TY - JOUR
AU1 - Devant, M.
AU2 - Penner, G. B.
AU3 - Marti, S.
AU4 - Quintana, B.
AU5 - Fábregas, F.
AU6 - Bach, A.
AU7 - Arís, A.
AB - ABSTRACT Twenty-four individually housed Holstein bulls (395 ± 7.3 kg BW and 252 ± 3.1 d age) were exposed to a 2 × 2 factorial design (meal vs. pellets; with vs. without straw) to evaluate the effect of concentrate form and provision of straw in finishing diets on behavior and expression of rumen and cecum epithelium genes related to inflammation and behavior. Concentrate and straw consumption were recorded monthly and behavior (self-grooming, social, oral nonnutritive, tongue rolling, eating, drinking, ruminating, and lying) was recorded every two weeks. Bulls were slaughtered after 64 d of exposure to treatments, lesions on the rumen and liver were assessed, and samples of the rumen and cecum were collected. Straw supplementation tended (P = 0.08) to increase concentrate intake (8.0 vs. 7.4 ± 0.26 kg/d), increased (P < 0.01) the proportion of time ruminating (9.4 vs. 3.1 ± 1.02%), and decreased (P < 0.01) the occurrence of oral nonnutritive behaviors (0.52 vs. 1.34 ± 0.123 times/15 min) relative to bulls deprived of straw. Provision of straw increased ruminal pH, but the magnitude of the change was greater when the concentrate was provided as meal compared with pellets (interaction, P < 0.05). When straw was not supplemented, all rumen samples had papillae fusion, whereas only 16.7% of bulls fed pellets and straw had papillae fusions (interaction, P < 0.05). Vacuole grading of the rumen papillae was less (P < 0.01) in bulls provided straw compared with bulls without straw. For the ruminal epithelium, straw provision tended to increase the relative expression ratio of free fatty acid receptor 2 (which stimulates peptide YY, PYY, and serotonin secretion; P = 0.06) and α-2C adrenergic receptor (which modulates immune reactions and behavior; P = 0.09) and increased occludin and claudin-4 (tight junction proteins; P < 0.05), along with il-1β and tnfα (proinflammatory cytokines; P < 0.01) and toll-like receptor-4 (P < 0.01) in the rumen. Moreover, it also tended to increase the relative gene expression ratio of β-defensin1 (an antimicrobial peptide; P = 0.10) and intestinal alkaline phosphatase (P = 0.10). Bulls fed pellets had a decreased ruminal relative expression ratio of α-2C adrenergic receptor (P < 0.05). Bulls without straw had increased (P < 0.05) the cecum relative expression ratio of il-1β. In conclusion, the lack of straw supplementation in bulls fed high-concentrate diets modifies behavior and affects rumen macroscopic morphology and expression of epithelial genes that could be related to behavior and inflammation. INTRODUCTION There is a consensus among researchers that the assessment of animal welfare is dependent on animal-based measures (Velarde and Dalmau, 2012). For finishing beef cattle, the most common behaviors indicative of poor welfare are aggressive behavior and abnormal oral nonnutritive behaviors (Gonyou, 1994). In rodents, behavioral responses related to anxiety, stress, and depression are affected when the commensal intestinal microbiota has been altered (Foster and McVey Neufeld, 2013; Borre et al., 2014; Carabotti et al., 2015). Potential crosstalk mechanisms described in nonruminant animals between the gut microbiota and the brain include the production and regulation of neurotransmitters, intestinal barrier integrity, modulation of enteric sensory afferents, bacterial metabolites, and mucosal immune regulation (Borre et al., 2014; Carabotti et al., 2015). In ruminants, previous short-term experiments have indicated that nutrition affects some crosstalk mechanisms including rumen inflammation and barrier function (Penner et al., 2011; Dionissopoulos et al., 2012; Liu et al., 2015). Other studies have reported that nutrition affects nonnutritive behaviors in beef animals fed high-concentrate diets (Redbo and Nordblad, 1997; Faleiro et al., 2011). However, the linkage between diet characteristics changes in potential mechanisms involved in crosstalk and behavioral responses have not been evaluated for beef cattle. The hypothesis was that the provision of straw and concentrate presentation form would affect ruminal fermentation (Xiong et al., 1991; Faleiro et al., 2011; Castrillo et al., 2013) and, in turn, the potential crosstalk mechanisms in the epithelium affecting behavior. Therefore, the objectives of the present study were to evaluate the effects of straw provision and concentrate presentation form on behavior, rumen macro- and microscopic changes, and expression of genes potentially related to the gut–brain crosstalk in the rumen and cecum of finishing bulls. MATERIALS AND METHODS Animals, Diets, and Housing Bulls were cared for following the principles and specific guidelines of the Institut de Recerca i Tecnologia Agroalimentàries Animal Care Committee. Twenty-four Holstein bulls (395 ± 7.3 kg BW and 252 ± 3.1 d old) were kept in individual partially slatted pens (1.9 by 3.4 m) at the experimental station of the Cooperativa Agraria de Guissona (Guissona, Spain), and pens were randomly assigned to 1 of 4 treatments. Treatments were arranged in a 2 × 2 factorial design with the main effects of concentrate presentation form (meal vs. pellets) and whether straw was included (without vs. with straw provision). Both experimental concentrates had the same ingredient composition (35.4% corn, 18.7% barley, 8.0% wheat, 8.4% wheat middlings, 15.0% corn gluten feed, 5.9% beet pulp, 2.7% soybean meal [47% CP], 3.2% palm oil, 1.2% calcium carbonate, 0.6% sodium bicarbonate, 0.2% vitamin/mineral premix, 0.4% urea, and 0.2% white salt, all on an as-fed basis) and nutrient composition was the same in both concentrates (88.6% DM, 5.3% ash, 14.2% CP, 19.7% NDF, 6.3% ether extract, 54.5% nonfiber carbohydrates, and 3.4 Mcal of ME/kg, on a DM basis), and both experimental concentrates were formulated to meet Fundación Española para el Desarrollo de la Nutrición Animal (Ferret et al., 2008) recommendations and differed in the concentrate physical form of presentation. The dietary ingredients were ground through a hammer mill with screen openings of 2.75 mm, except for corn (6-mm screen openings), for the meal presentation. Granulometry was assessed as the weight of the different fractions and expressed as a percentage of total sample weight [(g of fraction/g of total sample) × 100]. Granulometry results indicated that 1.7% of the particles were >4 mm, 2.3% were between 4 and 3.35 mm, 5.3% were between 3.35 and 2.5 mm, 5.1% were between 2.5 and 2 mm, 5.5% were between 2 and 1.7 mm, 40.3% were between 1.7 and 1 mm, 28.6% were between 1 and 0.5 mm, 7.1% were between 0.5 and 0.3 mm, and 4.1% were less than 0.3 mm. In the case of the pellets, the mixed mash was steam conditioned at 80°C with a 0.5-min retention time and then pelleted. The pellet mill was equipped with a die ring (3.5 mm diameter holes and 70 mm thickness). The corresponding pellet exit temperatures were within ±10°C relative to the conditioning temperature. The pellet die knife was set at 10 mm from the die face. The pellets were pneumatically transferred to a cyclone cooler with a retention time of 20 min. The pellets were screened on a 2-screen rotex (Rotex, Rotex USA, Cincinnati, OH). The manufactured pellets had a uniform diameter (3.5 mm) and length (10 mm). Barley straw (3.5% CP, 1.6% ether extract, 76.9% NDF, and 6.1% ash, on a DM basis) and concentrate were fed in separate troughs (0.6 by 1.2 by 0.3 m) for ad libitum intake until 64 d of the experiment, when animals reached a target final BW of approximately 495 kg. Before the study started and during a period of 111 d, bulls were allocated in groups and were fed their corresponding treatment diets. The study started after this period of 111 d; animals were individually allocated to allow individual recording of intake and behavior. Measurements and Sample Collection Concentrate and straw offer was recorded daily, orts were recorded monthly at 0730 h (0, 28, and 54 d of study), and behavior was recorded every 14 d (0, 14, 28, 42, and 54 d of study. Animal behavior was recorded from 0830 to 1100 h as described elsewhere (Mach et al., 2009; Marti et al., 2010) to verify that the evaluated dietary treatments had an effect on the main behavior outcomes (rumination and nonnutritional oral behaviors). Eight pens were observed at the same time. Whereas oral nonnutritive and social behavior (Table 1) were scored during a continuous sampling period of 15 min and records corresponded to total counts of each activity per animal based on Mounier et al. (2005), general activities (standing, lying, eating concentrate and straw, drinking, and ruminating; Table 1) were scored using scan samplings of 1 s at 5-min intervals (Mach et al., 2009) during 15 min. The scan sampling method can be used to record a behavior exhibited by an animal at a fixed time interval (Colgan, 1978). This recording procedure (15 min) was repeated twice during the morning, and the sequence in which pens were observed was randomly chosen within day to avoid the effect of time relative to feeding. As previously mentioned, before the study started, animals were fed the same dietary treatments, and during this adaptation period, the animal behavior procedures were evaluated to confirm if this short behavior period (2 periods of 15 min) was enough to detect differences among these extreme dietary treatments. Two observers were involved in behavior recording, and the observers were trained using live observations to avoid ambiguous data observations; detailed behavior description (Table 1) are explained. To determine interobserver reliability, 2 observers simultaneously recorded behavior for 2-h live observation of 8 bulls; observers were unable to see the recording sheets of each other. Interobserver reliability was assessed by correlations among observer's records. Table 1. Description of the behavioral categories and general activities recorded Item  Definition  Self-grooming  Defined as nonstereotyped licking of its own body or scratching with a hind limb or against the fixtures  Social  When a bull was licking or nosing a neighboring bull with the muzzle or social horning defined as a head play (animals rubbing their heads together)  Oral nonnutritive  The act of licking or biting the fixtures  Tongue rolling  Swinging of the tongue outside the mouth, from one side to the other, or repetitively rolling the tongue  Eating  Eating (concentrate or straw) was defined as when the animal had its head into the feeder and was engaged in chewing. An observation was defined as eating when the bull was eating from the feed bunk with its muzzle in the feed bunk or chewing or swallowing food with its head over the bunk.  Drinking  Drinking was recorded when the animal had its mouth in the water bowl. An observation was recorded as drinking when the bull was with its muzzle in the water bowl or swallowing the water.  Ruminating  Ruminating, included the regurgitation, mastication, and swallowing of the bolus  Lying  Lying was recorded as soon as the animal was not standing on its 4 legs, independently of any activity the animal might perform.  Standing  Standing was recorded when the animal was standing on its 4 legs, independently of any activity the animal might perform.  Item  Definition  Self-grooming  Defined as nonstereotyped licking of its own body or scratching with a hind limb or against the fixtures  Social  When a bull was licking or nosing a neighboring bull with the muzzle or social horning defined as a head play (animals rubbing their heads together)  Oral nonnutritive  The act of licking or biting the fixtures  Tongue rolling  Swinging of the tongue outside the mouth, from one side to the other, or repetitively rolling the tongue  Eating  Eating (concentrate or straw) was defined as when the animal had its head into the feeder and was engaged in chewing. An observation was defined as eating when the bull was eating from the feed bunk with its muzzle in the feed bunk or chewing or swallowing food with its head over the bunk.  Drinking  Drinking was recorded when the animal had its mouth in the water bowl. An observation was recorded as drinking when the bull was with its muzzle in the water bowl or swallowing the water.  Ruminating  Ruminating, included the regurgitation, mastication, and swallowing of the bolus  Lying  Lying was recorded as soon as the animal was not standing on its 4 legs, independently of any activity the animal might perform.  Standing  Standing was recorded when the animal was standing on its 4 legs, independently of any activity the animal might perform.  View Large Table 1. Description of the behavioral categories and general activities recorded Item  Definition  Self-grooming  Defined as nonstereotyped licking of its own body or scratching with a hind limb or against the fixtures  Social  When a bull was licking or nosing a neighboring bull with the muzzle or social horning defined as a head play (animals rubbing their heads together)  Oral nonnutritive  The act of licking or biting the fixtures  Tongue rolling  Swinging of the tongue outside the mouth, from one side to the other, or repetitively rolling the tongue  Eating  Eating (concentrate or straw) was defined as when the animal had its head into the feeder and was engaged in chewing. An observation was defined as eating when the bull was eating from the feed bunk with its muzzle in the feed bunk or chewing or swallowing food with its head over the bunk.  Drinking  Drinking was recorded when the animal had its mouth in the water bowl. An observation was recorded as drinking when the bull was with its muzzle in the water bowl or swallowing the water.  Ruminating  Ruminating, included the regurgitation, mastication, and swallowing of the bolus  Lying  Lying was recorded as soon as the animal was not standing on its 4 legs, independently of any activity the animal might perform.  Standing  Standing was recorded when the animal was standing on its 4 legs, independently of any activity the animal might perform.  