TY - JOUR
AU1 - Wang,, Jie
AU2 - Kou,, Xiao-Lin
AU3 - Chen,, Cheng
AU4 - Wang,, Mei
AU5 - Qi,, Cui
AU6 - Wang,, Jing
AU7 - You,, Wei-Yan
AU8 - Hu,, Gang
AU9 - Chen,, Jiong
AU1 - Gao,, Jun
AB - Abstract WD repeat protein 1 (Wdr1), known as a cofactor of actin-depolymerizing factor (ADF)/cofilin, is conserved among eukaryotes, and it plays a critical role in the dynamic reorganization of the actin cytoskeleton. However, the function of Wdr1 in the central nervous system remains elusive. Using Wdr1 conditional knockout mice, we demonstrated that Wdr1 plays a significant role in regulating synaptic plasticity and memory. The knockout mice exhibited altered reversal spatial learning and fear responses. Moreover, the Wdr1 CKO mice showed significant abnormalities in spine morphology and synaptic function, including enhanced hippocampal long-term potentiation and impaired long-term depression. Furthermore, we observed that Wdr1 deficiency perturbed actin rearrangement through regulation of the ADF/cofilin activity. Taken together, these results indicate that Wdr1 in the hippocampal CA1 area plays a critical role in actin dynamics in associative learning and postsynaptic receptor availability. actin, hippocampus, learning and memory, synaptic plasticity, Wdr1 Introduction A central feature of the brain is its ability to learn from experience and adapt future behavior based on memories. Synaptic plasticity is the cellular basis of learning and memory. Rapid remodeling of the actin cytoskeleton in the postsynaptic compartment is thought to have an important function in synaptic plasticity (Lei et al. 2016). Actin is a cytoskeletal protein that is highly enriched in dendritic spines, and it plays an essential role in spine formation, morphological properties, and motility associated with synaptic modification (Matus 2000; Carlisle and Kennedy 2005; Hotulainen and Hoogenraad 2010). The actin cytoskeleton is constantly assembling and disassembling. Previous studies have shown that actin dynamics are critically involved in postsynaptic trafficking and membrane addition of AMPARs during synaptic plasticity, including long-term potentiation (LTP), a form of synaptic plasticity that is considered critical to learning and memory formation (Bramham 2008; Rust et al. 2010). In addition, actin rearrangement in the hippocampus has been clarified to play a role in memory consolidation or extinction (Fischer et al. 2004; Hou et al. 2009). Exertion of the physiological function of actin depends on remodeling, which is regulated by many proteins, including actin-depolymerizing factor (ADF)/cofilin, Arp2/3, Eps8, profilin, and myosin II and V (Carlier et al. 2015). ADF/cofilin is ubiquitously expressed in eukaryotes, directly regulates actin remodeling and is essential for growth and development; therefore, it is gradually becoming a research focus in the fields of tumor metastasis and diseases of the reproductive system, circulatory system, and nervous system (Kanellos and Frame 2016). Binding of dephosphorylated cofilin (the active form of cofilin) to filamentous actin (F-actin) results in actin severing and depolymerization, which can negatively regulate actin dynamics and synaptic plasticity (Cingolani and Goda 2008; Yuen et al. 2010). Actin-interacting protein 1 (AIP1), also known as WD repeat protein 1 (Wdr1), is conserved among eukaryotes. Many studies suggest that Wdr1 preferentially interacts with ADF/cofilin-decorated actin filaments and enhances filament disassembly but exhibits minimal effects on bare actin filaments (Okada et al. 1999; Smith et al. 2014). As a result, Wdr1 has often been regarded as a major cofactor of ADF/cofilin that only regulates ADF/cofilin activity. During the last few years, multiple genetic and cell biological studies focused on the physiological functions of the Wdr1 gene. Kile et al. (2007) identified that Wdr1 knockout in mice is lethal; however, it exhibits no obvious phenotype in yeast (Rodal et al. 1999), and depletion of Wdr1 in embryonic mouse epidermis results in a striking planar cell polarity (PCP) phenotype (Luxenburg et al. 2015). Wdr1 has been reported to play an essential role in sarcomeric actin assembly in striated muscles in C. elegans (Ono et al. 2011), Drosophila (Schnorrer et al. 2010), and mice (Yuan et al. 2014), which indicates that AIP1-dependent actin rearrangement is a conserved requirement for myofibril assembly in animals. Additionally, Wdr1 has also been suggested to play a role in blood disorders (Ono 2017), cancer progression (Lee et al. 2016; Ono 2017; Xiang et al. 2017; Yuan et al. 2018), and plant development (Ono 2017). A recent study also showed that Wdr1-regulated actin dynamics is required for the development of the outflow tract and the right ventricle (Hu et al. 2018). Overall, all the studies described above for other systems suggest that the effects of Wdr1 depend on its physical interaction with F-actin as well as its association with members of the cofilin family of actin-binding proteins. To directly explore the function of Wdr1 in synaptic plasticity, we generated hippocampal CA1-specific Wdr1 conditional knockout (CKO) mice by crossing Wdr1fl/fl mice with T29-2 Cre mice. Here, we show that Wdr1 is an important regulator of synaptic F-actin turnover and that loss of Wdr1 leads to the accumulation of synaptic F-actin content. Consistent with the physiological deficits, the Wdr1 knockout mice exhibited abnormalities in fear conditioning and spatial learning, whereas the exploratory activity of the mice appeared to be unaffected. In conclusion, Wdr1-dependent actin dynamics contributed to synaptic plasticity during learning and memory. Materials and Methods Mice The Wdr1fl/fl mice used in this study were kindly provided by the Animal Research Center (Nanjing University, China). The Tg(Camk2a-cre)T29-2Stl mice, which mediate Cre/loxP recombination predominantly in CA1 pyramidal cells, were a kind gift from Prof. Tsai L-H (Picower Institute for Learning and Memory, MIT, USA). The hippocampal CA1-specific Wdr1 CKO mice were generated by crossing the Wdr1fl/fl mice with the T29-2 Cre mice. In this study, the Wdr1fl/fl; T29-2 Cre mice were considered the hippocampal CA1-specific Wdr1 CKO mice and were named CKO; the control (Ctrl) mice were the Wdr1fl/fl mice without the Cre gene. All mouse lines were maintained in a C57BL/6 J genetic background and bred in the animal facility of Nanjing Medical University (Nanjing, Jiangsu, China). Before conducting the behavior evaluation, the animals were handled 3–5 min every day for 7 days. The mouse experiments were performed in compliance with the guidelines of the National Institutes of Health of China. Genotyping The genotype was identified via PCR using genomic DNA obtained from the toes. The primers for genotyping were as follows: Wdr1-F: GGACCTTCTAAGCAGTTACAACC Wdr1-R: TTGCACAGAGGTGAATGACAGAG T29-2-Cre-F: TGCCACGACCAAGTGACAGCAATG T29-2-Cre-R: ACCAGAGACGGAAATCCATCGCTC The program contained the following cycles: 35 cycles including denaturation for 30 s at 94°C, annealing for 30 s at 58°C, and elongation for 1 min at 72°C. The products were electrophoresed on a 1% gel at 120 V. Real-Time PCR Total RNA was extracted using TRIzol (Invitrogen), followed by reverse transcription with HiScript Q Select RT SuperMix (Vazyme, Jiangsu, China). Real-time quantitative PCR was performed using a LightCycler® 96 detection system with SYBR Green I reagents (Vazyme). The primers used in the examination were as follows: Wdr1-ss: AATGGCAAGTGCGTCATCCT Wdr1-as: CCAGATCCTTAGCTTCCCAGAGA GAPDH-ss: CTCCACTCACGGCAAATTCA GAPDH-as: GCCTCACCCCATTTGATGTT Transcript levels for each gene were normalized to GAPDH cDNA levels according to standard procedures. Data were derived from 3 independent amplifications. Cell Culture Low-density hippocampal neurons were prepared from control and Wdr1 CKO mice as previously described (Kaech and Banker 2006). In brief, the hippocampus of neonatal mice (P0) were dissociated by enzymatic digestion in 0.25% trypsin for 5 min at 37°C and triturated with a fire-polished Pasteur pipette. The dissociated cells were neutralized with fetal bovine serum (FBS)-containing medium and spun at 1000 rpm for 5 min. The cell suspension was plated in 24-well plates coated with poly-d-lysine at a density of 2.5 × 104 cells/cm2. The cultures were maintained in DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere of 5% CO2. Twenty-four hours after the initial plating, the medium was replaced with fresh NeuroBasal medium and refreshed every 3 days by replacing half of the volume of the medium with an equal volume of fresh and prewarmed NeuroBasal medium. Cytarabine was used from days in vitro (DIV) 3 to inhibit the growth of glial