NPCs) [49] or undergoing mitosis in the SVZ (Supporting Information Fig. S5), suggesting that the decreased percentage of GFP+ cells in the OB induced by the dominant‐negative forms of Dvl2 (Fig. 1) was not due to the altered differentiation or proliferation of SVZ cells. Taken together, these results suggest that blocking PCP signaling disturbs the migration of NPCs into the OB. 1 Open in new tabDownload slide Effect of Dvl2 on the distribution of NPCs. (A, B): Sagittal sections of the RMS and OB, 7 days after the electroporation of GFP‐ (A) or Dvl2ΔPDZ‐GFP‐ (B) encoding plasmids, stained for GFP (green) and Hoechst (red). The borders between the RMS and OB are indicated by a dotted line in A and B. (C): Significantly fewer NPCs, as a percentage of all GFP+ cells, reached the OB in animals given Dvl2‐C or Dvl2ΔPDZ. *, p < .05; **, p < .01. Scale bar = B, C, 100 μm. Abbreviations: Dvl2, dishevelled2; GFP, green fluorescent protein; NPC, neuronal precursor cell; OB, olfactory bulb; RMS, rostral migratory stream. 1 Open in new tabDownload slide Effect of Dvl2 on the distribution of NPCs. (A, B): Sagittal sections of the RMS and OB, 7 days after the electroporation of GFP‐ (A) or Dvl2ΔPDZ‐GFP‐ (B) encoding plasmids, stained for GFP (green) and Hoechst (red). The borders between the RMS and OB are indicated by a dotted line in A and B. (C): Significantly fewer NPCs, as a percentage of all GFP+ cells, reached the OB in animals given Dvl2‐C or Dvl2ΔPDZ. *, p < .05; **, p < .01. Scale bar = B, C, 100 μm. Abbreviations: Dvl2, dishevelled2; GFP, green fluorescent protein; NPC, neuronal precursor cell; OB, olfactory bulb; RMS, rostral migratory stream. Second, to study the final distribution of newborn OB neurons, a lentivirus expression vector encoding GFP with or without a dominant‐negative construct was injected into the lateral ventricle of neonatal mice. As a dominant‐negative form of Vangl2, we used Vangl2ΔC (Supporting Information Fig. S2), which lacks the C‐terminal region [50]. Six to eight weeks later, numerous GFP+ cells were observed in the OB in all the experimental groups (data not shown), indicating that, although blocking the PCP signaling could transiently disturb the directional migration of NPCs in the RMS (Fig. 1), the NPCs eventually reached the OB. The differentiation of GFP+ cells in the OB was not disturbed by the blocking of PCP signaling (Supporting Information Fig. S6). Notably, a significantly smaller percentage of GFP+ cells expressing dominant‐negative constructs was observed in the outer half of the GCL compared with that in the control group (control, 40.6% ± 2.8%, n = 795 cells from three mice; Dvl2‐C, 22.9% ± 3.1%, n = 347 cells from three mice, p = .0425 vs. control; Dvl2ΔPDZ, 29.4% ± 3.1%, n = 327 cells from three mice, p = .0429 vs. control; Vangl2ΔC 32.3% ± 1.6%, n = 1,561 cells from three mice, p = .0398 vs. control; Vangl2, 47.9% ± 3.1%, n = 1,543 cells from three mice; p = .1601 vs. control) (Fig. 2A–2C), but the total percentage of GFP+ cells in the GCL and PGL was not altered. Full‐length Vangl2 did not affect the distribution of infected cells in the OB (Vangl2, 47.9% ± 3.1%, n = 1,543 cells from three mice; p = .1601 vs. control) (Fig. 2C). These results suggest that long‐term blocking of the PCP pathway decreases the distribution of newly generated neurons to the outer GCL of the OB. 2 Open in new tabDownload slide Long‐term effects of Dvl2 and Vangl2 on the distribution of new neurons in the OB. (A, B): Coronal sections of an OB harvested 6–8 weeks after the injection of control (A) or Dvl2‐C (B) lentiviral vector, stained for green fluorescent protein (GFP). The borders of the inner GCL and outer GCL of the OB core are marked in yellow. (C): Distribution of GFP+ neuronal precursor cell (NPCs) in the OB. The percentage of NPCs in the outer GCL was significantly decreased in the Dvl2‐C‐, Dvl2ΔPDZ‐, and Vangl2ΔC‐treated animals compared with control animals, and full‐length Vangl2 had no effect compared with control. *, p < .05. Scale bars = A, B, 100 μm. Abbreviations: Dvl2, dishevelled2; GCL, granule cell layer; OB, olfactory bulb; PGL, periglomerular layer; Vangl2, Van Gogh like‐2. 