TY - JOUR
AU - Louache, Fawzia
AB - Abstract CXCR4, the stromal cell–derived factor‐1 receptor, plays an important role in the migration of hematopoietic progenitor/stem cells. The surface and cytoplasmic expression of CXCR4 on human hematopoietic CD34+ cells was investigated. We show that its surface expression is low, whereas a large part of CXCR4 protein is sequestered intracellularly. Using confocal microscopy, we demonstrated that CXCR4 is colocalized with EEA‐1, Rab5, Rab4, and Rab11, which are localized in early and recycling endosomes. No significant colocalization of CXCR4 with lysosomal markers CD63 and Lamp‐1 was detected. Using antibody feeding experiments, we report a role for CXCR4 constitutive endocytosis in subcellular localization in stably transduced UT7‐CXCR4‐GFP and CD34+ cells. Agonist‐independent endocytosis of CXCR4 occurs through clathrin‐coated vesicles. These data implicate a constitutive endocytosis in the regulation of CXCR4 membrane expression and suggest that constitutive endocytosis may be involved in the regulation of trafficking the human hematopoietic progenitor/stem cells to and in the bone marrow microenvironment. CXCR4 receptor, SDF‐1, CD34+ cells, Endocytosis, Cell migration Introduction The CXC chemokine ligand 12/stromal cell–derived factor‐1 (SDF‐1)/pre–B cell growth‐stimulating factor was isolated from bone marrow (BM) stromal cells and first characterized as a pre–B cell growth‐stimulating factor [1]. CXCR4 is the primary physiologic receptor for SDF‐1 and functions also as an entry coreceptor for strains of HIV‐1 [2,3]. SDF‐1 and CXCR4 knockout mice display abnormal B‐cell development, impaired colonization of BM by hematopoietic progenitors, defects in blood vessel formation and the gastrointestinal tract, abnormal cardiac ventricular septum formation and cerebellar development, and embryonic lethality [4–7]. In adult, CXCR4 receptors are involved in numerous biological processes, ranging from cell migration [8] to proliferation and survival [9–11], indicating that this receptor plays a central role in cell biology. In the hematopoietic system, several data suggest that SDF‐1 and CXCR4 play a critical role in the homing of hematopoietic progenitor cells (HPCs), with SDF‐1 acting as a major chemoattractant for HPCs, severe combined immunodeficiency (SCID)–repopulating cells, and leukemic cells [12–14]. Blocking CXCR4 with anti‐CXCR4 antibodies on SCID–repopulating cells prevented their engraftment into nonobese diabetic (NOD)/SCID mice [15]. Moreover, stimulation of mobilized peripheral CD34+ blood cells with a low concentration of CXCR4 antibody or SDF‐1 resulted in an enhanced potential to engraft into NOD/SCID mice.[16] Additionally, a critical role for CXCR4 in mobilization—the egress of HPC from BM to the peripheral blood—was recently suggested [17–19]. Despite increasing evidence for a prominent role of SDF‐1/CXCR4 in the regulation of several aspects of HPC biology, very little is known about the regulation of CXCR4 expression on the membrane of these cells. Like many other G protein–coupled receptors, CXCR4 may undergo intracellular sequestration upon SDF‐1 binding or after protein kinase C (PKC) activation. A constitutive internalization of CXCR4 was suggested in studies using green fluorescent protein (GFP)–tagged receptors, and a colocalization with internalized transferrin was demonstrated in several cell lines [20]. Moreover, in T and B cells [21], cutaneous Langerhans cells [22], and various cell lines [20], CXCR4 exhibits an intracellular localization, suggesting that CXCR4 internalization may occur as both ligand‐dependent and ‐independent processes [23]. However, the degree of intracellular expression and spontaneous endocytosis was significantly different between cell types, suggesting the existence of a cell‐specific regulation of CXCR4 trafficking [20]. To understand additionally the mechanisms regulating CXCR4 expression