TY - JOUR
AU - Godfrey, Tony, E
AB - Abstract Background: PCR-based assays can improve clinical care, but they remain technically demanding and labor-intensive. We describe a new instrument, the GeneXpert®, that performs automated nucleic acid isolation, reverse transcription, and fluorescence-based quantitative PCR in ∼35 min. Methods: Yield and integrity of RNA isolated on the GeneXpert were compared with Qiagen-based extraction for parallel samples (5-μm frozen tissue sections). The reproducibility of automated RNA isolation, reverse transcription, and quantitative PCR was determined by replicate (n = 10) analysis of 10 tissues, using duplex (target and endogenous control) reverse transcription-PCR reactions for two gene combinations. The GeneXpert was then used to perform rapid analysis of lymph nodes from melanoma, breast cancer, and lung cancer patients and analysis of melanoma metastatic to the lung, primary lung adenocarcinoma, and healthy lung tissue. Results: On the GeneXpert, RNA was recovered in slightly over 6 min, and the yield was ∼70% of that from parallel Qiagen reactions. The RNA integrity was comparable to that of Qiagen-isolated RNA as determined by gel electrophoresis. For the melanoma samples, the 95% prediction interval for the ΔCt for a new measurement was ±1.54 cycles, and for breast cancer samples, the interval for a newly observed ΔCt was ±1.40 cycles. GeneXpert assays successfully detected the presence of metastatic melanoma, breast cancer, and lung cancer in lymph nodes and also differentiated among metastatic melanoma, lung adenocarcinoma, and healthy lung. Conclusions: RNA yield and integrity on the GeneXpert are comparable to benchtop methods. Reproducibility of the GeneXpert data is similar to that seen with manual methods in our hands but may need improvement for some applications. The GeneXpert can perform RNA isolation, reverse transcription, and quantitative PCR in ∼35 min and could therefore be used for intraoperative testing when applicable. Molecular assays offer promise as diagnostic and prognostic tests for cancer and other diseases. In particular, the widespread use of PCR and, subsequently, real-time quantitative PCR has revolutionized basic research and has facilitated evaluation of the genetic basis of many diseases. In the areas of infectious disease and hereditary diseases, the clinical use of PCR and real-time PCR assays has also grown rapidly and is now a major part of the in vitro diagnostics laboratory. In oncology, however, the number of real-time PCR and, specifically, real-time reverse transcription-PCR assays remains relatively small. This may reflect, in part, the complexity of designing, validating, and performing such assays. A typical PCR assay requires sample preparation, nucleic acid isolation, assay set up, PCR amplification, and detection of PCR products. If the genetic target is RNA, the assays are further complicated by the labile nature of RNA and the need to add a reverse transcription step. Consequently, such assays are currently restricted to centralized testing facilities or major medical centers with the resources to finance molecular testing laboratories that maintain rigorous quality assurance and accreditation. Recent advances in real-time PCR technology have facilitated accurate quantification of PCR or reverse transcription-PCR products for DNA copy number and RNA expression analysis, respectively (1)(2)(3)(4). In addition to providing quantitative data, real-time PCR has, in most cases, eliminated the need for post-PCR processing for detection of products, thereby greatly reducing assay time and minimizing, if not eliminating, the possibility of contamination and false-positive results. Other technical advances also allow the thermal cycling portion of real-time PCR assays to be performed extremely rapidly, with results in 20 min or less (5)(6)(7). As a result, real-time PCR assays are beginning to enter clinical testing in situations in which rapid, point-of-care diagnostics are required, such as peripartum testing for group B streptococcus in pregnant women (8)(9). In such a rapid testing scenario, the time-consuming and labor-intensive nature of nucleic acid isolation and assay setup severely limits the ability to provide improved patient care that could be afforded by immediate molecular test results. In this report, we describe the evaluation of an instrument for rapid, automated RNA isolation and quantitative reverse transcription (QRT)-PCR2 (GeneXpert®; Cepheid) that helps to overcome the limitations described above. In addition, the prototype GeneXpert instrument, provided to our group at the University of Pittsburgh, was used to develop, optimize, and test protocols for specific QRT-PCR assays intended for cancer-related diagnostic testing. Materials and Methods role of cepheid Coauthors from Cepheid were responsible for design and development of the GeneXpert instrument and cartridges and for development of preliminary protocols for RNA isolation on the GeneXpert. They also provided technical support and intellectual input for the development and optimization of RNA isolation protocols from human tissues. Cepheid did not have a significant role in the experimental design or data acquisition, analysis, or interpretation. Finally, all authors assisted in writing and editing