Item  Definition  Self-grooming  Defined as nonstereotyped licking of its own body or scratching with a hind limb or against the fixtures  Social  When a bull was licking or nosing a neighboring bull with the muzzle or social horning defined as a head play (animals rubbing their heads together)  Oral nonnutritive  The act of licking or biting the fixtures  Tongue rolling  Swinging of the tongue outside the mouth, from one side to the other, or repetitively rolling the tongue  Eating  Eating (concentrate or straw) was defined as when the animal had its head into the feeder and was engaged in chewing. An observation was defined as eating when the bull was eating from the feed bunk with its muzzle in the feed bunk or chewing or swallowing food with its head over the bunk.  Drinking  Drinking was recorded when the animal had its mouth in the water bowl. An observation was recorded as drinking when the bull was with its muzzle in the water bowl or swallowing the water.  Ruminating  Ruminating, included the regurgitation, mastication, and swallowing of the bolus  Lying  Lying was recorded as soon as the animal was not standing on its 4 legs, independently of any activity the animal might perform.  Standing  Standing was recorded when the animal was standing on its 4 legs, independently of any activity the animal might perform.  View Large Fecal and bloat scoring were recorded at d 14, 28, 42, and 54 of the study. Fecal scoring was based on Heinrichs et al. (2003), where “1” was normal; “2” was soft to loose; “3” was loose to watery; “4” was watery, mucousy, and slightly bloody; and “5” was watery, mucousy, and bloody. Bloat scoring was determined according to the following description scale as defined by Johnson et al. (1958), where “0” was no bloat (no distension in left paralumbar fossa), “1” was slight (a slight distension in left paralumbar fossa; “puffy”), “2” was mild (marked distension in left paralumbar fossa; well rounded out), “3” was moderate (well rounded out on left side and drum-like; full on right side; restless), “4” was severe (both sides badly distended; left hip nearly hidden; skin tight; defecation; urination; incoordination; protruding anus; mild respiratory distress), and “5” was terminal (extreme abdominal distension; severe respiratory distress; cyanosis; prostration; death unless treated). On d 64 of the study, bulls were transported to a commercial slaughterhouse (Guissona, Barcelona, Spain) by truck. Transport distance was less than 1 km. Immediately following slaughter, a ruminal liquid sample obtained from homogeneous rumen content strained with a cheesecloth and a cecal content sample were collected and pH was measured using a portable pH meter (model 507; Crisson Instruments SA, Barcelona, Spain). Based on Jounay (1982), 4 mL of ruminal and cecal fluid were mixed with 1 mL of a solution containing 0.2% (wt/wt) mercuric chloride, 2% (wt/wt) orthophosphoric acid, and 4-methylvaleric acid (internal standard) in distilled water and stored at −20°C until subsequent VFA analysis. The entire ruminal epithelium was examined and the presence of clumped papillae (Nocek et al., 1984), ulcers, hair presence, and parakeratosis (presence and location) were recorded. Also, rumens were classified from 1 to 5 depending on the color, with “5” indicative of a black-colored rumen and “1” indicative of a white-colored rumen (González et al., 2001). Presence of cecal wall petechiae and cecal wall color (0 = white-pink, 1 = light pink, 2 = pink, and 3 = dark pink) were also recorded. Liver abscesses were graded following Brown et al. (1975). Additionally, 1-cm2 sections of the ruminal (from the right side of the cranial ventral sac and from the left side of the caudal dorsal sac) and cecal epithelia from the end of the cecum were sampled, washed with a 0.9% (wt/vol) NaCl solution, and preserved in a 10% formalin solution until subsequent histological analyses. Another 1-cm2 section of each rumen site and the cecum were sampled and were rinsed 2 times with chilled PBS after sampling and immediately incubated in RNAlater (Invitrogen, Madrid, Spain) to preserve the RNA integrity. After 24 h of incubation with RNAlater at 4°C, the liquid was removed and the tissue was frozen at −80°C until further RNA extraction and subsequent gene expression analysis. Biological and Chemical Analyses Samples of feed were analyzed for DM (24 h at 103°C; method number 925.04; AOAC, 1995), ash (4 h at 550°C; method number 642.05; AOAC, 1995), CP by the Kjeldahl method (method number 988.05; AOAC, 1995), NDF according to Van Soest et al. (1991) using sodium sulfite and α-amylase, and fat using a Soxhlet apparatus after an acid hydrolysis preparation (method number 920.39; AOAC, 1995). Ruminal and cecal VFA concentration were analyzed with a semicapillary column (15 m by 0.53 mm i.d., 0.5-μm film thickness, TRB-FFAP; Teknokroma, Barcelona, Spain) composed of 100% polyethylene glycol esterified with nitroterephtalic acid, bonded and crosslinked phase (method number 5560; Eaton et al., 2005) using a CP-3800-GC (Varian, Inc., Walnut Creek, CA). For the histological analysis of ruminal papillae and cecal epithelia, tissue samples were dehydrated and embedded in paraffin wax, sectioned at 4 μm, and stained with hematoxylin and eosin. Morphometric measurements were performed with a light microscope (BHS; Olympus, Barcelona, Spain) using a linear ocular micrometer (Olympus, Microplanet, Barcelona, Spain) with 2x and 20x magnification. For ruminal samples, well-orientated papillae length and width, number of papillae, and keratin layer thickness were measured on a 1-cm section. All morphometric measurements were performed by the same person. Mean papillae density, papillae width, and papillae length were used to calculate papillae surface area following the methods of Hill et al. (2005). Based on Nocek et al. (1984), a scale of 1 to 5 was used to characterize the tissue with “1” being an unvacuolated cytoplasm, particularly in the stratum granulosum, and “5” being an epithelium with highly vacuolated stratum granulosum. Gradations “2” to “4” were gradations of the 2 extremes. In the cecum samples, crypt depth, number of goblet cells, number of intraepithelial lymphocytes, and number of mitosis were measured in a 1-cm section. For gene expression analyses, total RNA was extracted from rumen wall tissues using Trizol (Invitrogen). One microgram of RNA was reverse transcribed to cDNA using an IScript cDNA synthesis kit (Bio-Rad Laboratories, Madrid, Spain) following the manufacturer's instructions. The RNA purity was assessed by a NanoDrop instrument (ThermoFisher, Madrid, Spain) at 260, 280, and 230 nm, obtaining 260:280 nm ratios between 1.9 and 2.0 and 260:230 nm ratios between 2.0 and 2.2. Genes analyzed in the rumen and cecum epithelia were chosen based on the human literature (Carabotti et al., 2015), which indicates that the gut–brain crosstalk may take place through production, expression, and turnover of neurotransmitters (Evans et al., 2013; Holzer and Farzi, 2014; Sudo, 2014); protection of intestinal barrier and tight junction integrity (Alonso et al., 2014); modulation of enteric sensory afferents (de Jonge, 2013); bacterial metabolites (Evans et al., 2013); and mucosal immune regulation. The quantification of expression of genes coding for 1) the tight-junction proteins occludin and claudin-4; 2) genes coding the production, expression, and turnover of neurotransmitters: free fatty acid receptor 2 (gpr43) and free fatty acid receptor 3 (gpr41), ppyr1 (pancreatic polypeptide receptor 1; actual name neuropeptide Y receptor Y4 [NPY4R]), dopamine receptor subtype A1 (dopamine D1 receptor, also known as D(1A) dopamine receptor), and α 2-adrenergic receptor subtype A, α 2-adrenergic receptor subtype B, and α 2-adrenergic receptor subtype C (adra2a, adra2b, and adra2c, respectively); 3) genes encoding proinflammatory cytokines genes il-1β and tnfα or anti-inflammatory gene il-6 (anti-inflammatory) and genes coding pattern recognition receptors, such as Toll-like receptors trl4 and trl2 and antimicrobial peptides released by intestinal cells, defensin, intestinal alkaline phosphatase, and lactoferrin, were performed by quantitative PCR (qPCR) using β-actin (actb) as a housekeeping gene. The qPCR conditions for each set of primers were individually optimized (Table 2). The specificity of the amplification was evaluated by single band identification at the expected molecular weight in 0.8% DNA agarose gels and a single peak in the melting curve. The efficiency was calculated by amplifying serial 1:10 dilutions of each gene amplicon. A standard curve of crossing point (Cq) versus the logarithm of the concentration was plotted to obtain the efficiency, which was calculated using the formula 101/slope, with an acceptable range of 1.8 to 2.2. A total reaction volume of 20 μL was used, containing 50 ng of cDNA, 10 μL of SYBR green fluorescent (Bio-Rad Laboratories, Madrid, Spain), and the optimized primer concentration for each gene (Table 2). The qPCR reactions were cycled as follows: an initial denaturing step of 10 min at 95°C followed by 40 cycles of 10 s at 95°C, 15 s at optimized annealing temperature for each gene, 30 s at 72°C, and a final extension of 10 min at 72°C. The resulting Cq values were used to calculate the relative expression of selected genes by relative quantification using a reference gene (housekeeping gene) and a calibrator (Pfaffl, 2004, Eq. [3.5]). A sample corresponding to an animal fed without straw provision and fed meal was randomly chosen as the calibrator (Pfaffl, 2004, Eq. [3.5]). Table 2. Sequence, annealing temperature (At), efficiency (%), concentration (μM), and amplicon size (bp) of the primers used for quantitative PCR Gene  Forward primer  Reverse primer  At, °C  Efficiency, %  Concentration, μM  Amplicon size, bp  ffar3  AAAGCAGCAGTGGCCATGA  GAGGTTTAGCAAGAGCACGTCC  57  1.98  0.25  182  ffar2  CGCTCCTTAATTTCCTGCTG  CAAAGGACCTGCGTACGACT  52  2.03  0.5  173  drd5  GGCTGCCCTTCTTCATCCTT  TCAAAGGTGGTCTCGCTGAC  55  2.06  0.5  87  adra2a  TCATCTCGGCCGTCATCTCCTT  CGCACATAGACCAGGATCATGAT  55  2.13  0.5  177  adra2b  TTGCTGGGCTACTGGTACTTC  TACCAGGCCTCTTGGTTGAGCT  56  1.72  0.25  295  adra2c  TGCGCGCCCCGCAGAACCTCTTCCT  ATGCAGGAGGACAGGATGTACCA  59  1.97  0.5  403  ppyr1  TGAGGCCATCCCCATTTGTC  CTCAGACTCCTCCACAGGGA  57  2.22  0.25  174  occludin  ATCAACCCCGGTGCCGGAAG  GTGGTCTTGCTCTGCCCGCC  57  1.82  0.5  162  claudin-4  CATGATCGTGGCCGGCGTG  AGGGCTTGTCGTTGCGGG  62  1.82  0.125  226  il-1β  tGGGAGATGGAAACATCCAG  TTTATTGACTGCACGGGTGC  50  1.82  0.3125  232  tnfα  aACAGCCCTCTGGTTCAAAC  TCTTGATGGCAGACAGGATG  60  1.89  0.5  296  il-6  GGGCTCCCATGATTGTGGTA  GTGTGCCCAGTGGACAGGTT  52  1.86  0.5  69  tlr4  TCAGAAACCTCCGCTACCTTG  TTCTGAAAAGAGTTGCCTGCC  55  1.91  0.5  117  tlr2  ACGACGCCTTTGTGTCCTAC  CCGAAAGCACAAAGATGGTT  53  1.98  0.5  191  defensin-β  gGTCACAAGTGGCAGAGGAT  TGGTTGAAGAACTTCAGGGC  60  2.01  0.25  152  biap  AACTGAGGAGGCACGGTTTC  CTGTGTCGCTGTCTCCTCTC  60  2.18  0.5  205  lactoferrin  TGAAAGGGGAAGCAGATG  AAGTCCTCACGATTCAAGTT  50  1.98  0.5  552  actb  CTGGACTTCGAGCAGGAGAT-  CCCGTCAGGAAGCTCGTAG-  57  1.82  0.125  75  Gene  Forward primer  Reverse primer  At, °C  Efficiency, %  Concentration, μM  Amplicon size, bp  ffar3  AAAGCAGCAGTGGCCATGA  GAGGTTTAGCAAGAGCACGTCC  57  1.98  0.25  182  ffar2  CGCTCCTTAATTTCCTGCTG  CAAAGGACCTGCGTACGACT  52  2.03  0.5  173  drd5  GGCTGCCCTTCTTCATCCTT  TCAAAGGTGGTCTCGCTGAC  55  2.06  0.5  87  adra2a  TCATCTCGGCCGTCATCTCCTT  CGCACATAGACCAGGATCATGAT  55  2.13  0.5  177  adra2b  TTGCTGGGCTACTGGTACTTC  TACCAGGCCTCTTGGTTGAGCT  56  1.72  0.25  295  adra2c  TGCGCGCCCCGCAGAACCTCTTCCT  ATGCAGGAGGACAGGATGTACCA  59  1.97  0.5  403  ppyr1  TGAGGCCATCCCCATTTGTC  CTCAGACTCCTCCACAGGGA  57  2.22  0.25  174  occludin  ATCAACCCCGGTGCCGGAAG  GTGGTCTTGCTCTGCCCGCC  57  1.82  0.5  162  claudin-4  CATGATCGTGGCCGGCGTG  AGGGCTTGTCGTTGCGGG  62  1.82  0.125  226  il-1β  tGGGAGATGGAAACATCCAG  TTTATTGACTGCACGGGTGC  50  1.82  0.3125  232  tnfα  aACAGCCCTCTGGTTCAAAC  TCTTGATGGCAGACAGGATG  60  1.89  0.5  296  il-6  GGGCTCCCATGATTGTGGTA  GTGTGCCCAGTGGACAGGTT  52  1.86  0.5  69  tlr4  TCAGAAACCTCCGCTACCTTG  TTCTGAAAAGAGTTGCCTGCC  55  1.91  0.5  117  tlr2  ACGACGCCTTTGTGTCCTAC  CCGAAAGCACAAAGATGGTT  53  1.98  0.5  191  defensin-β  gGTCACAAGTGGCAGAGGAT  TGGTTGAAGAACTTCAGGGC  60  2.01  0.25  152  biap  AACTGAGGAGGCACGGTTTC  CTGTGTCGCTGTCTCCTCTC  60  2.18  0.5  205  lactoferrin  TGAAAGGGGAAGCAGATG  AAGTCCTCACGATTCAAGTT  50  1.98  0.5  552  actb  CTGGACTTCGAGCAGGAGAT-  CCCGTCAGGAAGCTCGTAG-  57  1.82  0.125  75  View Large Table 2. Sequence, annealing temperature (At), efficiency (%), concentration (μM), and amplicon size (bp) of the primers used for quantitative PCR Gene  Forward primer  Reverse primer  At, °C  Efficiency, %  Concentration, μM  Amplicon size, bp  ffar3  AAAGCAGCAGTGGCCATGA  GAGGTTTAGCAAGAGCACGTCC  57  1.98  0.25  182  ffar2  CGCTCCTTAATTTCCTGCTG  CAAAGGACCTGCGTACGACT  52  2.03  0.5  173  drd5  GGCTGCCCTTCTTCATCCTT  TCAAAGGTGGTCTCGCTGAC  55  2.06  0.5  87  adra2a  TCATCTCGGCCGTCATCTCCTT  CGCACATAGACCAGGATCATGAT  55  2.13  0.5  177  adra2b  TTGCTGGGCTACTGGTACTTC  TACCAGGCCTCTTGGTTGAGCT  56  1.72  0.25  295  adra2c  TGCGCGCCCCGCAGAACCTCTTCCT  ATGCAGGAGGACAGGATGTACCA  59  1.97  0.5  403  ppyr1  TGAGGCCATCCCCATTTGTC  CTCAGACTCCTCCACAGGGA  57  2.22  0.25  174  occludin  ATCAACCCCGGTGCCGGAAG  GTGGTCTTGCTCTGCCCGCC  57  1.82  0.5  162  claudin-4  CATGATCGTGGCCGGCGTG  AGGGCTTGTCGTTGCGGG  62  1.82  0.125  226  il-1β  tGGGAGATGGAAACATCCAG  TTTATTGACTGCACGGGTGC  50  1.82  0.3125  232  tnfα  aACAGCCCTCTGGTTCAAAC  TCTTGATGGCAGACAGGATG  60  1.89  0.5  296  il-6  GGGCTCCCATGATTGTGGTA  GTGTGCCCAGTGGACAGGTT  52  1.86  0.5  69  tlr4  TCAGAAACCTCCGCTACCTTG  TTCTGAAAAGAGTTGCCTGCC  55  1.91  0.5  117  tlr2  ACGACGCCTTTGTGTCCTAC  CCGAAAGCACAAAGATGGTT  53  1.98  0.5  191  defensin-β  gGTCACAAGTGGCAGAGGAT  TGGTTGAAGAACTTCAGGGC  60  2.01  0.25  152  biap  AACTGAGGAGGCACGGTTTC  CTGTGTCGCTGTCTCCTCTC  60  2.18  0.5  205  lactoferrin  TGAAAGGGGAAGCAGATG  AAGTCCTCACGATTCAAGTT  50  1.98  0.5  552  actb  CTGGACTTCGAGCAGGAGAT-  CCCGTCAGGAAGCTCGTAG-  57  1.82  0.125  75  Gene  Forward primer  Reverse primer  At, °C  Efficiency, %  Concentration, μM  Amplicon size, bp  ffar3  AAAGCAGCAGTGGCCATGA  GAGGTTTAGCAAGAGCACGTCC  57  1.98  0.25  182  ffar2  CGCTCCTTAATTTCCTGCTG  CAAAGGACCTGCGTACGACT  52  2.03  0.5  173  drd5  GGCTGCCCTTCTTCATCCTT  TCAAAGGTGGTCTCGCTGAC  55  2.06  0.5  87  adra2a  TCATCTCGGCCGTCATCTCCTT  CGCACATAGACCAGGATCATGAT  55  2.13  0.5  177  adra2b  TTGCTGGGCTACTGGTACTTC  TACCAGGCCTCTTGGTTGAGCT  56  1.72  0.25  295  adra2c  TGCGCGCCCCGCAGAACCTCTTCCT  ATGCAGGAGGACAGGATGTACCA  59  1.97  0.5  