on hematopoietic progenitors, we investigated the cellular distribution and the subcellular localization of CXCR4 in freshly isolated BM and mobilized peripheral blood (MPB) and CD34+ cells. Independently of the source of CD34+ cells, we identified a large intracellular pool of CXCR4 receptors that was mainly localized in early and recycling endosome compartments but not in lysosomes. Using antibody feeding experiments to evaluate CXCR4 trafficking, we provide evidences for a rapid ligand‐independent endocytosis. Thus, CXCR4 internalization and recycling in CD34+ cells may provide a dynamic regulation of HPC responses by altering the threshold for SDF‐1 signaling, leading to a modulation in their migration and mobilization potential. Materials and Methods Antibodies Fluorescein isothiocyanate (FITC)‐, R‐phycoerythrin (R‐PE), and allophycocyanin (APC)‐conjugated monoclonal antibodies (MoAb) specific for the following antigens were used: FITC and PE‐HPCA2 (anti‐CD34, immunoglobulin G1 [IgG1] isotype), APC‐ and PE‐12G5 (anti‐CXCR4, IgG2a isotype), and PE‐conjugated IgG1 and IgG2a control MoAbs, all purchased from BD Biosciences (Le Pont de Claix, France) and APC‐conjugated IgG2a and FITC‐conjugated CD63 (IgG1 isotype) MoAbs from Immunotech (Marseille, France). Two unconjugated antibodies directed against CXCR4 (12G5 and MAB172, clone number 44716.111; IgG2a and IgG2b isotype, respectively) and their control iso‐types IgG2a and IgG2b were from R&D Systems (Minneapolis). MoAbs against clathrin (IgM isotype) and Rab11 (IgG2a isotype) were obtained from Progen (Heidelberg, Germany) and BD Biosciences, respectively. The rabbit anti‐early endosome antigen 1 (EEA1) polyclonal antibody was from Affinity Bioreagents (Golden, CO). The rabbit anti‐Lamp‐1 polyclonal antibody was obtained from Santa Cruz Biotech‐nology (Santa Cruz, CA). Rabbit anti‐Rab4 and rabbit anti‐Rab5 polyclonal antibodies were from Stressgen Biotechnologies (Victoria, Canada). FITC‐conjugated AffiniPure F(ab')2 donkey anti‐rabbit and anti‐goat IgG (H + L) were purchased from Jackson Immuno‐Research Laboratories (West Grove, PA). Goat anti‐mouse IgG2b tetramethylrho‐damine isothiocyanate (TRITC), goat anti‐mouse IgM‐FITC, goat anti‐mouse IgG2a‐FITC, and goat anti‐mouse IgG2b‐RPE were all purchased from Southern Biotechnology Associates (Birmingham, AL). Plasmid Constructs, Retrovirus Production, and Obtention of CXCR4‐Expressing Cell Lines The complete coding region of CXCR4 (1.1 kb) was amplified by polymerase chain reaction (PCR) from a cDNA library prepared from the Daudi cell line using 5′ and 3′ primers, each containing a kpnI site (underlined) as follows: sense: 5′‐ACGGGTACCATGTGCCGCACCCTG‐GCCGC‐3′; antisense: 5′‐TCCCCATGGTCAGGTGTGT‐GAGGGCTCGTC‐3′. The amplified cDNA was subcloned into the PCR‐TOPOII expression vector (Invitrogen, Cergy Pontoise, France) to generate an untagged wild‐type CXCR4 protein or into the pEGFPC1 cloning vector to generate a CXCR4‐GFP fusion protein. CXCR4 cDNA was inserted into the retroviral vector pSF1N (kindly provided by Dr. W. Ostertag, Germany). The pSFIN retrovirus contains the murine stem cell virus promoter. Retroviral Infectious Particles Production in 293‐EBNA Cells The retrovirus‐producing cell line 293‐EBNA (Invitrogen) was maintained in Dulbecco's minimum essential medium (DMEM) (Gibco BRL) with 10% fetal bovine serum (FBS) and 250 μg/ml of G418 (Gibco BRL, Cergy‐Pontoise, France). The vesicular stomatitis virus‐glycoprotein (VSV‐G) pseudo‐typed retroviruses were produced by transient transfection of 293 EBNA with three different constructs, as previously described [24]. Viral titers were determined by limiting dilution assay with NIH 3T3 cells on the basis of GFP fluorescence and ranged from 1 to 5 × 106/ml. UT7 cells, factor‐dependent cells isolated from M7 leukemia, were infected with the viral supernatant at a multiplicity of infection of 10 retrovirus particles per cell in the