cells. AAV-CMV-bGi-eGFP (Shanghai Taitool Bioscience) was transfected into the cells at DIV 7–9 according to the manufacturer’s protocol; the cells were used for chemical LTP and immunocytochemistry at DIV 18-21. Chemically Induced Long-term Potentiation Chemically induced long-term potentiation (c-LTP) was induced as follows: first, the medium was replaced with an extracellular solution (ECS) (25 mM HEPES, pH 7.3; 140 mM NaCl; 5 mM KCl; 1 mM MgCl2; 1.3 mM CaCl2; 33 mM d-glucose; 0.0005 mM tetrodotoxin; 0.001 mM strychnine; and 0.05 picrotoxin), and the cells were incubated in this medium for 20 min at room temperature (RT). Next, the cells were incubated in ECS lacking MgCl2 and containing 200 μM glycine for 5 min (cells) or 15 min (brain slices). Next, the incubation solution was replaced with the control solution without glycine, and the cells were incubated for 15 min before protein detection and for 30 min before fixation for immunohistochemistry to detect synaptic vesicle-associated protein (SVP). Immunocytochemistry The cells were fixed for 15 min in 4% paraformaldehyde in phosphate-buffered saline (PBS). Permeabilization was performed for 10 min in 0.3% Triton X-100 three times. The cells were blocked for 1 h in 10% FBS (Gibco) in 0.3% PBST. Next, the cells were probed with primary antibodies against SVP (Sigma-Aldrich, 1:1000) overnight at 4°C. Goat Anti-Mouse IgG (H + L) Dylight 594 (Bioworld, 1:400) was used as the secondary antibody. Images were acquired using a confocal microscope (FV1000-D, Olympus, Tokyo, Japan). Immunohistochemistry Immunohistochemical analysis was performed as described in a previous study (Gao et al. 2010). Briefly, the mice were perfused with 4% paraformaldehyde in PBS, and the brain was dissected and placed in sucrose solution. After cryoprotection using a 30% sucrose solution, coronal hippocampal slices were prepared at 25-μm thickness using a freezing microtome (CM-1950, LEICA). The brain sections were rinsed with PBS containing 0.3% Triton X-100 (PBST) for 10 min 3 times and incubated with 10% FBS (Gibco) in 0.3% PBST for blocking at RT for 2 h. The samples were incubated with primary antibodies in 0.3% PBST at 4°C overnight. After 3 PBST rinses, the samples were incubated with Alexa-Fluor-conjugated secondary antibodies in 0.3% PBST with 4′,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma-Aldrich) at RT for 2 h. The primary antibodies included: NeuN (Milipore, 1:500), Anti-Glial Fibrillary Acidic protein (Milipore, 1:500), and SVP (Sigma-Aldrich, 1:1000). All images that were included in the analysis were scanned using the same settings, and the relative fluorescence intensities were calculated. For each genotype, at least 3 different animals were analyzed for each immunostaining experiment. G-actin and F-actin Separation G-actin and F-actin were separated via ultracentrifugation. Briefly, the hippocampus from control or CKO mice were lysed in a cold F-actin stabilization buffer (10 mM K2HPO4, 100 mM NaF, 50 mM KCl, 2 mM MgCl2, 1 mM EGTA, 0.2 mM DTT, 1% Triton X-100, and 1 mM sucrose, pH 7.0, protease inhibitor cocktail). The lysates were transferred to an ultracentrifuge and spun at 150 000 × g for 60 min to separate the globular (G)-actin (supernatant) and filamentous (F)-actin fractions (Beckman). All samples were diluted with an appropriate volume of 2 × loading buffer and boiled for 8 min. Actin was quantified via western blot analysis. Western Blot Analysis and Antibodies The hippocampus from control and CKO mice were isolated and homogenized with a lysis buffer (50 mM MOPS, 100 mM KCl, 50 mM NaF, 20 mM NaPPi, 20 mM Glycerol-P, 320 mM Sucrose, 0.2 mM DTT, 1 mM EDTA, 1 mM EGTA, 0.5 mM MgCl2, 1 mM NaVO4, and one protease inhibitor tablet (Pierce) in 10 mL). The supernatant was separated through centrifugation at 12 000 rpm for 15 min, the protein content was quantified (BCA protein assay, Thermo Scientific) at 2 μg/μL. Samples were denatured by adding 5× SDS-loading sample buffer and boiling for 8 min. Western blotting was performed as previously described (Gao et al. 2010). To detect the protein levels in the hippocampus with c-LTP, coronal hippocampal slices were prepared at 200 μm thickness using a Leica VT1000S vibratome (Leica Instruments Ltd.) in ice-cold oxygenated (95% O2/5% CO2) cutting artificial cerebrospinal fluid (ACSF) containing 75 mM sucrose, 87 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 21.4 mM NaHCO3, 0.5 mM CaCl2, 7 mM MgCl2, 1.3 mM ascorbic acid, and 20 mM d-glucose (pH 7.2–7.4). Chemical LTP was induced, and the hippocampus was dissected with surgical blades and forceps. Phospholipase inhibitors (Pierce) were added to prevent the degradation of phosphorylated protein. The following primary antibodies were used: anti-Wdr1 (Proteintech, 1:1000), Anti-GluR1 (Milipore, 1:1000), p-GluR1 (Ser381) (Milipore, 1:1000), Anti-Cofilin (Cell Signaling Technology, 1:1000), p-Cofilin (Ser3) (Cell Signaling Technology, 1:1000), GAPDH (Bioworld, 1:5000), SVP (Sigma-Aldrich, 1:1000), and Pan-actin (Cell Signaling Technology, 1:2000). The secondary antibody was HRP-linked anti-rabbit/mouse IgG antibody (Bioworld, 1:8000). The Western Lightning Gel Imaging System (Tanon 2500, Shanghai, Tianneng Technology Corporation) was used to detect the signal. The intensity of the blots was quantified using the ImageJ software. Golgi Impregnation Golgi staining was performed using the FD Rapid Golgi Stain Kit (FD Neuro Technologies); all protocols followed the manufacturer’s instructions. Golgi-Cox-stained brains were cut to 200-μm-thick cross sections using a vibratome (Leica) and analyzed using the Olympus FV1000 microscope and the Olympus software. Twenty-three images were acquired of different slices from four animals in each group. The number of spines on the apical and basal dendrites of the hippocampal CA1 pyramidal neurons was counted by a researcher who was blinded to the genotype. Electrophysiological Analysis Field electrophysiology LTP and long-term depression (LTD) in the CA3-CA1 circuit from acute 350-μm transverse hippocampal slices were recorded as previously described (Gao et al. 2010). The hippocampal slices were derived from mice that were 7–10 weeks of age. Briefly, after decapitation, the brain was removed and placed in oxygenated (95% O2/5% CO2) ACSF at 4°C. The cutting ACSF containing (in mM) 75 sucrose, 87 NaCl, 2.5 KCl, 1.25 NaH2PO4, 21.4 NaHCO3, 0.5 CaCl2, 7 MgCl2, 1.3 ascorbic acid, and 20 d-glucose (pH 7.2–7.4), and the recording ACSF containing (in mM) 119 NaCl, 2.5 KCl, 1 NaH2PO4, 26.2 NaHCO3, 2.5 CaCl2, 1.3 MgSO4, and 11 d-glucose (pH 7.2–7.4). Slices were cut using a Leica VT1000S vibratome (Leica Instruments Ltd) and were maintained at 32°C for 60 min in a holding chamber filled with oxygenated ACSF. Next, the slices were incubated at RT for at least 1 h before recording. In our experiments, 2 × TBS or HFS (50 Hz) was used to induce LTP. To generate LTD here, we prepared paired-pulse facilitation (PPF) (an interval interpulse of 50 ms, one sweep every 30 s for 6 runs) before low-frequency stimulation (LFS) which consisted of 900 pulses at 1 Hz. Baseline of the fEPSP was recorded with the stimulation intensity that evoked about 30–50% of the maximum of fEPSP, recordings were filtered at 2 kHz. The LTP and LTD magnitude were calculated from the average of the last 15 min of recording and was reported as the (%) means ± SEM of the baseline fEPSP slope. Open-field test Locomotor activity and anxiety responses of rodents were evaluated using an open-field test. The mice were individually placed in a corner of an open field (50 cm × 50 cm × 50 cm) and allowed to explore freely for 30 min. The movement of the mice was tracked via video tracking software (ANY-Maze, Stoelting). The total running distance, which reflected the locomotor activity, and the time spent in the central area of the open filed, which reflected anxiety-like behavior, were analyzed. Elevated plus maze The elevated plus maze (EPM) consisted of 2 open arms (30 cm × 7 cm) and 2 closed arms (30 cm × 7 cm × 15 cm) that extended from a common central platform (7 cm × 7 cm). The entire maze was elevated 90 cm above the floor. The number of closed-arm entries, number of open-arm entries, and the time spent on the open arms were recorded for 5 min for each animal. The percentage of open-arm entries (100 × open-arm entries/total entries) and percentage of the time spent on the open arms (100 × time spent on open arms/[time spent on open arms + time spent on closed arms]) were calculated. Morris Water Maze Test The water maze test was performed in a 1.2-m-diameter circular tank, which was filled with water (23 ± 1°C) to hide a platform (11 cm × 11 cm) in the center of the target