TY - JOUR
AU - Wood, Andrew J.
AB - Abstract Tortula ruralis (Syntrichia ruralis) is a useful model system for the study of gene control in response to severe water deficit‐stress. EST gene discovery efforts utilizing desiccated gametophytes have identified two cDNAs designated Elipa and Elipb with significant similarity to early light‐inducible proteins (ELIPs). Elipa is 1006 bp in length, encoding a 212 amino acid deduced polypeptide (ELIPa) with a predicted molecular mass of 23.3 kDa and pI of 5.57. Elipb is 997 bp in length, encoding a 224 amino acid deduced polypeptide (ELIPb) with a predicted molecular mass of 24.4 kDa and pI of 9.27. Phylogenetic analysis demonstrated that ELIPa and ELIPb are reproducibly grouped with ELIP sequences derived from desiccation‐tolerance tissues. RNA blot hybridization was used to analyse Elipa and Elipb mRNA abundance in response to a variety of stresses. Elipa steady‐state transcript levels increased in response to slow desiccation, rapid desiccation/rehydration, salinity, ABA, and rehydration in high light. The Elipb transcript was only detectable in response to ABA or rehydration in high light. It is postulated that ELIPa and ELIPb are an adaptive response to stress‐induced photodamage within the moss chloroplast, and play a key role in the protection and/or repair of the photosynthetic apparatus. Bryophyte, gene expression, moss, photodamage. ABA, abscisic acid, EST, expressed sequence tag. Introduction Tortula ruralis is a desiccation‐tolerant bryophyte capable of surviving desiccation at various drying speeds (Bewley, 1979; Wood and Oliver, 1999; Oliver et al., 2000; Wood et al., 2000c). In response to desiccation and rehydration, T. ruralis employs both a constitutive protection system and an active rehydration‐induced recovery mechanism (Oliver and Bewley, 1997). Utilizing desiccated T. ruralis gametophytes, EST analysis was used to discover genes that control vegetative desiccation tolerance and these efforts have identified early light‐inducible protein (ELIP) homologues (Wood et al., 1999). ELIPs were first discovered to be transiently expressed during the greening of etiolated plants (Grimm et al., 1989) and are one of the first nuclear‐encoded light‐inducible proteins detectable within the thylakoid membrane system (Meyer and Kloppstech, 1984). ELIPs also accumulate within green tissue in response to a variety of environmental stress factors including high light (Adamska and Kloppstech, 1994; Lindahl et al., 1997), UV‐B (Adamska, 1995), methyl jasmonate (Wierstra and Kloppstech, 2000), cold (Montane et al., 1997), low oxygen and CO2 concentration (Montane et al., 1998), nutrient starvation (Levy et al., 1993), senescence (Binyamin et al., 2001), and desiccation (Bartels et al., 1992). ELIPs contain three transmembrane helices and are members of the extended super family of CABs (Heddad and Adamska, 2000). Purified pea ELIPs have been demonstrated to bind both Chl a and lutein (Adamska et al., 1999). The membrane insertion of in vitro transcribed and translated low molecular mass barley ELIP precursors strictly depended upon chlorophyll a but not on chlorophyll b nor the xanthophyll zeaxanthin (Adamska et al., 2001). ELIPs are postulated to act as transient pigment‐binding proteins during biogenesis or turnover of chlorophyll‐binding proteins and to protect the chloroplast from light‐induced damage that results from the presence of ‘free’ chlorophyll (Lindahl et al., 1997; Adamska et al., 1999). Their function might be extended to include protection against photodamage caused by any situation suboptimal for electron transport through the dissipation of excessive light energy (Montane and Kloppstech, 2000). Three‐helix light‐harvesting related proteins such as ELIPs and LHCs are postulated to have evolved from one‐helix, highly light‐inducible proteins (HLIPs) in cyanobacteria through two successive gene duplication steps (Montane and Kloppstech, 2000). PsbS of PSII is a modern day representative of the intermediate four‐helix light‐inducible protein (Green and Kuhlbrandt, 1995). Recently, ELIP‐like stress‐enhanced proteins (Seps) with two (Heddad and Adamska, 2000) or one (Jansson et al., 2000) predicted transmembrane helix have been reported from Arabidopsis. These two‐helix Seps were suggested to represent an evolutionary intermediate between the one‐ and three‐helix antenna proteins (Heddad and Adamska, 2000). ELIPs have also been identified and studied in plant tissues that undergo desiccation (i.e. fern spores and Craterostigma plantagineum leaves). ELIP‐like DSP22 accumulates within C. plantagineum chloroplasts and is postulated to protect the photosystem from desiccation‐induced damage (Alamillo and Bartels, 2001). Chloroplasts are very susceptible to oxidative damage caused by water stress (Halliwell, 1987) and it is postulated that mechanisms involved in the protection and/or repair of chloroplast localized structures play a fundamental role in vegetative desiccation‐tolerance (Oliver et al., 2000). In order to pursue this hypothesis at the molecular level, and to further this investigation of the relationship between salinity‐stress and desiccation‐stress in T. ruralis, two cDNAs Elipa and Elipb encoding predicted polypeptides with significant similarity to ELIP‐like proteins were isolated and characterized. Materials and methods Plant material Gametophytes of Tortula ruralis (Hedw.) Gaerten., Meyer & Scherb. (Syntrichia ruralis (Hedw.) F Weber & D Mohr) were prepared for experimentation as described previously (Wood et al., 1999). Hydrated moss was obtained after a 24 h rehydration period (14 °C, 50 μE m−2 s−1). Desiccated moss was obtained by drying over activated silica gel (rapid‐dried, RD) or a stirred saturated solution of sodium nitrite (slow‐dried, SD) as described (Chen et al., 2002). Rehydrated moss was obtained by the addition of ddH2O to desiccated moss (14 °C, 50 μE m−2 s−1). Additionally, moss was both desiccated and rehydrated in high light (1500 μE m−2 s−1), and desiccated in high light after the application of 150 μM abscisic acid (ABA‐cis, trans, Sigma). For ABA‐treatment, rehydrated moss was incubated in solutions that ranged from 50–1000 μM for 8 h, or step‐wise 50 μM for 2 h+100 μM for 6 h. For response to light intensity, moss was incubated in dark at 18 °C for 24 h, and then exposed to irradiances ranging from 50 μE m−2 s−1 to 1500 μE m−2 s−1 for 30 min. Salt‐treated moss was obtained by the step‐wise addition of NaCl to rehydrated moss (50 mM 2 h, 50 mM+50 mM 2 h, and 100 mM+50 mM 2 h; 6 h total application) or by incubation of rehydrated moss in 50 mM, 100 mM or 150 mM for 6 h. cDNA clone isolation and DNA sequence analysis The EST clone RNP80 (AI304978) was previously isolated from a T. ruralis cDNA expression library cDNA derived from the polysomal, mRNP fraction of desiccated gametophytes (Wood et al., 1999). The EST QRNP4 was isolated from the same library during a screen for RNA‐binding protein using the rehydrin Tr288 as ligand (Wood and Oliver, 1999). Both truncated cDNAs have significant similarity to ELIPs as determined by PSI‐BLAST (Altschul et al., 1997). A full‐length RNP80 cDNA clone was obtained by 5′ random amplification of cDNA ends (5′‐RACE) as described earlier (Zeng and Wood, 2000) using the gene specific primers EST80A (5′‐GTGTACAGAAGTCCGTAATT‐3′) and EST80B (5′‐GGTCACGAGGAGCGCAACGA‐3′). A full‐length QRNP4 cDNA clone was obtained by RNA Ligase Mediated Rapid Amplification of cDNA Ends (RLM‐RACE) as described by the manufacturer (Ambion, Austin, Texas) using the gene specific primers QRNP4A (5′‐CGCGTACGTGAACAGCTGCA‐3′) and QRNP4B (5′‐CGCGGATCCAGACGCTGCGTTTGCTGGCTTTGATG‐3′). The DNA sequence was determined by the Plant Biotechnology and Genome Center (SIU‐C) using an automated sequencer (ABI model 377; Applied Biosystems, Foster City, CA). Analysis of amino acid composition, MW and pI prediction, prediction of stability, and identification of targeting sequences was performed using ProtParam, ChloroP (Nielsen et al., 1997), and PESTfind (Rechsteiner and Rogers, 1996). Prediction of transmembrane helices was determined using SOSUI (Hirokawa et al., 2000) and TMHMM (ver2.0) (Sonnhammer et al., 1998). Phylogenetic analysis A data set that consisted of the deduced amino acid sequences from T. ruralis Elipa and Elipb cDNAs and 13 additional taxa was subjected to phylogenetic analysis: Arabidopsis thaliana (AF134132 and U89014), Craterostigma plantagineum (X66598), Triticum aestivum (AB019617), Glycine max (U82810), Pisum sativum (X05979), Hordeum vulgare HV90 (X15692), HV60 (X15691) and HV58 (X15693), Helianthus annuus (CAA63338), Onoclea sensibilis (AAB25012), Oryza sativa (AF017357), and Dunaliella bardawil (P27516). The amino acid sequences of ELIPs were aligned with the ClustalW program (Thompson et al., 1994) using the progressive pairwise comparison algorithm. C‐terminal sequences (residues 101–225) were aligned manually and phylogenetic trees were constructed using the distance method as implemented in PAUP* 4.0 (Swofford, 1998) and the Neighbor–Joining clustering algorithm (Saitou and Nei, 1987). RNA isolation and RNA blot hybridizations Total RNA was isolated using the RNeasy kit (Qiagen, Valencia, CA, USA) as described by the manufacturer. Polysomes were extracted from gametophytic tissue as described earlier (Wood and Oliver, 1999). The 27 000 g supernatant was layered over a sucrose pad and centrifuged at 100 000 g for 90 min in a 50TI ultracentrifuge rotor (Beckman Scientific, Fullerton, CA). RNA gel blot analysis was performed using standard techniques as described previously (Duff et al., 1999). Purified cDNA inserts were labelled with [α32P]‐dCTP (Amersham Pharmacia, Arlington Heights, IL) using Random Primers DNA Labeling System (GIBCO, Gaithersburg, MD) and purified using probeQuantTM G‐50 micro columns (Amersham Pharmacia, Piscataway, NJ). Membranes were prehybridized and hybridized at 42 °C using ULTRAhybTM (Ambion) as described by the