presence of 4 μg/ml of hexa‐dimethrine bromide (Sigma‐Aldrich, St. Quentin Fallavier, France). Cells were cultured for 24 hours, and a second round of infection was performed in the same conditions. UT7 cells were maintained in minimum essential alpha medium (MEM alpha) (Gibco BRL, France) supplemented with 10% FBS, 1 mg/ml L‐glutamine, 100 U/ml penicillin G, and 100 μg/ml streptomycin (all from Gibco BRL) in the presence of 10 ng/ml recombinant human granulocyte‐macrophage colony‐stimulating factor (a gift from Novartis, Basel, Switzerland). GFP‐expressing cells were sorted using FACSVantage (Becton, Dickinson, Le Pont de Claix, France). Bone Marrow and Mobilized Peripheral Blood CD34+ Cells Aliquots of cytapheresis products from patients with non‐hematologic disease after mobilization by chemotherapy and granulocyte colony‐stimulating factor and BM of healthy patients undergoing hip surgery were obtained after informed consent. Mononuclear cells were separated on a Ficoll gradient (Lymphoprep; Nycomed Pharma, Oslo, Norway), and CD34+ cells were separated using a magnetic cell‐sorting system (miniMACS; Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of recovered cells was determined by flow cytometry after staining with the PE‐HPCA2 anti‐CD34 MoAb and was greater than 95%. Flow Cytometry Analysis Cells were stained with appropriate dilutions of the antibodies or isotype‐matched controls. After one washing, cells were suspended in phosphate‐buffered saline (PBS), kept at 4°C, and analyzed on a FACsort (Becton, Dickinson) with the CellQuest Pro software package. Chemotactic Assay The migration assay in response to SDF‐1 was as previously described [25]. All assays were performed in triplicate. Data are presented as the percentage of migration calculated by the following ratio: number of migrated cells in response to SDF‐1α or medium alone/number of input cells. Confocal Microscope and Image Analysis To determine the membrane expression of CXCR4, the staining procedure was carried out at 4°C without fixation. Unconjugated antibody directed against CXCR4 (MAB172) was added in a blocking buffer (1% bovine serum albumin + 2% milk), and cells were incubated for 1 hour. After washing with PBS, cells were exposed for 30 minutes to goat anti‐mouse IgG2b‐TRITC. After washing, cells were fixed with 2% paraformadehyde (PFA) and mounted on glass slides with a mounting medium (Vector Laboratories, Burlingame, CA). To identify intracellular receptors, cells were fixed with 2% PFA, 5% sucrose, 2 mM MgCl2, and 1 mM CaCl2 in PBS, permeabilized with 1% Brij 58 (polyoxyethylene 20 cetyl ether, Sigma), and suspended in the blocking buffer. Cells were stained for 1 hour with MAB172 in the blocking buffer, washed, and incubated for 30 minutes with a goat TRITC‐conjugated anti‐mouse γ2b heavy chain. For colocalization experiments, cells were suspended in medium, dropped on poly‐prep slides (Sigma), and left at 4°C for 1 hour to allow adhesion. After fixation and permeabilization, cells were labeled with the anti‐CXCR4 MoAb (MAB172, IgG2b isotype), and each of the rabbit primary antibodies was directed against markers for intracellular organelles such as anti‐EEA1, anti‐Rab4, anti‐Rab5, and anti‐Lamp‐1. Cells were then stained for 1 hour with a mix of two secondary antibodies, the goat TRITC‐conjugated anti‐mouse γ2b heavy and the donkey FITC‐conjugated anti‐Rabbit IgG (H + L). For simultaneous staining with anti‐CXCR4 (MAB172, IgG2b isotype) and anti‐clathrin MoAb (IgM isotype) or anti‐Rab11 MoAb (IgG2a isotype), a mix of secondary antibodies containing TRITC‐conjugated anti‐mouse γ2b heavy chain and either FITC‐conjugated anti‐mouse μheavy chain or anti‐mouse γ2a heavy chain was used. For colocalization experiments with CD63, the primary antibody mix contained anti‐CXCR4 MoAb (MAB172) and FITC‐conjugated anti‐CD63 MoAb (IgG1 isotype) and was followed by goat TRITC‐conjugated anti‐mouse γ2b antibody in the