of the manuscript. Cepheid had the right to review this manuscript for proprietary or patentable information and to request delay of publication for up to 6 months to file for intellectual property rights. Cepheid did not make such a request. tissue sources All tissues used in this study were obtained under protocols approved by the University of Pittsburgh Institutional Review Board. The tissues from lung cancer patients, as well as benign nodes from patients undergoing antireflux surgery, were obtained from the Division of Thoracic and Foregut Surgery tissue bank. The tissues from patients with breast cancer or melanoma were acquired from the Magee Women’s Hospital (Pittsburgh, PA) tissue bank. All tissues were snap-frozen in liquid nitrogen at the time of collection and later embedded in optimal cutting compound for cryosectioning and analysis. RNA samples for the characterization of RNA yields were either extracted from archived frozen tissues or obtained commercially (Ambion). histology All cryosectioned tissues were stained with hematoxylin and eosin (H&E) for histologic review. In addition, samples from patients with breast or lung cancer were stained with the AE1/AE3 pankeratin antibody cocktail (Dako), and samples from patients with melanoma were stained with a monoclonal antibody for the antigen MELAN-A (Dako). A pathologist (K.S.M.) evaluated all slides and confirmed the presence of metastatic disease in positive nodes and the absence of contaminating tissue in negative and benign nodes. description of GeneXpert The GeneXpert is a software-driven cartridge processor and integrated fluorescence-based quantitative thermal cycler (Fig. 1A1 ) that interfaces with single-use disposable cartridges (Fig. 1B1 ) to achieve nucleic acid isolation and QRT-PCR. The microfluidics-based GeneXpert cartridge consists of multiple chambers that are designed to hold the biological sample in lysis buffer; purification and elution buffers; and all RT-PCR reagents, enzymes, and buffers and to retain all sample-processing wastes. The cartridge also has an attached PCR tube with fluidic connections to the reagents in the cartridge chambers. When inserted into the GeneXpert, the PCR tube is surrounded by heating/cooling plates and by optical blocks that enable amplification and real-time, fluorescence-based PCR product detection. At the center of the cartridge is a syringe barrel that has a dry interface (which nearly eliminates the potential for contamination) with the GeneXpert through a syringe plunger, thereby allowing the movement of fluids within the cartridge and between the PCR tube and the cartridge. Fluid movement within the cartridge is controlled by a rotary valve (Fig. 1C1 , valve body) that provides random access capability for fluid movement between different chambers and to the PCR tube. The valve body assembly also contains an active region fitted with a 55-μL cavity containing nucleic acid purification beads (Cellpure® beads; Cepheid; Fig. 1D1 ). Within the cavity are inlet and outlet ports that provide for fluid movement over the purification beads. These beads are retained within the cavity by screens that cover the two ports on the back of the valve body and a flat cap on the front of the valve body (Fig. 1D1 ). For nucleic acid capture, a tissue lysate solution from one reagent chamber is flowed through the beads within the valve body. The bound nucleic acid is then washed, eluted, mixed with RT-PCR reagents, and dispensed into the PCR tube for reverse transcription, amplification, and real-time detection as described below. GeneXpert rna isolation and qrt-pcr methods A typical GeneXpert protocol used in this study is described below. Reagents were manually loaded into the cartridge reservoirs before the assay, and all subsequent fluid movement within the cartridge was controlled by the GeneXpert software. The steps performed in these experiments were as follows: Cryosectioned tissue sections (twenty to thirty 5-μm sections) were lysed in 800 μL of chaotropic lysis buffer consisting of 5 mol/L guanidine isothiocyanate, 50 mmol/L Tris-HCl (pH 7.15), and 10 mL/L β-mercaptoethanol and filtered through a 0.22 μm syringe filter (Osmonics Inc.). An equal volume of ethanol was added, and the lysed sample was placed in a chamber within the GeneXpert cartridge. The sample was drawn into the syringe barrel and dispensed through the nucleic acid purification beads into a waste chamber on the cartridge. A high-salt wash solution [200 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.0), and 100 mL/L polyethylene glycol] was then aspirated from a reagent reservoir into the syringe barrel and dispensed through the purification beads to the waste chamber, thus washing the beads to remove proteins and residual lysis buffer. The bound RNA was eluted off the purification beads with nuclease-free water. The first 50 μL, containing high concentrations of KCl and polyethylene glycol but low amounts of RNA, was directed to the waste chamber, and the next 30 μL, containing purified RNA, was directed to an unused reagent chamber. The eluted RNA was mixed with reverse transcription reagents [30-μL volume containing 600 U of Superscript II (Invitrogen), 30 U of SUPERase-In (Ambion), 200 nmol/L each deoxynucleotide triphosphate, 150 nmol/L each reverse transcription primer, and 