403  ppyr1  TGAGGCCATCCCCATTTGTC  CTCAGACTCCTCCACAGGGA  57  2.22  0.25  174  occludin  ATCAACCCCGGTGCCGGAAG  GTGGTCTTGCTCTGCCCGCC  57  1.82  0.5  162  claudin-4  CATGATCGTGGCCGGCGTG  AGGGCTTGTCGTTGCGGG  62  1.82  0.125  226  il-1β  tGGGAGATGGAAACATCCAG  TTTATTGACTGCACGGGTGC  50  1.82  0.3125  232  tnfα  aACAGCCCTCTGGTTCAAAC  TCTTGATGGCAGACAGGATG  60  1.89  0.5  296  il-6  GGGCTCCCATGATTGTGGTA  GTGTGCCCAGTGGACAGGTT  52  1.86  0.5  69  tlr4  TCAGAAACCTCCGCTACCTTG  TTCTGAAAAGAGTTGCCTGCC  55  1.91  0.5  117  tlr2  ACGACGCCTTTGTGTCCTAC  CCGAAAGCACAAAGATGGTT  53  1.98  0.5  191  defensin-β  gGTCACAAGTGGCAGAGGAT  TGGTTGAAGAACTTCAGGGC  60  2.01  0.25  152  biap  AACTGAGGAGGCACGGTTTC  CTGTGTCGCTGTCTCCTCTC  60  2.18  0.5  205  lactoferrin  TGAAAGGGGAAGCAGATG  AAGTCCTCACGATTCAAGTT  50  1.98  0.5  552  actb  CTGGACTTCGAGCAGGAGAT-  CCCGTCAGGAAGCTCGTAG-  57  1.82  0.125  75  View Large Calculations and Statistical Analysis Scan samples of general behaviors were multiplied by 5 and the duration (a total of 30 min of observation) of each behavior was converted to a percentage of the total time observed (Mitlöhner et al., 2001), and lastly, these percentages were transformed to the root of percentage plus 1 to achieve a normal distribution. The frequency (number of occurrences) of each social behavior indicator was obtained by summing by day, pen, and scan and was then transformed into the root of the sum of each activity plus 1 to achieve a normal distribution. Gene expression data were transformed into natural logarithms to achieve a normal distribution. Normality of the data prior to ANOVA was evaluated by a frequency histogram distribution and a Shapiro–Wilk test. The means of behavior and gene expression data presented in the tables correspond to back-transformed data, and SEM correspond to the ANOVA SEM values of the transformed data. Performance and behavior data were analyzed using a mixed-effects model with repeated measures (SAS Inst. Inc., Cary, NC) for a completely randomized design with a 2 × 2 arrangement of treatments. The model included initial BW as a covariate; effects of straw provision, concentrate presentation form, the interaction between these factors, time (14-d period or monthly records), and the interactions between main factors and time as fixed effects; and animal as a random effect. Time was considered a repeated factor, and for each analyzed variable, animal nested within treatment (the error term) was subjected to 3 variance–covariance structures: compound symmetry, autoregressive order one, and unstructured. The covariance structure that minimized Schwarz's Bayesian information criterion was considered the most desirable analysis. In the case of number of occurrences of each social behavior, scan effect was also introduced in the model as a random effect. Rumen and cecum data (VFA, pH, histological, and gene expression) were analyzed using ANOVA using a model that included initial BW as a covariate and treatment (as there were no repeated measures) as the main effect. Last, a χ2 test was conducted to evaluate the effects of treatment on rumen macroscopical classification and fecal and bloat scoring data (categorical variables). For all analyses, significance was declared at P ≤ 0.05 and tendencies were discussed at 0.05 < P ≤ 0.10. RESULTS The most common bloat score registered was “0” (no bloat), with the exception of bulls without straw provision and fed pellets, where at d 14 (P = 0.10), 28 (P < 0.05), 42 (P = 0.41), and 54 (P < 0.05) of the study, 33.3, 50, 17, and 50%, respectively, were scored “1” (slight) and 0, 0, 17, and 17%, respectively, were scored “2” (mild; data not shown). At Day 14, a ruminal surgical fistula was inserted in 1 bull with no straw provision and fed pellets because of chronic bloating. The only fecal score recorded throughout the study was “1” (normal). Intake and Animal Performance The effects of treatments on final BW, ADG, total DMI, and total G:F are summarized in Table 3. An interaction between straw provision and feed presentation form was detected for initial BW (P = 0.05), where initial BW was greater in bulls fed pellets compared with bulls fed meal when straw was provided. When no straw was provided, the initial BW was less for bulls fed pellets compared with those fed meal. As previously described, before the study started and for a 111-d period, bulls were fed their corresponding treatment diets. After this period of 111 d, they were allocated to individual pens and intake and behavior were individually recorded. During the individual feeding period, treatment affected (P < 0.01) ADG and final BW. When straw was available, bulls fed the pelleted feed grew more than when fed the meal; however, the opposite was observed when straw was not provided. Bulls tended (P = 0.09) to consume more concentrate and consumed (P < 0.001) more total DM when straw was provided than when no straw was available. When bulls were provided straw, the ratio between concentrate intake and total DMI was 91 to 100. An interaction between straw provision and concentrate presentation form was observed (P < 0.01): when bulls were provided straw, they were more efficient when they were fed pellets than when fed meal; however, the opposite was observed when they were not provided straw. Slaughter weight and carcass weight were greater (P < 0.05) when bulls were provided straw and fed pellets (513.2 ± 8.25 kg slaughter weight and 270.1 ± 4.73 kg carcass weight) than when bulls were fed straw with meal (493.8 ± 8.25 kg slaughter weight and 254.9 ± 4.73 kg carcass weight); however, the opposite was observed when they were not provided straw (P < 0.05; data not shown). When no straw was provided and bulls were fed pellets, slaughter weight and carcass weight (479.5 ± 8.25 kg slaughter weight and 255.6 ± 4.73 kg carcass weight) were less than when compared with bulls with no straw provision were fed meal (497.8 ± 8.25 kg slaughter weight and 262.9 ± 4.73 kg carcass weight). Table 3. Performance during the finishing period (from 8 to 10 mo of age) in Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Initial age, d  258  247  252  251  3.1  0.67  0.07  0.09  Initial BW, kg  388ab  385b  391ab  417a  7.3  0.02  0.10  0.05  ADG, kg/d  1.66b  1.32c  1.63b  1.90a  0.05  0.001  0.08  0.01  Final BW, kg  491ab  471b  482ab  504a  7.2  0.13  0.85  0.01  Concentrate, kg DM/d  7.9  6.8  8.0  8.0  0.36  0.08  0.16  0.17  Straw, kg DM/d  0  0  0.7  0.7  0.03  0.001  0.84  0.87  Total, kg DM/d  7.9  6.8  8.7  8.7  0.35  0.01  0.15  0.15  Ratio of concentrate to total DMI, kg/kg  100  100  91.4  91.5  0.53  0.001  0.92  0.91  G:F,3 kg/kg  0.210a  0.194b  0.187b  0.218a  0.0277  0.51  0.58  0.01    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Initial age, d  258  247  252  251  3.1  0.67  0.07  0.09  Initial BW, kg  388ab  385b  391ab  417a  7.3  0.02  0.10  0.05  ADG, kg/d  1.66b  1.32c  1.63b  1.90a  0.05  0.001  0.08  0.01  Final BW, kg  491ab  471b  482ab  504a  7.2  0.13  0.85  0.01  Concentrate, kg DM/d  7.9  6.8  8.0  8.0  0.36  0.08  0.16  0.17  Straw, kg DM/d  0  0  0.7  0.7  0.03  0.001  0.84  0.87  Total, kg DM/d  7.9  6.8  8.7  8.7  0.35  0.01  0.15  0.15  Ratio of concentrate to total DMI, kg/kg  100  100  91.4  91.5  0.53  0.001  0.92  0.91  G:F,3 kg/kg  0.210a  0.194b  0.187b  0.218a  0.0277  0.51  0.58  0.01  a–cMeans within a row with different superscripts are differ (P < 0.05). 1No straw = concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. 3SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. View Large Table 3. Performance during the finishing period (from 8 to 10 mo of age) in Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Initial age, d  258  247  252  251  3.1  0.67  0.07  0.09  Initial BW, kg  388ab  385b  391ab  417a  7.3  0.02  0.10  0.05  ADG, kg/d  1.66b  1.32c  1.63b  1.90a  0.05  0.001  0.08  0.01  Final BW, kg  491ab  471b  482ab  504a  7.2  0.13  0.85  0.01  Concentrate, kg DM/d  7.9  6.8  8.0  8.0  0.36  0.08  0.16  0.17  Straw, kg DM/d  0  0  0.7  0.7  0.03  0.001  0.84  0.87  Total, kg DM/d  7.9  6.8  8.7  8.7  0.35  0.01  0.15  0.15  Ratio of concentrate to total DMI, kg/kg  100  100  91.4  91.5  0.53  0.001  0.92  0.91  G:F,3 kg/kg  0.210a  0.194b  0.187b  0.218a  0.0277  0.51  0.58  0.01    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Initial age, d  258  247  252  251  3.1  0.67  0.07  0.09  Initial BW, kg  388ab  385b  391ab  417a  7.3  0.02  0.10  0.05  ADG, kg/d  1.66b  1.32c  1.63b  1.90a  0.05  0.001  0.08  0.01  Final BW, kg  491ab  471b  482ab  504a  7.2  0.13  0.85  0.01  Concentrate, kg DM/d  7.9  6.8  8.0  8.0  0.36  0.08  0.16  0.17  Straw, kg DM/d  0  0  0.7  0.7  0.03  0.001  0.84  0.87  Total, kg DM/d  7.9  6.8  8.7  8.7  0.35  0.01  0.15  0.15  Ratio of concentrate to total DMI, kg/kg  100  100  91.4  91.5  0.53  0.001  0.92  0.91  G:F,3 kg/kg  0.210a  0.194b  0.187b  0.218a  0.0277  0.51  0.58  0.01  a–cMeans within a row with different superscripts are differ (P < 0.05). 1No straw = concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. 3SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. View Large Animal Behavior Concentrate eating time was less when bulls were fed pellets (P < 0.05) than when fed meal (2.3 ± 0.542 vs. 7.6 ± 0.54%), and this response was independent of straw provision (Table 4). Social interactions were greater (P < 0.05) when bulls were fed meal compared with when bulls were fed pellets (1.36 and 0.92 ± 0.140 times/15 min, respectively; Table 5). When bulls were not provided straw, the proportion of time for ruminations was shorter (P < 0.01) compared with when bulls were provided straw (3.1 and 9.4 ± 1.02%, respectively; Table 4). Moreover, in bulls where no straw was provided, more (P < 0.001) oral nonnutritive behaviors were recorded (P < 0.05) compared with bulls provided straw (1.34 and 0.52 ± 0.123 times/15 min and 0.10 and 0.27 ± 0.002 times/15 min, respectively; Table 5). For oral nonnutritive and self-grooming behaviors, the interaction between straw and presentation form was statistically significant (P < 0.05); at the end of the study, bulls that were fed without straw provision performed more oral nonnutritive and more self-grooming behaviors than bulls with straw provision. Treatments did not affect any of the remaining recorded behaviors. Table 4. General behavior (percentage of the activity during the scan sampling of 30 min performed from 0830 to 1100 h) during the finishing period (from 8 to 10 mo of age) in Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Standing  67.3  62.5  78.5  64.6  1.68  0.19  0.08  0.39  Lying  33.7  37.5  21.5  35.5  1.33  0.30  0.12  0.42  Eating concentrate  6.9a  3.5b  8.3a  1.4b  1.04  0.89  0.04  0.53  Eating straw  –  –  11.8  13.9  1.30    0.56    Drinking  4.8  4.2  2.7  2.7  1.04  0.32  0.66  0.66  Ruminating  2.7b  3.4b  8.3a  10.4a  1.02  0.01  0.49  0.73    Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Standing  67.3  62.5  78.5  64.6  1.68  0.19  0.08  0.39  Lying  33.7  37.5  21.5  35.5  1.33  0.30  0.12  0.42  Eating concentrate  6.9a  3.5b  8.3a  1.4b  1.04  0.89  0.04  0.53  Eating straw  –  –  11.8  13.9  1.30    0.56    Drinking  4.8  4.2  2.7  2.7  1.04  0.32  0.66  0.66  Ruminating  2.7b  3.4b  8.3a  10.4a  1.02  0.01  0.49  0.73  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 3Straw = No straw vs. straw; Form = meal vs. pellets. View Large Table 4. General behavior (percentage of the activity during the scan sampling of 30 min performed from 0830 to 1100 h) during the finishing period (from 8 to 10 mo of age) in Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Standing  67.3  62.5  78.5  64.6  1.68  0.19  0.08  0.39  Lying  33.7  37.5  21.5  35.5  1.33  0.30  0.12  0.42  Eating concentrate  6.9a  3.5b  8.3a  1.4b  1.04  0.89  0.04  0.53  Eating straw  –  –  11.8  13.9  1.30    0.56    Drinking  4.8  4.2  2.7  2.7  1.04  0.32  0.66  0.66  Ruminating  2.7b  3.4b  8.3a  10.4a  1.02  0.01  0.49  0.73    Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Standing  67.3  62.5  78.5  64.6  1.68  0.19  0.08  0.39  Lying  33.7  37.5  21.5  35.5  1.33  0.30  0.12  0.42  Eating concentrate  6.9a  3.5b  8.3a  1.4b  1.04  0.89  0.04  0.53  Eating straw  –  –  11.8  13.9  1.30    0.56    Drinking  4.8  4.2  2.7  2.7  1.04  0.32  0.66  0.66  Ruminating  2.7b  3.4b  8.3a  10.4a  1.02  0.01  0.49  0.73  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 3Straw = No straw vs. straw; Form = meal vs. pellets. View Large Table 5. Social behavior (number of occurrences/15 min) during the finishing period (from 8 to 10 mo of age) in Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Self-grooming4  1.7  1.7  1.5  1.7  0.07  0.56  0.96  0.95  Social  1.5a  1.0b  1.2a  0.8b  1.39  0.15  0.02  0.67  Oral nonnutritive4  1.3a  1.4a  0.5b  0.7b  1.40  0.001  0.45  0.56  Tongue rolling  0.3  0.2  0.1  0.1  1.05  0.29  0.84  0.71    Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Self-grooming4  1.7  1.7  1.5  1.7  0.07  0.56  0.96  0.95  Social  1.5a  1.0b  1.2a  0.8b  1.39  0.15  0.02  0.67  Oral nonnutritive4  1.3a  1.4a  0.5b  0.7b  1.40  0.001  0.45  0.56  Tongue rolling  0.3  0.2  0.1  0.1  1.05  0.29  0.84  0.71  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 3Straw = No straw vs. straw; Form = meal vs. pellets. 4Interaction between straw, presentation form, and time was statistically significant (P < 0.05); at the end of the study, animals that were fed only with concentrate ad libitum and with no straw performed more oral nonnutritive and more self-grooming behaviors than animals fed with concentrate and straw both ad libitum. View Large Table 5. Social behavior (number of occurrences/15 min) during the finishing period (from 8 to 10 mo of age) in Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Self-grooming4  1.7  1.7  1.5  1.7  0.07  0.56  0.96  0.95  Social  1.5a  1.0b  1.2a  0.8b  1.39  0.15  0.02  0.67  Oral nonnutritive4  1.3a  1.4a  0.5b  0.7b  1.40  0.001  0.45  0.56  Tongue rolling  0.3  0.2  0.1  0.1  1.05  0.29  0.84  0.71    Treatment1        No straw  Straw    P-value3  Item  Meal  Pellet  Meal  Pellet  SEM2  Straw  Form  Straw × form  Self-grooming4  1.7  1.7  1.5  1.7  0.07  0.56  0.96  0.95  Social  1.5a  1.0b  1.2a  0.8b  1.39  0.15  0.02  0.67  Oral nonnutritive4  1.3a  1.4a  0.5b  0.7b  1.40  0.001  0.45  0.56  Tongue rolling  0.3  0.2  0.1  0.1  1.05  0.29  0.84  0.71  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 3Straw = No straw vs. straw; Form = meal vs. pellets. 