mix. Nonspecific background fluorescence was determined by staining with the conjugated secondary antibodies only for polyclonal antibodies and by using isotype controls followed by conjugated antibodies for monoclonal antibodies. Stacks of 15 to 20 confocal images were collected with a LSM 510 laser‐scanning confocal microscope (Zeiss, Oberkochen, Germany) using 63 × 1.4 NA apochromat plan lens. The excitation wavelengths for FITC and rhodamine were 488 and 543 nm, respectively. Image analysis was performed using LSM Image Examiner software (Zeiss). For each experimental condition, 15 to 17 images per cell were recorded from at least 20 cells. The images illustrate a single section with 0.38‐μM thickness. Each experiment analyzing CXCR4 expression and colocalization by confocal microscopy was repeated four times, each time using one different sample. Endocytosis of CXCR4 Cells were incubated with anti‐CXCR4 MoAb (MAB172) at 5 μg/ml for 45 minutes at 4°C, washed, and incubated at 37°C in serum‐free medium without cytokines to allow endocytosis. At different time points, samples were returned to 4°C and incubated with PE‐conjugated goat anti‐mouse IgG2b to detect CXCR4 that remained on the cell surface. CXCR4 cell‐surface expression was assessed using APC‐ or PE‐conjugated 12G5 after the cells were exposed for 5 minutes to an acidic buffer (MEM alpha adjusted to pH 3.0). MAB172 and 12G5 bindings were evaluated by fluorescence‐activated cell sorter (FACS). For staining with iron‐loaded human transfer‐rin (Tf) coupled to tetramethyrhodamine (Molecular Probes, Eugene, OR), cells were incubated with tetramethyrhodamine‐Tf for 30 minutes at 4°C in medium, harvested with PBS, and suspended in medium for various times at 37°C. Samples were taken at different time points, fixed, and analyzed by confocal microscopy. Statistics Results of experimental points obtained from three to five repeated experiments are reported as the mean ± standard deviation. Statistical analysis was performed using the two‐tailed Student's t‐test for paired data. Results CXCR4 Is Primarily an Intracellular Protein in CXCR4‐Transduced Cell Lines and CD34+ Cells In initial experiments, we used UT7 cells stably transduced with a GFP‐tagged version of CXCR4 to visualize the cellular distribution of the receptor. As assessed by confocal microscopy, fluorescence was present on both the cell surface and intracellular compartments (Fig. 1). When UT7‐CXCR4‐GFP cells were stained with MAB172 after perme‐abilization (Fig. 1A), GFP (Fig. 1B) and CXCR4 staining completely overlapped (Fig. 1C), confirming the specificity of MAB172 to intracellular CXCR4 molecules. A similar distribution of CXCR4 was seen in CXCR4‐GFP–transduced K562 and DAMI cell lines (data not shown). To exclude the possibility that GFP tagging was causing a mis‐location of CXCR4, an untagged CXCR4 version was expressed in UT7 cells. The overall staining pattern at the membrane (Fig. 1D) and in the cytoplasm (Fig. 1E) was similar to that observed in UT7‐CXCR4‐GFP cells, indicating that the GFP tagging did not interfere with CXCR4 localization. These observations are in line with previous studies that have reported an intracellular localization of GFP‐tagged CXCR4 [20]. Figure 1. Open in new tabDownload slide Intracellular expression of CXCR4 in CXCR4‐transduced UT7 cells. UT7 and UT7 cells overexpressing a fusion CXCR4‐GFP protein (UT7‐CXCR4‐GFP) or a wild‐type protein (UT7‐CXCR4) were fixed, permeabilized, and stained with the anti‐CXCR4 MAB172 monoclonal antibody. MAB172 binding was revealed with tetramethylrhodamine isothiocyanate anti‐immunoglobulin G2b. (A): CXCR4 distribution in UT7‐CXCR4‐GFP cells stained with MAB172. (B): Distribution of GFP‐tagged CXCR4 receptors. (C): Merged images showing significant overlapping. Membrane (D) and intracellular (E) expression of CXCR4 in UT7 cells overex‐pressing wild‐type receptors. Membrane (F) and intracellular (G) background