1× PCR buffer (10 mmol/L Tris (pH 7.6), 10 mmol/L KCl, and 4.5 mmol/L MgCl2)] and moved into the PCR tube of the cartridge. QRT-PCR analysis on the GeneXpert was performed to emulate the manual, single-tube, two-step protocol as published previously (10)(11). Reverse transcription was performed for 5 min at 48 °C, followed by a heat inactivation of the reverse transcription enzyme for 2 min at 95 °C. At this point, the cDNA mixture was removed from the tube, mixed with PCR reagents (20-μL volume containing sufficient PCR primers and probes to give the final concentrations listed in Table 11 ), and dispensed back into the PCR tube. PCR amplification was performed with the following cycling conditions: 30 s at 95 °C, followed by up to 40 cycles with 1 s at 95 °C for template denaturation, 4 s at 53 °C for primer annealing, and 6 s at 64 °C for primer extension and optical data collection. To facilitate quantitative multiplexing, the PCR protocol was automatically changed when the fluorescence associated with PCR amplification of the endogenous control gene reached a threshold of 10 fluorescence units. After this point, the temperature for the primer annealing and extension phase was increased to 64 °C for the remaining cycles (total of 40 cycles). This effectively eliminates endogenous control primer annealing and amplification, thus allowing quantitative detection of the target gene (11). The primer and probe sequences and concentrations used in this study are given in Table 11 . All PCR primers were designed by previously described approaches (12) to avoid amplification of genomic DNA, and this was confirmed by testing with 100 ng of human genomic DNA as template for PCR. Relative expression values of the target genes were calculated by the previously described Δthreshold cycle (ΔCt) method (4)(13)(14). evaluation of rna isolation on the GeneXpert We compared the yield, integrity, and purity of lymph node RNA isolated on the GeneXpert with the RNA obtained by manual isolation using the RNeasy® Minikit (Qiagen). We performed parallel RNA isolations on tissue sections from 10 independent lymph nodes. For these comparisons, tissues were cut, ten 5-μm sections at a time, and added to Qiagen and GeneXpert lysis buffers in an alternating fashion (total of 30 sections per isolation). RNAs were isolated on the GeneXpert by the protocol described above with the exception that the procedure was stopped at step 4, and the RNA was eluted in 80 μL with no fluid sent to waste. Qiagen extractions were performed with the manufacturer’s recommended protocol. RNA yield and purity were determined spectrophotometrically and with Ribogreen Quantification reagent (Molecular Probes) on the ABI 7700 sequence detection system (Applied Biosystems). RNA integrity was evaluated by electrophoresis of an aliquot of the RNA (precipitated and concentrated with ammonium acetate/ethanol) on native 1% agarose gels. evaluation of assay reproducibility on the GeneXpert To determine the reproducibility of QRT-PCR data from the GeneXpert, we performed replicate analyses on lymph nodes from patients with melanoma or breast cancer (n = 5 for each disease). For each tissue sample, we cut 250 sections (5-μm) into lysis buffer and filtered and divided them into 10 aliquots for independent analysis on the GeneXpert. Breast cancer samples were analyzed in a β-glucuronidase/prolactin-inducible protein (GUS/PIP) multiplex assay, and melanoma samples were analyzed in a GUS/MART1 (melanoma antigen recognized by T cells 1) multiplex assay. We calculated 95% confidence intervals for the ΔCt values (target gene Ct − GUS Ct) for each assay. Results evaluation of rna isolation on the GeneXpert We compared RNA isolation on the GeneXpert with manual RNA isolation for 10 independent frozen tissue samples. Both isolation methods provided RNA with clearly visible 18S and 28S ribosomal RNA bands on agarose gels (Fig. 2A2 ) without difference in apparent integrity. The median RNA yield on the GeneXpert was 63.5% of the Qiagen yield when quantified by spectrophotometry and 69.5% of the Qiagen yield when quantified by Ribogreen fluorometric analysis after DNase treatment (Fig. 2B2 ). The median A260/A280 ratios for the GeneXpert- and RNeasy-isolated RNAs were 2.15 and 1.99, respectively, indicating high purity. reproducibility of automated GeneXpert qrt-pcr analysis One potential advantage of automated QRT-PCR analysis is the ability to obtain reproducible and objective results in different clinical environments. To determine the reproducibility of the GeneXpert QRT-PCR analysis, we performed replicate analyses on 10 lymph nodes with metastatic disease (5 breast cancer and 5 melanoma). The results of this study are shown in Fig. 1 of the Data Supplement that accompanies the online version of this article at http://www.clinchem.org/content/vol51/issue5/. For the melanoma samples, the 95% prediction interval for the ΔCt for a new measurement was ±1.54 cycles. Similarly, for the breast cancer samples, the 95% prediction interval for a newly observed ΔCt was ±1.40 cycles. There were no assay failures noted in this set of 100 analyses. GeneXpert qrt-pcr analysis for rapid detection of metastasis to lymph nodes Intraoperative frozen-section analysis of lymph nodes for cancer staging impacts surgical decision-making. However, this