quadrant. First, the mice were trained to swim in the tank for 45 s to get habituated to the environment, and the swim speed (cm/s) was recorded. During the next 6 subsequent days, the mice were subjected to 4 training trials per day. They were placed into the maze from 4 random points of the tank in sequence and were allowed to search for the platform within 60 s. The latency for each trial was recorded by a video camera and was analyzed using the ANY-Maze software (Stoelting). If the mice did not locate the platform within 60 s, they were manually placed on the platform for 15 s. On the seventh day, the platform was removed from the tank, and the mice were subjected to a probe trial session; the mice were allowed to swim in the tank for 60 s, and the swimming path was recorded. The time spent in every quadrant (second) was evaluated during the probe trial: T: target quadrant; O: opposite quadrant; R: adjacent right quadrant; and L: adjacent left quadrant. After the probe trial session, the platform was relocated to the opposite quadrant, and the mice were subjected to another set of 4 trials per day for 3 additional days. Reversal learning in the Morris water maze (MWM) reveals whether or not animals can extinguish their initial learning of the platform’s position and acquire a direct path to the new goal position. At the end of the reversal phase, a reversal probe trial was conducted 24 h later. Contextual Fear Condition The experimental protocol from a previously published study was slightly modified (De Oliveira Alvares et al. 2013). The animals were placed in a chamber for conditioning context A for 3 min. After habituation, they were administered 3 consecutive foot shocks of 0.75 mA lasting 2 s at 2-min intervals to form a fear-conditioned memory. The memory test was performed 24 h later by re-exposing the mice to the conditioning context A for 3 min. Next, the mice were removed from the chamber and returned to their home cages. One day later, the animals were put back into the chamber for conditioning context B following the same protocol as before. On the fourth day, all animals were returned to the same chamber for context B, and freezing was automatically recorded using the FRAMEFREEZE software (Coulbourn Instruments) for 3 min. Freezing was defined as a lack of movement except for breathing associated with a crouching posture. Statistics Analysis The data were presented as the means ± SEM. The differences between 2 groups were compared via a 2-tailed Student’s t-test. P < 0.05 was considered statistically significant. Results Wdr1-specific Knockout in the Hippocampal CA1 Area To evaluate the consequences of Wdr1 ablation in hippocampal neurons, Wdr1fl/fl; T29 mice were generated using the Cre line Tg (Camk2a-cre) T29-2Stl, in which Cre is highly expressed in the CA1 pyramidal neurons of the hippocampus. (Fig. 1A). The Wdr1fl/fl; T29 mice and Wdr1fl/fl mice were referred to as CKO and Ctrl mice, respectively. Quantitative real-time PCR showed an obvious reduction in the levels of the Wdr1 mRNA in the CKO hippocampus (Fig. 1B). The knockdown efficiency was also confirmed via western blot analysis (Fig. 1C). Here, we found there was still quite a lot of Wdr1 expression in the hippocampus (>50% in both mRNA and the protein level), which may due to the Wdr1 in the other area of the hippocampus could not be eliminated by the T29-2 Cre, such as CA3 or DG. Moreover, the possibility of Wdr1 expression in other cells cannot be excluded at present, which needs to be further studied in our future research. Immunostaining of GFAP, NeuN, and DAPI showed no cellular–morphological abnormality in the hippocampal CA1 or the DG area by the Wdr1 CKO (Fig. 1D). Figure 1. Open in new tabDownload slide Generation of hippocampal CA1-specific Wdr1 CKO mice. (A) Schematic representation of the Wdr1 gene targeting strategy. In this study, Wdr1fl/fl; T29-2 Cre mice were considered the hippocampal CA1-specific Wdr1 CKO mice and were named CKO, the control mice were Wdr1fl/fl mice without the Cre gene. (B) Real-time PCR analysis of the Wdr1 mRNA expression in control and CKO mice at 10 weeks of age. (C) Western blot analysis of the Wdr1 protein levels from the hippocampus of each genotype at 10 weeks of age. Left, representative western blot. Right, quantification of the left panel. (D) Confocal micrograph of hippocampal slices from the 10-week-old control and CKO mice (CA1 and DG region) showing GFAP (Green), NeuN (Red), DAPI (Blue), and Merge staining. Scale bar: 200μm. Data are expressed as means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. *P < 0.05, **P < 0.01. Figure 1. Open in new tabDownload slide Generation of hippocampal CA1-specific Wdr1 CKO mice. (A) Schematic representation of the Wdr1 gene targeting strategy. In this study, Wdr1fl/fl; T29-2 Cre mice were considered the hippocampal CA1-specific Wdr1 CKO mice and were named CKO, the control mice were Wdr1fl/fl mice without the Cre gene. (B) Real-time PCR analysis of the Wdr1 mRNA expression in control and CKO mice at 10 weeks of age. (C) Western blot analysis of the Wdr1 protein levels from the hippocampus of each genotype at 10 weeks of age. Left, representative western blot. Right, quantification of the left panel. (D) Confocal micrograph of hippocampal slices from the 10-week-old control and CKO mice (CA1 and DG region) showing GFAP (Green), NeuN (Red), DAPI (Blue), and Merge staining. Scale bar: 200μm. Data are expressed as means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. *P < 0.05, **P < 0.01. Wdr1 CKO Mice Exhibit Normal Locomotor or Exploratory Activity To eliminate the possibility that general neurological deficits rather than changes in hippocampal-dependent behavioral ability in Wdr1 CKO mice may contribute to altered performance on spatial and contextual memory task, we performed several general behavioral tasks. In our previous study, we noted that T29-2 Cre-mediated gene knockout is relatively specific to the CA1 area in young mice (< 3.5 months old), with the deletion of gene spreading to the cortical and other brain regions in older (4-month-old) mice (Guan et al. 2011). Therefore, we used 2- to 3.5-month-old mice to perform all behavioral tests. First, locomotion and anxiety-like behavior were assessed through an open-field task. As shown in Figure 2, in the open-field test, no significant difference was found between the control and CKO mice with respect to the total distance traveled (Fig. 2A); entries to the center (Fig. 2B); the time (Fig. 2C); or the distance (Fig. 2D) in the center of the open field. Anxiety-related behavior was examined using an EPM test. Mice were placed on a plus-shaped elevated platform in which 2 of the 4 arms had high-protective walls (closed arms), while the other 2 were open (open arms). The Wdr1 CKO mice spent a similar amount of time in the open arms as their wild-type littermates (Fig. 2E). In addition, there was no difference in the entries of the Wdr1 CKO mice crossed in the maze compared with their wild-type littermates (Fig. 2F). Overall, the results from the open-field test and EPM indicated that the locomotor activity and the anxiety level of the CKO mice were almost the same as those of the control mice. Figure 2. Open in new tabDownload slide No effect of Wdr1 deletion on the locomotor or the exploratory activity of the mice. (A–D) Open-field test analysis, there were no significant differences between control and CKO mice in locomotor or exploratory activity for the distance traveled (A); entries to the center (B); the time (C); or the distance (D) in the center of the open field. (E, F) Elevated plus maze (EPM) analysis, Both the ratio of the time (E) and the entries (F) in the open arm had no significant difference between CKO mice and control mice. The data are shown as means ± SEM. All tested mice of each genotype were at 10 weeks old. Figure 2. Open in new tabDownload slide No effect of Wdr1 deletion on the locomotor or the exploratory activity of the mice. (A–D) Open-field test analysis, there were no significant differences between control and CKO mice in locomotor or exploratory activity for the distance traveled (A); entries to the center (B); the time (C); or the distance (D) in the center of the open field. (E, F) Elevated plus maze (EPM) analysis, Both the ratio of the time (E) and the entries (F) in the open arm had no significant difference between CKO mice and control mice. The data are shown as means ± SEM. All tested mice of each genotype were at 10 weeks old. Wdr1 CKO Mice Exhibit Normal Spatial Learning and Memory but Impaired Reversal Learning in the MWM To further evaluate the integrity of hippocampus-dependent memory formation in the CKO mice, the MWM paradigm was utilized (Bannerman et al. 2014). In the MWM task, mice were placed in a pool of opaque water and were trained for 6 consecutive days to learn the location of a hidden platform using spatial cues. After the final day of training, the hidden platform was removed, and a probe test was performed. The swimming speed of the Wdr1 CKO mice was similar to that of their control littermates (Fig. 3A). The time taken to find the visible plate showed no functional deficits in the ability of the animals to visualize their surroundings (Fig. 3B). The latency for the CKO mice to find the hidden platform did not differ from that for the wild-type mice during the training period (Fig. 3C). In addition, we detected no significant difference in the amount of time spent in the target quadrant on day 7 between the Wdr1 CKO mice and their control littermates during the probe test (Fig. 3C). These findings indicated that the Wdr1 CKO mice exhibit normal hippocampus-dependent spatial learning and memory. Subsequently, a reversal task was conducted on days 8–10; the hidden platform was moved to a different quadrant (the opposite side of the original quadrant), and the latency of the mice to find the new location of the hidden platform was recorded. Over 3 days of reversal learning, the CKO mice found the hidden platform significantly more slowly than their control littermates did on day 9 and 10 (Fig. 3D). Additionally, during the reversal test on day 11, the CKO mice spent more time in the old target quadrant but less time in the new target quadrant, compared with the control mice (Fig. 3D). These findings indicated that although Wdr1 CKO in CA1 exhibited no impact on hippocampus-dependent learning and memory, reversal learning was found to be impaired when the mice needed to adjust their prior knowledge and find the new location of the hidden platform. Figure 3. Open in new tabDownload slide Deletion of Wdr1 impaired performance in the reversal task of the Morris water maze (MWM). (A, B) No significant changes were found in the swimming speed (A) and the latency to find the visible platform (B) between control and CKO mice. (C) Left, acquisition of spatial memory in the MWM, latency to escape during training phase of control and CKO mice on 6 consecutive days (3 trials per day) were recorded. Right, time spent in each of the 4 quadrants of the pool during a 1-min probe trial on day 7. Representative traces of tracking behavior during the probe trail session are showed in the middle. (D) Left, the latency of CKO mice to find the hidden platform was significantly longer than that of control mice in the reversal training trials on days 9 and 10. Right, the CKO mice had significantly higher cumulative proximity than control mice during the reversal test session on day 11. Representative traces of tracking behavior during the reversal test session are showed in the middle. T: target quadrant; O: opposite quadrant; R: adjacent right quadrant; L: adjacent left quadrant. The data are shown as means ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001. Figure 3. Open in new tabDownload slide Deletion of Wdr1 impaired performance in the reversal task of the Morris water maze (MWM). (A, B) No significant changes were found in the swimming speed (A) and the latency to find the visible platform (B) between control and CKO mice. (C) Left, acquisition of spatial memory in the MWM, latency to escape during training phase of control and CKO mice on 6 consecutive days (3 trials per day) were recorded. Right, time spent in each of the 4 quadrants of the pool during a 1-min probe trial on day 7. Representative traces of tracking behavior during the probe trail session are showed in the middle. (D) Left, the latency of CKO mice to find the hidden platform was significantly longer than that of control mice in the reversal training trials on days 9 and 10. Right, the CKO mice had significantly higher cumulative proximity than control mice during the reversal test session on day 11. Representative traces of tracking behavior during the reversal test session are showed in the middle. T: target quadrant; O: opposite quadrant; R: adjacent right quadrant; L: adjacent left quadrant. The data are shown as means ± SEM. *P < 0.05, **P < 0.01, ***P < 0.001. Wdr1 CKO Mice Exhibit Impaired Fear Associations in a Renewal Paradigm During Context-dependent Memory Tests As we know, contextual fear conditioning requires the involvement of the hippocampus (Corcoran et al. 2005). We subsequently examined the associative memory of the Wdr1 CKO mice using a previously reported context-dependent fear-conditioning protocol with slight modification (De Oliveira Alvares et al. 2013). A detailed paradigm for the context-dependent memory test is shown in Fig. 4A. Briefly, mice were trained using the Pavlovian fear-conditioning paradigm in a chamber (context A) with 3 electrical foot shocks (0.75 mA at 2-min intervals) 24 h prior to a memory test. The freezing behavior of the mice was recorded. As shown in Fig. 4B, we did not detect any difference in freezing time between the CKO and Ctrl mice on the first day of training or on the second day of the test program (Fig. 4B). However, when context A was replaced with context B on the third day and the same condition paradigm was conducted as that on the first day, the CKO mice exhibited less freezing time after the third electric shock (Fig. 4C). Moreover, the CKO mice also showed a significant reduction in freezing time compared with their control littermates on the last day of the test session (Fig. 4C). In summary, these results suggested that fear association in a renewal paradigm was impaired in the Wdr1 CKO mice. Figure 4. Open in new tabDownload slide Deletion of Wdr1 impaired fear associations in a renewal paradigm during context-dependent memory tests. (A) Paradigm for the context-dependent memory test. (B) Freezing behavior was not affected by Wdr1 deletion. Both groups showed similar levels of freezing during 3 trials and 24 h after test in context A. (C) When context A was changed to context B, freezing behavior was reduced in CKO mice compared with control mice 24 h after fear-condition training. The data are shown as the means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. ES, electric shock, *P < 0.05, **P < 0.01. Figure 4. Open in new tabDownload slide Deletion of Wdr1 impaired fear associations in a renewal paradigm during context-dependent memory tests. (A) Paradigm for the context-dependent memory test. (B) Freezing behavior was not affected by Wdr1 deletion. Both groups showed similar levels of freezing during 3 trials and 24 h after test in context A. (C) When context A was changed to context B, freezing behavior was reduced in CKO mice compared with control mice 24 h after fear-condition training. The data are shown as the means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. ES, electric shock, *P < 0.05, **P < 0.01. Wdr1 CKO Mice Exhibit Abnormal Synaptic Plasticity The impaired reversal learning in MWM and fear association in a renewal paradigm during context-dependent memory tests in the Wdr1 CKO mice prompted us to investigate whether the induction of synaptic plasticity was affected in the CKO mice. We recorded field excitatory postsynaptic potentials (fEPSPs) from CA1 pyramidal cells in acute hippocampal slices from the mice. Input–output curves were determined using measurements of the fEPSP slope in response to a series of stimulation intensities from 0.2 to 0.8 mA (0.2, 0.3, 0.4, 0.5, 0.6, 0.7, and 0.8 mA), demonstrating that the CKO mice exhibited a normal input–output relationship compared with the control mice (Fig. 5A). The synaptic efficacy was tested via PPF. The CKO mice showed a significant increase in PPF at interpulse intervals of 10 ms (P < 0.001), 20 ms (P < 0.05), and 50 ms (P < 0.01) (Fig. 5B). Next, we determined whether the Schaffer CA3-CA1 hippocampal collateral pathway exhibited any deficits in activity-dependent synaptic plasticity via evaluating LTP. LTP was induced by 2 × TBS; however, no differences were observed between the control and CKO mice (Fig. 5C). However, LTP induced by 50-Hz HFS was significantly facilitated in the Wdr1 CKO mice compared with the control mice (Fig. 5D). Another form of synaptic plasticity is LTD, which was reported to be related to memory updating (Dietz and Manahan-Vaughan 2017). We proceeded to evaluate LTD induced by LFS (1 Hz 900 pulse). As shown in Fig. 5E, LTD could not be induced in the hippocampus slices from the Wdr1 CKO mice. In summary, these results suggested that lack of Wdr1 in the hippocampal CA1 area impaired synaptic efficacy, including 50-Hz HFS-induced LTP and LFS-induced LTD. Figure 5. Open in new tabDownload slide Deletion of Wdr1 