2 Open in new tabDownload slide Long‐term effects of Dvl2 and Vangl2 on the distribution of new neurons in the OB. (A, B): Coronal sections of an OB harvested 6–8 weeks after the injection of control (A) or Dvl2‐C (B) lentiviral vector, stained for green fluorescent protein (GFP). The borders of the inner GCL and outer GCL of the OB core are marked in yellow. (C): Distribution of GFP+ neuronal precursor cell (NPCs) in the OB. The percentage of NPCs in the outer GCL was significantly decreased in the Dvl2‐C‐, Dvl2ΔPDZ‐, and Vangl2ΔC‐treated animals compared with control animals, and full‐length Vangl2 had no effect compared with control. *, p < .05. Scale bars = A, B, 100 μm. Abbreviations: Dvl2, dishevelled2; GCL, granule cell layer; OB, olfactory bulb; PGL, periglomerular layer; Vangl2, Van Gogh like‐2. Dvl2 and Vangl2 Act in a Cell‐Autonomous Manner During the Dendritogenesis of OB Neurons Next, we studied the morphology of OB neurons in which PCP signaling was continuously blocked in vitro. To examine whether PCP signaling acts in a cell‐autonomous manner during the dendritogenesis of OB neurons, we introduced a dominant‐negative Dvl2 (Dvl2‐C) or Vangl2 KD (Vangl2 KD) vector into dissociated SVZ cells and cultured them for 6 days (Fig. 3). Compared with control cells expressing GFP (Fig. 3A, 3F), the neurons expressing Dvl2‐C or Vangl2 KD showed impaired dendritogenesis (Fig. 3B, 3G, respectively). Quantitative analysis revealed that the expression of Dvl2‐C or Vangl2 KD significantly decreased the number of branch points (control [pEGFP‐N1], 1.40 ± 0.18, n = 20 cells; Dvl2‐C, 0.25 ± 0.11, n = 16 cells, p = .000016; control [lacZ KD], 1.44 ± 0.35, n = 18 cells; Vangl2 KD, 0.64 ± 0.19, n = 25 cells, p = .038) (Fig. 3C, 3H), the number of tips (control [pEGFP‐N1], 3.50 ± 0.21, n = 20 cells; Dvl2‐C, 1.93 ± 0.19, n = 16 cells, p = .0000063; control [lacZ KD], 3.83 ± 0.43, n = 18 cells; Vangl2 KD, 2.84 ± 0.24, n = 25 cells, p = .038) (Fig. 3D, 3I), and the total dendrite length (control [pEGFP‐N1], 137.4 ± 10.9 μm, n = 20 cells; Dvl2‐C, 60.8 ± 9.3 μm, n = 16 cells, p = .0000096; control [lacZ KD], 137.1 ± 12.5 μm, n = 18 cells; Vangl2 KD, 102.2 ± 9.3 μm, n = 25 cells, p = .027) (Fig. 3E, 3J), suggesting that Dvl2 and Vangl2 act in a cell‐autonomous manner during dendritogenesis. 3 Open in new tabDownload slide Effects of Dvl2 and Vangl2 on the dendritic morphology of cultured neurons. (A–E): Inhibition of Dvl2 causes morphological defects in cultured neurons. Photomicrographs show representative examples of neurons transfected with control (A) or Dvl2‐C‐carrying (B) vector. The numbers of branch points (C) and tips (D) in the Dvl2‐C group were significantly lower than in controls. The total dendrite length (E) in the Dvl2‐C group was significantly lower than in controls. (F–J): KD of Vangl2 causes morphological defects in cultured neurons. Photomicrographs show representative examples of neurons transfected with control (F) or Vangl2 KD (G) vector. The numbers of branch points (H) and tips (I) in the Vangl2 KD group were significantly lower than in controls. The total dendrite length (J) in the Vangl2 KD group was significantly lower than in controls. *, p < .05; ***, p < .005. Scale bar = A, B, F, and G, 10 μm. Abbreviations: Dvl2, dishevelled2; EGFP, enhanced green fluorescent protein; KD, knockdown; Vangl2, Van Gogh like‐2. 3 Open in new tabDownload slide Effects of Dvl2 and Vangl2 on the dendritic morphology of cultured neurons. (A–E): Inhibition of Dvl2 causes morphological defects in cultured neurons. Photomicrographs show representative examples of neurons transfected with control (A) or Dvl2‐C‐carrying (B) vector. The numbers of branch points (C) and tips (D) in the Dvl2‐C group were significantly lower than in controls. The total dendrite length (E) in the Dvl2‐C group was significantly lower than in controls. (F–J): KD of Vangl2 causes morphological defects in cultured neurons. Photomicrographs show representative examples of neurons transfected with control (F) or Vangl2 KD (G) vector. The numbers of branch points (H) and tips (I) in the Vangl2 KD group were