analysis is challenging because of poor tissue architecture and time pressure, which invariably reduce the accuracy of interpretation in this setting. Thus, this point-of-care clinical analysis is one potential application for a rapid and automated QRT-PCR assay. Detailed studies from our group showing that QRT-PCR assays can accurately characterize lymph nodes for the presence of metastatic esophageal, oropharyngeal, and breast cancer have recently been published (15), are in press (16), or have been submitted (Hughes et al., A rapid, fully-automated molecular-based assay accurately analyzes sentinel lymph nodes for the presence of metastatic breast cancer, submitted for publication), and manuscripts on colorectal cancer, lung cancer, and melanoma are in preparation. To demonstrate how the GeneXpert may be useful for the rapid, molecular detection of lymph node metastases, we analyzed histologically positive and benign nodes from patients with melanoma, breast cancer, and lung cancer, using markers established from our own studies. For each tumor type, we identified four histologically positive lymph nodes and four nodes from patients without cancer (benign). The histologically positive lymph nodes had mean percentages of tumor involvement of 59% (range, 40–75%), 50% (2–100%), and 42% (20–90%) for breast cancer, lung cancer, and melanoma, respectively. Results of the GeneXpert QRT-PCR analysis on these lymph nodes is shown in Fig. 33 , along with representative photographs of H&E- and immunohistochemically (IHC) stained lymph nodes. All histologically positive lymph nodes clearly had higher expression of the relevant marker than was detected in the benign lymph nodes (Fig. 33 , C, F, and I), and all assays, from tissue cutting to result, were completed in <35 min. GeneXpert qrt-pcr analysis of melanoma metastasis to the lung Another clinical dilemma that the GeneXpert may improve on is determining the tissue of origin of a tumor in a patient with a previous history of cancer. For example, MART1 is well established as a marker for detecting melanoma metastases to lymph nodes (17)(18)(19)(20)(21), and we have found that MART1 expression is extremely low in healthy lung tissue and in primary non-small cell lung cancer (NSCLC; data available at http://www.mssm.edu/labs/godfrt01/research/mart1.htm). Thus, MART1 can also serve as a good marker for differentiating metastatic melanoma from primary NSCLC. To demonstrate this, we used the GeneXpert to quantify MART1 expression in lung nodules that were determined by routine pathology to be either metastatic melanoma (n = 2) or primary NSCLC (n = 5). In addition, we also analyzed two biopsies of healthy lung taken from patients with NSCLC. As expected, expression of MART1 was much higher in the metastatic melanoma samples than in either healthy lung or primary NSCLC (Fig. 44 ), demonstrating the potential to differentiate between these two malignancies. Discussion Although the number of PCR-based, clinical assays continues to grow, most of the applications of this technology are in DNA-based assays. Even with the technical advance of real-time, quantitative PCR technology, the number of RNA-based clinical assays for gene expression is very small, despite their potential to improve patient care. In oncology, in particular, the number of molecular tests applied to cancer diagnosis and prognosis is negligible compared with the large number of such potential assays reported in the basic research literature. These promising PCR and RT-PCR assays invariably face major problems in gaining clinical acceptance, including (a) difficulty in preserving RNA yield and integrity; (b) high risks of contamination; (c) reagent variability; (d) paucity of appropriate experimental controls; (e) inability to obtain consistent results between laboratories and institutions; and (f) heavy reliance on technician expertise. Thus, the multicenter clinical trials required to validate any of these assays are very difficult to perform. Consequently, even the most promising new molecular diagnostic assays are frequently limited to the individual institution at which they were developed. The need for standardization in PCR assays is highlighted by several reports that have evaluated the reproducibility of PCR results across multiple testing laboratories (22)(23)(24)(25)(26). In one study by the Dermatologic Cooperative Oncology Group (25), seven independent laboratories were evaluated with respect to the detection of melanoma cells in blood by a RT-PCR assay for tyrosinase expression. Of the 60 patient samples tested, no sample gave a positive result in more than two of seven laboratories. In this study, the large variability observed was attributed to very low tyrosinase expression in the samples and to the fact that a different RT-PCR assay techniques was used in each laboratory. In another study, however, interlaboratory differences were high even when the comparison was made with exactly the same PCR reagents and assay conditions (26). This study found significant differences at all stages of the assay, including nucleic acid isolation, PCR amplification, and data interpretation. These reproducibility issues are, in part, responsible for the fact that very few RT-PCR-based oncologic assays have made the transition from the benchtop to the