manufacturer. Membranes were washed at 42 °C (2×5 min in 2×SSC, 0.1% SDS followed by 2×15 min in 0.1×SSC, 0.1% SDS). Blots were stripped and reprobed with 18S rRNA–DNA amplified from T. ruralis to demonstrate equal loading. Results Characterization of Elipa and Elipb The Tortula ruralis ESTs RNP80 and QRNP4 were isolated from a cDNA expression library derived from the polysomal, mRNP fraction of desiccated gametophytes (Wood et al., 1999) with significant similarity to the desiccation stress‐inducible protein DSP22 from C. plantagineum (Bartels et al., 1992). The full‐length cDNAs were obtained by either 5′‐RACE or RLM‐RACE and designated Elipa and Elipb, respectively. Elipa was 1007 bp in length and contained a single, continuous open reading frame from nucleotide 95 to 730 (data not shown). Elipb was 977 bp in length and contained a single, continuous open reading frame from nucleotide 95 to 767 (data not shown). The initiation and termination sequences conformed to the known consensus sequences in plants, and each cDNA contained putative polyadenylation signal sequences (Wood et al., 2000b). The Elipa ORF encodes a deduced polypeptide of 212 amino acids, designated ELIPa, with a predicted molecular mass of 23.2 kDa and predicted pI of 5.57. The Elipb ORF encodes a deduced polypeptide of 224 amino acids, designated ELIPb, with a predicted molecular mass of 24.4 kDa and predicted pI of 9.25. ELIPa is 53% identical to ELIPb and the Tortula deduced polypeptides are 37–49% identical to paralogues from A. thaliana (Moscovici‐Kadouri and Chamovitz, 1997) and C. plantagineum (Bartels et al., 1992) (Fig. 1A). The Tortula N‐terminal domains are longer and show the greatest divergence relative to the higher plant peptides. ELIPa and ELIPb each contain a chloroplast transit peptide as predicted by ChloroP (Nielsen et al., 1997) (Fig. 1B). Mature ELIPa has a predicted molecular mass of 19.5 kDa and predicted pI of 4.89 and mature ELIPb has a predicted molecular mass of 18.7 kDa and predicted pI of 6.20. ELIPa contains three transmembrane helices: residues 105–124 (Helix I), 139–158 (Helix II) and 179–198 (Helix III) (Fig. 1B). ELIPb is predicted to contain no transmembrane helices; however, it does contain three similar hydrophobic domains that correspond to Helix I, Helix II and Helix III (Fig. 1B; data not shown). ELIPa and ELIPb each embed a chlorophyll a/b binding protein motif, residues 101–194 and 120–216, respectively. ELIPa is predicted to contain two target PEST sequences (residues 44–55 and residues 84–97) that are associated with rapid destruction of the peptide in vivo (Rechsteiner and Rogers, 1996). ELIPb contains no potential PEST target sequences. Fig. 1.  View largeDownload slide (A) Alignment of the deduced amino acid sequences of ELIPs from different plant species. See Materials and methods for species names and Genbank accession numbers. (B) Schematic representation of the predicted secondary structure of ELIPs. The black bar indicates the predicted transit peptide and the striped boxes indicate the hydrophobic α‐helices. Numbers above indicate the predicted length of each domain. The bars and boxes are not scaled. Fig. 1.  View largeDownload slide (A) Alignment of the deduced amino acid sequences of ELIPs from different plant species. See Materials and methods for species names and Genbank accession numbers. (B) Schematic representation of the predicted secondary structure of ELIPs. The black bar indicates the predicted transit peptide and the striped boxes indicate the hydrophobic α‐helices. Numbers above indicate the predicted length of each domain. The bars and boxes are not scaled. Phylogenetic analysis of ELIPa and ELIPb To examine the structural relationship between ELIPa, ELIPb and ELIP‐like proteins from other plant species, the deduced amino acid sequences were analysed. An unrooted Neighbor–Joining cladogram is depicted in Fig. 2. Relationships shown in this gene tree generally reflect standard groupings of monocots, dicots, ferns, and bryophytes. Tortula ELIPb groups with the fern Onoclea rather than with ELIPa. Craterostigma is separated from other dicot angiosperms and groups instead with T. ruralis and Onoclea, thereby creating an association of ELIP sequences derived from desiccation‐tolerance tissues. Amongst the selected taxa, Craterostigma is nearest phylogenetically to Helianthus (Asterales). However, moving Craterostigma to the Helianthus branch required more than 20 additional steps to the tree length (data not shown). Fig. 2.  View largeDownload slide An unrooted neighbor–joining tree derived from a data set of deduced amino acids of ELIPs from different plant species using distance optimality criterion (PAUP* 4.0). Numbers above the lines indicate the mean character difference. Numbers below the lines represent bootstrap percentages (based on 1000 replicates). See Materials and methods for species names and accession numbers. The scale bar indicates the number of changes per unit length. Results obtained using maximum parsimony as the search criterion were essentially identical to those obtained using distance (data not shown). Fig. 2.  