4Interaction between straw, presentation form, and time was statistically significant (P < 0.05); at the end of the study, animals that were fed only with concentrate ad libitum and with no straw performed more oral nonnutritive and more self-grooming behaviors than animals fed with concentrate and straw both ad libitum. View Large Rumen Wall, Cecum, and Liver Lesions The interaction between straw provision and presentation form for rumen wall color, papillae fusion, and hair presence was significant (Table 6). No differences in rumen color were observed between presentation forms when no straw was provided; however, when straw was provided, 50% of the rumen walls of bulls fed meal were classified as “5” (the score corresponding to the darkest color) whereas in bulls fed pellets, no rumens were classified as “5” (P < 0.05). All rumens of bulls that were not provided straw had papillae fusion in contrast to bulls provided straw (0 and 16.7% papillae fusions for bulls fed meal or pellets, respectively; P < 0.05). Moreover, no hair presence was observed in bulls provided straw, whereas some rumens of bulls not provided straw had hairs attached to the wall (33.3 and 66.7% hair presence for bulls fed meal or pellets, respectively; P < 0.05). Lastly, cecum petechiae presence, cecum color, and liver abscesses were not affected by treatment. No liver abscesses were observed. Table 6. Rumen and cecum pH and macroscopic evaluation at slaughterhouse of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1      No straw  Straw  P-value2  Item  Meal  Pellet  Meal  Pellet  Straw  Form  Straw × form  Rumen color3          0.01  0.38  0.05      1                    2                    3  83.3  83.3  –  50.0            4  16.7  16.7  50.0  50.0            5  –  –  50.0  –        Rumen papillae fusion4          0.001  0.68  0.05      Yes  100  100  –  16.7            No  –  –  100  83.3        Hair presence in the papillae                    Yes  33.3  66.7  –  –  0.001  0.34  0.01      No  66.7  33.3  100  100        Cecum petechiae presence      Yes  33.3  –  –  16.7  0.53  0.53  0.16      No  66.7  100  100  83.3        Cecum color5          0.20  0.60  0.68      0  50.0  66.7  33.3  50.0            1  –  –  16.7  16.7            2  33.3  33.3  50.0  33.3            3  16.7  –  –  –          Treatment1      No straw  Straw  P-value2  Item  Meal  Pellet  Meal  Pellet  Straw  Form  Straw × form  Rumen color3          0.01  0.38  0.05      1                    2                    3  83.3  83.3  –  50.0            4  16.7  16.7  50.0  50.0            5  –  –  50.0  –        Rumen papillae fusion4          0.001  0.68  0.05      Yes  100  100  –  16.7            No  –  –  100  83.3        Hair presence in the papillae                    Yes  33.3  66.7  –  –  0.001  0.34  0.01      No  66.7  33.3  100  100        Cecum petechiae presence      Yes  33.3  –  –  16.7  0.53  0.53  0.16      No  66.7  100  100  83.3        Cecum color5          0.20  0.60  0.68      0  50.0  66.7  33.3  50.0            1  –  –  16.7  16.7            2  33.3  33.3  50.0  33.3            3  16.7  –  –  –        1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. 3Adapted from González et al. (2001): 1 = white and 5 = black. 4Adapted from Nocek et al. (1984). 50 = white-pink, 1 = light pink, 2 = pink, and 3 = dark pink. View Large Table 6. Rumen and cecum pH and macroscopic evaluation at slaughterhouse of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1      No straw  Straw  P-value2  Item  Meal  Pellet  Meal  Pellet  Straw  Form  Straw × form  Rumen color3          0.01  0.38  0.05      1                    2                    3  83.3  83.3  –  50.0            4  16.7  16.7  50.0  50.0            5  –  –  50.0  –        Rumen papillae fusion4          0.001  0.68  0.05      Yes  100  100  –  16.7            No  –  –  100  83.3        Hair presence in the papillae                    Yes  33.3  66.7  –  –  0.001  0.34  0.01      No  66.7  33.3  100  100        Cecum petechiae presence      Yes  33.3  –  –  16.7  0.53  0.53  0.16      No  66.7  100  100  83.3        Cecum color5          0.20  0.60  0.68      0  50.0  66.7  33.3  50.0            1  –  –  16.7  16.7            2  33.3  33.3  50.0  33.3            3  16.7  –  –  –          Treatment1      No straw  Straw  P-value2  Item  Meal  Pellet  Meal  Pellet  Straw  Form  Straw × form  Rumen color3          0.01  0.38  0.05      1                    2                    3  83.3  83.3  –  50.0            4  16.7  16.7  50.0  50.0            5  –  –  50.0  –        Rumen papillae fusion4          0.001  0.68  0.05      Yes  100  100  –  16.7            No  –  –  100  83.3        Hair presence in the papillae                    Yes  33.3  66.7  –  –  0.001  0.34  0.01      No  66.7  33.3  100  100        Cecum petechiae presence      Yes  33.3  –  –  16.7  0.53  0.53  0.16      No  66.7  100  100  83.3        Cecum color5          0.20  0.60  0.68      0  50.0  66.7  33.3  50.0            1  –  –  16.7  16.7            2  33.3  33.3  50.0  33.3            3  16.7  –  –  –        1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. 3Adapted from González et al. (2001): 1 = white and 5 = black. 4Adapted from Nocek et al. (1984). 50 = white-pink, 1 = light pink, 2 = pink, and 3 = dark pink. View Large Rumen wall sections were histologically analyzed (Table 7) and no parakeratosis was observed. However, in the left side of the caudal dorsal sac section, keratin thickness tended (P = 0.08) to be greater in bulls fed meal compared with bulls fed pellets when straw was provided, whereas when no straw was provided, no effect on keratin thickness was observed. However, in the cranial ventral sac, keratin thickness was greater (P < 0.01) when straw was provided compared with no straw provision (37.7 and 32.6 ± 1.79 μm, respectively). Vacuole grading is an indirect measurement of rumen epithelia integrity (Nocek et al., 1984). In both sections (from the left side of the cranial ventral sac and from the left side of the caudal dorsal sac), vacuole grading (Nocek et al., 1984) was less (P < 0.01) in bulls provided straw compared with bulls not provided straw. The rumens from bulls fed pellets also had a decreased vacuole grading in the left side of the cranial ventral sac compared with the rumens of the bulls fed meal. Rumens from bulls fed meal had a greater (P < 0.05) number of papillae compared with those from bulls fed pellets (9.81 and 7.75 ± 0.684 per cm, respectively). In the cecum, the number of goblet cells was greater (P < 0.05) in bulls provided straw compared with bulls that were not provided straw (34.4 and 28.2 ± 1.95, respectively; Table 8). Table 7. Rumen morphometric measures from left side caudal dorsal sac and the left side of the cranial ventral sac of the rumen of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Left side of the caudal dorsal sac      Papillae, μm          Length  3,730  3,470  3,431  4,342  351  0.41  0.35  0.11          Width  292ab  229b  298ab  337a  22.2  0.03  0.96  0.05          Vacuola,3 grading  1.21a  1.27a  0.89b  0.63b  0.158  <0.01  0.52  0.32          Keratin, μm  35.7  36.5  41.1  34.2  2.07  0.45  0.16  0.08          Papillae number,3 per cm  8.3  7.8  10.7  8.1  1.62  0.18  0.14  0.49  Left side of the cranial ventral sac      Papillae          Length, μm  5,400  4,250  4,050  4,390  650  0.58  0.80  0.14          Width, μm  278  293  290  310  19.5  0.46  0.37  0.87          Vacuola,3 grading  1.26  1.06  1.05  0.33  0.174  <0.01  <0.01  0.15          Keratin, μm  31.5b  33.6b  37.1a  38.3a  2.54  <0.05  0.53  0.84          Papillae number, per cm  9.4a  7.3b  10.2a  8.2b  0.96  0.41  <0.05  0.96    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Left side of the caudal dorsal sac      Papillae, μm          Length  3,730  3,470  3,431  4,342  351  0.41  0.35  0.11          Width  292ab  229b  298ab  337a  22.2  0.03  0.96  0.05          Vacuola,3 grading  1.21a  1.27a  0.89b  0.63b  0.158  <0.01  0.52  0.32          Keratin, μm  35.7  36.5  41.1  34.2  2.07  0.45  0.16  0.08          Papillae number,3 per cm  8.3  7.8  10.7  8.1  1.62  0.18  0.14  0.49  Left side of the cranial ventral sac      Papillae          Length, μm  5,400  4,250  4,050  4,390  650  0.58  0.80  0.14          Width, μm  278  293  290  310  19.5  0.46  0.37  0.87          Vacuola,3 grading  1.26  1.06  1.05  0.33  0.174  <0.01  <0.01  0.15          Keratin, μm  31.5b  33.6b  37.1a  38.3a  2.54  <0.05  0.53  0.84          Papillae number, per cm  9.4a  7.3b  10.2a  8.2b  0.96  0.41  <0.05  0.96  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. 3Based on Nocek et al. (1984). A quantitative morphological analysis was used to determine rumen epithelial integrity. A scale of 1 to 5 was used to characterize the tissue, with “1” being an epithelium that had light staining and an unvaculoated cytoplasm, particularly in the stratum granulosum. “5” was an epithelium with highly vacuolated granulosum, and, often, the very thick corneum was in various stages of sloughing. The 4 layers of the epithelium densely stained and were easily differentiated; grades “2” to “4” were gradations of the 2 extremes. View Large Table 7. Rumen morphometric measures from left side caudal dorsal sac and the left side of the cranial ventral sac of the rumen of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Left side of the caudal dorsal sac      Papillae, μm          Length  3,730  3,470  3,431  4,342  351  0.41  0.35  0.11          Width  292ab  229b  298ab  337a  22.2  0.03  0.96  0.05          Vacuola,3 grading  1.21a  1.27a  0.89b  0.63b  0.158  <0.01  0.52  0.32          Keratin, μm  35.7  36.5  41.1  34.2  2.07  0.45  0.16  0.08          Papillae number,3 per cm  8.3  7.8  10.7  8.1  1.62  0.18  0.14  0.49  Left side of the cranial ventral sac      Papillae          Length, μm  5,400  4,250  4,050  4,390  650  0.58  0.80  0.14          Width, μm  278  293  290  310  19.5  0.46  0.37  0.87          Vacuola,3 grading  1.26  1.06  1.05  0.33  0.174  <0.01  <0.01  0.15          Keratin, μm  31.5b  33.6b  37.1a  38.3a  2.54  <0.05  0.53  0.84          Papillae number, per cm  9.4a  7.3b  10.2a  8.2b  0.96  0.41  <0.05  0.96    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Left side of the caudal dorsal sac      Papillae, μm          Length  3,730  3,470  3,431  4,342  351  0.41  0.35  0.11          Width  292ab  229b  298ab  337a  22.2  0.03  0.96  0.05          Vacuola,3 grading  1.21a  1.27a  0.89b  0.63b  0.158  <0.01  0.52  0.32          Keratin, μm  35.7  36.5  41.1  34.2  2.07  0.45  0.16  0.08          Papillae number,3 per cm  8.3  7.8  10.7  8.1  1.62  0.18  0.14  0.49  Left side of the cranial ventral sac      Papillae          Length, μm  5,400  4,250  4,050  4,390  650  0.58  0.80  0.14          Width, μm  278  293  290  310  19.5  0.46  0.37  0.87          Vacuola,3 grading  1.26  1.06  1.05  0.33  0.174  <0.01  <0.01  0.15          Keratin, μm  31.5b  33.6b  37.1a  38.3a  2.54  <0.05  0.53  0.84          Papillae number, per cm  9.4a  7.3b  10.2a  8.2b  0.96  0.41  <0.05  0.96  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. 3Based on Nocek et al. (1984). A quantitative morphological analysis was used to determine rumen epithelial integrity. A scale of 1 to 5 was used to characterize the tissue, with “1” being an epithelium that had light staining and an unvaculoated cytoplasm, particularly in the stratum granulosum. “5” was an epithelium with highly vacuolated granulosum, and, often, the very thick corneum was in various stages of sloughing. The 4 layers of the epithelium densely stained and were easily differentiated; grades “2” to “4” were gradations of the 2 extremes. View Large Table 8. Cecum morphometric measures of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Crypt depth, μm  415  459  451  454  23.6  0.52  0.33  0.41  Goblet cells, number  27.5b  28.8b  32.1a  36.5a  2.76  0.03  0.30  0.58  Intraepithelial lymphocyte, number  5.7  6.5  3.7  6.5  1.63  0.53  0.28  0.55  Mitosis, number  1.03  0.68  0.78  0.58  0.194  0.35  0.18  0.67    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Crypt depth, μm  415  459  451  454  23.6  0.52  0.33  0.41  Goblet cells, number  27.5b  28.8b  32.1a  36.5a  2.76  0.03  0.30  0.58  Intraepithelial lymphocyte, number  5.7  6.5  3.7  6.5  1.63  0.53  0.28  0.55  Mitosis, number  1.03  0.68  0.78  0.58  0.194  0.35  0.18  0.67  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. View Large Table 8. Cecum morphometric measures of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Crypt depth, μm  415  459  451  454  23.6  0.52  0.33  0.41  Goblet cells, number  27.5b  28.8b  32.1a  36.5a  2.76  0.03  0.30  0.58  Intraepithelial lymphocyte, number  5.7  6.5  3.7  6.5  1.63  0.53  0.28  0.55  Mitosis, number  1.03  0.68  0.78  0.58  0.194  0.35  0.18  0.67    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Crypt depth, μm  415  459  451  454  23.6  0.52  0.33  0.41  Goblet cells, number  27.5b  28.8b  32.1a  36.5a  2.76  0.03  0.30  0.58  Intraepithelial lymphocyte, number  5.7  6.5  3.7  6.5  1.63  0.53  0.28  0.55  Mitosis, number  1.03  0.68  0.78  0.58  0.194  0.35  0.18  0.67  a,bMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. View Large Rumen and Cecum Fermentation Ruminal and cecal fermentation variables are presented in Table 9. When no straw was provided, ruminal pH did not differ between meal or pellets and ruminal pH was below 5.6, whereas when straw was provided, ruminal pH was greater in bulls fed meal compared with bulls fed pellets (interaction, P < 0.05). Total VFA concentration in the rumen tended to be affected by the interaction between concentrate form and straw inclusion (P = 0.07) with a pattern that corresponds to ruminal pH. Molar proportions of VFA in the rumen, with the exception of butyrate, isovalerate, and valerate, were affected by an interaction between straw provision and presentation form (P < 0.01). When straw was not provided, presentation form did not affect molar proportion of these VFA; however, when straw was provided in bulls fed meal, the rumen molar proportion of acetate and isobutyrate was greater and the molar proportion of propionate was less than compared with bulls fed pellets. In the cecum, the molar proportion of acetate