significantly lower than in controls. The total dendrite length (J) in the Vangl2 KD group was significantly lower than in controls. *, p < .05; ***, p < .005. Scale bar = A, B, F, and G, 10 μm. Abbreviations: Dvl2, dishevelled2; EGFP, enhanced green fluorescent protein; KD, knockdown; Vangl2, Van Gogh like‐2. Blocking PCP Signaling Alters the Morphology of Newborn OB Neurons In Vivo Finally, we studied the effect of blocking the PCP signaling on the morphology of OB neurons in vivo. First, we traced and compared the dendritic pattern of GCs expressing GFP and a dominant‐negative form of Dvl2 with that of control GCs in vivo (Fig. 4A–4D). Most of the GFP+ GCs had no axon and one long primary dendrite that formed a dendritic tree, regardless of whether the PCP signaling was blocked. However, quantitative analyses revealed that the expression of dominant‐negative Dvl2 decreased the total length of dendrites (control, 608.5 ± 44.0 μm, n = 10 cells from three mice; Dvl2‐C, 429.3 ± 44.0 μm, n = 6 cells from two mice; p = .0175), increased the length of the primary dendrite (control, 147.8 ± 24.3 μm, n = 10 cells from three mice; Dvl2‐C, 236.9 ± 31.7 μm, n = 6 cells from two mice; p = .0420), and decreased the number of dendritic branch points (control, 4.00 ± 0.46, n = 10 cells from three mice; Dvl2‐C, 2.14 ± 0.26, n = 6 cells from two mice; p = .0052) (Fig. 4E–4G), suggesting that dendritogenesis was impaired. 4 Open in new tabDownload slide Effects of Dvl2 on dendritic morphology of granule cells (GCs) in the GC layer. (A–D): Photomicrographs (left columns) and traced drawings (right columns) show two representative examples of infected GCs in control (A, B) and Dvl2‐C (C, D) cases. Brackets indicate the length of the primary dendrite. (E–G): Quantification of morphological defects in GCs. The GC total neurite length was significantly lower (E) and the primary dendrite length was significantly higher (F) than in controls. The branch‐point number (G) was significantly lower in the Dvl2‐C group than in controls. *, p < .05; **, p < .01. Scale bar = A–D, 50 μm. Abbreviation: Dvl2, dishevelled2. 4 Open in new tabDownload slide Effects of Dvl2 on dendritic morphology of granule cells (GCs) in the GC layer. (A–D): Photomicrographs (left columns) and traced drawings (right columns) show two representative examples of infected GCs in control (A, B) and Dvl2‐C (C, D) cases. Brackets indicate the length of the primary dendrite. (E–G): Quantification of morphological defects in GCs. The GC total neurite length was significantly lower (E) and the primary dendrite length was significantly higher (F) than in controls. The branch‐point number (G) was significantly lower in the Dvl2‐C group than in controls. *, p < .05; **, p < .01. Scale bar = A–D, 50 μm. Abbreviation: Dvl2, dishevelled2. We also examined the effect of electroporating the Vangl2 KD vector in vivo, which labels the morphology of GCs and PGCs more clearly. Consistent with the effect of Dvl2‐C, Vangl2 KD also caused a decreased total length of dendrites in GCs (control, 411.0 ± 28.6 μm, n = 55 cells from three mice; Vangl2 KD, 328.5 ± 30.5 μm, n = 52 cells from three mice; p = .0386) (Fig. 5A–5C). In addition, PGCs expressing Vangl2 KD had a significantly decreased total dendrite length (control, 108.00 ± 11.98 μm, n = 29 cells from three mice; Vangl2 KD, 66.59 ± 8.17 μm, n = 32 cells from three mice; p = .0036), a reduced number of dendritic branch points (control, 2.00 ± 0.31, n = 29 cells from three mice; Vangl2 KD, 0.56 ± 0.17, n = 32 cells from three mice; p < .001), and a reduced number of neurites extending from the soma (control, 2.52 ± 0.21, n = 29 cells from three mice; Vangl2 KD, 1.88 ± 0.17, n = 32 cells from three mice; p = .0013) (Fig. 5D–5H). Together, these results suggest that the location and dendritogenesis of newborn neurons in the OB are altered when the PCP signal is blocked. 