View largeDownload slide An unrooted neighbor–joining tree derived from a data set of deduced amino acids of ELIPs from different plant species using distance optimality criterion (PAUP* 4.0). Numbers above the lines indicate the mean character difference. Numbers below the lines represent bootstrap percentages (based on 1000 replicates). See Materials and methods for species names and accession numbers. The scale bar indicates the number of changes per unit length. Results obtained using maximum parsimony as the search criterion were essentially identical to those obtained using distance (data not shown). Expression of Elipa and Elipb in response to desiccation and rehydration The accumulation of T. ruralis Elipa and Elipb steady‐state mRNA transcripts was analysed by RNA blot hybridization. In response to a desiccation/rehydration cycle, Elipa transcripts are detectable within both the total and polysomal RNA fractions while Elipb transcripts are undetectable (Fig. 3). In total RNA, Elipa steady‐state transcript levels increased in response to slow drying (SD) and returned to control levels upon rehydration (SR). However, Elipa transcript levels were unchanged in response to rapid drying (RD), but increased in response to rehydration (RR) (Fig. 3A). In the polysomal RNA fraction, Elipa steady‐state transcript levels increase in response to both slow drying (SD) and rapid drying (RD), and only decrease in response to rehydration of rapid‐dried gametophytes (RR). According to the prior cDNA classification scheme for T. ruralis established earlier (Scott and Oliver, 1994), Elipa is a rehydrin clone (i.e. transcripts are more abundant within the RR polysomal fraction than in the hydrated controls). Fig. 3.  View largeDownload slide RNA blot analysis of Elipa and Elipb using total RNA (A) and polysomal RNA (B) from T. ruralis gametophytes in response to a desiccation–rehydration cycle. C, control; SD, slow dried; SR, SD/rehydrated; RD, rapid dried; RR, RD/rehydrated. RNA (approximately 10 μg) was separated by electrophoresis in a formaldehyde–agarose gel and transferred to nitrocellulose under standard conditions (Duff et al., 1999). The resulting RNA blot was hybridized with 32P‐labelled cDNA probe for either Elipa or Elipb. To enable normalization of the hybridization signals to account for loading anomalies, the membrane was reprobed after the initial analysis using the T. ruralis 18S nuclear rRNA probe. Essentially identical results were obtained in three independent experiments. Fig. 3.  View largeDownload slide RNA blot analysis of Elipa and Elipb using total RNA (A) and polysomal RNA (B) from T. ruralis gametophytes in response to a desiccation–rehydration cycle. C, control; SD, slow dried; SR, SD/rehydrated; RD, rapid dried; RR, RD/rehydrated. RNA (approximately 10 μg) was separated by electrophoresis in a formaldehyde–agarose gel and transferred to nitrocellulose under standard conditions (Duff et al., 1999). The resulting RNA blot was hybridized with 32P‐labelled cDNA probe for either Elipa or Elipb. To enable normalization of the hybridization signals to account for loading anomalies, the membrane was reprobed after the initial analysis using the T. ruralis 18S nuclear rRNA probe. Essentially identical results were obtained in three independent experiments. Expression of Elipa and Elipb in response to salinity, light intensity and ABA NaCl‐treated moss was obtained by incubation with NaCl at concentrations of 50 mM, 100 mM or 150 mM for 6 h, or by the step‐wise addition of NaCl (50 mM 2 h, 100 mM 2 h, and 150 mM 2 h; 6 h total application) (Fig. 4A). In the total RNA fraction, Elipa steady‐state transcript levels increased in response to all salt treatments while Elipb transcripts are undetectable. To investigate the effect of light intensity upon Elip expression, gametophytes were hydrated in darkness for 24 h and then exposed to irradiances from 50 μE m−2 s−1 to 1500 μE m−2 s−1 for 30 min (Fig. 4B). In the total RNA fraction, Elipa steady‐state transcript levels do not increase in response to light intensity and decline at 1500 μE m−2 s−1, while Elipb transcripts are undetectable. ABA‐treated moss was obtained by incubation with 50 μM to 1000 μM ABA solutions (Fig. 4C). Both Elipa and Elipb steady‐state transcripts increased in response to 50 μM ABA even though ABA is undetectable within gametophytic tissue from either control or desiccated T. ruralis (Oliver et al., 2000). In order to investigate the interaction between light intensity and a desiccation/rehydration cycle upon Elip expression, gametophytes were desiccated and rehydrated in either dark (D), low light (LL, 50 μE m−2 s−1) or high light (HL, 1500 μE m−2 s−1) (Fig. 4D). In total RNA, Elipa transcripts were more abundant in all slow‐dried samples relative to the controls. Drying in high light (DHL) induced greater accumulation of