staining with MAB172 was determined on untransduced UT7 cells. Bar = 10 μM. Abbreviation: GFP, green fluorescent protein. Figure 1. Open in new tabDownload slide Intracellular expression of CXCR4 in CXCR4‐transduced UT7 cells. UT7 and UT7 cells overexpressing a fusion CXCR4‐GFP protein (UT7‐CXCR4‐GFP) or a wild‐type protein (UT7‐CXCR4) were fixed, permeabilized, and stained with the anti‐CXCR4 MAB172 monoclonal antibody. MAB172 binding was revealed with tetramethylrhodamine isothiocyanate anti‐immunoglobulin G2b. (A): CXCR4 distribution in UT7‐CXCR4‐GFP cells stained with MAB172. (B): Distribution of GFP‐tagged CXCR4 receptors. (C): Merged images showing significant overlapping. Membrane (D) and intracellular (E) expression of CXCR4 in UT7 cells overex‐pressing wild‐type receptors. Membrane (F) and intracellular (G) background staining with MAB172 was determined on untransduced UT7 cells. Bar = 10 μM. Abbreviation: GFP, green fluorescent protein. We next performed FACS analysis and immunostaining to determine the location of CXCR4 expression in freshly isolated MPB and BM CD34+ cells. When cells were stained with either MAB172 or PE‐12G5 before fixation and perme‐abilization, a low but significant staining was detected at the cell surface, with, in most cases, an intensity slightly higher in BM than MPB CD34+ cells (Table 1, Figs. 2A, 2B). In contrast, after permeabilization, most of the freshly isolated MPB (Fig. 2A) and BM (Fig. 2B) CD34+ cells exhibited an intense staining throughout the cytoplasm. No staining was observed with isotype control antibody (not shown). These data indicate that CXCR4 is primarily found in a cytoplasmic compartment in both BM and MPB CD34+ cells. Table 1. CXCR4 expression on freshly isolated MPB CD34+ cells and BM CD34+ cells Source of cells MCFR (MAB172) (mean ± SD) MCFR (12G5‐PE) (mean ± SD)  PB CD34+ cells (n = 7) 4.33 ± 3.88 2.59 ± 0.55  BM CD34+ cells (n = 6) 9.40 ± 2.36 3.14 ± 0.47 Source of cells MCFR (MAB172) (mean ± SD) MCFR (12G5‐PE) (mean ± SD)  PB CD34+ cells (n = 7) 4.33 ± 3.88 2.59 ± 0.55  BM CD34+ cells (n = 6) 9.40 ± 2.36 3.14 ± 0.47 Freshly isolated CD34+ cells from MPB and BM were labeled with 12G5‐PE or MAB172 followed with anti‐IgG2b‐PE. The correspondent controls were IgG2a‐PE and IgG2b. To compare between different samples, the MCFR was defined, which is the ratio between mean channel fluorescence intensities of CXCR4 and their respective negative controls. Abbreviations: BM, bone marrow; IgG2a, immunoglobulin G2a; IgG2b, immunoglobulin G2b; MCFR, mean channel fluorescence ratio; MPB, mobilized peripheral blood; PE, phycoerythrin; SD, standard deviation. Open in new tab Table 1. CXCR4 expression on freshly isolated MPB CD34+ cells and BM CD34+ cells Source of cells MCFR (MAB172) (mean ± SD) MCFR (12G5‐PE) (mean ± SD)  PB CD34+ cells (n = 7) 4.33 ± 3.88 2.59 ± 0.55  BM CD34+ cells (n = 6) 9.40 ± 2.36 3.14 ± 0.47 Source of cells MCFR (MAB172) (mean ± SD) MCFR (12G5‐PE) (mean ± SD)  PB CD34+ cells (n = 7) 4.33 ± 3.88 2.59 ± 0.55  BM CD34+ cells (n = 6) 9.40 ± 2.36 3.14 ± 0.47 Freshly isolated CD34+ cells from MPB and BM were labeled with 12G5‐PE or MAB172 followed with anti‐IgG2b‐PE. The correspondent controls were IgG2a‐PE and IgG2b. To compare between different samples, the MCFR was defined, which is the ratio between mean channel fluorescence intensities of CXCR4 and their respective negative controls. Abbreviations: BM, bone marrow; IgG2a, immunoglobulin G2a; IgG2b, immunoglobulin G2b; MCFR, mean channel fluorescence ratio; MPB, mobilized peripheral blood; PE, phycoerythrin; SD, standard deviation. Open in new tab Figure 2. Open in new tabDownload slide Membrane and intracellular expression of CXCR4 on MPB CD34+ and BM CD34+ cells. Freshly isolated CD34+ cells were stained with anti‐CXCR4 MAB172 and fluorescein isothiocyanate–conjugated anti‐CD34 monoclonal antibodies before (‐fixation) or after (+fixation) fixation and