5 Open in new tabDownload slide Effects of Vangl2 on the dendritic morphology of neuronal precursor cells in the granule cell layer (GCL) and periglomerular layer (PGL). (A, B): Coronal sections through the olfactory bulb (OB) GCL harvested 7 days after electroporation of the control (A) or Vangl2 KD (B) vector. The borders between the inner and outer GCL and between the outer GCL and the PGL are indicated by lines. (C): Total GC dendrite length was significantly lower in the Vangl2 KD group than in controls. (D, E): Coronal sections through the PGL of OBs harvested 7 days after the electroporation of control (D) or Vangl2 KD (E) vector. The number of neurites extending from the soma (F), branch‐point number (G), and the total dendrite length (H) of the PGCs were significantly lower in the Vangl2 KD group than controls. *, p < .05; **, p < .01. Scale bar = A–E, 50 μm. Abbreviations: KD, knockdown; PGC, periglomerular cell; Vangl2, Van Gogh like‐2. 5 Open in new tabDownload slide Effects of Vangl2 on the dendritic morphology of neuronal precursor cells in the granule cell layer (GCL) and periglomerular layer (PGL). (A, B): Coronal sections through the olfactory bulb (OB) GCL harvested 7 days after electroporation of the control (A) or Vangl2 KD (B) vector. The borders between the inner and outer GCL and between the outer GCL and the PGL are indicated by lines. (C): Total GC dendrite length was significantly lower in the Vangl2 KD group than in controls. (D, E): Coronal sections through the PGL of OBs harvested 7 days after the electroporation of control (D) or Vangl2 KD (E) vector. The number of neurites extending from the soma (F), branch‐point number (G), and the total dendrite length (H) of the PGCs were significantly lower in the Vangl2 KD group than controls. *, p < .05; **, p < .01. Scale bar = A–E, 50 μm. Abbreviations: KD, knockdown; PGC, periglomerular cell; Vangl2, Van Gogh like‐2. Discussion In this work, we studied the function of two major core components of the Wnt/PCP pathway, Dvl2 and Vangl2, in postnatal neuronal migration and differentiation in the OB. The functions of Vangl2 during embryonic development have been extensively investigated, mainly using a mutant mouse line, Loop‐tail (Lp) [51, 52]. Since Vangl2Lp/Lp mice die as embryos, little is known about its function in the postnatal brain. Although adult Dvl2 mutant mice are viable, functional redundancy with Dvl1 makes it difficult to detect the specific role of Dvl2 in postnatal neurogenesis [53]. Furthermore, it is possible that these mutations impair the development of the SVZ, RMS, and/or OB, which could indirectly affect postnatal neurogenesis. To address these issues, we used dominant‐negative forms and a KD construct of these genes. Roles of the Wnt/PCP pathway in cell migration have been reported in several different contexts [24–32]. In this work, blocking the Wnt/PCP pathway decreased the number of NPCs that reached the OB, without affecting their differentiation or proliferation (Figs. 1 and 2, Supporting Information Figs. S4–S6), suggesting that this pathway's function in NPC migration into the OB is cell‐autonomous. On the other hand, NPC migration in the SVZ‐RMS‐OB path is known to be regulated by the surrounding cells, including ependymal cells, astrocytes, and blood vessels [54–57]. Since Dvl2 and Vangl2 are expressed broadly in this region (Supporting Information Fig. S1), it is also possible that these cells regulate NPC migration in the SVZ‐RMS‐OB path via PCP signaling in a non‐cell‐autonomous manner, as shown for the FBM neuronal migration in mice and zebrafish [25, 27, 29–31]. Previous studies identified several extracellular factors involved in the dendritogenesis of SVZ‐derived OB interneurons, including GABA [58] and vascular endothelial growth factor (VEGF) [59]. Wnt5a, which likely activates the PCP signaling pathway, increases the neurite complexity of OB interneurons derived from the SVZ [35]. However, the cell‐intrinsic mechanisms involved in dendrite formation in newborn NPCs in the postnatal OB remain largely elusive. We showed that blocking the PCP signal in the newborn neurons using nucleofection and lentiviral vectors impaired their dendritic growth and arborization in vitro (Fig. 3) and in the OB (Figs. 4 and 5), suggesting that PCP signaling's role in dendritogenesis is cell‐autonomous. In addition, since impaired PCP signaling decreases