Elipa transcripts relative to drying in dark (DD) or drying in low light (DLL), and the accumulation was not enhanced by treatment with 1000 μM of ABA (DHLA). In response to rehydration in high light (RHL), both Elipa and Elipb steady‐state transcript levels increased. A schematic model summarizing the differential expression of Elipa and Elipb is depicted in Fig. 5. Elipa steady‐state transcript levels increased in response to slow drying (Fig. 3), rapid drying/rehydration (Fig. 3), salinity (Fig. 4A), ABA (Fig. 4C), rehydration in high light (Fig. 4D), temperature below 14 °C, and exposure to UV‐C (data not shown). Elipb transcripts were only detectable in gametophytes subjected to ABA treatment (Fig. 4C) and rehydration in high light (Fig. 4D). Neither Elipa nor Elipb was induced by dark to high light transition. Fig. 4.  View largeDownload slide RNA blot analysis of Elipa and Elipb using total RNA in response to salinity (A), light intensity (B), ABA (C), and rehydration in altered light intensities (D). (A) C, control, rehydrated moss; 50, 100, 150 mM NaCl or step‐wise addition of NaCl 50+, 100+, 150+. (B) CD, hydrated in dark for 24 h and then exposed to 50, 100, 250, 500, 1000 or 1500 μE m−2 s−1. (C) C, control; 50, 100, 500, 1000 μM ABA; 50 for 2 h, 50 μM ABA for 2 h; 50+100, 50 μM for 2 h plus 100 μM ABA for 6 h. (D) C, control; CD, rehydrated in dark; RHL, rehydrated in high light; DD, dried in dark; DLL, dried in low light (50 μE m−2 s−1); DHL, dried in high light (1500 μE m−2 s−1); DHLA, dried in high light (1500 μE m−2 s−1) with the addition of 1000 μM of ABA. Essentially identical results were obtained in three independent experiments. Fig. 4.  View largeDownload slide RNA blot analysis of Elipa and Elipb using total RNA in response to salinity (A), light intensity (B), ABA (C), and rehydration in altered light intensities (D). (A) C, control, rehydrated moss; 50, 100, 150 mM NaCl or step‐wise addition of NaCl 50+, 100+, 150+. (B) CD, hydrated in dark for 24 h and then exposed to 50, 100, 250, 500, 1000 or 1500 μE m−2 s−1. (C) C, control; 50, 100, 500, 1000 μM ABA; 50 for 2 h, 50 μM ABA for 2 h; 50+100, 50 μM for 2 h plus 100 μM ABA for 6 h. (D) C, control; CD, rehydrated in dark; RHL, rehydrated in high light; DD, dried in dark; DLL, dried in low light (50 μE m−2 s−1); DHL, dried in high light (1500 μE m−2 s−1); DHLA, dried in high light (1500 μE m−2 s−1) with the addition of 1000 μM of ABA. Essentially identical results were obtained in three independent experiments. Fig. 5.  View largeDownload slide Schematic model of Elipa and Elipb expression in response to a variety of environmental factors. Arrows indicate an increase in the steady‐state transcript levels, while blunt‐ended lines indicate no impact upon transcript levels. Fig. 5.  View largeDownload slide Schematic model of Elipa and Elipb expression in response to a variety of environmental factors. Arrows indicate an increase in the steady‐state transcript levels, while blunt‐ended lines indicate no impact upon transcript levels. Discussion The photosystems of desiccation‐tolerant mosses survive desiccation essentially intact (Bewley and Krochko, 1982; Beckett et al., 2000; Proctor and Smirnoff, 2000). In response to drying of T. ruralis gametophytes, the structural organization of thylakoid membranes in chloroplasts of desiccated gametophytes are maintained (Platt et al., 1994). Non‐ultrastructural observations using Nomarski optics demonstrate that, during desiccation, the protoplasm condenses at the proximal and distal ends of the cell and contains smaller and more rounded chloroplasts (Tucker et al., 1975). Within minutes after rehydration chloroplasts are swollen and globular in shape and their outer membranes are folded and separated from the thylakoids, which themselves are no longer compacted (Tucker et al., 1975; Bewley and Pacey, 1978). However, within 4–6 h the chloroplasts are repaired and metabolically active (Bewley and Krochko, 1982). In order to study the mechanisms involved in the protection and/or repair of chloroplast localized structures, two EST‐derived T. ruralis cDNAs have been isolated and characterized, Elipa and Elipb encoding predicted polypeptides with significant similarity to early light‐inducible proteins (ELIPs). Similar to the ELIP dsp22 from the desiccation‐tolerant angiosperm C. plantagineum, the rehydrin Elipa is induced in response to both desiccation and ABA. Elipa transcripts accumulate in the polysomal RNA fraction of both rapid‐dried and slow‐dried moss indicating the formation of a messenger ribonucleoprotein particle (mRNP) (Fig. 3). No previously characterized rehydrin transcript has been shown to accumulate within the rapid‐dried polysomal fraction (Scott and Oliver, 1994; Velten and Oliver, 2001) and it has been established that the rehydrin Tr288 forms a mRNP in response to slow drying only (Wood and Oliver, 1999). By contrast to Tr288, Elipa transcripts form a stable protein/mRNA complex irrespective of drying