clinic. We report here our initial evaluation of an instrument, the GeneXpert, designed to address the problems described above. The GeneXpert automates all aspects of RT-PCR analysis, including RNA isolation, reverse transcription, quantitative PCR, and data analysis. In this study, we used a prototype version of the GeneXpert cartridge that required manual addition of reagents. Although the reproducibility observed in our experiments would give a seven- to eightfold 95% confidence interval for any single new measurement, we believe that this can be reduced significantly as the prototype instrumentation, cartridges, and software are replaced by production versions. Furthermore, our assays were optimized for research use on the SmartCycler instrument, but this was far less rigorous than the optimization undertaken for a clinical assay, and no specific optimization was performed on the GeneXpert. Finally, in cases in which more precise data are required, running tests in duplicate or triplicate would improve precision and give 95% confidence intervals of ∼3.1- to 3.5-fold (for triplicates) even with the assays and instrumentation described in this study. In addition to full automation, the GeneXpert is also capable of very fast RNA isolation (∼6 min) and PCR cycling times. When combined with our previously described methods for rapid reverse transcription and quantitative PCR multiplexing (7)(10)(11), QRT-PCR assays can be completed in <35 min from tissue to result. With this capability comes, for the first time, the potential to perform molecular diagnostic assays in rapid, point-of-care scenarios. In cancer, one such possibility is the analysis of tissues at the time of surgery to help determine the most appropriate surgical treatment, and we have demonstrated proof of principle for two such applications on the GeneXpert. The first example of this is intraoperative analysis of sentinel lymph node (SLN) specimens. If the SLN contains metastatic cancer, a lymph node dissection is typically indicated, whereas this morbid procedure can be avoided if the SLN is free of metastatic tumor. Although final, postoperative pathology (including time-consuming interpretation of multiple H&E- and IHC-stained cross-sections) is very sensitive, current methods of intraoperative histologic analysis lack sensitivity (27)(28)(29). As a result, 10–20% of breast cancer and melanoma patients (29)(30) are being subjected to a second operation when intraoperative pathology is negative but final pathology is positive for metastasis. Our results show that GeneXpert analysis of these specimens is quite reproducible, even in its current form using manual set up of the cartridges, and can consistently be completed in <35 min. We therefore believe that intraoperative analysis of SLNs by the GeneXpert could assist pathologists in this difficult task and reduce the number of second operations required to complete lymph node dissection in breast cancer, melanoma, and other tumor types. The second challenging scenario in which a GeneXpert-based assay may be useful is the evaluation of tumors observed in patients with previously treated cancer. Clinically, this differentiation can have important implications for treatment options, including the suitability for, and extent of, surgical resection or the need for systemic therapy. Although pathologic diagnosis is relatively straightforward in most cases, some cancer types, such as melanoma and poorly differentiated subtypes of other tumors, can pose a diagnostic problem and often require IHC or other histochemical staining. This analysis is typically performed on fixed tissues after surgery to obtain a tissue biopsy. In this study, we show that rapid QRT-PCR analysis for MART1 can aid in the distinction between melanoma metastasis to the lung and primary NSCLC. The ability to perform this analysis intraoperatively on the GeneXpert could make it possible to combine biopsy, analysis, and complete surgical treatment (if appropriate) in the same procedure. Furthermore, with the use of appropriate markers, similar assays could also be developed for identification of metastases to other solid organs for a variety of different tumor types. In summary, we believe that the automation, standardization, and reproducibility provided by the GeneXpert could facilitate the testing, acceptance, and routine use of quantitative PCR and RT-PCR assays in clinical diagnostics. Furthermore, the ability to perform rapid molecular assays outside of specialized laboratory setting could lead to a major shift in the approach to patient care and management. In addition to intraoperative use during surgery, GeneXpert-based assays could also be used in oncology clinics for residual disease monitoring or diagnosis of leukemias; in emergency rooms for rapid diagnosis of bacterial, viral, or fungal meningitis; and in maternity wards for detection of group B streptococci in pregnant women (8)(31). Perhaps the most important feature of the GeneXpert, however, may be its ability to provide a standardized platform on which multicenter trials of these and other applications can finally be critically tested and evaluated. Figure 1. Open in new tabDownload slide Design of the GeneXpert instrument. (A), photograph of the GeneXpert instrument showing the four cartridge bays, one of which is