NPC migration into the outer GCL (Fig. 2), it is possible that the altered morphology of the GCs, such as the longer primary dendrite, is partly due to their altered migration and localization [60]. Roles for Wnt signaling in neurite formation have been reported in invertebrates and vertebrates. In cultured hippocampal neurons, Wnt7 and Dvl activate Rac and JNK, promoting dendrite development [33]. Wnt3a stimulates the neurite outgrowth of Ewing tumor cells via JNK [61]. Celsr2 and Celsr3 regulate dendrite branching patterns [34]. Given that Wnt5a is expressed in the olfactory sensory axons, PGCs, and granule cells in the postnatal OB [35, 62], and given that it functions in the noncanonical pathway to increase neurite complexity [35], it is possible that Dvl2 and Vangl2 function downstream of Wnt5a in this system. Interestingly, the Wnt/β‐catenin signal suppresses dendrite maturation in SVZ‐derived neurons [35], suggesting that both the Wnt/β‐catenin and Wnt/PCP pathways cooperatively regulate the dendritogenesis of NPCs in the adult OB. Conclusions In conclusion, this study suggests possible roles for PCP signaling in the migration and morphogenesis of new neurons in the OB and provides new insights into the mechanisms underlying postnatal neurogenesis. Acknowledgements We thank R. Habas, H. Miyoshi, and H. Naka for providing materials and members of the Sawamoto laboratory for useful discussions. M. Sawada is a Research Fellow of the Japan Society for the Promotion of Science. This work was supported by the Funding Program for Next Generation World‐Leading Researchers (to K.S.), a Grant‐in‐Aid for Young Scientists (S) (to K.S.), the International Human Frontier Science Program Organization (to K.S.), and the Japan Brain Foundation (to Y.H.). Disclosure of Potential Conflicts of Interest The authors indicate no potential conflicts of interest. References 1 Seki T , Sawamoto K, Parent JM et al., eds. Neurogenesis in the Adult Brain I: Neurobiology . New York: Springer , 2011 : 1 – 406 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 2 Doetsch F , Caille I, Lim DA et al. Subventricular zone astrocytes are neural stem cells in the adult mammalian brain . Cell 1999 ; 97 : 703 – 716 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Luskin MB . Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone . Neuron 1993 ; 11 : 173 – 189 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Lois C , Alvarez‐Buylla A. Long‐distance neuronal migration in the adult mammalian brain . Science 1994 ; 264 : 1145 – 1148 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Belvindrah R , Lazarini F, Lledo PM. Postnatal neurogenesis: From neuroblast migration to neuronal integration . Rev Neurosci 2009 ; 20 : 331 – 346 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Ihrie RA , Alvarez‐Buylla A. Lake‐front property: A unique germinal niche by the lateral ventricles of the adult brain . Neuron 2011 ; 70 : 674 – 686 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Ming GL , Song H. Adult neurogenesis in the mammalian brain: Significant answers and significant questions . Neuron 2011 ; 70 : 687 – 702 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Okano H . Stem cell biology of the central nervous system . J Neurosci Res 2002 ; 69 : 698 – 707 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Okano H , Sawamoto K. Neural stem cells: Involvement in adult neurogenesis and CNS repair . Philos Trans R Soc Lond B Biol Sci 2008 ; 363 : 2111 – 2122 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Patapoutian A , Reichardt LF. Roles of Wnt proteins in neural development and maintenance . Curr Opin Neurobiol 2000 ; 10 : 392 – 399 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Ikeda M , Hirota Y, Sakaguchi M et al. Expression and proliferation‐promoting role of diversin in the neuronally committed precursor cells migrating in the adult mouse brain . Stem Cells 2010 ; 28 : 2017 – 2026 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Shimogori T , VanSant J, Paik E et al. Members of the Wnt, Fz, and Frp gene families expressed in postnatal mouse cerebral cortex . J Comp Neurol 2004 ; 473 : 496 – 510 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Tissir F , Goffinet AM. Expression of planar cell polarity genes during development of the mouse CNS . Eur J Neurosci 2006 ; 23 : 597 – 607 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Guirao B , Meunier A, Mortaud S et al. Coupling between hydrodynamic forces and planar cell polarity orients mammalian motile cilia . Nat Cell Biol 2010 ; 12 : 341 – 350 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Tada M , Kai M. Noncanonical Wnt/PCP signaling during vertebrate gastrulation . Zebrafish 2009 ; 6 : 29 – 40 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Wallingford JB , Habas R. The developmental biology of Dishevelled: An enigmatic protein governing cell fate and cell polarity . Development 2005 ; 132 : 4421 – 4436 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Lee SM , Tole S, Grove E et al. A local Wnt‐3a signal is required for development of the mammalian hippocampus . Development 2000 ; 127 : 457 – 467 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Qu Q , Sun G, Li W et al. Orphan nuclear receptor TLX activates Wnt/beta‐catenin signalling to stimulate neural stem cell proliferation and self‐renewal . Nat Cell Biol . 2010 ; 12 : 31 – 40 ; sup pp31–39. Google Scholar Crossref Search ADS PubMed WorldCat 19 Chenn A , Walsh CA. Regulation of cerebral cortical size by control of cell cycle exit in neural precursors . Science 2002 ; 297 : 365 – 369 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Galceran J , Miyashita‐Lin EM, Devaney E et al. Hippocampus development and generation of dentate gyrus granule cells is regulated by LEF1 . Development 2000 ; 127 : 469 – 482 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Hirabayashi Y , Itoh Y, Tabata H et al. The Wnt/beta‐catenin pathway directs neuronal differentiation of cortical neural precursor cells . Development 2004 ; 131 : 2791 – 2801 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Adachi K , Mirzadeh Z, Sakaguchi M et al. Beta‐catenin signaling promotes proliferation of progenitor cells in the adult mouse subventricular zone . Stem Cells 2007 ; 25 : 2827 – 2836 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Lake BB , Sokol SY. Strabismus regulates asymmetric cell divisions and cell fate determination in the mouse brain . J Cell Biol 2009 ; 185 : 59 – 66 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Bingham S , Higashijima S, Okamoto H et al. The Zebrafish trilobite gene is essential for tangential migration of branchiomotor neurons . Dev Biol 2002 ; 242 : 149 – 160 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Jessen JR , Topczewski J, Bingham S et al. Zebrafish trilobite identifies new roles for Strabismus in gastrulation and neuronal movements . Nat Cell Biol 2002 ; 4 : 610 – 615 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Mapp OM , Walsh GS, Moens CB et al. Zebrafish Prickle1b mediates facial branchiomotor neuron migration via a farnesylation‐dependent nuclear activity . Development 2011 ; 138 : 2121 – 2132 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Qu Y , Glasco DM, Zhou L et al. Atypical cadherins Celsr1‐3 differentially regulate migration of facial branchiomotor neurons in mice . J Neurosci 2010 ; 30 : 9392 – 9401 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Sittaramane V , Sawant A, Wolman MA et al. The cell adhesion molecule Tag1, transmembrane protein Stbm/Vangl2, and Lamininalpha1 exhibit genetic interactions during migration of facial branchiomotor neurons in zebrafish . Dev Biol 2009 ; 325 : 363 – 373 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Wada H , Iwasaki M, Sato T et al. Dual roles of zygotic and maternal Scribble1 in neural migration and convergent extension movements in zebrafish embryos . Development 2005 ; 132 : 2273 – 2285 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Wada H , Tanaka H, Nakayama S et al. Frizzled3a and Celsr2 function in the neuroepithelium to regulate migration of facial motor neurons in the developing zebrafish hindbrain . Development 2006 ; 133 : 4749 – 4759 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Walsh GS , Grant PK, Morgan