speed. It is postulated that the Elipa transcript quickly associates with a mRNA binding protein and forms a desiccation mRNP in response to either rapid or slow drying. The results presented in Fig. 4 demonstrate that steady‐state transcript levels of Elipa and Elipb do not respond to environmental factors as a typical angiosperm Elip gene. In mature green tissue, ELIPs are expressed in response to high‐light and are postulated to protect the chloroplast from high irradiance‐induced damage by binding Chl a and/or zeaxanthin (Krol et al., 1999; Adamska et al., 1999). Neither Elipa nor Elipb is induced in response to high‐irradiance alone (i.e. >500 μE m−2 s−1). In Tortula, Elipa transcript levels are maximal at 50 μE m−2 s−1, remain essentially unchanged up to 1000 μE m−2 s−1 and decline at 1500 μE m−2 s−1. With respect to high‐irradiance, Elipa is constitutively expressed. Interestingly, both Elipa and Elipb steady‐state transcript levels do increase if desiccated gametophytes are rehydrated in high‐light (i.e. 1500 μE m−2 s−1) (Fig. 4D). Proctor and Smirnoff have demonstrated the rapid recovery of photosystems upon the rewetting of desiccation‐tolerant mosses such as Anomodon viticulosus and Racomitrium lanuginosum (Proctor and Smirnoff, 2000) and the importance of dynamic non‐photochemical quenching (Tuba et al., 1997) and xanthophyll cycle‐dependent photoprotection (Gilmore, 1997) in protecting the photosynthetic apparatus of mosses from damage during desiccation has been emphasized. In C. plantagineum, two functions are proposed for DSP 22 accumulation in response to desiccation (Alamillo and Bartels, 2001): (1) DSP 22 maintains a hydrophobic environment that promotes zeaxanthin stabilization or (2) DSP 22 stabilizes zeaxanthin during rehydration thereby transiently protecting PSII. Further, Montane and Kloppstech postulate that ELIP function might be extended to include protection against photodamage caused by any situation suboptimal for electron transport through the dissipation of excessive light energy (Montane and Kloppstech, 2000). This study's results suggest that salinity, desiccation, rehydration, and particularly rehydration in high‐light, create physiological conditions within the moss chloroplast that mimic chloroplast ‘greening’ and/or exposure to high‐irradiance thereby triggering the accumulation of Elipa and Elipb gene product(s). ELIPa and ELIPb each contain a chloroplast transit peptide and three hydrophobic domains (Fig. 1). However, as predicted by TMHMM and SOSUI only ELIPa is a membrane‐associated protein (data not shown). It is hypothesized that genes essential to recovery and cellular repair are preferentially expressed upon rehydration of desiccated gametophytes (Oliver and Wood, 1997; Wood and Oliver, 1999; Duff et al., 1999; Wood et al., 2000a). The expression of Elipa is consistent with a putative role for ELIPa in scavenging free Chl a and/or protecting PSII from photo‐oxidative damage in response to a variety of stresses (Figs 3, 4). ELIPb, as a chloroplast‐localized soluble protein, could maintain a hydrophobic environment within the stroma that promotes zeaxanthin stabilization in response to rehydration in high light. It is postulated that the ELIPa and ELIPb represent an adaptive response to stress‐induced photodamage within the moss chloroplast. Further research will confirm the subcellular localization of these polypeptides and investigate their ability to protect and/or repair the photosynthetic apparatus. 1 The nucleotide sequence data appear in EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers AY034890 (Elipa) and AY034891 (Elipb). 2 To whom correspondence should be addressed. Fax: +16184533441. E‐mail: wood@plant.siu.edu The authors thank D Nickrent (Southern Illinois University, Carbondale, IL) for providing 18S rRNA–DNA oligonucleotide primers and assisting in the preparation of the gene tree(s). This work was supported in part by a grant to AJW (USDA NRI No. 9735100). References Adamska I. 1995. Regulation of early light‐inducible protein gene expression by blue and red light in etiolated seedlings involves nuclear and plastid factors. Plant Physiology  107, 1167–1175. Google Scholar Adamska I, Kloppstech K. 1994. Low temperature increases the abundance of early light‐inducible transcript under light stress conditions. Journal of Biological Chemistry  269, 30221–30226. Google Scholar Adamska I, Kruse E, Kloppstech K. 2001. Stable insertion of the early light‐induced proteins into etioplast membranes requires chlorophyll a. The Journal of Biological Chemistry  276, 8582–8587. Google Scholar Adamska I, Roobol‐Boza M, Lindahl M, Andersson B. 1999. Isolation of pigment‐binding early light‐inducible proteins from pea. European Journal of Biochemistry  260, 453–460. Google Scholar Alamillo JM, Bartels D. 2001. Effects of desiccation on photosynthesis pigments and the ELIP‐like dsp 22 protein complexes in the resurrection plant Craterostigma plantagineum. Plant Science  160, 1161–1170. Google Scholar Altschul SF, Thomas LM, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. 