changed the synaptic transmission in the hippocampus slices of mice. (A) Input–output (I/O) curve. Each point represents the group mean value of fEPSP slopes against stimulus intensity from 0.2 to 0.8 mA in the hippocampus slices from control mice or CKO mice (N = 3, n = 9). (B) Paired-pulse facilitation (PPF) of fEPSP in the hippocampus. Paired-pulse ratio (PPR, %) of fEPSP slopes was plotted against various interpulse intervals (IPIs) ranging from 10 to 500 ms (N = 3, n = 9). (C) LTP was induced by 2× TBS in CA1 region from the CKO mice or their floxed littermates, CKO mice showed normal LTP induction and maintenance as controls (N = 3, n = 9). (D) The 50-Hz HFS-induced LTP was facilitated in CA1 region from CKO mice compared with that from the control mice. By 40 min, fEPSPs from the control mice decayed to the baseline (n = 9 slices, 108.84 ± 6.4% compared with baseline), whereas fEPSPs from CKO mice remained potentiated (n = 9 slices, 137.46 ± 10.73% compared with baseline). (E) Left, LTD induction by low-frequency stimulation (LFS, 1 Hz 900 pulse) was significantly impaired in CKO mice (N = 3, n = 9). Right, the final 15-min LTD recordings from control and CKO mice were quantified. Data are expressed as means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. *P < 0.05. Figure 5. Open in new tabDownload slide Deletion of Wdr1 changed the synaptic transmission in the hippocampus slices of mice. (A) Input–output (I/O) curve. Each point represents the group mean value of fEPSP slopes against stimulus intensity from 0.2 to 0.8 mA in the hippocampus slices from control mice or CKO mice (N = 3, n = 9). (B) Paired-pulse facilitation (PPF) of fEPSP in the hippocampus. Paired-pulse ratio (PPR, %) of fEPSP slopes was plotted against various interpulse intervals (IPIs) ranging from 10 to 500 ms (N = 3, n = 9). (C) LTP was induced by 2× TBS in CA1 region from the CKO mice or their floxed littermates, CKO mice showed normal LTP induction and maintenance as controls (N = 3, n = 9). (D) The 50-Hz HFS-induced LTP was facilitated in CA1 region from CKO mice compared with that from the control mice. By 40 min, fEPSPs from the control mice decayed to the baseline (n = 9 slices, 108.84 ± 6.4% compared with baseline), whereas fEPSPs from CKO mice remained potentiated (n = 9 slices, 137.46 ± 10.73% compared with baseline). (E) Left, LTD induction by low-frequency stimulation (LFS, 1 Hz 900 pulse) was significantly impaired in CKO mice (N = 3, n = 9). Right, the final 15-min LTD recordings from control and CKO mice were quantified. Data are expressed as means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. *P < 0.05. Wdr1 CKO Mice Exhibit Increased Synaptic and Dendritic Spine Density The synapse is widely assumed to be the cellular site for learning and memory (Martin et al. 2000). We therefore assessed whether Wdr1 regulates the density of dendritic spines and synapse numbers. The density of hippocampal CA1 apical dendrites along individual neurons were increased in the CKO mice compared with that in the control mice (Fig. 6A). In addition, we cultured hippocampal neurons from postnatal day 0 (P0) from control or CKO mice and applied AAV-GFP (Green) at DIV 7–9. The cells were fixed for immunostaining with SVP (red) to observe the SVP density at DIV 18–21. SVP in the synapses of the CKO mice was obviously more than that of the control mice (Fig. 6B). Consistently, we performed immunostaining of SVP and DAPI in the hippocampal CA1 area in control and CKO mice. Upon visualizing the density of SVP, we found that total density of SVP was increased in the hippocampal CA1 area from the CKO mice (Fig. 6C); quantitative analysis of the fluorescence intensity of SVP is also shown in Figure 6C. All of these results were in agreement with our slice electrophysiological analysis, which demonstrated that CKO mice showed long-term facilitation in 50-Hz HFS-induced LTP (Fig. 5D). Collectively, increased spine density and excitatory synapses may indicate abnormal learning and memory in CKO mice. Figure 6. Open in new tabDownload slide Increases in spine density of hippocampal CA1 apical dendrites and number of excitatory synapses in the CA1 region of CKO mice. (A) Representative images of golgi impregnation on CA1 region of control and CKO mice. Scale bar: 10μm. Quantification of spine density from multiple animals is displayed as means ± SEM (N = 4, n = 23). (B) Confocal images showing the cultured hippocampal pyramidal neurons of 18–21 days in vitro expressing AAV-GFP (Green), neurons were immunostained against SVP (Red). Scale bar: 20μm. Dendritic regions enclosed by white boxes were shown in a higher magnification. Scale bar: 50μm. (C) Representative immunofluorescence staining of SVP (Red) and DAPI (Blue) in CA1 from control and CKO mice at 10 weeks. Scale bar: 50μm. Quantitative analysis of fluorescence intensity of SVP in panel. Data are expressed as means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001. Figure 6. Open in new tabDownload slide Increases in spine density of hippocampal CA1 apical dendrites and number of excitatory synapses in the CA1 region of CKO mice. (A) Representative images of golgi impregnation on CA1 region of control and CKO mice. Scale bar: 10μm. Quantification of spine density from multiple animals is displayed as means ± SEM (N = 4, n = 23). (B) Confocal images showing the cultured hippocampal pyramidal neurons of 18–21 days in vitro expressing AAV-GFP (Green), neurons were immunostained against SVP (Red). Scale bar: 20μm. Dendritic regions enclosed by white boxes were shown in a higher magnification. Scale bar: 50μm. (C) Representative immunofluorescence staining of SVP (Red) and DAPI (Blue) in CA1 from control and CKO mice at 10 weeks. Scale bar: 50μm. Quantitative analysis of fluorescence intensity of SVP in panel. Data are expressed as means ± SEM, and the P-value was analyzed by a 2-tailed Student’s t-test. *P < 0.05, **P < 0.01, ***P < 0.001. Wdr1 CKO Mice Exhibit Impairment of Actin Rearrangement Recently, Wdr1-mediated actin dynamics has been reported to play an indispensable role in the normal development of the outflow tract and right ventricle (Hu et al. 2018). Actin is highly enriched in dendritic spines and provides the structural foundation for spine formation, morphological properties, and motility associated with synaptic modification (Matus 2000; Carlisle and Kennedy 2005; Hotulainen and Hoogenraad 2010). Therefore, we first detected the F/G actin ratio in the control and CKO mice via western blot analysis. As shown in Figure 7A, the CKO mice processed a higher ratio of F/G actin than the control mice, which indicated that Wdr1 deletion could cause F-actin accumulation and disrupt the sarcomeric structure. LTP is accompanied by increased spine density and cytoskeleton remodeling, and c-LTP is a widely used cellular model of plasticity. Here, we used glycine to induce LTP in cultured hippocampal neurons, as previously reported (Fortin et al. 2010). Interestingly, after c-LTP was induced, a significantly higher expression of SVP was observed in cultured hippocampal neurons of the control mice but not in that of the CKO mice (Fig. 7B). Previous studies have shown that Wdr1 is involved in the process of ADF/cofilin-mediated actin disassembly (Yuan et al. 2018). ADF/cofilin promotes actin disassembly by severing actin filaments and dissociating actin monomers from filaments, and its significant role in actin cytoskeletal remodeling have been demonstrated in various cell types across eukaryotes (Ono 2017; Hu et al. 2018; Yuan et al. 2018). Next, we evaluated whether ADF/cofilin was affected in our CKO mice via western blot analysis. As shown in Fig. 7C, the expression level of cofilin was significantly increased, while the level of phospho-cofilin/cofilin was decreased in hippocampus slices from the CKO mice. We also observed an increase in phospho-cofilin/cofilin after glycine-induced LTP in both Ctrl and CKO mice. ADF/cofilin-mediated actin dynamics has been known to regulate AMPA-receptor trafficking during synaptic plasticity (Wang et al. 2013). Subsequently, a significant increase in phospho-GluR1/GluR1 was detected in the control hippocampus slices that had been subjected to c-LTP induction, while no change was observed in c-LTP-induced hippocampal slices from the CKO mice; however, a higher expression level of phospho-GluR1/GluR1 was observed for CKO mouse hippocampal slices without glycine treatment (Fig. 7D). These data suggest that Wdr1-mediated actin dynamics also play an important role during c-LTP through regulation of ADF/cofilin activity, which is required for AMPAR insertion during c-LTP. Figure 7. Open in new tabDownload slide Deletion of Wdr1 in CA1 area leaded to