JA et al. Planar polarity pathway and Nance‐Horan syndrome‐like 1b have essential cell‐autonomous functions in neuronal migration . Development 2011 ; 138 : 3033 – 3042 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Banerjee S , Gordon L, Donn TM et al. A novel role for MuSK and non‐canonical Wnt signaling during segmental neural crest cell migration . Development 2011 ; 138 : 3287 – 3296 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Rosso SB , Sussman D, Wynshaw‐Boris A et al. Wnt signaling through Dishevelled, Rac and Jnk regulates dendritic development . Nat Neurosci 2005 ; 8 : 34 – 42 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Shima Y , Kawaguchi SY, Kosaka K et al. Opposing roles in neurite growth control by two seven‐pass transmembrane cadherins . Nat Neurosci 2007 ; 10 : 963 – 969 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Pino D , Choe Y, Pleasure SJ. Wnt5a controls neurite development in olfactory bulb interneurons . ASN Neuro 2011 ; 3 : e00059 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Goodrich LV . The plane facts of PCP in the CNS . Neuron 2008 ; 60 : 9 – 16 . Google Scholar Crossref Search ADS PubMed WorldCat 37 Tissir F , Goffinet AM. Planar cell polarity signaling in neural development . Curr Opin Neurobiol 2010 ; 20 : 572 – 577 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Wada H , Okamoto H. Roles of planar cell polarity pathway genes for neural migration and differentiation . Dev Growth Differ 2009 ; 51 : 233 – 240 . Google Scholar Crossref Search ADS PubMed WorldCat 39 Habas R , Kato Y, He X. Wnt/frizzled activation of Rho regulates vertebrate gastrulation and requires a novel Formin homology protein Daam1 . Cell 2001 ; 107 : 843 – 854 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Hirota Y , Meunier A, Huang S et al. Planar polarity of multiciliated ependymal cells involves the anterior migration of basal bodies regulated by non‐muscle myosin II . Development 2010 ; 137 : 3037 – 3046 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Miyoshi H , Blomer U, Takahashi M et al. Development of a self‐inactivating lentivirus vector . J Virol 1998 ; 72 : 8150 – 8157 . Google Scholar Crossref Search ADS PubMed WorldCat 42 Niwa H , Yamamura K, Miyazaki J. Efficient selection for high‐expression transfectants with a novel eukaryotic vector . Gene 1991 ; 108 : 193 – 199 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 43 Boutin C , Diestel S, Desoeuvre A et al. Efficient in vivo electroporation of the postnatal rodent forebrain . PLoS One 2008 ; 3 : e1883 . Google Scholar Crossref Search ADS PubMed WorldCat 44 Hirota Y , Ohshima T, Kaneko N et al. Cyclin‐dependent kinase 5 is required for control of neuroblast migration in the postnatal subventricular zone . J Neurosci 2007 ; 27 : 12829 – 12838 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Park TJ , Mitchell BJ, Abitua PB et al. Dishevelled controls apical docking and planar polarization of basal bodies in ciliated epithelial cells . Nat Genet 2008 ; 40 : 871 – 879 . Google Scholar Crossref Search ADS PubMed WorldCat 46 Gao C , Chen YG. Dishevelled: The hub of Wnt signaling . Cell Signal 2010 ; 22 : 717 – 727 . Google Scholar Crossref Search ADS PubMed WorldCat 47 Sakaguchi M , Shingo T, Shimazaki T et al. A carbohydrate‐binding protein, Galectin‐1, promotes proliferation of adult neural stem cells . Proc Natl Acad Sci USA 2006 ; 103 : 7112 – 7117 . Google Scholar Crossref Search ADS PubMed WorldCat 48 Parras CM , Galli R, Britz O et al. Mash1 specifies neurons and oligodendrocytes in the postnatal brain . EMBO J 2004 ; 23 : 4495 – 4505 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Brown JP , Couillard‐Despres S, Cooper‐Kuhn CM et al. Transient expression of doublecortin during adult neurogenesis . J Comp Neurol 2003 ; 467 : 1 – 10 . Google Scholar Crossref Search ADS PubMed WorldCat 50 Montcouquiol M , Rachel RA, Lanford PJ et al. Identification of Vangl2 and Scrb1 as planar polarity genes in mammals . Nature 2003 ; 423 : 173 – 177 . Google Scholar Crossref Search ADS PubMed WorldCat 51 Kibar Z , Vogan KJ, Groulx N et al. Ltap, a mammalian homolog of Drosophila