1997. Gapped BLAST and PSI‐BLAST: a new generation of protein database search programs. Nucleic Acids Research  25, 3389–3402. Google Scholar Bartels D, Hanke C, Schneider K, Michel D, Salamini F. 1992. A desiccation‐related Elip‐like gene from the resurrection plant Craterostigma plantagineum is regulated by light and ABA. The EMBO Journal  11, 2771–2778. Google Scholar Beckett RP, Csintalan Z, Tuba Z. 2000. ABA treatment increases both the desiccation tolerance of photosynthesis, and non‐photochemical quenching in the moss Atricum undulatum. Plant Ecology  151, 65–71. Google Scholar Bewley JD. 1979. Physiological aspects of desiccation‐tolerance. Annual Review of Plant Physiology  30, 195–238. Google Scholar Bewley JD, Krochko J. 1982. Desiccation‐tolerance. In: Lange OL, Nobel PS, Osmond CB, Ziegler H, eds. Encyclopedia of plant physiology , Vol. 12B. Physiological ecology II. Berlin: Springer‐Verlag, 325–378. Google Scholar Bewley JD, Pacey J. 1978. Desiccation‐induced ultrastructural changes in drought‐sensitive and drought‐tolerant plants. In: Crowe JH, Clegg JS, eds. Dry biological systems . London, New York: Academic Press, Series 2, 53–73. Google Scholar Binyamin L, Falah M, Portnoy V, Soudry E, Gepstein S. 2001. The early light‐induced protein is also produced during leaf senescence of Nicotiana tabacum. Planta  212, 591–597. Google Scholar Chen X, Kanokporn T, Zeng Q, Wilkins TA, Wood AJ. 2002. Characterization of the V‐type H(+)‐ATPase in the resurrection plant Tortula ruralis: accumulation and polysomal recruitment of the proteolipid c subunit in response to salt‐stress. Journal of Experimental Botany  53, 225–232. Google Scholar Duff RJ, Oliver MJ, Wood AJ. 1999. A Tortula ruralis cDNA encoding small‐subunit ribosomal protein S3a: polysomal retention of transcript in response to desiccation and rehydration. The Bryologist  102, 418–425. Google Scholar Gilmore AM. 1997. Mechanistic aspects of xanthophyll cycle‐dependent photoprotection in higher plant chloroplasts and leaves. Physiologia Plantarum  99, 197–209. Google Scholar Green B, Kuhlbrandt W. 1995. Sequence conservation of light harvesting and stress‐response proteins in relation to the three‐dimensional molecular structure of LHCII. Photosynthesis Research  44, 139–148. Google Scholar Grimm B, Kruse E, Kloppstech K. 1989. Transiently expressed early light‐inducible proteins share transmembrane domains with light‐harvesting chlorophyll‐binding proteins. Plant Molecular Biology  13, 583–593. Google Scholar Halliwell B. 1987. Oxidative damage, lipid peroxidation and antioxidant protection in chloroplasts. Chemistry and Physics in Lipids  44, 327–340. Google Scholar Heddad M, Adamska I. 2000. Light stress‐regulated two‐helix proteins in Arabidopsis thaliana related to the chlorophyll a/b‐binding gene family. Proceedings of the National Academy of Sciences, USA  97, 3741–3746. Google Scholar Hirokawa T, Uechi J, Sasamoto H, Suwa M, Mitaku S. 2000. A triangle lattice model that predicts transmembrane helix configuration using a polar jigsaw puzzle. Protein Engineering  13, 771–778. Google Scholar Jansson S, Andersson J, Jung Kim S, Jackowski G. 2000. An Arabidopsis thaliana protein homologous to cyanobacterial high‐light‐inducible proteins. Plant Molecular Biology  42, 345–351. Google Scholar Krol M, Ivanov A, Jansson S, Kloppstech K, Huner N. 1999. Greening under high light or cold temperature affects the levels of xanthophyll‐cycle pigments, early light‐induced proteins and light‐harvesting polypeptides in wild‐type barley and the chlorina f2 mutant. Plant Physiology  120, 193–203. Google Scholar Levy H, Tal T, Shaish A, Zamir A. 1993. Cbr, an algal homolog of plant early light‐induced proteins, is a putative zeaxanthin binding protein. Journal of Biological Chemistry  268, 20892–20896. Google Scholar Lindahl M, Funk C, Webster J, Bingsmark S, Adamska I, Andersson B. 1997. Expression of ELIPs and PSIIs protein in spinach during acclimative reduction of the photosystem II antenna in response to increased light intensities. Photosynthesis Research  54, 227–236. Google Scholar Meyer G, Kloppstech K. 1984. A rapidly light‐induced chloroplast protein with a high turnover coded for by pea nuclear DNA. European Journal of Biochemistry  138, 201–207. Google Scholar Montane MH, Dreyer S, Triantaphylides C, Kloppstech K. 1997. Early light‐inducible proteins during long‐term acclimation of barley to photo‐oxidative stress caused by light and cold—high level of accumulation by post‐transcriptional regulation. Planta  202, 293–302. Google Scholar Montane MH, Tardy F, Kloppstech K, Havaux M. 1998. Differential control of xanthophylls and light‐induced stress proteins, as opposed to light‐harvesting chlorophyll a/b proteins, during photosynthetic acclimation of barley leaves to light irradiance. Plant Physiology  118, 227–235. Google Scholar Montane MH, Kloppstech K. 2000. The family of light‐harvesting‐related proteins (LHCs, ELIPs, HLIPs): was the harvesting of light their primary function? Gene  258, 1–8. Google Scholar Moscovici‐Kadouri S, Chamovitz DA. 1997. Characterization of a cDNA encoding the early light‐inducible protein (ELIP) (Accession No. U89014) from Arabidopsis (PGR97‐155). Plant Physiology  115, 1287. Google Scholar Nielsen H, Engelbrecht J, Brunak S, von Heijne G. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering  10, 1–6. Google Scholar Oliver MJ, Bewley JD. 1997. Desiccation‐tolerance of plant tissues: a mechanistic overview. Horticultural Reviews  18, 171–213. Google Scholar Oliver MJ, Velten J, Wood AJ. 2000. Bryophytes as experimental models for the study of environmental stress tolerance: Tortula ruralis and desiccation‐tolerance in mosses. Plant Ecology  151, 73–84. Google Scholar Oliver MJ, Wood AJ. 1997. Desiccation‐tolerance in mosses . New York: Plenum Publishing Corporation. Google Scholar Platt KA, Oliver MJ, Thomson WW. 1994. Membranes and organelles of dehydrated Selaginella and Tortula retain their normal configuration and structural integrity: freeze fracture evidence. Protoplasma  178, 57–65. Google Scholar Proctor MCF, Smirnoff N. 2000. Rapid recovery of photosystems on rewetting desiccation‐tolerant mosses: chlorophyll fluorescence and inhibitor experiments. Journal of Experimental Botany  51, 1695–1704. Google Scholar Rechsteiner M, Rogers SM. 1996. PEST sequences and regulation by proteolysis. TIBS  21, 267–271. Google Scholar Saitou N, Nei M. 1987. The Neighbor–Joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution  4, 406–425. Google Scholar Scott II HB, Oliver MJ. 1994. Accumulation and polysomal recruitment of transcripts in response to desiccation and rehydration of the moss Tortula ruralis. Journal of Experimental Botany  45, 577–583. Google Scholar Sonnhammer ELL, von Heijne G, Krogh A. 1998. A hidden Markov model for predicting transmembrane helices in protein sequences. In: Glasgow J, ed. Proceedings of the Sixth International Conference on Intelligent Systems for Molecular Biology  California: AAAI Press, 175–182. Google Scholar Swofford DL. 1998. PAUP: Phylogenetic analysis using parsimony (and other methods) , Version 4. Sunderland, MA: Sinauer Associates. Google Scholar Thompson JD, Higgins DG, Gibson TJ. 1994. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position‐specific gap penalties and weight matrix choice. Nucleic Acids Research  22, 4673–4680. Google Scholar Tuba Z, Proctor MCF, Csintalan Z. 1997. Ecophysiological responses of homochlorophyllous and poikilochlorophyllous desiccation‐tolerant plants. Plant Growth Regulation  26, 71. Google Scholar Tucker EB, Costerton JW, Bewley JD. 1975. The ultrastructure of the moss Tortula ruralis on recovery from desiccation. Canadian Journal of Botany  53, 94–101. Google Scholar Velten J, Oliver MJ. 2001. Tr288, A rehydrin with a dehydrin twist. Plant Molecular Biology  45, 713–722. Google Scholar Wierstra I, Kloppstech K. 2000. Differential effects of methyl jasmonate on the expression of the early light‐inducible proteins and other light‐regulated genes in barley. Plant Physiology  124, 833–844. Google Scholar Wood AJ, Duff RJ, Oliver MJ. 1999. Expressed Sequence Tags (ESTs) from desiccated Tortula ruralis identify a large number of novel plant genes. Plant and Cell Physiology  40, 361–368. Google Scholar WoodAJ, Duff RJ, Oliver MJ. 2000a. The translational apparatus of Tortula ruralis: polysomal retention of transcripts encoding the ribosomal proteins RPS14, RPS16, and RPL23 in desiccated and rehydrated gametophytes. Journal of Experimental Botany  51, 1655–1662. Google Scholar Wood AJ, Duff RJ, Zeng Q, Oliver MJ. 2000b. Molecular architecture of bryophyte genes: putative polyadenylation signals in cDNA 3′‐ends of Tortula ruralis. The Bryologist  103, 44–51. Google Scholar Wood AJ, Oliver MJ, Cove DJ. 2000c. Frontiers in bryological and lichenological research. I. Bryophytes as model systems. The Bryologist  103, 128–133. Google Scholar Wood AJ, Oliver MJ. 1999. Translational control in plant stress: characterization of messenger ribonucleoprotein particles (mRNPs) in desiccated Tortula ruralis. The Plant Journal  18, 359–370. Google Scholar Zeng Q, Wood AJ. 2000. A cDNA encoding ribosomal protein RPL15 from the desiccation‐tolerant bryophyte Tortula ruralis: mRNA transcripts are stably maintained in desiccated and rehydrated gametophytes. Bioscience Biotechnology Biochemistry  64, 2221–2224. Google Scholar © Society for Experimental Biology
TI - Two early light‐inducible protein (ELIP) cDNAs from the resurrection plant Tortula ruralis are differentially expressed in response to desiccation, rehydration, salinity, and high light
JO - Journal of Experimental Botany
DO - 10.1093/jexbot/53.371.1197
DA - 2002-05-01
UR - https://www.deepdyve.com/lp/oxford-university-press/two-early-light-inducible-protein-elip-cdnas-from-the-resurrection-0XSINjTf0z
SP - 1197
EP - 1205
VL - 53
IS - 371
DP - DeepDyve
ER -