tended (interaction, P = 0.07) to increase when bulls were provided straw and pellets compared with bulls fed meal, and no differences in molar proportion of acetate were observed when no straw was provided. In the cecum, when no straw was provided, the molar proportion of propionate was greater (P < 0.05) in bulls fed pellets compared with bulls fed meal, whereas when straw was provided, the molar proportion of propionate was not affected by feed presentation form. Straw provision, independent of feed presentation form, increased (P < 0.05) the molar percentage of valerate in the cecum (1.23 vs. 0.89 ± 0.104 mol/100 mol, respectively). Table 9. Rumen fermentation parameters of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Rumen      pH  5.49b  5.52b  6.46a  5.71b  0.16  0.01  0.05  <0.05      Total VFA, mM  144.4  144.3  98.9  145.8  12.29  0.08  0.07  0.07      Individual VFA, mol/100 mol          Acetate  46.8b  44.1b  62.7a  45.5b  1.83  <0.001  <0.001  <0.001          Propionate  37.0a  38.8a  22.2b  41.5a  1.83  <0.001  <0.001  <0.001          Isobutyrate  0.76b  0.65b  1.42a  0.69b  0.094  <0.001  <0.001  <0.01          n-Butyrate  10.2a  11.9a  9.5b  8.8b  0.93  <0.05  0.58  0.21          Isovalerate  2.6  1.3  2.8  0.7  0.604  0.80  <0.001  0.56          Valerate  2.5  3.1  1.3  2.6  0.234  <0.01  <0.001  0.13          Acetate:propionate ratio, mol/mol  1.31b  1.14b  2.96a  1.10b  0.196  <0.001  <0.001  <0.001  Cecum      pH  6.57  6.27  6.26  6.44  0.160  0.67  0.70  0.16      Total VFA, mM  98.5  117.3  118.3  120.6  12.13  0.35  0.39  0.50      Individual VFA, mol/100 mol          Acetate  72.6  69.5  71.4  75.2  1.84  0.23  0.82  0.07          Propionate  15.8b  19.0a  15.8b  15.0b  0.767  0.01  0.11  <0.05          Isobutyrate  0.63  0.51  0.73  0.27  0.159  0.64  0.08  0.30          n-Butyrate  9.5  9.6  10.2  7.9  1.47  0.73  0.44  0.42          Isovalerate  0.51  0.38  0.57  0.27  0.135  0.85  0.12  0.51          Valerate  0.90  0.88  1.23  1.24  0.148  <0.05  0.94  0.91          Acetate:propionate ratio, mol/mol  4.65b  3.73c  4.55b  5.06a  0.282  <0.05  0.47  <0.05    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Rumen      pH  5.49b  5.52b  6.46a  5.71b  0.16  0.01  0.05  <0.05      Total VFA, mM  144.4  144.3  98.9  145.8  12.29  0.08  0.07  0.07      Individual VFA, mol/100 mol          Acetate  46.8b  44.1b  62.7a  45.5b  1.83  <0.001  <0.001  <0.001          Propionate  37.0a  38.8a  22.2b  41.5a  1.83  <0.001  <0.001  <0.001          Isobutyrate  0.76b  0.65b  1.42a  0.69b  0.094  <0.001  <0.001  <0.01          n-Butyrate  10.2a  11.9a  9.5b  8.8b  0.93  <0.05  0.58  0.21          Isovalerate  2.6  1.3  2.8  0.7  0.604  0.80  <0.001  0.56          Valerate  2.5  3.1  1.3  2.6  0.234  <0.01  <0.001  0.13          Acetate:propionate ratio, mol/mol  1.31b  1.14b  2.96a  1.10b  0.196  <0.001  <0.001  <0.001  Cecum      pH  6.57  6.27  6.26  6.44  0.160  0.67  0.70  0.16      Total VFA, mM  98.5  117.3  118.3  120.6  12.13  0.35  0.39  0.50      Individual VFA, mol/100 mol          Acetate  72.6  69.5  71.4  75.2  1.84  0.23  0.82  0.07          Propionate  15.8b  19.0a  15.8b  15.0b  0.767  0.01  0.11  <0.05          Isobutyrate  0.63  0.51  0.73  0.27  0.159  0.64  0.08  0.30          n-Butyrate  9.5  9.6  10.2  7.9  1.47  0.73  0.44  0.42          Isovalerate  0.51  0.38  0.57  0.27  0.135  0.85  0.12  0.51          Valerate  0.90  0.88  1.23  1.24  0.148  <0.05  0.94  0.91          Acetate:propionate ratio, mol/mol  4.65b  3.73c  4.55b  5.06a  0.282  <0.05  0.47  <0.05  a–cMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. View Large Table 9. Rumen fermentation parameters of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Rumen      pH  5.49b  5.52b  6.46a  5.71b  0.16  0.01  0.05  <0.05      Total VFA, mM  144.4  144.3  98.9  145.8  12.29  0.08  0.07  0.07      Individual VFA, mol/100 mol          Acetate  46.8b  44.1b  62.7a  45.5b  1.83  <0.001  <0.001  <0.001          Propionate  37.0a  38.8a  22.2b  41.5a  1.83  <0.001  <0.001  <0.001          Isobutyrate  0.76b  0.65b  1.42a  0.69b  0.094  <0.001  <0.001  <0.01          n-Butyrate  10.2a  11.9a  9.5b  8.8b  0.93  <0.05  0.58  0.21          Isovalerate  2.6  1.3  2.8  0.7  0.604  0.80  <0.001  0.56          Valerate  2.5  3.1  1.3  2.6  0.234  <0.01  <0.001  0.13          Acetate:propionate ratio, mol/mol  1.31b  1.14b  2.96a  1.10b  0.196  <0.001  <0.001  <0.001  Cecum      pH  6.57  6.27  6.26  6.44  0.160  0.67  0.70  0.16      Total VFA, mM  98.5  117.3  118.3  120.6  12.13  0.35  0.39  0.50      Individual VFA, mol/100 mol          Acetate  72.6  69.5  71.4  75.2  1.84  0.23  0.82  0.07          Propionate  15.8b  19.0a  15.8b  15.0b  0.767  0.01  0.11  <0.05          Isobutyrate  0.63  0.51  0.73  0.27  0.159  0.64  0.08  0.30          n-Butyrate  9.5  9.6  10.2  7.9  1.47  0.73  0.44  0.42          Isovalerate  0.51  0.38  0.57  0.27  0.135  0.85  0.12  0.51          Valerate  0.90  0.88  1.23  1.24  0.148  <0.05  0.94  0.91          Acetate:propionate ratio, mol/mol  4.65b  3.73c  4.55b  5.06a  0.282  <0.05  0.47  <0.05    Treatment1        No straw  Straw    P-value2  Item  Meal  Pellet  Meal  Pellet  SEM  Straw  Form  Straw × form  Rumen      pH  5.49b  5.52b  6.46a  5.71b  0.16  0.01  0.05  <0.05      Total VFA, mM  144.4  144.3  98.9  145.8  12.29  0.08  0.07  0.07      Individual VFA, mol/100 mol          Acetate  46.8b  44.1b  62.7a  45.5b  1.83  <0.001  <0.001  <0.001          Propionate  37.0a  38.8a  22.2b  41.5a  1.83  <0.001  <0.001  <0.001          Isobutyrate  0.76b  0.65b  1.42a  0.69b  0.094  <0.001  <0.001  <0.01          n-Butyrate  10.2a  11.9a  9.5b  8.8b  0.93  <0.05  0.58  0.21          Isovalerate  2.6  1.3  2.8  0.7  0.604  0.80  <0.001  0.56          Valerate  2.5  3.1  1.3  2.6  0.234  <0.01  <0.001  0.13          Acetate:propionate ratio, mol/mol  1.31b  1.14b  2.96a  1.10b  0.196  <0.001  <0.001  <0.001  Cecum      pH  6.57  6.27  6.26  6.44  0.160  0.67  0.70  0.16      Total VFA, mM  98.5  117.3  118.3  120.6  12.13  0.35  0.39  0.50      Individual VFA, mol/100 mol          Acetate  72.6  69.5  71.4  75.2  1.84  0.23  0.82  0.07          Propionate  15.8b  19.0a  15.8b  15.0b  0.767  0.01  0.11  <0.05          Isobutyrate  0.63  0.51  0.73  0.27  0.159  0.64  0.08  0.30          n-Butyrate  9.5  9.6  10.2  7.9  1.47  0.73  0.44  0.42          Isovalerate  0.51  0.38  0.57  0.27  0.135  0.85  0.12  0.51          Valerate  0.90  0.88  1.23  1.24  0.148  <0.05  0.94  0.91          Acetate:propionate ratio, mol/mol  4.65b  3.73c  4.55b  5.06a  0.282  <0.05  0.47  <0.05  a–cMeans within a row with different superscripts are differ (P < 0.05). 1No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 2Straw = No straw vs. straw; Form = meal vs. pellets. View Large Expression of Genes in the Rumen and Cecum Epithelia No interactions between straw provision and feed presentation form were detected for the relative expression ratio of genes analyzed in the 2 rumen regions (Table 10). Most treatment effects on the epithelial relative gene expression ratio were observed in the left side of the cranial ventral sac, and straw provision exerted a greater impact on the relative gene expression ratio in the rumen compared with feed presentation form. The relative gene expression ratio for ffar2 (a gene coding for the production and turnover of neurotransmitters) in the caudal dorsal sac tended (P = 0.09) to be greater in bulls fed pellets compared with bulls fed meal (0.000026 and 0.000013 ± 0.135, respectively). Moreover, in the cranial ventral sac, the relative expression of claudin (a gene coding for a protein part of tight junctions) tended (P = 0.06) to be lesser in the bulls fed pellets compared those fed meal. Table 10. The rumen relative gene expression ratio from the left side caudal dorsal sac and the left side of the cranial ventral sac of the rumen of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  Left side of the caudal dorsal sac      FFA3  0.33  0.58  0.34  0.93  0.192  0.58  0.09  0.59      FFA2  0.85  0.85  0.87  0.74  0.217  0.68  0.88  0.88      DAD1A  0.80  0.68  0.83  0.74  0.277  0.93  0.81  0.96      ADRA2A  0.14  0.13  0.10  0.14  0.137  0.73  0.82  0.54      ADRA2B  0.41  0.49  0.46  0.39  0.079  0.77  0.98  0.37      ADRA2C  0.85b  0.81b  1.70a  1.38a  0.058  <0.01  0.31  0.58      PPYR1  3.98  5.25  3.72  4.68  0.255  0.87  0.65  0.96      Occludin  2.09  1.91  2.04  2.40  0.085  0.61  0.91  0.53      Claudin  0.69b  0.62b  1.15a  1.02a  0.0048  <0.001  0.29  0.91      IL-1β  5.50  5.13  3.72  5.37  0.180  0.69  0.71  0.60      TNFα  0.72b  0.83b  2.14a  1.51a  0.134  <0.01  0.72  0.43      IL-6  4.90  6.92  4.07  6.61  0.199  0.78  0.36  0.87      TLR4  1.86  2.29  0.76  3.98  0.342  0.81  0.24  0.37      TLR2  0.16  0.15  0.12  0.17  0.307  0.80  0.64  0.54      Defensin-β  1.51  2.04  0.62  1.07  0.185  0.08  0.33  0.75      BIAP  0.83  0.89  0.79  0.87  0.255  0.87  0.75  0.93      Lactoferrin  0.15  0.18  0.16  0.16  0.158  0.88  0.85  0.81  Left side of the cranial ventral sac      FFAR3  12.30  48.98  50.12  29.51  0.275  0.48  0.50  014      FFAR2  17.78  15.85  32.36  50.12  0.274  0.06  0.44  0.33      DAD1A  1.12  0.40  1.10  1.55  0.235  0.22  0.52  0.21      ADRA2A  0.16  0.13  0.13  0.23  0.218  0.71  0.77  0.43      ADRA2B  4.57  5.37  7.24  10.47  0.157  0.13  0.47  0.76      ADRA2C  0.66a  0.39b  0.79a  0.56b  0.081  0.09  0.05  0.45      PPYR1  9.12  8.32  23.44  40.74  0.302  0.08  0.73  0.63      Occludin  1.32b  1.17b  2.40a  1.82a  0.078  <0.01  0.27  0.62      Claudin  0.79b  0.50b  0.95a  0.81a  0.007  <0.05  0.06  0.33      IL-1β  0.66b  0.44b  2.24a  1.35a  0.184  <0.01  0.28  0.94      TNFα  0.63b  0.83b  2.88a  1.35a  0.151  <0.01  0.50  0.15      IL6  7.24  5.37  8.91  19.95  0.244  0.18  0.65  0.34      TLR4  1.38b  1.17b  3.09a  2.57a  0.080  <0.001  0.35  0.95      TLR2  2.75b  0.83b  4.37a  5.62a  0.237  0.03  0.38  0.19      Defensin-β  3.31  2.57  5.50  10.72  0.243  0.10  0.72  0.43      BIAP  3.09  2.51  4.90  6.92  0.187  0.10  0.87  0.50      Lactoferrin  1.23b  1.15b  3.47a  1.86a  0.147  <0.01  0.33  0.42    Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  Left side of the caudal dorsal sac      FFA3  0.33  0.58  0.34  0.93  0.192  0.58  0.09  0.59      FFA2  0.85  0.85  0.87  0.74  0.217  0.68  0.88  0.88      DAD1A  0.80  0.68  0.83  0.74  0.277  0.93  0.81  0.96      ADRA2A  0.14  0.13  0.10  0.14  0.137  0.73  0.82  0.54      ADRA2B  0.41  0.49  0.46  0.39  0.079  0.77  0.98  0.37      ADRA2C  0.85b  0.81b  1.70a  1.38a  0.058  <0.01  0.31  0.58      PPYR1  3.98  5.25  3.72  4.68  0.255  0.87  0.65  0.96      Occludin  2.09  1.91  2.04  2.40  0.085  0.61  0.91  0.53      Claudin  0.69b  0.62b  1.15a  1.02a  0.0048  <0.001  0.29  0.91      IL-1β  5.50  5.13  3.72  5.37  0.180  0.69  0.71  0.60      TNFα  0.72b  0.83b  2.14a  1.51a  0.134  <0.01  0.72  0.43      IL-6  4.90  6.92  4.07  6.61  0.199  0.78  0.36  0.87      TLR4  1.86  2.29  0.76  3.98  0.342  0.81  0.24  0.37      TLR2  0.16  0.15  0.12  0.17  0.307  0.80  0.64  0.54      Defensin-β  1.51  2.04  0.62  1.07  0.185  0.08  0.33  0.75      BIAP  0.83  0.89  0.79  0.87  0.255  0.87  0.75  0.93      Lactoferrin  0.15  0.18  0.16  0.16  0.158  0.88  0.85  0.81  Left side of the cranial ventral sac      FFAR3  12.30  48.98  50.12  29.51  0.275  0.48  0.50  014      FFAR2  17.78  15.85  32.36  50.12  0.274  0.06  0.44  0.33      DAD1A  1.12  0.40  1.10  1.55  0.235  0.22  0.52  0.21      ADRA2A  0.16  0.13  0.13  0.23  0.218  0.71  0.77  0.43      ADRA2B  4.57  5.37  7.24  10.47  0.157  0.13  0.47  0.76      ADRA2C  0.66a  0.39b  0.79a  0.56b  0.081  0.09  0.05  0.45      PPYR1  9.12  8.32  23.44  40.74  0.302  0.08  0.73  0.63      Occludin  1.32b  1.17b  2.40a  1.82a  0.078  <0.01  0.27  0.62      Claudin  0.79b  0.50b  0.95a  0.81a  0.007  <0.05  0.06  0.33      IL-1β  0.66b  0.44b  2.24a  1.35a  0.184  <0.01  0.28  0.94      TNFα  0.63b  0.83b  2.88a  1.35a  0.151  <0.01  0.50  0.15      IL6  7.24  5.37  8.91  19.95  0.244  0.18  0.65  0.34      TLR4  1.38b  1.17b  3.09a  2.57a  0.080  <0.001  0.35  0.95      TLR2  2.75b  0.83b  4.37a  5.62a  0.237  0.03  0.38  0.19      Defensin-β  3.31  2.57  5.50  10.72  0.243  0.10  0.72  0.43      BIAP  3.09  2.51  4.90  6.92  0.187  0.10  0.87  0.50      Lactoferrin  1.23b  1.15b  3.47a  1.86a  0.147  <0.01  0.33  0.42  a,bMeans within a row with different superscripts are differ (P < 0.05). 1FFAR3 = free fatty acid receptor 3 (gpr41); FFAR2 = free fatty acid receptor 2 (gpr43); DAD1A = dopamine receptor subtype A1; ADRA2A = alpha 2-adrenergic receptor subtype A; ADRA2B = alpha 2-adrenergic receptor subtype B; ADRA2C = alpha 2-adrenergic receptor subtype C; PPYR1 = pancreatic polypeptide receptor 1; TLR4 = Toll-like receptor 4; TLR2 = Toll-like receptor 2; BIAP = intestinal alkaline phosphatase. 