the impairment of actin rearrangement. (A) Left, representative immunoblots of pan-actin to detect G-actin and F-actin in the hippocampus from the control and CKO mice. Right, the optical density of F-actin/G-actin ratio is displayed as means ± SEM. (B) Confocal images showing the cultured hippocampal pyramidal neurons of 18–21 days in vitro expressing AAV-GFP (Green), neurons were immunostained against SVP (Red), merge channels were shown, chemical LTP was induced by glycine (200uM) in DIV 18–21. Scale bar: 20μm. (C) Left, representative sample of a western blot of hippocampal extracts with or without glycine treatment, using antibodies that recognize p-Cofilin (Ser3), total Cofilin, and GAPDH. Right, relative quantification of p-Cofilin/Cofilin ratio was shown, this experiment had been independently repeated three times. (D) Left, the hippocampal slices’ extracts were prepared with or without chemical LTP induced and were analyzed for GluR1 phosphorylation by immunoblotting. Right, relative quantification of p-GluR1/GluR1 ratio of each group was shown, this experiment had been independently repeated 3 times. The P-value was analyzed by a 2-tailed Student’s t-test. Data are expressed as means ± SEM. *P < 0.05, #P < 0.05, **P < 0.01, NS, no significant difference. Figure 7. Open in new tabDownload slide Deletion of Wdr1 in CA1 area leaded to the impairment of actin rearrangement. (A) Left, representative immunoblots of pan-actin to detect G-actin and F-actin in the hippocampus from the control and CKO mice. Right, the optical density of F-actin/G-actin ratio is displayed as means ± SEM. (B) Confocal images showing the cultured hippocampal pyramidal neurons of 18–21 days in vitro expressing AAV-GFP (Green), neurons were immunostained against SVP (Red), merge channels were shown, chemical LTP was induced by glycine (200uM) in DIV 18–21. Scale bar: 20μm. (C) Left, representative sample of a western blot of hippocampal extracts with or without glycine treatment, using antibodies that recognize p-Cofilin (Ser3), total Cofilin, and GAPDH. Right, relative quantification of p-Cofilin/Cofilin ratio was shown, this experiment had been independently repeated three times. (D) Left, the hippocampal slices’ extracts were prepared with or without chemical LTP induced and were analyzed for GluR1 phosphorylation by immunoblotting. Right, relative quantification of p-GluR1/GluR1 ratio of each group was shown, this experiment had been independently repeated 3 times. The P-value was analyzed by a 2-tailed Student’s t-test. Data are expressed as means ± SEM. *P < 0.05, #P < 0.05, **P < 0.01, NS, no significant difference. Discussion Mechanisms of actin dynamics have been well studied during the last few years. The actin cytoskeleton is constantly assembling and disassembling; at the biochemical level, fast actin depolymerization is necessary to replenish the pool of polymerizable actin monomer that is used to rapidly assemble actin filaments and needed for various cellular processes (Pontrello et al. 2012). The actin cytoskeleton is critically involved in the regulation of the dendritic spine and synaptic properties, it has been reported that reduced synaptic F-actin content, an immature spine profile, can impair LTP (Zhou et al. 2009). ADF/cofilin has been reported to modulate the actin cytoskeleton all the time (Sarmiere and Bamburg 2004). Many studies have shown that ADF/cofilin inactivation is required for spine enlargement and stabilization during LTP, while ADF/cofilin activation can drive F-actin disassembly and spine shrinkage during LTD (Rust 2015). In addition, dephosphorylated (active) ADF/cofilin rapidly moves into dendritic spines during the initial phase of structural LTP, resulting in a strong and persistent synaptic enrichment which is required for spine enlargement (Bosch et al. 2014). However, the severing of cofilin-mediated actin filaments alone cannot account for the actin disassembly dynamics detected in cells (Brieher 2013). Various auxiliary factors have been identified that augment cofilin function, including Wdr1, coronin, and CAP (Ono 2007). The importance of these factors in actin turnover dynamics has been demonstrated in multiple organisms (Ono 2007). In this study, we focused on Wdr1, which has been widely reported to participate in the promotion of cofilin-mediated actin filament disassembly in other systems (Ono 2017; Hu et al. 2018; Yuan et al. 2018). At presynaptic terminals, assembly and disassembly of F-actin (termed actin dynamics) are temporally coordinated with synaptic activity, suggesting that F-actin is relevant for neurotransmission (Sankaranarayanan et al. 2003). All the above observations suggest the likely involvement of the Wdr1 gene in synaptic plasticity and memory. The present study further examined if synaptic plasticity and memory are maintained when Wdr1 is eliminated only in the excitatory neurons of the hippocampal CA1 area. Utilizing the Cre-loxp system, we generated mice with reduced postdevelopmental expression of Wdr1 in the hippocampal CA1 area. As expected, we observed a significantly higher ratio of F/G actin level in Wdr1 CKO mice. Additionally, changes were also detected in the expression level of phospho-cofilin (inactive form of cofilin)/cofilin and phospho-GluR1/GluR1. Thus, Wdr1 may play a similar role in the central nervous system as previously reported, and it must be involved in learning and memory. Memory encoding, consolidation, and retrieval of episodic memories are all related to the function of the hippocampus (Bannerman et al. 2014). The ability to update associative memory is an important aspect of episodic memory and is a critical skill for social adaptation. Memory updating refers to new learning of old information that has been previously encountered (Nashiro et al. 2013). Reversal learning tasks and fear-conditioning tests are often used to study memory updating (De Oliveira Alvares et al. 2013; Gajardo et al. 2018). In our study, although Wdr1 CKO mice displayed normal initial learning and memory, they did display impaired reversal learning via the MWM test and impaired fear associations in a renewal paradigm during the context-dependent memory test. An important candidate for the molecular basis of learning and memory is LTD, which may function to weaken previous memory traces and is involved in the processing and acquisition of new information (Ji and Maren 2007; Collingridge et al. 2010). Updating of spatial memory provoked by the spatial reconfiguration of familiar cues can enable LTD in the hippocampal CA1 area (Dietz and Manahan-Vaughan 2017). Consistent with these results, we observed that LTD induced by LFS (1 Hz) was impaired in the CKO mice. Overall, deletion of Wdr1 in the hippocampal CA1 area promotes changes in LTD mechanisms that impact the related behavior. Dendritic spines are actin-rich protrusions from the dendritic shaft, which are highly dynamic structures that receive the vast majority of excitatory synaptic input within the brain (Bellot et al. 2014). They are key structures in learning and memory formation and are widely located on hippocampal pyramidal neurons (Bourne and Harris 2008). It is well established that LTP is another candidate cellular model for learning and memory, which has been clarified to be related to changed spine structure and increased spine density, accompanied by recruitment of additional GluR1-containing AMPA receptors (AMPARs) (Carlisle and Kennedy 2005; Bourne and Harris 2008; Lamkin and Heiman 2017). Our electrophysiological analysis data revealed that CKO mice showed normal LTP induced by a 2 × TBS protocol. Because the mechanism of LTP induction differs with different stimulation protocols, we also tested LTP induction using HFS. Hernandez et al. (2005) demonstrated a linear relationship between the number of pulses applied during stimulation and the intensity of LTP induction, regardless of TBS or HFS. Thus, we chose 50-Hz HFS to avoid inducing saturated LTP. Interestingly, LTP induced by 50-Hz HFS was significantly more facilitated in Wdr1 CKO mice. Indeed, the density of hippocampal CA1 apical dendrites along individual neurons were increased in CKO mice compared with that in control mice. Additionally, CKO mice also exhibited a higher SVP level in cultured mature hippocampal neurons. Together, our findings suggested that increased synaptic and dendritic spine density may result in the facilitated LTP induced by 50-Hz HFS. Glycine-induced LTP has been considered to be a synapse-specific form of chemical LTP; we also used glycine to induce LTP in hippocampus slices or cultured hippocampal neurons. When c-LTP was induced, more cofilin moves into dendritic spines, and this translocation is required for