permeabilization. Membrane and intra‐cellular expression of CXCR4 and CD34 on MPB CD34+ cells (A) and BM CD34+ cells (B). Background staining with anti‐CD34 monoclonal antibodies was determined on CD34− cells (C). Abbreviation: BM, bone marrow; MPB; mobilized peripheral blood. Figure 2. Open in new tabDownload slide Membrane and intracellular expression of CXCR4 on MPB CD34+ and BM CD34+ cells. Freshly isolated CD34+ cells were stained with anti‐CXCR4 MAB172 and fluorescein isothiocyanate–conjugated anti‐CD34 monoclonal antibodies before (‐fixation) or after (+fixation) fixation and permeabilization. Membrane and intra‐cellular expression of CXCR4 and CD34 on MPB CD34+ cells (A) and BM CD34+ cells (B). Background staining with anti‐CD34 monoclonal antibodies was determined on CD34− cells (C). Abbreviation: BM, bone marrow; MPB; mobilized peripheral blood. Intracellular Compartment Containing CXCR4 Overlapped with Endocytic Compartment To investigate more precisely CXCR4 intracellular location, we performed an immunofluorescence labeling with tetramethyrhodamine‐conjugated Tf, because it is well documented that Tf internalizes with its receptor and constitutively recycles with the receptor from early endosomes to the recycling compartment before reappearing on the cell surface [26]. After exposure to labeled Tf, UT7‐CXCR4‐GFP cells were incubated at 37°C for different lengths of time to allow internalization. At the end of each time point, cells were fixed and analyzed by confocal microscopy for Tf and CXCR4‐GFP expression. Tf was first detected at the cell surface and then intracellularly into small vesicular structures concentrated in the perinuclear region (Fig. 3). As shown in merged images (Fig. 3), CXCR4‐GFP colocalized with Tf, particularly in the perinuclear vesicular structures. These results indicate that CXCR4 is associated with the endocytic compartment and suggest that a spontaneous CXCR4 endocytosis occurs in UT7 cells. Figure 3. Open in new tabDownload slide Intracellular CXCR4 colocalized with transferrin, an endosome marker. UT7‐CXCR4‐GFP cells were labeled with tetramethylrhodamine‐conjugated transferrin at 4°C, washed, and incubated at 37°C for 1–30 minutes to allow transferrin internalization. Cells were fixed and analyzed by confocal microscopy. Red fluorescence shows the endocytosis of transferrin. Green fluorescence shows the distribution of GFP‐tagged CXCR4. The yellow color in merged images indicates significant colocalization. Abbreviation: GFP, green fluorescent protein. Figure 3. Open in new tabDownload slide Intracellular CXCR4 colocalized with transferrin, an endosome marker. UT7‐CXCR4‐GFP cells were labeled with tetramethylrhodamine‐conjugated transferrin at 4°C, washed, and incubated at 37°C for 1–30 minutes to allow transferrin internalization. Cells were fixed and analyzed by confocal microscopy. Red fluorescence shows the endocytosis of transferrin. Green fluorescence shows the distribution of GFP‐tagged CXCR4. The yellow color in merged images indicates significant colocalization. Abbreviation: GFP, green fluorescent protein. To identify the subcellular compartment in which CXCR4 was localized in freshly isolated MPB CD34+ cells, we tried to use tetramethyrhodamine‐conjugated Tf as above. However, our attempts have been unsuccessful so far, most likely because the level of Tf receptors expressed in these cells is low. We therefore used indirect immunofluorescence microscopy to dually label CD34+ cells with a CXCR4 MoAb and various antibodies directed against markers of the secretory and endocytotic pathways, including clathrin, EEA1, late endosome/lysosomal Lamp‐1, and CD63. As shown in Figure 4A, a large proportion of CXCR4 molecules were colocalized with EEA1. Similar results were obtained with the clathrin marker (Fig. 4A). In contrast, most CXCR4 molecules did not show colocalization with Lamp‐1 and CD63 (Fig. 4B), indicating that most CXCR4 molecules