2No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 3SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 4Straw = No straw vs. straw; Form = meal vs. pellets. View Large Table 10. The rumen relative gene expression ratio from the left side caudal dorsal sac and the left side of the cranial ventral sac of the rumen of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  Left side of the caudal dorsal sac      FFA3  0.33  0.58  0.34  0.93  0.192  0.58  0.09  0.59      FFA2  0.85  0.85  0.87  0.74  0.217  0.68  0.88  0.88      DAD1A  0.80  0.68  0.83  0.74  0.277  0.93  0.81  0.96      ADRA2A  0.14  0.13  0.10  0.14  0.137  0.73  0.82  0.54      ADRA2B  0.41  0.49  0.46  0.39  0.079  0.77  0.98  0.37      ADRA2C  0.85b  0.81b  1.70a  1.38a  0.058  <0.01  0.31  0.58      PPYR1  3.98  5.25  3.72  4.68  0.255  0.87  0.65  0.96      Occludin  2.09  1.91  2.04  2.40  0.085  0.61  0.91  0.53      Claudin  0.69b  0.62b  1.15a  1.02a  0.0048  <0.001  0.29  0.91      IL-1β  5.50  5.13  3.72  5.37  0.180  0.69  0.71  0.60      TNFα  0.72b  0.83b  2.14a  1.51a  0.134  <0.01  0.72  0.43      IL-6  4.90  6.92  4.07  6.61  0.199  0.78  0.36  0.87      TLR4  1.86  2.29  0.76  3.98  0.342  0.81  0.24  0.37      TLR2  0.16  0.15  0.12  0.17  0.307  0.80  0.64  0.54      Defensin-β  1.51  2.04  0.62  1.07  0.185  0.08  0.33  0.75      BIAP  0.83  0.89  0.79  0.87  0.255  0.87  0.75  0.93      Lactoferrin  0.15  0.18  0.16  0.16  0.158  0.88  0.85  0.81  Left side of the cranial ventral sac      FFAR3  12.30  48.98  50.12  29.51  0.275  0.48  0.50  014      FFAR2  17.78  15.85  32.36  50.12  0.274  0.06  0.44  0.33      DAD1A  1.12  0.40  1.10  1.55  0.235  0.22  0.52  0.21      ADRA2A  0.16  0.13  0.13  0.23  0.218  0.71  0.77  0.43      ADRA2B  4.57  5.37  7.24  10.47  0.157  0.13  0.47  0.76      ADRA2C  0.66a  0.39b  0.79a  0.56b  0.081  0.09  0.05  0.45      PPYR1  9.12  8.32  23.44  40.74  0.302  0.08  0.73  0.63      Occludin  1.32b  1.17b  2.40a  1.82a  0.078  <0.01  0.27  0.62      Claudin  0.79b  0.50b  0.95a  0.81a  0.007  <0.05  0.06  0.33      IL-1β  0.66b  0.44b  2.24a  1.35a  0.184  <0.01  0.28  0.94      TNFα  0.63b  0.83b  2.88a  1.35a  0.151  <0.01  0.50  0.15      IL6  7.24  5.37  8.91  19.95  0.244  0.18  0.65  0.34      TLR4  1.38b  1.17b  3.09a  2.57a  0.080  <0.001  0.35  0.95      TLR2  2.75b  0.83b  4.37a  5.62a  0.237  0.03  0.38  0.19      Defensin-β  3.31  2.57  5.50  10.72  0.243  0.10  0.72  0.43      BIAP  3.09  2.51  4.90  6.92  0.187  0.10  0.87  0.50      Lactoferrin  1.23b  1.15b  3.47a  1.86a  0.147  <0.01  0.33  0.42    Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  Left side of the caudal dorsal sac      FFA3  0.33  0.58  0.34  0.93  0.192  0.58  0.09  0.59      FFA2  0.85  0.85  0.87  0.74  0.217  0.68  0.88  0.88      DAD1A  0.80  0.68  0.83  0.74  0.277  0.93  0.81  0.96      ADRA2A  0.14  0.13  0.10  0.14  0.137  0.73  0.82  0.54      ADRA2B  0.41  0.49  0.46  0.39  0.079  0.77  0.98  0.37      ADRA2C  0.85b  0.81b  1.70a  1.38a  0.058  <0.01  0.31  0.58      PPYR1  3.98  5.25  3.72  4.68  0.255  0.87  0.65  0.96      Occludin  2.09  1.91  2.04  2.40  0.085  0.61  0.91  0.53      Claudin  0.69b  0.62b  1.15a  1.02a  0.0048  <0.001  0.29  0.91      IL-1β  5.50  5.13  3.72  5.37  0.180  0.69  0.71  0.60      TNFα  0.72b  0.83b  2.14a  1.51a  0.134  <0.01  0.72  0.43      IL-6  4.90  6.92  4.07  6.61  0.199  0.78  0.36  0.87      TLR4  1.86  2.29  0.76  3.98  0.342  0.81  0.24  0.37      TLR2  0.16  0.15  0.12  0.17  0.307  0.80  0.64  0.54      Defensin-β  1.51  2.04  0.62  1.07  0.185  0.08  0.33  0.75      BIAP  0.83  0.89  0.79  0.87  0.255  0.87  0.75  0.93      Lactoferrin  0.15  0.18  0.16  0.16  0.158  0.88  0.85  0.81  Left side of the cranial ventral sac      FFAR3  12.30  48.98  50.12  29.51  0.275  0.48  0.50  014      FFAR2  17.78  15.85  32.36  50.12  0.274  0.06  0.44  0.33      DAD1A  1.12  0.40  1.10  1.55  0.235  0.22  0.52  0.21      ADRA2A  0.16  0.13  0.13  0.23  0.218  0.71  0.77  0.43      ADRA2B  4.57  5.37  7.24  10.47  0.157  0.13  0.47  0.76      ADRA2C  0.66a  0.39b  0.79a  0.56b  0.081  0.09  0.05  0.45      PPYR1  9.12  8.32  23.44  40.74  0.302  0.08  0.73  0.63      Occludin  1.32b  1.17b  2.40a  1.82a  0.078  <0.01  0.27  0.62      Claudin  0.79b  0.50b  0.95a  0.81a  0.007  <0.05  0.06  0.33      IL-1β  0.66b  0.44b  2.24a  1.35a  0.184  <0.01  0.28  0.94      TNFα  0.63b  0.83b  2.88a  1.35a  0.151  <0.01  0.50  0.15      IL6  7.24  5.37  8.91  19.95  0.244  0.18  0.65  0.34      TLR4  1.38b  1.17b  3.09a  2.57a  0.080  <0.001  0.35  0.95      TLR2  2.75b  0.83b  4.37a  5.62a  0.237  0.03  0.38  0.19      Defensin-β  3.31  2.57  5.50  10.72  0.243  0.10  0.72  0.43      BIAP  3.09  2.51  4.90  6.92  0.187  0.10  0.87  0.50      Lactoferrin  1.23b  1.15b  3.47a  1.86a  0.147  <0.01  0.33  0.42  a,bMeans within a row with different superscripts are differ (P < 0.05). 1FFAR3 = free fatty acid receptor 3 (gpr41); FFAR2 = free fatty acid receptor 2 (gpr43); DAD1A = dopamine receptor subtype A1; ADRA2A = alpha 2-adrenergic receptor subtype A; ADRA2B = alpha 2-adrenergic receptor subtype B; ADRA2C = alpha 2-adrenergic receptor subtype C; PPYR1 = pancreatic polypeptide receptor 1; TLR4 = Toll-like receptor 4; TLR2 = Toll-like receptor 2; BIAP = intestinal alkaline phosphatase. 2No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 3SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 4Straw = No straw vs. straw; Form = meal vs. pellets. View Large The relative expression ratio of adra2c was greater (P < 0.01) in the caudal dorsal sac and tended (P = 0.09) to be greater in the cranial ventral sac, and the relative expression ratio of ffar3 (P = 0.06) and pancreatic polypeptide receptor 1 (P = 0.08) tended to be greater in bulls provided straw compared with bulls with no straw provision (Table 10). In addition, the relative expression ratio of occludin and claudin (genes coding for protein of the tight junction) in the caudal dorsal sac and in the cranial ventral sac of the rumen were greater (P < 0.05) for bulls provided straw compared with those without straw provision. In the cranial ventral sac of the rumen, the relative expression ratio of genes coding for proinflammatory cytokines genes il-1β (P < 0.01) and tnfα (P < 0.01), also in the caudal dorsal sac, and genes coding for pattern recognition receptors, such as Toll-like receptors trl4 (P < 0.001) and trl2 (P < 0.05), antimicrobial peptides expressed by intestinal cells defensin (P = 0.10), intestinal alkaline phosphatase (P = 0.10), and lactoferrin (P < 0.05) were greater in rumens of bulls provided straw compared with those with no straw provision. The relative expression ratio of adra2a (gene coding for the production and turnover of neurotransmitters) tended (P = 0.09) to be greater in bulls fed meal when straw was provided compared with bulls fed pellets, whereas when no straw was provided, the opposite has been observed (Table 11). The relative expression ratio of defensin (P = 0.05) and intestinal alkaline phosphatase (P = 0.05), antimicrobial peptides expressed by intestinal cells, was less than when straw was provided and pellets were fed, whereas when no straw was provided, meal presentation had contradictory effects depending on the gene analyzed. Lastly, in the cecum, the relative expression ratio of the genes coding proinflammatory cytokines such as il-1β (P < 0.05) was greater in bulls that were not provided straw compared with bulls provided straw. However, the relative expression ratio of lactoferrin, an antimicrobial peptides released by intestinal cells, was lesser (P < 0.05) in bulls that were not provided straw compared with bulls provided straw. Table 11. The cecum relative gene expression ratio of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  FFAR3  1.62  2.95  1.86  2.09  0.217  0.85  0.49  0.61  FFAR2  0.33  0.34  0.30  0.16  0.214  0.34  0.46  0.43  DAD1A  0.74  1.95  1.55  1.95  0.365  0.66  0.48  0.65  ADRA2A  0.87  1.82  4.07  1.66  0.206  0.14  0.85  0.09  ADRA2B  1.23  1.51  1.32  2.19  0.123  0.47  0.21  0.60  ADRA2C  0.84  1.95  4.90  1.78  0.341  0.30  0.92  0.25  PPYR1  0.55  1.38  0.82  0.33  0.285  0.43  0.98  0.17  Occludin  0.21  0.35  0.13  0.15  0.339  0.18  0.55  0.52  Claudin  0.35  0.36  0.20  0.08  0.233  0.23  0.54  0.70  IL-1β  0.39a  0.40a  0.07b  0.05b  0.307  <0.05  0.87  0.85  TNFα  0.06  0.14  0.04  0.04  0.349  0.28  0.68  0.49  IL6  0.22  0.13  0.17  0.05  0.223  0.23  0.12  0.51  TLR4  1.00  0.55  0.66  1.00  0.234  0.70  0.76  0.67  TLR2  0.59  2.34  0.46  0.28  0.319  0.12  0.54  0.20  Defensin- β  0.69b  2.24a  2.88a  0.79b  0.238  0.73  0.90  <0.05  BIAP  0.66b  2.09a  2.19a  1.02ab  0.176  0.54  0.63  <0.05  Lactoferrin  0.20a  0.63a  0.01b  0.002b  0.548  <0.01  0.94  0.41    Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  FFAR3  1.62  2.95  1.86  2.09  0.217  0.85  0.49  0.61  FFAR2  0.33  0.34  0.30  0.16  0.214  0.34  0.46  0.43  DAD1A  0.74  1.95  1.55  1.95  0.365  0.66  0.48  0.65  ADRA2A  0.87  1.82  4.07  1.66  0.206  0.14  0.85  0.09  ADRA2B  1.23  1.51  1.32  2.19  0.123  0.47  0.21  0.60  ADRA2C  0.84  1.95  4.90  1.78  0.341  0.30  0.92  0.25  PPYR1  0.55  1.38  0.82  0.33  0.285  0.43  0.98  0.17  Occludin  0.21  0.35  0.13  0.15  0.339  0.18  0.55  0.52  Claudin  0.35  0.36  0.20  0.08  0.233  0.23  0.54  0.70  IL-1β  0.39a  0.40a  0.07b  0.05b  0.307  <0.05  0.87  0.85  TNFα  0.06  0.14  0.04  0.04  0.349  0.28  0.68  0.49  IL6  0.22  0.13  0.17  0.05  0.223  0.23  0.12  0.51  TLR4  1.00  0.55  0.66  1.00  0.234  0.70  0.76  0.67  TLR2  0.59  2.34  0.46  0.28  0.319  0.12  0.54  0.20  Defensin- β  0.69b  2.24a  2.88a  0.79b  0.238  0.73  0.90  <0.05  BIAP  0.66b  2.09a  2.19a  1.02ab  0.176  0.54  0.63  <0.05  Lactoferrin  0.20a  0.63a  0.01b  0.002b  0.548  <0.01  0.94  0.41  a,bMeans within a row with different superscripts are differ (P < 0.05). 1FFAR3 = free fatty acid receptor 3 (gpr41); FFAR2 = free fatty acid receptor 2 (gpr43); DAD1A = dopamine receptor subtype A1; ADRA2A = alpha 2-adrenergic receptor subtype A; ADRA2B = alpha 2-adrenergic receptor subtype B; ADRA2C = alpha 2-adrenergic receptor subtype C; PPYR1 = pancreatic polypeptide receptor 1; TLR4 = Toll-like receptor 4; TLR2 = Toll-like receptor ; BIAP = intestinal alkaline phosphatase. 2No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 3SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 4Straw = No straw vs. straw; Form = meal vs. pellets. View Large Table 11. The cecum relative gene expression ratio of Holstein bulls fed high-concentrate diets in 2 forms (meal or pellets) with or without straw   Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  FFAR3  1.62  2.95  1.86  2.09  0.217  0.85  0.49  0.61  FFAR2  0.33  0.34  0.30  0.16  0.214  0.34  0.46  0.43  DAD1A  0.74  1.95  1.55  1.95  0.365  0.66  0.48  0.65  ADRA2A  0.87  1.82  4.07  1.66  0.206  0.14  0.85  0.09  ADRA2B  1.23  1.51  1.32  2.19  0.123  0.47  0.21  0.60  ADRA2C  0.84  1.95  4.90  1.78  0.341  0.30  0.92  0.25  PPYR1  0.55  1.38  0.82  0.33  0.285  0.43  0.98  0.17  Occludin  0.21  0.35  0.13  0.15  0.339  0.18  0.55  0.52  Claudin  0.35  0.36  0.20  0.08  0.233  0.23  0.54  0.70  IL-1β  0.39a  0.40a  0.07b  0.05b  0.307  <0.05  0.87  0.85  TNFα  0.06  0.14  0.04  0.04  0.349  0.28  0.68  0.49  IL6  0.22  0.13  0.17  0.05  0.223  0.23  0.12  0.51  TLR4  1.00  0.55  0.66  1.00  0.234  0.70  0.76  0.67  TLR2  0.59  2.34  0.46  0.28  0.319  0.12  0.54  0.20  Defensin- β  0.69b  2.24a  2.88a  0.79b  0.238  0.73  0.90  <0.05  BIAP  0.66b  2.09a  2.19a  1.02ab  0.176  0.54  0.63  <0.05  Lactoferrin  0.20a  0.63a  0.01b  0.002b  0.548  <0.01  0.94  0.41    Treatment2        No straw  Straw    P-value4  Gene1  Meal  Pellet  Meal  Pellet  SEM3  Straw  Form  Straw × form  FFAR3  1.62  2.95  1.86  2.09  0.217  0.85  0.49  0.61  FFAR2  0.33  0.34  0.30  0.16  0.214  0.34  0.46  0.43  DAD1A  0.74  1.95  1.55  1.95  0.365  0.66  0.48  0.65  ADRA2A  0.87  1.82  4.07  1.66  0.206  0.14  0.85  0.09  ADRA2B  1.23  1.51  1.32  2.19  0.123  0.47  0.21  0.60  ADRA2C  0.84  1.95  4.90  1.78  0.341  0.30  0.92  0.25  PPYR1  0.55  1.38  0.82  0.33  0.285  0.43  0.98  0.17  Occludin  0.21  0.35  0.13  0.15  0.339  0.18  0.55  0.52  Claudin  0.35  0.36  0.20  0.08  0.233  0.23  0.54  0.70  IL-1β  0.39a  0.40a  0.07b  0.05b  0.307  <0.05  0.87  0.85  TNFα  0.06  0.14  0.04  0.04  0.349  0.28  0.68  0.49  IL6  0.22  0.13  0.17  0.05  0.223  0.23  0.12  0.51  TLR4  1.00  0.55  0.66  1.00  0.234  0.70  0.76  0.67  TLR2  0.59  2.34  0.46  0.28  0.319  0.12  0.54  0.20  Defensin- β  0.69b  2.24a  2.88a  0.79b  0.238  0.73  0.90  <0.05  BIAP  0.66b  2.09a  2.19a  1.02ab  0.176  0.54  0.63  <0.05  Lactoferrin  0.20a  0.63a  0.01b  0.002b  0.548  <0.01  0.94  0.41  a,bMeans within a row with different superscripts are differ (P < 0.05). 1FFAR3 = free fatty acid receptor 3 (gpr41); FFAR2 = free fatty acid receptor 2 (gpr43); DAD1A = dopamine receptor subtype A1; ADRA2A = alpha 2-adrenergic receptor subtype A; ADRA2B = alpha 2-adrenergic receptor subtype B; ADRA2C = alpha 2-adrenergic receptor subtype C; PPYR1 = pancreatic polypeptide receptor 1; TLR4 = Toll-like receptor 4; TLR2 = Toll-like receptor ; BIAP = intestinal alkaline phosphatase. 2No straw = Concentrate fed ad libitum; straw was not fed; Straw = concentrate and straw both fed ad libitum in separate feeders; Meal = concentrate presentation form was meal; Pellet = concentrate presentation form was pellet. 3SEM are derived from statistical analyses of base 10 log-transformed data, and means are back-transformed values. 4Straw = No straw vs. straw; Form = meal vs. pellets. View Large DISCUSSION Behavior, Rumen Lesions, and Fermentation The objectives of the present study were to evaluate the effects of straw provision and presentation form on behavior, rumen macro- and microscopic evaluation, and expression of genes in the rumen and in the cecum related to the gut–brain crosstalk mechanisms that could be involved in behavioral responses in Holstein bulls. The nutritional strategies evaluated were successful in modifying behavior, with the lack of straw provision having the greatest impact by increasing abnormal behaviors and increasing behaviors such as nonnutritive oral behavior. Bergeron et al. (2006) reviewed stereotypic or abnormal oral behavior in captive ungulates and described in cattle 2 abnormal behaviors: tongue rolling (designated as stereotypy in the present study) and object licking (designated as nonnutritive oral behaviors herein). These authors indicated that ruminants restrictively fed low-fiber diets display these abnormal behaviors. Studies have reported an increase in tongue rolling (Faleiro et al., 2011) and other abnormal oral behaviors (Redbo and Nordblad, 1997) when diets with limited amounts of forage were fed. Bergeron et al. (2006) suggested that low chewing time (feeding/ruminating) could be a key predictor of postprandial abnormal oral behavior. There are 3 hypotheses (Bergeron et al., 2006) that could explain the origin of oral stereotypies in ungulates: 1) a deficiency of some nutrient (fiber) for which cattle are inherently motivated to obtain, 2) insufficient time devoted to chewing and ruminating leaving animals with unfulfilled motivations, and 3) a consequence of gut dysfunction (such as rumen acidosis). The first 2 hypotheses imply that animal frustration occurs due to the inability to obtain a resource for which there is motivation; in the present study, the lack of straw provision implied that animals were fed a fiber-deficient diet and rumination activity decreased, supporting these first 2 theories. In foals, a link between oral abnormal behavior and gastrointestinal tract lesions (ulcers or gastritis) has been reported (Nicol et al., 2002). However, in ruminants, the link between gastrointestinal lesions and behavior has not been observed, probably because in the