opened to reveal the plunger that interfaces with the cartridge. (B), photograph of the GeneXpert cartridge showing reagent reservoirs and the integrated PCR tube. (C), illustration of the GeneXpert cartridge and nucleic acid purification valve body. (D), detailed illustration of the GeneXpert cartridge valve body showing the location of the nucleic acid isolation matrix. Figure 1. Open in new tabDownload slide Design of the GeneXpert instrument. (A), photograph of the GeneXpert instrument showing the four cartridge bays, one of which is opened to reveal the plunger that interfaces with the cartridge. (B), photograph of the GeneXpert cartridge showing reagent reservoirs and the integrated PCR tube. (C), illustration of the GeneXpert cartridge and nucleic acid purification valve body. (D), detailed illustration of the GeneXpert cartridge valve body showing the location of the nucleic acid isolation matrix. Table 1. Primer and probe sequences and final concentrations in RT-PCR reactions.1 Name . Sequence, 5′–3′ . Concentration, nmol/L . TACSTD1-F2 TCATTTGCTCAAAGCTGGCTG 800 TACSTD1-R GGTTTTGCTCTTCTCCCAAGTTT 800 TACSTD1-RT AGCCCATCATTGTTCTG 75 TACSTD1-probe FAM-TGGTGATGAAGGCAGAAATGAATGGC-BHQ1 200 MART1-F GATGCTCACTTCATCTATGGTTACC 800 MART1-R ACTGTCAGGATGCCGATCC 800 MART1-RT GCCGATGAGCAGTAAGACT 75 MART1-probe FAM-AGCGGCCTCTTCAGCCGTGGTGT-BHQ1 200 PIP-F CTGGGACTTTTACACCAACAGAACT 800 PIP-R GCAGATGCCTAATTCCCGAA 800 PIP-RT GCAGATGCCTAATTCCC 75 PIP-probe FAM-TGCAAATTGCAGCCGTCGTTGATGT-BHQ1 200 GUSB-F CTCATTTGGAATTTTGCC 600 GUSB-R CGAGTGAAGATCCCCTT 600 GUSB-RT TTTGGTTGTCTCTGCCGAGT 75 GUSB-probe TXR-TGAACAGTCACCGACGAGAGTGCTGG-BHQ2 200 Name . Sequence, 5′–3′ . Concentration, nmol/L . TACSTD1-F2 TCATTTGCTCAAAGCTGGCTG 800 TACSTD1-R GGTTTTGCTCTTCTCCCAAGTTT 800 TACSTD1-RT AGCCCATCATTGTTCTG 75 TACSTD1-probe FAM-TGGTGATGAAGGCAGAAATGAATGGC-BHQ1 200 MART1-F GATGCTCACTTCATCTATGGTTACC 800 MART1-R ACTGTCAGGATGCCGATCC 800 MART1-RT GCCGATGAGCAGTAAGACT 75 MART1-probe FAM-AGCGGCCTCTTCAGCCGTGGTGT-BHQ1 200 PIP-F CTGGGACTTTTACACCAACAGAACT 800 PIP-R GCAGATGCCTAATTCCCGAA 800 PIP-RT GCAGATGCCTAATTCCC 75 PIP-probe FAM-TGCAAATTGCAGCCGTCGTTGATGT-BHQ1 200 GUSB-F CTCATTTGGAATTTTGCC 600 GUSB-R CGAGTGAAGATCCCCTT 600 GUSB-RT TTTGGTTGTCTCTGCCGAGT 75 GUSB-probe TXR-TGAACAGTCACCGACGAGAGTGCTGG-BHQ2 200 1 All primers and probes were synthesized by Integrated DNA Technologies. 2 F, forward PCR primer; R, reverse PCR primer; RT, reverse transcription primer; FAM, 5,6-carboxyfluorescein; BHQ, Black Hole Quencher; TXR, Texas Red. Table 1. Primer and probe sequences and final concentrations in RT-PCR reactions.1 Name . Sequence, 5′–3′ . Concentration, nmol/L . TACSTD1-F2 TCATTTGCTCAAAGCTGGCTG 800 TACSTD1-R GGTTTTGCTCTTCTCCCAAGTTT 800 TACSTD1-RT AGCCCATCATTGTTCTG 75 TACSTD1-probe FAM-TGGTGATGAAGGCAGAAATGAATGGC-BHQ1 200 MART1-F GATGCTCACTTCATCTATGGTTACC 800 MART1-R ACTGTCAGGATGCCGATCC 800 MART1-RT GCCGATGAGCAGTAAGACT 75 MART1-probe FAM-AGCGGCCTCTTCAGCCGTGGTGT-BHQ1 200 PIP-F CTGGGACTTTTACACCAACAGAACT 800 PIP-R GCAGATGCCTAATTCCCGAA 800 PIP-RT GCAGATGCCTAATTCCC 75 PIP-probe FAM-TGCAAATTGCAGCCGTCGTTGATGT-BHQ1 200 GUSB-F CTCATTTGGAATTTTGCC 600 GUSB-R CGAGTGAAGATCCCCTT 600 GUSB-RT TTTGGTTGTCTCTGCCGAGT 75 GUSB-probe TXR-TGAACAGTCACCGACGAGAGTGCTGG-BHQ2 200 Name . Sequence, 5′–3′ . Concentration, nmol/L . TACSTD1-F2 TCATTTGCTCAAAGCTGGCTG 800 TACSTD1-R GGTTTTGCTCTTCTCCCAAGTTT 800 TACSTD1-RT AGCCCATCATTGTTCTG 75 TACSTD1-probe FAM-TGGTGATGAAGGCAGAAATGAATGGC-BHQ1 200 MART1-F GATGCTCACTTCATCTATGGTTACC 800 MART1-R ACTGTCAGGATGCCGATCC 800 MART1-RT GCCGATGAGCAGTAAGACT 75 MART1-probe FAM-AGCGGCCTCTTCAGCCGTGGTGT-BHQ1 200 PIP-F CTGGGACTTTTACACCAACAGAACT 800 PIP-R GCAGATGCCTAATTCCCGAA 800 PIP-RT GCAGATGCCTAATTCCC 75 PIP-probe FAM-TGCAAATTGCAGCCGTCGTTGATGT-BHQ1 200 GUSB-F CTCATTTGGAATTTTGCC 600 GUSB-R CGAGTGAAGATCCCCTT 600 GUSB-RT TTTGGTTGTCTCTGCCGAGT 75 GUSB-probe TXR-TGAACAGTCACCGACGAGAGTGCTGG-BHQ2 200 1 All primers and probes were synthesized by Integrated DNA Technologies. 2 F, forward PCR primer; R, reverse PCR primer; RT, reverse transcription primer; FAM, 5,6-carboxyfluorescein; BHQ, Black Hole Quencher; TXR, Texas Red. Figure 2. Open in new tabDownload slide Comparison of RNA recovery with the GeneXpert and the Qiagen RNeasy Minikit. (A), RNA from three representative samples after electrophoresis on an agarose gel and ethidium bromide staining (GX, GeneXpert isolation; Q, Qiagen isolation; Con, positive control spleen RNA from Ambion). (B), GeneXpert RNA yields as a percentage of the RNA recovered from a parallel Qiagen extraction. The horizontal line inside the box indicates the median yield, and the box represents the interquartile range (contains 50% of all values). The whiskers extend to the range of data observed except for outliers (•). Figure 2. Open in new tabDownload slide Comparison of RNA recovery with the GeneXpert and the Qiagen RNeasy Minikit. (A), RNA from three representative samples after electrophoresis on an agarose gel and ethidium bromide staining (GX, GeneXpert isolation; Q, Qiagen isolation; Con, positive control spleen RNA from Ambion). (B), GeneXpert RNA yields as a percentage of the RNA recovered from a parallel Qiagen extraction. The horizontal line inside the box indicates the median yield, and the box represents the interquartile range (contains 50% of all values). The whiskers extend to the range