Strabismus/Van Gogh, is altered in the mouse neural tube mutant Loop‐tail . Nat Genet 2001 ; 28 : 251 – 255 . Google Scholar Crossref Search ADS PubMed WorldCat 52 Murdoch JN , Doudney K, Paternotte C et al. Severe neural tube defects in the loop‐tail mouse result from mutation of Lpp1, a novel gene involved in floor plate specification . Hum Mol Genet 2001 ; 10 : 2593 – 2601 . Google Scholar Crossref Search ADS PubMed WorldCat 53 Hamblet NS , Lijam N, Ruiz‐Lozano P et al. Dishevelled 2 is essential for cardiac outflow tract development, somite segmentation and neural tube closure . Development 2002 ; 129 : 5827 – 5838 . Google Scholar Crossref Search ADS PubMed WorldCat 54 Kaneko N , Marin O, Koike M et al. New neurons clear the path of astrocytic processes for their rapid migration in the adult brain . Neuron 2010 ; 67 : 213 – 223 . Google Scholar Crossref Search ADS PubMed WorldCat 55 Sawamoto K , Wichterle H, Gonzalez‐Perez O et al. New neurons follow the flow of cerebrospinal fluid in the adult brain . Science 2006 ; 311 : 629 – 632 . Google Scholar Crossref Search ADS PubMed WorldCat 56 Snapyan M , Lemasson M, Brill MS et al. Vasculature guides migrating neuronal precursors in the adult mammalian forebrain via brain‐derived neurotrophic factor signaling . J Neurosci 2009 ; 29 : 4172 – 4188 . Google Scholar Crossref Search ADS PubMed WorldCat 57 Whitman MC , Fan W, Rela L et al. Blood vessels form a migratory scaffold in the rostral migratory stream . J Comp Neurol 2009 ; 516 : 94 – 104 . Google Scholar Crossref Search ADS PubMed WorldCat 58 Gascon E , Dayer AG, Sauvain MO et al. GABA regulates dendritic growth by stabilizing lamellipodia in newly generated interneurons of the olfactory bulb . J Neurosci 2006 ; 26 : 12956 – 12966 . Google Scholar Crossref Search ADS PubMed WorldCat 59 Licht T , Eavri R, Goshen I et al. VEGF is required for dendritogenesis of newly born olfactory bulb interneurons . Development 2009 ; 137 : 261 – 271 . Google Scholar Crossref Search ADS WorldCat 60 Kelsch W , Mosley CP, Lin CW et al. Distinct mammalian precursors are committed to generate neurons with defined dendritic projection patterns . PLoS Biol 2007 ; 5 : e300 . Google Scholar Crossref Search ADS PubMed WorldCat 61 Endo Y , Beauchamp E, Woods D et al. Wnt‐3a and Dickkopf‐1 stimulate neurite outgrowth in Ewing tumor cells via a Frizzled3‐ and c‐Jun N‐terminal kinase‐dependent mechanism . Mol Cell Biol 2008 ; 28 : 2368 – 2379 . Google Scholar Crossref Search ADS PubMed WorldCat 62 Rodriguez‐Gil DJ , Greer CA. Wnt/frizzled family members mediate olfactory sensory neuron axon extension . J Comp Neurol 2008 ; 511 : 301 – 317 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Author contributions: Y.H. and M. Sawada: conception and design, collection and assembly of data, data analysis and interpretation, and manuscript writing; Y.S.K.: conception and design, collection and assembly of data, data analysis and interpretation, and provision of study material or patients; S.H.: collection and assembly of data and data analysis and interpretation; M.Sakaguchi and O.Y.: conception and design and collection and assembly of data; T.O.: conception and design, provision of study material or patients, financial support, and administrative support; H.O.: conception and design, data analysis and interpretation, financial support, and administrative support; K.S.: conception and design, data analysis and interpretation, financial support, manuscript writing, and administrative support. Disclosure of potential conflicts of interest is found at the end of this article. First published online in STEM CELLSEXPRESS May 24, 2012. Telephone: 81‐52‐853‐8532; Fax: 81‐52‐851‐1898 Copyright © 2012 AlphaMed Press This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Roles of Planar Cell Polarity Signaling in Maturation of Neuronal Precursor Cells in the Postnatal Mouse Olfactory Bulb
JF - Stem Cells
DO - 10.1002/stem.1137
DA - 2012-08-01
UR - https://www.deepdyve.com/lp/oxford-university-press/roles-of-planar-cell-polarity-signaling-in-maturation-of-neuronal-2c4L3UnRWR
SP - 1726
EP - 1733
VL - 30
IS - 8
DP - DeepDyve
ER -