previous studies (Sato et al., 1992) evaluating such relationships, a low incidence of ruminal acidosis was recorded. In the present study, when bulls had no access to straw, rumination activity decreased and abnormal oral behaviors increased together with an increase in rumen lesions (rumen papillae clumping, hair presence, and rumen papillae vacuoles) and low rumen pH values (<5.6), indicating that these animals may suffer a gastrointestinal dysfunction. A ruminal pH below 5.6 is commonly considered the threshold for ruminal acidosis (Nagaraja and Titgemeyer, 2007). There is debate regarding the biological significance of these abnormal oral behaviors: it could be that these behaviors exert positive consequences (i.e., saliva generation alleviating rumen acidosis) or that they represent an attempt to cope with a stressful situation, which would reflect stress or anxiety. Obviously, data of the present study cannot resolve this debate. However, our results indicate that for bulls exposed to diets that increase abnormal oral behaviors (i.e., absence of straw), ruminal pH is low, suggesting that performing these behaviors was not sufficient to avoid low ruminal pH. In the present study, straw provision reduced oral nonnutritive behaviors and rumen lesions; however, concentrate presentation form also had an impact, albeit to a lesser extent. As previously observed (Kertz et al., 1981), when lactating cows were fed their concentrate in meal form, they spent more time eating, probably because more effort is needed to consume meal concentrate compared with pellets. Also, some interactions between straw provision and concentrate presentation form were observed. Rumen wall color was darker when meal was fed with straw compared with when pellets were fed with straw, and when no straw was provided, no differences in rumen wall color were observed between presentations forms and the color was lighter compared with rumen walls of animals fed with straw. Previous studies (Hironaka et al., 1979; Greenwood et al., 1997; Beharka et al., 1998) have shown that feed characteristics such as particle size and its abrasive ability on rumen epithelia can modify macro- and microscopic morphology of the rumen such as papillae fusion, keratinization, and branch-chained papillae. Lastly, the effect of concentrate presentation form on ruminal pH was different depending on straw provision. As observed by Cullison (1961), when straw was provided, ruminal pH measured at the slaughterhouse increased, but the magnitude was greater when a meal form was fed compared with when pellets were fed. Straw provision enhances rumination and salivation; the increase in salivation helps ruminal pH regulation. However, pelleting increases starch availability (Svihus et al., 2005), and in turn, ruminal fermentation may drive a reduction in ruminal pH as observed in the present study. Gut–Brain Crosstalk Mechanisms: Rumen and Cecum VFA and Expression of Genes in the Rumen and Cecum Epithelia In the present study, straw provision and concentrate presentation form modified the expression of genes studied in the rumen but not in the cecum, and most effects were observed in the cranial ventral sac of the rumen. The variation among rumen sites is in accordance with previous studies that indicate that there is a within-rumen variation in rumen papillae morphology (Lesmeister et al., 2004). In nonruminant studies, as described in the introduction, some gut–brain crosstalk mechanisms have been described in the small intestine and in the colon and cecum. However, in the present study most differences between treatments were observed in the expression of genes of the rumen rather than in the cecum epithelium, suggesting that in the rumen, some of those crosstalk mechanisms could take place. To simplify the discussion, we will be mainly focusing on the results from the cranial ventral sac. It is important to note that this study was performed based on mRNA quantification by qPCR. This approach does not consider morphological data (receptor autoradiography), and the high sensitivity of mRNA measurement by PCR implies that small amounts of normal cells expressing receptors may overestimate the receptor expression of the main target cells. Lastly, although gene expression is not a direct measure of its action on intestinal cells and there may be also infiltration of other cell types, it provides a basis for inferring the gut–brain crosstalk mechanisms described in nonruminants. The present results will further provide the basis to better study the mechanisms of the gut–brain crosstalk, including a detection of the receptor protein itself and the receptor-binding sites in the target cells (Rehfeld, 2014). The most relevant effects of the lack of straw provision was the increase of the expression of genes ffar3, ppyr1, and adra2c, receptors involved in the production and turnover of neurotransmitters. Neuropeptides are important mediators within the nervous system and between neurons and other cell types. The expression of ffar3 is mainly stimulated by VFA produced in the gut (in the following order: propionate, butyrate, and acetate) and its physiological role includes the stimulation of the secretion of peptide YY (PYY) and serotonin (Evans et al., 2013). Serotonin is a monoamine neurotransmitter that is involved in the regulation of learning, mood, sleep, anxiety, and other psychiatry-related afflictions, and recently it has been studied as a signaling molecule linking the brain and the gut (Evans et al., 2013). Whereas PYY is almost exclusively expressed by enteroendocrine cells, neuropeptide Y (NPY) is found at all levels of the gut–brain and brain–gut axis (Holzer et al., 2012; Holzer and Farzi, 2014) and exerts its biological action via NPY receptors. Direct evidence that neuropeptides such as NPY contribute to the communication between gut microbial community and the central nervous system is scarce (Holzer and Farzi, 2014); it awaits further analyses to elucidate whether the behavioral disturbances associated with dysbiosis of the gut microbiota are likewise under the control of neuropeptide Y/ peptide Y (NPY/Y) receptor system and if the NPY/Y system plays a role in the impact of the gut microbiota on visceral pain sensitivity. In the present study, the expression of the gene coding for Y receptor, subtype 1, in the rumen tended to be greater in animals with straw provision, which also had fewer abnormal oral behaviors compared with those without straw provision. Alpha 2-adrenergic receptors are also reported to be present in the gut epithelial cells (de Jonge, 2013; Sudo, 2014). They are stimulated by luminal neurotransmitters—catecholamines, such as norepinephrine and dopamine—that regulate various types of body functions such as cognitive abilities, mood, and gut motility (Sudo, 2014). Some species of microorganisms can produce catecholamines (Wall et al., 2014). Alpha 2-adrenergic receptors are also involved with the modulation of enteric sensory afferents (de Jonge, 2013); dendritic cell functions may be modulated by the sympathetic nervous system via the local release of norepinephrine. In the presence of antigens or microbial products such as agonists for TRL-2 and TRL-4, norepinephrine inhibits dendritic cell migration, antigen presentation, and T-helper cell priming; this effect mediated by adrenergic receptors in dendritic cells may limit potentially damaging reactions (Elenkov et al., 2000; Kohm and Sanders, 2001; Sanders and Straub 2002). In the present study, bulls provided straw tended to have an increased expression of adra2c; it could be hypothesized that this may have limited the potentially damaging reactions expected because these animals had also an increased expression of genes involved with inflammatory response and these bulls had less rumen tissue damage (vacuole grading, papillae clumping, etc.) compared with bulls deprived of straw. The lack of straw provision decreased the expression of occludin and claudin, 2 tight junction proteins involved in the integrity of the intestinal barrier. The integrity of this barrier is important to avoid paracellular permeability, which could lead to systemic infections. Systemic infections, and the consequent inflammation, can lead the redirection of tryptophan for kynurenine instead for serotonin (Myint et al., 2012), decreasing serotonin levels; this decrease in serum serotonin levels may lead to a more anxious behavior. The integrity of the gut barrier is affected by stress, microbiota, and inflammation (Alonso et al., 2014). Surprisingly, tumor necrosis factor alpha downregulates the expression of occludin (Mankertz et al., 2000), and in the present study, in bulls with no straw provision, the expression of occludin and tnfα were both downregulated compared with bulls with straw provision. As previously discussed, other mechanisms may have limited the potentially damaging reactions of an increased inflammatory response. Lastly, mucosal immune regulation, another mechanism involved in the gut–brain crosstalk, was affected by nutritional strategies. When bulls were provided straw, in contrast to what might be expected, the expression of proinflammatory cytokines ilß, and tnfα and of pattern recognition receptors such as tlr4 (involved in recognition of endotoxin of gram-negative bacteria) and tlr2 (involved in the response to microbial lipoproteins and peptidoglicans of mycobacteria, Gram-positive bacteria, and yeast) increased. Antimicrobial peptides expressed by intestinal cells such as defensin (permeabilizes bacterial cell membrane and regulates anti-inflammatory response), BIAP (intestinal alkaline phosphatase; a standard marker of crypt–villus differentiation, which also plays a role modulating gut microflora and preventing inflammation and infection), and lactoferrin (expressed in epithelial and immune cells; its antimicrobial activity might not just be limited in regulating the free-iron levels; it also modulates inflammation) were also increased when straw was provided. These results were not expected because when straw was provided, macro- and microscopic evaluation of the rumen suggested that the rumen wall was healthier (less clumping, absence of hair, and less vacuola grading) compared with that of bulls with no straw provision. However, we cannot discard that slightly higher rates of inflammation and antimicrobial peptides could be related to healthier tissue, conferring the capacity to fight against infection and modulate the tissue integrity. A recent study (Dionissopoulos et al., 2012) indicated that cascade mediators could be necessary to remodel the extracellular matrix; for example, TNFα is associated with the modulation of metalloproteinases, which degrade and contribute to matrix remodeling (Han et al., 2001). Probably in most studies where high-concentrate diets are fed, this upregulating effect on inflammation and a downregulating effect on tight junctions were observed; these studies were conducted either in extreme dietary situations (all forage vs. all concentrate) or in short periods of feeding challenges (Liu et al., 2013, 2015). In the present study, bulls were fed these diets for a long duration (165 d) and the increase by straw of the expression of genes related to a proinflammatory response of the rumen tissue might be part of a wound-healing response. As previously discussed, other mechanisms that limit the damaging consequences of this healing process could be upregulated. On the other hand, in bulls not provided straw, this wound-healing process may be overwhelmed and the damaging consequences could not be avoided (less occludin expression, papillae clumping, and vacuole grading). Supporting this hypothesis, Penner et al. (2011) hypothesized that there is a change in the expression of genes involved in the inflammatory response over time under a grain challenge. Lastly, up- or downregulation of genes related to inflammation is difficult to interpret and, probably, a controlled inflammatory state is desired. The lack of straw provision decreased the rumen molar percentage of butyrate at the slaughterhouse. Bacterial metabolites are also involved in the gut–brain crosstalk mechanisms (Borre et al., 2014; Carabotti et al., 2015). Volatile fatty acids are involved in this crosstalk through the stimulation of free fatty acids as previously described, epithelial proliferation (Sakata and Yajima, 1984), and maintenance of epithelial barrier integrity (Bordin et al., 2004; Peng et al., 2009). In the present study, the lack of straw provision reduced rumen butyrate molar proportion without decreasing papillae size. Some authors (Penner et al., 2011) have hypothesized that butyrate does not directly promote epithelial proliferation but that hormones regulate the proliferative action. Dionissopoulos et al. (2012) reported that rumen butyrate increased following a high-grain challenge but steadily decreased over time. Results from intestinal tissue suggest that butyrate promotes tight-junction protein expression by enhancing the assembly of tight cell junctions (Bordin et al., 2004; Peng et al., 2009); however, in the present study, rumen tissue from bulls provided straw had a greater expression of genes involved in gut barrier integrity and lesser rumen butyrate molar proportion, indicating that, probably, rumen butyrate is not the only mechanism in the rumen involved in the expression of genes involved in the gut barrier integrity. In summary, straw provision was the nutritional factor that most affected behavior, macro- and microscopic rumen lesions, and rumen expression of genes related to the possible crosstalk mechanisms between the microbes and the brain in bulls fed high-concentrate diets over 2 mo. LITERATURE CITED Alonso A. Vicario M. Pigray M. Lobo B. Santos J. 2014. Instestinal barrier function and the brain-gut axis. In: Lyte M. Cryan J. F. editors, Microbial endocrinology: The microbiota-gut-brain axis in health and disease.  Springer, New York, NY. p. 73– 114. AOAC 1995. Official methods of analysis. 16th ed. AOAC Int., Arlington, VA. Beharka A. A. Nagaraja T. G. Morrill J. L. Kennedy G. A. Klemm R. D. 1998. Effects of form of the diet on anatomical, microbial, and fermentative development of the rumen of neonatal calves. J. Dairy Sci.  81: 1946– 1955. Google Scholar CrossRef Search ADS PubMed  Bergeron R. Badnell-Waters A. J. Lambton S. Mason G. 2006. Stereotypic oral behaviour in captive ungulates: Foraging, diet and gastrointestinal function. In: Mason G. Rushen J. editors, Stereotypic animal behaviour. Fundamentals and applications to welfare.  