actin polymerization and spine enlargement (Bosch et al. 2014). Moreover, cofilin-dependent actin dynamics control the synaptic accumulation of AMPAR during LTP (Gu et al. 2010). Thereafter, during consolidation of structural changes, cofilin becomes phosphorylated (inactivated) and accumulates in the spine head. As previously reported, the expression level of phospho-GluR1/GluR1 was significantly increased after c-LTP in control mice (Fortin et al. 2010) but not in our Wdr1 CKO mice. Similar results were detected in the SVP density of cultured hippocampus neurons. Unexpectedly, the expression level of cofilin was significantly increased, while the level of phospho-cofilin/cofilin was decreased in hippocampus slices from the CKO mice. We considered the following explanation for this result: Wdr1 is a major cofactor of ADF/cofilin in enhancing filament disassembly, and upon its elimination via the Cre gene, the body needs to produce more cofilin to sever the actin filaments and dissociate actin monomers from the filaments; consistently, a relatively lower expression of phospho-cofilin (inactive form of cofilin) is also needed. These results indicate that Wdr1-mediated actin dynamics may be involved in c-LTP through regulation of ADF/cofilin activity, which is required for AMPARs recruitment. Nevertheless, we could not exclude the possibility that NMDARs also play an important role in this process, especially in LTD. A previous study has identified NMDAR-mediated dendritic spine and synapse plasticity through spatial control over cofilin activation (Pontrello et al. 2012). We also detected a higher expression level of NR2B in the hippocampus synaptosomal fraction from CKO mice (date not shown). Generally, our data shown here, together with earlier findings, strongly support the critical function of the actin cytoskeleton in restricting the diffusion of postsynaptic receptors, possibly through collision of the receptors with F-actin or via directly tethering the receptors. In conclusion, our data support that actin-binding proteins represent a tool box for neurons to introduce specificity in actin-guided synaptic transmission. The deletion of Wdr1 changed the ability of actin to control spine shape and AMPAR mobility, impaired the induction of LTP and LTD in CA3-CA1 synapses, and regulated learning and memory updating. In human beings, alterations in cofilin activity are thought to contribute to mental disorders (Bamburg and Wiggan 2002), and deletion of the cofilin regulator LIMK-1 has been linked to Williams’ syndrome (Frangiskakis et al. 1996). These observations indicate that changes in the actin dynamics regulated by Wdr1 may have a crucial clinical function, such as in the clinical treatment of Alzheimer’s disease, posttraumatic stress disorder or other degenerative mental sickness. Authors’ Contributions Jun Gao and Jiong Chen designed and supervised the project. Jie Wang and Xiao-Lin Kou performed most experimental work and drafted the initial manuscript. Mei Wang and Cui Qi cultured primary hippocampal neurons. Cheng Chen contributed histochemistry experiments. Jing Wang and Wei-Yan You performed the behaviors tests. Jiong Chen provided Wdr1fl/fl mice. Jun Gao and Jiong Chen wrote/edited the manuscript. Gang Hu provided technical assistance and conceptual input throughout. All authors provided critical feedback and approved the final manuscript. Funding This work was financially supported by grants from the National Basic Research Program of China (2013CB835100 to Jun Gao), the National Natural Science Foundation of China (81222013 and 81673416 to Jun Gao, and 31171335 and 31271488 to Jiong Chen) and the Key R&D Program of Jiangsu Province (BE2016761, 2017CX010) to Jun Gao, the Natural Science Foundation of the Jiangsu Higher Education institutions of China (18KJB180017) to Wei-Yan You, and the Foundation of Nanjing Medical University (KY101NJMUZD15015) to Jing Wang. Notes The authors thank Dr Li-Huei Tsai for providing the T29-2 mice. Conflict of Interests: The authors declare that they have no competing financial interests. References Bamburg JR , Wiggan OP . 2002 . ADF/cofilin and actin dynamics in disease . Trends Cell Biol . 12 : 598 – 605 . Google Scholar Crossref Search ADS PubMed WorldCat Bannerman DM , Sprengel R , Sanderson DJ , McHugh SB , Rawlins JN , Monyer H , Seeburg PH . 2014 . Hippocampal synaptic plasticity, spatial memory and anxiety . Nat Rev Neurosci . 15 : 181 – 192 . Google Scholar Crossref Search ADS PubMed WorldCat Bellot A , Guivernau B , Tajes M , Bosch-Morato M , Valls-Comamala V , Munoz FJ . 2014 . The structure and function of actin cytoskeleton in mature glutamatergic dendritic spines . Brain Res . 1573 : 1 – 16 . Google Scholar Crossref Search ADS PubMed WorldCat Bosch M , Castro J , Saneyoshi T , Matsuno H , Sur M , Hayashi Y . 2014 . Structural and molecular remodeling of dendritic spine substructures during long-term potentiation . Neuron . 82 : 444 – 459 . Google Scholar Crossref Search ADS PubMed WorldCat Bourne JN , Harris KM . 2008 . Balancing structure and function at hippocampal dendritic spines . Annu Rev Neurosci . 31 : 47 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat Bramham CR . 2008 . Local protein synthesis, actin dynamics, and LTP consolidation . Curr Opin Neurobiol . 18 : 524 – 531 . Google Scholar Crossref Search ADS PubMed WorldCat Brieher W . 2013 . Mechanisms of actin disassembly . Mol Biol Cell . 24 : 2299 – 2302 . Google Scholar Crossref Search ADS PubMed WorldCat Carlier MF , Pernier J , Montaville P , Shekhar S , Kuhn S , Grp CDM . 2015 . Control of polarized assembly of actin filaments in cell motility . Cell Mol Life Sci . 72 : 3051 – 3067 . Google Scholar Crossref Search ADS PubMed WorldCat Carlisle HJ , Kennedy MB . 2005 . Spine architecture and synaptic plasticity . Trends Neurosci . 28 : 182 – 187 . Google Scholar Crossref Search ADS PubMed WorldCat Cingolani LA , Goda Y . 2008 . Actin in action: the interplay between the actin cytoskeleton and synaptic efficacy . Nat Rev Neurosci . 9 : 344 – 356 . Google Scholar Crossref Search ADS PubMed WorldCat Collingridge GL , Peineau S , Howland JG , Wang YT . 2010 . Long-term depression in the CNS . Nat Rev Neurosci . 11 : 459 – 473 . Google Scholar Crossref Search ADS PubMed WorldCat Corcoran KA , Desmond TJ , Frey KA , Maren S . 2005 . Hippocampal inactivation disrupts the acquisition and contextual encoding of fear extinction . J Neurosci . 25 : 8978 – 8987 . Google Scholar Crossref Search ADS PubMed WorldCat De Oliveira Alvares L , Crestani AP , Cassini LF , Haubrich J , Santana F , Quillfeldt JA . 2013 . Reactivation enables memory updating, precision-keeping and strengthening: exploring the possible biological roles of reconsolidation . Neuroscience . 244 : 42 – 48 . Google Scholar Crossref Search ADS PubMed WorldCat Dietz B , Manahan-Vaughan D . 2017 . Hippocampal long-term depression is facilitated by the acquisition and updating of memory of spatial auditory content and requires mGlu5 activation . Neuropharmacology . 115 : 30 – 41 . Google Scholar Crossref Search ADS PubMed WorldCat Fischer A , Sananbenesi F , Schrick C , Spiess J , Radulovic J . 2004 . Distinct roles of hippocampal de novo protein synthesis and actin rearrangement in extinction of contextual fear . J Neurosci . 24 : 1962 – 1966 . Google Scholar Crossref Search ADS PubMed WorldCat Fortin DA , Davare MA , Srivastava T , Brady JD , Nygaard S , Derkach VA , Soderling TR . 2010 . Long-term potentiation-dependent spine enlargement requires synaptic Ca2+-permeable AMPA receptors recruited by CaM-kinase I . J Neurosci . 30 : 11565 – 11575 . Google Scholar Crossref Search ADS PubMed WorldCat Frangiskakis JM , Ewart AK , Morris CA , Mervis CB , Bertrand J , Robinson BF , Klein BP , Ensing GJ , Everett LA , Green ED , et al. 1996 . LIM-kinase1 hemizygosity implicated in impaired visuospatial constructive cognition . Cell . 86 : 59 – 69 . Google Scholar Crossref Search ADS PubMed WorldCat Gajardo I , Salazar CS , Lopez-Espindola D , Estay C , Flores-Munoz C , Elgueta C , Gonzalez-Jamett AM , Martinez AD , Munoz P , Ardiles AO . 2018 . Lack of pannexin 1 alters synaptic GluN2 subunit composition and spatial reversal learning in mice . Front Mol Neurosci . 11 : 114 . Google Scholar Crossref Search ADS PubMed WorldCat Gao J , Wang WY , Mao YW , Graff J , Guan JS , Pan L , Mak G , Kim D , Su SC , Tsai LH . 2010 . A novel pathway regulates memory and plasticity via SIRT1 and miR-134 . Nature . 466 : 1105 – 1109 . Google Scholar Crossref Search ADS PubMed WorldCat Gu J , Lee CW , Fan Y , Komlos D , Tang X , Sun C , Yu K , Hartzell HC , Chen G , Bamburg JR , et al. 2010 . ADF/cofilin-mediated actin dynamics regulate AMPA receptor trafficking during synaptic plasticity . Nat Neurosci . 