of data observed except for outliers (•). Figure 3. Open in new tabDownload slide GeneXpert QRT-PCR of lymph node tissue. Tumor metastasis to a lymph node in breast cancer (A–C), lung cancer (D–F), and melanoma (G–I). A and D, IHC staining with AE1/AE3 antibody cocktail; G, staining with MELAN-A monoclonal antibody. B, E, and H, staining with H&E. C, F, and I, relative expression values (log scale) for histologically positive nodes (red) and benign nodes (blue). For breast cancer, the mean (SD) relative expression of PIP was 550.4 (589.2) and 0.825 (0.347) in positive and benign nodes, respectively. For lung cancer, the mean relative expression of TACSTD1 was 1253.4 (1338.7) and 0.816 (0.378) in positive and benign nodes, respectively. For melanoma, the mean (SD) relative expression of MART1 was 1282.4 (1627.4) in positive nodes and was nondetectable in benign nodes (histogram columns indicate arbitrarily assigned values for visual purposes only). Figure 3. Open in new tabDownload slide GeneXpert QRT-PCR of lymph node tissue. Tumor metastasis to a lymph node in breast cancer (A–C), lung cancer (D–F), and melanoma (G–I). A and D, IHC staining with AE1/AE3 antibody cocktail; G, staining with MELAN-A monoclonal antibody. B, E, and H, staining with H&E. C, F, and I, relative expression values (log scale) for histologically positive nodes (red) and benign nodes (blue). For breast cancer, the mean (SD) relative expression of PIP was 550.4 (589.2) and 0.825 (0.347) in positive and benign nodes, respectively. For lung cancer, the mean relative expression of TACSTD1 was 1253.4 (1338.7) and 0.816 (0.378) in positive and benign nodes, respectively. For melanoma, the mean (SD) relative expression of MART1 was 1282.4 (1627.4) in positive nodes and was nondetectable in benign nodes (histogram columns indicate arbitrarily assigned values for visual purposes only). Figure 4. Open in new tabDownload slide GeneXpert QRT-PCR to detect tumor metastasis to distant organs. (A and C), H&E-stained tissue sections in a melanoma metastasis to the lung and primary lung cancer, respectively. (B and D), amplification plots of MART1 and GUS in the melanoma metastasis to the lung and primary lung cancer shown in A and C, respectively. (E), expression values for the two melanoma metastases to the lung (red), five primary NSCLCs (two adenocarcinomas and three squamous cell carcinomas; dark blue), and two samples of healthy lung (light blue). Figure 4. Open in new tabDownload slide GeneXpert QRT-PCR to detect tumor metastasis to distant organs. (A and C), H&E-stained tissue sections in a melanoma metastasis to the lung and primary lung cancer, respectively. (B and D), amplification plots of MART1 and GUS in the melanoma metastasis to the lung and primary lung cancer shown in A and C, respectively. (E), expression values for the two melanoma metastases to the lung (red), five primary NSCLCs (two adenocarcinomas and three squamous cell carcinomas; dark blue), and two samples of healthy lung (light blue). 1 Current affiliation: Department of Medicine, Mount Sinai School of Medicine, New York, NY 10029. 2 Nonstandard abbreviations: QRT-PCR, quantitative reverse transcription-PCR; H&E, hematoxylin and eosin; Ct, threshold cycle; GUS, β-glucuronidase; PIP, prolactin-inducible protein; MART1, melanoma antigen recognized by T cells 1; IHC, immunohistochemical; NSCLC, non-small cell lung cancer; and SLN, sentinel lymph node. Steven J. Hughes and Tony E. Godfrey serve as members of the scientific advisory board of Cepheid; compensations for this service include stock options. This work was supported by grant from the NIH (STTR Grant 1R42 CA099123-01). 1 Ginzinger DG, Godfrey TE, Nigro J, Moore DH, Suzuki S, Pallavicini MG, et al. Measurement of DNA copy number at microsatellite loci using quantitative PCR analysis. Cancer Res 2000 ; 60 : 5405 -5409. 2 Godfrey TE, Raja S, Finkelstein SD, Gooding WE, Kelly LA, Luketich JD. Prognostic value of quantitative reverse transcription-polymerase chain reaction in lymph node-negative esophageal cancer patients. Clin Cancer Res 2001 ; 7 : 4041 -4048. 3 Suzuki S, Moore DH, Ginzinger DG, Godfrey TE, Barclay J, Powell B, et al. An approach to analysis of large-scale correlations between genome changes and clinical endpoints in ovarian cancer. Cancer Res 2000 ; 60 : 5382 -5385. 4 Tassone F, Hagerman RJ, Taylor AK, Gane LW, Godfrey TE, Hagerman PJ. Elevated levels of FMR1 mRNA in carrier males: a new mechanism of involvement in the fragile-X syndrome. Am J Hum Genet 2000 ; 66 : 6 -15. 5 Wittwer CT, Fillmore GC, Garling DJ. Minimizing the time required for DNA amplification by efficient heat transfer to small samples. Anal Biochem 1990 ; 186 : 328 -331. 6 Wittwer CT, Garling DJ. Rapid cycle DNA amplification: time and temperature optimization. Biotechniques 1991 ; 10 : 76 -83. 7 Raja S, Luketich JD, Kelly LA, Gooding WE, Finkelstein SD, Godfrey TE. Rapid, quantitative reverse transcriptase-polymerase chain reaction: application to intraoperative molecular detection of occult metastases in esophageal cancer. J Thorac Cardiovasc Surg 2002 ; 123 : 475 -483. 8 Bergeron MG, Ke D, Menard C, Picard FJ, Gagnon M, Bernier M, et al. Rapid detection of group B streptococci in pregnant women at delivery. N Engl J Med 2000 ; 343 : 175 -179. 