CAB International, Oxfordshire, UK. p. 19– 57. doi: https://doi.org/10.1079/9780851990040.0019 Google Scholar CrossRef Search ADS   Bordin M. d'Atri F. Guillemot L. Citi S. 2004. Histone deacetylase inhibitors up-regulate the expression of tight junction proteins. Mol. Cancer Res.  2: 692– 701. Google Scholar PubMed  Borre Y. E. Moloney R. D. Clarke G. Dinan T. G. Cryan J. F. 2014. The impact of microbiota on brain and behavior: Mechanisms & therapeutic potential. In: Lyte M. Cryan J. F. editors, Microbial endocrinology: The microbiota-gut-brain axis in health and disease.  Springer, New York, NY. p. 373– 403. doi: https://doi.org/10.1007/978-1-4939-0897-4_17 Google Scholar CrossRef Search ADS   Brown H. Bing R. F. Grueter H. P. Mc Askill J. W. Cooley C. O. Rathmacher R. P. 1975. Tylosin and chlortetracycline for the prevention of liver abscesses, improved weight gains and feed efficiency in feedlot cattle. J. Anim. Sci.  40: 207– 213. Google Scholar CrossRef Search ADS PubMed  Carabotti M. Scirocco A. Maselli M. A. Severi C. 2015. The gut-brain axis: Interactions between enteric microbiota, central, and enteric nervous systems. Ann. Gastroenterol.  28: 1– 7. Google Scholar PubMed  Castrillo C. Mota M. Van Laar H. Martín-Tereso J. Gimeno A. 2013. Effect of compound feed pelleting and die diameter on rumen fermentation in beef cattle fed high concentrate diets. Anim. Feed Sci. Technol.  180: 34– 43. doi: https://doi.org/10.1016/j.anifeedsci.2013.01.004 Google Scholar CrossRef Search ADS   Colgan P. W. 1978. Quantitative ethology. Wiley, New York. Cullison A. E. 1961. Effect of physical form of the ration on steer performance and certain rumen phenomena. J. Anim. Sci.  20: 478– 483. Google Scholar CrossRef Search ADS   de Jonge W. J. 2013. The gut's little brain in control of intestinal immunity. ISRN Gastroenterol.  2013: 1– 17. doi: https://doi.org/10.1155/2013/630159 Google Scholar CrossRef Search ADS   Dionissopoulos L. Steele M. A. AlZahal O. Mc Bride B. W. 2012. Adaptation to high grain diets proceeds through minimal immune system stimulation and differences in extracellular matrix protein expression in a model of subacute ruminal acidosis in non-lactating dairy cows. Am. J. Anim. Vet. Sci.  7: 84– 91. doi: https://doi.org/10.3844/ajavsp.2012.84.91 Google Scholar CrossRef Search ADS   Eaton A. D. Clesceri L. S. Rice E. W. Greenberg A. E. editors. 2005. Method 5560-D Organic and volatile acids. In: Standard methods for the examination of water and wastewater.  21st ed. American Public Health Association, American Water Works Association, and Water Environment Federation, Washington, DC. Elenkov I. J. Wilder R. L. Chrousos G. P. Vizi E. S. 2000. The sympathetic nerve – An integrative interface between two supersystems: The brain and the immune system. Pharmacol. Rev.  52: 595– 638. Google Scholar PubMed  Evans J. M. Morris L. S. Marchesi J. R. 2013. The gut microbiome: The role of a virtual organ in the endocrinology of the host. J. Endocrinol.  218: R37– R47. doi: https://doi.org/10.1530/JOE-13-0131 Google Scholar CrossRef Search ADS PubMed  Faleiro A. G. González L. A. Blanch M. Cavini S. Castells L. Ruiz de la Torre J. L. Manteca X. Calsamiglia S. Ferret A. 2011. Performance, ruminal changes, behavior and welfare of growing heifers fed a concentrate diets with or without barley straw. Animal  5: 294– 303. doi: https://doi.org/10.1017/S1751731110001904 Google Scholar CrossRef Search ADS PubMed  Ferret A. Calsamiglia S. Bach A. Devant M. Fernández C. García-Rebollar P. editors. 2008. Necesidades nutricionales para rumiantes de cebo: Normas FEDNA. (In Spanish.)http://www.fundacionfedna.org/sites/default/files/NORMAS_RUMIANTES_2008.pdf. (Accessed January 2015.) Foster J. A. McVey Neufeld K. 2013. Gut-brain axis: How the microbiome influences anxiety and depression. Trends Neurosci.  36: 305– 312. doi: https://doi.org/10.1016/j.tins.2013.01.005 Google Scholar CrossRef Search ADS PubMed  Greenwood R. H. Morrill J. L. Titgemeyer E. C. Kennedy G. A. 1997. A new method of measuring diet abrasion and its effect on the development of the forestomach. J. Dairy Sci.  80: 2534– 2541. doi: https://doi.org/10.3168/jds.S0022-0302(97)76207-6 Google Scholar CrossRef Search ADS PubMed  Gonyou H. W. 1994. Why the study of animal behavior is associated with the animal welfare issue. J. Anim. Sci.  72: 2171– 2177. Google Scholar CrossRef Search ADS PubMed  González J. M. Garcia de Jalón J. A. Askar A. R. Guada J. A. Ferrer L. M. de las Heras M. 2001. Efecto de la dieta con cebada y nucleo proteico sobre la patología ruminal en corder- os. In: XXVI Jornadas de la SEOC, Sevilla, Spain. p. 733– 739. Han Y. Tuan T. Wu H. Hughes M. Garner W. L. 2001. TNF-alpha stimulates activation of pro-MMP2 in human skin through NF-(kappa)B mediated induction of MT1-MMP. J. Cell Sci.  114: 131– 139. Google Scholar PubMed  Heinrichs A. J. Jones C. M. Heinrichs B. S. 2003. Effects of mannan oligosaccharide or antibiotics in neonatal diets on health and growth of dairy calves. J. Dairy Sci.  86: 4064– 4069. doi: https://doi.org/10.3168/jds.S0022-0302(03)74018-1 Google Scholar CrossRef Search ADS PubMed  Hill S. R. Hopkins B. A. Davidson S. Bolt S. M. Diaz D. E. Brownie C. Brown T. Huntington G. B. Whitlow L. W. 2005. Technical note: Technique for dissection and analysis of the rumen in young calves. J. Dairy Sci.  88: 324– 326. doi: https://doi.org/10.3168/jds.S0022-0302(05)72691-6 Google Scholar CrossRef Search ADS PubMed  Hironaka R. Kimura N. Kozub G. C. 1979. Influence of feed particle size on rate and efficiency of gain, characteristics of rumen fluid and rumen epithelium, and numbers of rumen protozoa. Can. J. Anim. Sci.  59: 395– 402. doi: https://doi.org/10.4141/cjas79-049 Google Scholar CrossRef Search ADS   Holzer P. Farzi A. 2014. Neuropeptides and the microbiota-gut-brain axis. In: Lyte M. Cryan J. F. editors, Microbial endocrinology: The microbiota-gut-brain axis in health and disease.  Springer, New York, NY. p. 195– 220. Google Scholar CrossRef Search ADS   Holzer P. Reichmann F. Farzi A. 2012. Neuropeptide Y, peptide YY and pancreatic polypeptide in the gut-brain axis. Neuropeptides  46: 261– 274. doi: https://doi.org/10.1016/j.npep.2012.08.005 Google Scholar CrossRef Search ADS PubMed  Johnson R. H. Brown L. R. Jacobson N. L. Homeyer P. G. 1958. Effectiveness and practicability of some oils, penicillin, n-decyl alcohol, and lecithin in the control of alfalfa bloat. J. Anim. Sci.  17: 893– 902. Google Scholar CrossRef Search ADS   Jounay J. P. 1982. Volatile fatty acids and alcohol determination in digestive contents, silage juice, bacterial cultures and anaerobic fermentor contents. Sci. Aliments  2: 131– 144. Kertz A. F. Darcy B. K. Prewitt L. R. 1981. Eating rate of lactating cows fed four physical forms of the same grain ration. J. Dairy Sci.  64: 2388– 2391. doi: https://doi.org/10.3168/jds.S0022-0302(81)82861-5 Google Scholar CrossRef Search ADS   Kohm A. P. Sanders V. M. 2001. Norepinephrine and β2-adrenergic receptor stimulation regulate CD4+ T and B lymphocyte function in vitro and in vivo. Pharmacol. Rev.  53: 487– 525. Google Scholar PubMed  Lesmeister K. E. Tozer P. R. Heinrichs A. J. 2004. Development and analysis of a rumen tissue sampling procedure. J. Dairy Sci.  87: 1336– 1344. doi: https://doi.org/10.3168/jds.S0022-0302(04)73283-X Google Scholar CrossRef Search ADS PubMed  Liu J. H. Bian G. R. Zhu W. Y. Mao S. Y. 2015. High-grain feeding causes strong shifts in ruminal epithelial bacterial community and expression of Toll-like receptor genes in goats. Front. Microbiol.  6: 167. doi: https://doi.org/10.3389/fmicb.2015.00167 Google Scholar PubMed  Liu J.-H. Xu T.-T. Liu Y.-J. Zhu W.-Y. Mao S.-Y. 2013. A high-grain diet causes massive disruption of ruminal epithelial tight junctions in goats. Am. J. Physiol. Regul. Integr. Comp. Physiol.  305: R232– R241. doi: https://doi.org/10.1152/ajpregu.00068.2013 Google Scholar CrossRef Search ADS PubMed  Mach N. Bach A. Realini C. E. Font iFurnols M. Velarde A. Devant M. 2009. Burdizzo pre-pubertal castration effects on performance, behavior, carcass characteristics, and meat quality of Holstein bulls fed high-concentrate diets. Meat Sci.  81: 329– 334. doi: https://doi.org/10.1016/j.meatsci.2008.08.007 Google Scholar CrossRef Search ADS PubMed  Mankertz J. Tavalali S. Schmitz H. Mankertz A. Riecken E. O. Fromm M. Schultzke J. D. 2000. Expression from the human occluding promoter is affected by tumor necrosis factor alpha and interferon gamma. J. Cell Sci.  113: 2085– 2090. Google Scholar PubMed  Marti S. Velarde A. de la Torre J. L. Bach A. Aris A. Serrano A. Manteca X. Devant M. 2010. Effects of ring castration with local anesthesia and analgesia in Holstein bulls at three months of age on welfare indicators. J. Anim. Sci.  88: 2789– 2796. doi: https://doi.org/10.2527/jas.2009-2408 Google Scholar CrossRef Search ADS PubMed  Mitlöhner F. M. Morrow-Tesch J. L. Wilson S. C. Dailey J. W. McGlone J. J. 2001. Behavioral sampling techniques for feedlot cattle. J. Anim. Sci.  79: 1189– 1193. Google Scholar CrossRef Search ADS PubMed  Mounier L. Veissier I. Boissy A. 2005. Behavior, physiology, and performance of bulls mixed at the onset of finishing to form uniform body weight groups. J. Anim. Sci.  83: 1696– 1704. Google Scholar CrossRef Search ADS PubMed  Myint A. Schwarz M. J. Müller N. J. 2012. The role of the kynurenine metabolism in major depression. J. Neural Transm.  119: 245. doi: https://doi.org/10.1007/s00702-011-0741-3 Google Scholar CrossRef Search ADS   Nagaraja T. G. Titgemeyer E. C. 2007. Ruminal acidosis in beef cattle: The current microbiological and nutritional outlook. J. Dairy Sci.  90( Suppl.): E17– E38. doi: https://doi.org/10.3168/jds.2006-478 Google Scholar CrossRef Search ADS PubMed  Nicol C. J. Davidson H. P. Harris P. A. Waters A. J. Wilson A. D. 2002. Study of crib-biting and gastric inflammation and ulceration in young horses. Vet. Rec.  151: 658– 662. doi: https://doi.org/10.1136/vr.151.22.658 Google Scholar CrossRef Search ADS PubMed  Nocek J. E. Heald C. W. Polan C. E. 1984. Influence of ration physical form and nitrogen availability on ruminal morphology of growing bull calves. J. Dairy Sci.  67: 334– 343. doi: https://doi.org/10.3168/jds.S0022-0302(84)81306-5 Google Scholar CrossRef Search ADS PubMed  Peng L. Li Z. Green R. S. Holzman I. R. Lin J. 2009. Butyrate enhances the intestinal barrier by facilitating tight junction assembly via activation of AMP-activated protein kinase in caco-2 cell monolayers. J. Nutr.  139: 1619– 1625. doi: https://doi.org/10.3945/jn.109.104638 Google Scholar CrossRef Search ADS PubMed  Penner G. B. Steele M. A. Aschenbach J. R. McBride B. W. 2011. Ruminant nutrition symposium: Molecular adaptation of ruminal epithelia to highly fermentable diets. J. Anim. Sci.  89: 1108– 1119. doi: https://doi.org/10.2527/jas.2010-3378 Google Scholar CrossRef Search ADS PubMed  Pfaffl M. W. 2004. Quantification strategies in real-time PCR. In: Bustin S. A. editor, A-Z of quantitative PCR.  International University Line, La Jolla, CA. p. 87– 112. Redbo I. Nordblad A. 1997. Stereotypies in heifers are affected by feeding regimen. Appl. Anim. Behav. Sci.  53: 193– 202. doi: https://doi.org/10.1016/S0168-1591(96)01145-8 Google Scholar CrossRef Search ADS   Rehfeld J. F. 2014. Gastrointestinal hormones and their targets. In: Lyte M. Cryan J. F. editors, Microbial endocrinology: The microbiota-gut-brain axis in health and disease.  Springer, New York, NY. p. 157– 176. Google Scholar CrossRef Search ADS   Sakata T. Yajima T. 1984. Influence of short chain fatty acids on the epithelial cell division of digestive tract. Q. J. Exp. Physiol.  69: 639– 648. doi: https://doi.org/10.1113/expphysiol.1984.sp002850 Google Scholar CrossRef Search ADS PubMed  Sanders V. M. Straub R. H. 2002. Norepinephrine, the β-adrenergic receptor, and immunity. Brain Behav. Immun.  16: 290– 332. doi: https://doi.org/10.1006/brbi.2001.0639 Google Scholar CrossRef Search ADS PubMed  Sato S. Kubo T. Abe M. 1992. Factors influencing tongue-rolling and the relationship between tongue-rolling and production traits in fattening cattle. J. Anim. Sci.  70( Suppl. 1): 157. Sudo N. 2014. Neuropeptides and the microbiota-gut-brain axis. In: Lyte M. Cryan J. F. editors, Microbial endocrinology: The microbiota-gut-brain axis in health and disease.  Springer, New York, NY. p. 195– 220. Svihus B. Uhlen A. K. Harstad O. M. 2005. Effect of starch granule structure, associated components and processing on nutritive value of cereal starch: A review. Anim. Feed Sci. Technol.  122: 303– 320. doi: https://doi.org/10.1016/j.anifeedsci.2005.02.025 Google Scholar CrossRef Search ADS   Van Soest P. J. Robertson J. B. Lewis B. A. 1991. Methods for dietary fiber, neutral fiber and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci.  74: 3583– 3597. doi: https://doi.org/10.3168/jds.S0022-0302(91)78551-2 Google Scholar CrossRef Search ADS PubMed  Velarde A. Dalmau A. 2012. Animal welfare assessment at slaughter in Europe: Moving from inputs to outputs. Meat Sci.  92: 244– 251. doi: https://doi.org/10.1016/j.meatsci.2012.04.009 Google Scholar CrossRef Search ADS PubMed  Wall R. Cryan J. F. Ross R. P. Fitzgerald G. F. Dinan T. G. Stanton G. 2014. Bacterial neuroactive compounds produced by psychobiotics. In: Lyte M. Cryan J. F. editors, Microbial endocrinology: The microbiota-gut-brain axis in health and disease.  Springer, New York, NY. p. 221– 240. Google Scholar CrossRef Search ADS   Xiong Y. Bartle S. J. Preston R. L. 1991. Density of steam-flaked sorghum grain, roughage level and feeding regimen for feedlot steers. J. Anim. Sci.  69: 1707– 1718. Google Scholar CrossRef Search ADS PubMed  American Society of Animal Science
TI - Behavior and inflammation of the rumen and cecum in Holstein bulls fed high-concentrate diets with different concentrate presentation forms with or without straw supplementation
JF - Journal of Animal Science
DO - 10.2527/jas.2016-0594
DA - 2016-09-01
UR - https://www.deepdyve.com/lp/oxford-university-press/behavior-and-inflammation-of-the-rumen-and-cecum-in-holstein-bulls-fed-0yGJJST6MS
SP - 3902
EP - 3917
VL - 94
IS - 9
DP - DeepDyve
ER -