13 : 1208 – 1215 . Google Scholar Crossref Search ADS PubMed WorldCat Guan JS , Su SC , Gao J , Joseph N , Xie ZG , Zhou Y , Durak O , Zhang L , Zhu JJ , Clauser KR , et al. 2011 . Cdk5 is required for memory function and hippocampal plasticity via the cAMP signaling pathway . PLoS One . 6 : e25735 . Google Scholar Crossref Search ADS PubMed WorldCat Hernandez RV , Navarro MM , Rodriguez WA , Martinez JL Jr. , LeBaron RG . 2005 . Differences in the magnitude of long-term potentiation produced by theta burst and high frequency stimulation protocols matched in stimulus number . Brain Res Brain Res Protoc . 15 : 6 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat Hotulainen P , Hoogenraad CC . 2010 . Actin in dendritic spines: connecting dynamics to function . J Cell Biol . 189 : 619 – 629 . Google Scholar Crossref Search ADS PubMed WorldCat Hou YY , Lu B , Li M , Liu Y , Chen J , Chi ZQ , Liu JG . 2009 . Involvement of actin rearrangements within the amygdala and the dorsal hippocampus in aversive memories of drug withdrawal in acute morphine-dependent rats . J Neurosci . 29 : 12244 – 12254 . Google Scholar Crossref Search ADS PubMed WorldCat Hu JS , Shi YC , Xia M , Liu ZY , Zhang RR , Luo HM , Zhang TC , Yang ZZ , Yuan BY . 2018 . WDR1-regulated actin dynamics is required for outflow tract and right ventricle development . Dev Biol . 438 : 124 – 137 . Google Scholar Crossref Search ADS PubMed WorldCat Ji J , Maren S . 2007 . Hippocampal involvement in contextual modulation of fear extinction . Hippocampus . 17 : 749 – 758 . Google Scholar Crossref Search ADS PubMed WorldCat Kaech S , Banker G . 2006 . Culturing hippocampal neurons . Nat Protoc . 1 : 2406 – 2415 . Google Scholar Crossref Search ADS PubMed WorldCat Kanellos G , Frame MC . 2016 . Cellular functions of the ADF/cofilin family at a glance . J Cell Sci . 129 : 3211 – 3218 . Google Scholar Crossref Search ADS PubMed WorldCat Kile BT , Panopoulos AD , Stirzaker RA , Hacking DF , Tahtamouni LH , Willson TA , Mielke LA , Henley KJ , Zhang JG , Wicks IP , et al. 2007 . Mutations in the cofilin partner Aip1/Wdr1 cause autoinflammatory disease and macrothrombocytopenia . Blood . 110 : 2371 – 2380 . Google Scholar Crossref Search ADS PubMed WorldCat Lamkin ER , Heiman MG . 2017 . Coordinated morphogenesis of neurons and glia . Curr Opin Neurobiol . 47 : 58 – 64 . Google Scholar Crossref Search ADS PubMed WorldCat Lee JH , Kim JE , Kim BG , Han HH , Kang S , Cho NH . 2016 . STAT3-induced WDR1 overexpression promotes breast cancer cell migration . Cell Signal . 28 : 1753 – 1760 . Google Scholar Crossref Search ADS PubMed WorldCat Lei W , Omotade OF , Myers KR , Zheng JQ . 2016 . Actin cytoskeleton in dendritic spine development and plasticity . Curr Opin Neurobiol . 39 : 86 – 92 . Google Scholar Crossref Search ADS PubMed WorldCat Luxenburg C , Heller E , Pasolli HA , Chai S , Nikolova M , Stokes N , Fuchs E . 2015 . Wdr1-mediated cell shape dynamics and cortical tension are essential for epidermal planar cell polarity . Nat Cell Biol . 17 : 592 – U139 . Google Scholar Crossref Search ADS PubMed WorldCat Martin SJ , Grimwood PD , Morris RG . 2000 . Synaptic plasticity and memory: an evaluation of the hypothesis . Annu Rev Neurosci . 23 : 649 – 711 . Google Scholar Crossref Search ADS PubMed WorldCat Matus A . 2000 . Actin-based plasticity in dendritic spines . Science . 290 : 754 – 758 . Google Scholar Crossref Search ADS PubMed WorldCat Nashiro K , Sakaki M , Nga L , Mather M . 2013 . Age-related similarities and differences in brain activity underlying reversal learning . Front Integr Neurosci . 7 : 37 . Google Scholar Crossref Search ADS PubMed WorldCat Okada K , Obinata T , Abe H . 1999 . XAIP1: a Xenopus homologue of yeast actin interacting protein 1 (AIP1), which induces disassembly of actin filaments cooperatively with ADF cofilin family proteins . J Cell Sci . 112 : 1553 – 1565 . Google Scholar PubMed WorldCat Ono S . 2007 . Mechanism of depolymerization and severing of actin filaments and its significance in cytoskeletal dynamics . Int Rev Cytol . 258 : 1 – 82 . Google Scholar Crossref Search ADS PubMed WorldCat Ono S . 2017 . Functions of actin-interacting protein 1 (AIP1)/WD repeat protein 1 (WDR1) in actin filament dynamics and cytoskeletal regulation . Biochem Biophys Res Commun . 506 : 315 – 322 . Google Scholar Crossref Search ADS PubMed WorldCat Ono S , Nomura K , Hitosugi S , Tu DK , Lee JA , Baillie DL , Ono K . 2011 . The two actin-interacting protein 1 genes have overlapping and essential function for embryonic development in Caenorhabditis elegans . Mol Biol Cell . 22 : 2258 – 2269 . Google Scholar Crossref Search ADS PubMed WorldCat Pontrello CG , Sun MY , Lin A , Fiacco TA , DeFea KA , Ethell IM . 2012 . Cofilin under control of beta-arrestin-2 in NMDA-dependent dendritic spine plasticity, long-term depression (LTD), and learning . Proc Natl Acad Sci U S A . 109 : E442 – E451 . Google Scholar Crossref Search ADS PubMed WorldCat Rodal AA , Tetreault JW , Lappalainen P , Drubin DG , Amberg DC . 1999 . Aip1p interacts with cofilin to disassemble actin filaments . J Cell Biol . 145 : 1251 – 1264 . Google Scholar Crossref Search ADS PubMed WorldCat Rust MB . 2015 . ADF/cofilin: a crucial regulator of synapse physiology and behavior . Cell Mol Life Sci . 72 : 3521 – 3529 . Google Scholar Crossref Search ADS PubMed WorldCat Rust MB , Gurniak CB , Renner M , Vara H , Morando L , Gorlich A , Sassoe-Pognetto M , Banchaabouchi MA , Giustetto M , Triller A , et al. 2010 . Learning, AMPA receptor mobility and synaptic plasticity depend on n-cofilin-mediated actin dynamics . EMBO J . 29 : 1889 – 1902 . Google Scholar Crossref Search ADS PubMed WorldCat Sankaranarayanan S , Atluri PP , Ryan TA . 2003 . Actin has a molecular scaffolding, not propulsive, role in presynaptic function . Nat Neurosci . 6 : 127 – 135 . Google Scholar Crossref Search ADS PubMed WorldCat Sarmiere PD , Bamburg JR . 2004 . Regulation of the neuronal actin cytoskeleton by ADF/cofilin . J Neurobiol . 58 : 103 – 117 . Google Scholar Crossref Search ADS PubMed WorldCat Schnorrer F , Schonbauer C , Langer CC , Dietzl G , Novatchkova M , Schernhuber K , Fellner M , Azaryan A , Radolf M , Stark A , et al. 2010 . Systematic genetic analysis of muscle morphogenesis and function in Drosophila . Nature . 464 : 287 – 291 . Google Scholar Crossref Search ADS PubMed WorldCat Smith BA , Gelles J , Goode BL . 2014 . Single-molecule studies of actin assembly and disassembly factors . Methods Enzymol . 540 : 95 – 117 . Google Scholar Crossref Search ADS PubMed WorldCat Wang Y , Dong Q , Xu XF , Feng X , Xin J , Wang DD , Yu H , Tian T , Chen ZY . 2013 . Phosphorylation of cofilin regulates extinction of conditioned aversive memory via AMPAR trafficking . J Neurosci . 33 : 6423 – 6433 . Google Scholar Crossref Search ADS PubMed WorldCat Xiang Y , Liao XH , Yao A , Qin H , Fan LJ , Li JP , Hu P , Li H , Guo W , Li JY , et al. 2017 . MRTF-A-miR-206-WDR1 form feedback loop to regulate breast cancer cell migration . Exp Cell Res . 359 : 394 – 404 . Google Scholar Crossref Search ADS PubMed WorldCat Yuan B , Wan P , Chu D , Nie J , Cao Y , Luo W , Lu S , Chen J , Yang Z . 2014 . A cardiomyocyte-specific Wdr1 knockout demonstrates essential functional roles for actin disassembly during myocardial growth and maintenance in mice . Am J Pathol . 184 : 1967 – 1980 . Google Scholar Crossref Search ADS PubMed WorldCat Yuan B , Zhang R , Hu J , Liu Z , Yang C , Zhang T , Zhang C . 2018 . WDR1 promotes cell growth and migration and contributes to malignant phenotypes of non-small cell lung cancer through ADF/cofilin-mediated actin dynamics . Int J Biol Sci . 14 : 1067 – 1080 . Google Scholar Crossref Search ADS PubMed WorldCat Yuen EY , Liu WH , Kafri T , van Praag H , Yan Z . 2010 . Regulation of AMPA receptor channels and synaptic plasticity by cofilin phosphatase Slingshot in cortical neurons . J Physiol Lond . 588 : 2361 – 2371 . Google Scholar Crossref Search ADS PubMed WorldCat Zhou Z , Meng Y , Asrar S , Todorovski Z , Jia Z . 2009 . A critical role of Rho-kinase ROCK2 in the regulation of spine and synaptic function . Neuropharmacology . 56 : 81 – 89 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Jie Wang and Xiao-Lin Kou contributed equally to this work © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Hippocampal Wdr1 Deficit Impairs Learning and Memory by Perturbing F-actin Depolymerization in Mice
JF - Cerebral Cortex
DO - 10.1093/cercor/bhy301
DA - 2019-09-13
UR - https://www.deepdyve.com/lp/oxford-university-press/hippocampal-wdr1-deficit-impairs-learning-and-memory-by-perturbing-f-2S6XvbA1lc
SP - 4194
VL - 29
IS - 10
DP - DeepDyve
ER -