9 Ke D, Menard C, Picard FJ, Boissinot M, Ouellette M, Roy PH, et al. Development of conventional and real-time PCR assays for the rapid detection of group B streptococci. Clin Chem 2000 ; 46 : 324 -331. 10 Raja S, Luketich JD, Ruff DW, Kelly LA, Godfrey TE. A method for increased sensitivity of one-step, quantitative RT-PCR. Biotechniques 2000 ; 29 : 702 -705. 11 Raja S, El Hefnawy T, Kelly LA, Chestney ML, Luketich JD, Godfrey TE. Temperature-controlled primer limit for multiplexing of rapid, quantitative reverse transcription-PCR assays: application to intraoperative cancer diagnostics. Clin Chem 2002 ; 48 : 1329 -1337. 12 Godfrey TE, Kely LA. Development of quantitative RT-PCR assays for measuring gene expression. Phouthone K Grant SG eds. Molecular toxicology protocols 2004 : 415 -445 Humana Press Totowa, NJ. . 13 Godfrey TE, Kim S-H, Chavira M, Ruff DW, Warren RS, Gray JW, et al. Quantitative mRNA expression analysis from formalin-fixed, paraffin-embedded tissues using 5′ nuclease quantitative RT-PCR. J Mol Diagn 2000 ; 2 : 84 -91. 14 . Perkin-Elmer Applied Biosystems. Relative quantitation of gene expression. User bulletin #2 1997 Perkin-Elmer Applied Biosystems Foster City, CA. . 15 Xi L, Luketich JD, Raja S, Gooding WE, Litle VR, Coello MC, et al. Molecular staging of lymph nodes from patients with esophageal adenocarcinoma. Clin Cancer Res 2005 ; 11 : 1099 -1109. 16 Ferris RL, Xi L, Raja S, Hunt JL, Wang J, Gooding WE, et al. Molecular staging of cervical lymph nodes in squamous cell carcinoma of the head and neck. Cancer Res 2005;65:in press.. 17 Palmieri G, Ascierto PA, Cossu A, Mozzillo N, Motti ML, Satriano SM, et al. Detection of occult melanoma cells in paraffin-embedded histologically negative sentinel lymph nodes using a reverse transcriptase polymerase chain reaction assay. J Clin Oncol 2001 ; 19 : 1437 -1443. 18 Wrightson WR, Wong SL, Edwards MJ, Chao C, Conrad AJ, Albrecht J, et al. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of nonsentinel nodes following completion lymphadenectomy for melanoma. J Surg Res 2001 ; 98 : 47 -51. 19 Takeuchi H, Kuo C, Morton DL, Wang HJ, Hoon DS. Expression of differentiation melanoma-associated antigen genes is associated with favorable disease outcome in advanced-stage melanomas. Cancer Res 2003 ; 63 : 441 -448. 20 Kuo CT, Hoon DS, Takeuchi H, Turner R, Wang HJ, Morton DL, et al. Prediction of disease outcome in melanoma patients by molecular analysis of paraffin-embedded sentinel lymph nodes. J Clin Oncol 2003 ; 21 : 3566 -3572. 21 Davids V, Kidson SH, Hanekom GS. Accurate molecular detection of melanoma nodal metastases: an assessment of multimarker assay specificity, sensitivity, and detection rate. Mol Pathol 2003 ; 56 : 43 -51. 22 Keilholz U, Willhauck M, Rimoldi D, Brasseur F, Dummer W, Rass K, et al. Reliability of reverse transcription-polymerase chain reaction (RT-PCR)-based assays for the detection of circulating tumour cells: a quality-assurance initiative of the EORTC Melanoma Cooperative Group. Eur J Cancer 1998 ; 34 : 750 -753. 23 van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia 1999 ; 13 : 1901 -28. 24 Bolufer P, Lo CF, Grimwade D, Barragan E, Diverio D, Cassinat B, et al. Variability in the levels of PML-RAR α fusion transcripts detected by the laboratories participating in an external quality control program using several reverse transcription polymerase chain reaction protocols. Haematologica 2001 ; 86 : 570 -576. 25 Reinhold U, Berkin C, Bosserhoff AK, Deutschmann A, Garbe C, Glaser R, et al. Interlaboratory evaluation of a new reverse transcriptase polymerase chain reaction-based enzyme-linked immunosorbent assay for the detection of circulating melanoma cells: a multicenter study of the Dermatologic Cooperative Oncology Group. J Clin Oncol 2001 ; 19 : 1723 -1727. 26 Raggi CC, Pinzani P, Paradiso A, Pazzagli M, Orlando C. External quality assurance program for PCR amplification of genomic DNA: an Italian experience. Clin Chem 2003 ; 49 : 782 -791. 27 Gibbs JF, Huang PP, Zhang PJ, Kraybill WG, Cheney R. Accuracy of pathologic techniques for the diagnosis of metastatic melanoma in sentinel lymph nodes. Ann Surg Oncol 1999 ; 6 : 699 -704. 28 Tanis PJ, Boom RP, Koops HS, Faneyte IF, Peterse JL, Nieweg OE, et al. Frozen section investigation of the sentinel node in malignant melanoma and breast cancer. Ann Surg Oncol 2001 ; 8 : 222 -226. 29 Stojadinovic A, Allen PJ, Clary BM, Busam KJ, Coit DG. Value of frozen-section analysis of sentinel lymph nodes for primary cutaneous malignant melanoma. Ann Surg 2002 ; 235 : 92 -98. 30 Cochran AJ, Huang RR, Guo J, Wen DR. Current practice and future directions in pathology and laboratory evaluation of the sentinel node. Ann Surg Oncol 2001 ; 8 : 13S -17S. 31 Ke D, Picard FJ, Martineau F, Menard C, Roy PH, Ouellette M, et al. Development of a PCR assay for rapid detection of enterococci. J Clin Microbiol 1999 ; 37 : 3497 -3503. © 2005 The American Association for Clinical Chemistry This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Technology for Automated, Rapid, and Quantitative PCR or Reverse Transcription-PCR Clinical Testing
JF - Clinical Chemistry
DO - 10.1373/clinchem.2004.046474
DA - 2005-05-01
UR - https://www.deepdyve.com/lp/oxford-university-press/technology-for-automated-rapid-and-quantitative-pcr-or-reverse-2bLwDgINdU
SP - 882
VL - 51
IS - 5
DP - DeepDyve
ER -