were localized in the endosomal compartment in human CD34+ cells. Figure 4. Open in new tabDownload slide Intracellular compartment containing CXCR4 overlapped with endocytic compartment in CD34+ cells. MPB CD34+ cells were fixed, permeabilized, and dually labeled with anti‐CXCR4 MAB172, revealed with a phycoerythrin anti‐Ig G2b (red fluorescence) and a panel of antibodies directed to EEA1 or clathrin (A); Lamp‐1 or CD63 (B); or Rab4, Rab5, and Rab11 (green fluorescence) (C). Cells were analyzed by confocal microscopy; the yellow color in merged images (right columns) indicates significant colocaliza‐tion. Background fluorescence was determined by staining with the conjugated secondary antibodies only for polyclonal antibodies and by using isotype controls followed by conjugated antibodies for monoclonal antibodies. Bar = 5 μm. Abbreviations: EEA1, early endosomal antigen 1; FITC, fluorescein isothiocyanate; Ig, immunoglobulin; MPB, mobilized peripheral blood. Figure 4. Open in new tabDownload slide Intracellular compartment containing CXCR4 overlapped with endocytic compartment in CD34+ cells. MPB CD34+ cells were fixed, permeabilized, and dually labeled with anti‐CXCR4 MAB172, revealed with a phycoerythrin anti‐Ig G2b (red fluorescence) and a panel of antibodies directed to EEA1 or clathrin (A); Lamp‐1 or CD63 (B); or Rab4, Rab5, and Rab11 (green fluorescence) (C). Cells were analyzed by confocal microscopy; the yellow color in merged images (right columns) indicates significant colocaliza‐tion. Background fluorescence was determined by staining with the conjugated secondary antibodies only for polyclonal antibodies and by using isotype controls followed by conjugated antibodies for monoclonal antibodies. Bar = 5 μm. Abbreviations: EEA1, early endosomal antigen 1; FITC, fluorescein isothiocyanate; Ig, immunoglobulin; MPB, mobilized peripheral blood. Two endosome populations, early and recycling endosomes, are involved in receptor recycling [27]. To characterize further the localization of CXCR4 with respect to these compartments, we performed colocalization studies using antibodies directed toward members of the Rab family of small GTPases. Double labeling with antibodies against Rab5, present in clathrin‐coated vesicles, and CXCR4 antibodies showed good, although incomplete, colocalization(Fig. 4C). Similarly, in most of the cells, CXCR4 colocalized with Rab4, a marker of membranes emerging from Rab5‐positive membranes. When the distribution of CXCR4 was examined with respect to recycling endosomes characterized by the presence of the Rab11 protein, a fairly good colocalization of the two proteins was seen (Fig. 4C). These results suggest that CXCR4 in CD34+ cells is associated with early and recycling endosomes but is not distributed in the lysosomal compartment. Cycling of CXCR4 between Cell Surface and Intracellular Stores The above data suggested that CXCR4 may cycle between the cell surface and the endocytic compartment. To determine whether surface CXCR4 undergoes ligand‐independent endocytosis, we performed antibody feeding experiments. As a first step before using MAB172 as a probe for CXCR4 endocytosis, we characterized the effects of the antibody on UT7‐CXCR4‐GFP cells. First, we examined whether MAB172 had the ability to induce CXCR4 internalization. Cells were incubated with a saturating concentration of MAB172 at 4°C, washed, and warmed at 37°C to allow receptor internalization. Cells were then returned to 4°C and labeled again with MAB172, followed with PE‐conjugated goat anti‐mouse IgG2b. Under these conditions, the PE fluorescence reflects the cell‐surface expression of CXCR4. Figure 5A shows that binding with MAB172 did not change the membrane expression of CXCR4. Moreover, no change in cell‐surface binding level of the conformation‐dependent 12G5 antibody was detected (Fig. 5B), indicating that MAB172 did not alter CXCR4 membrane expression and did not modify significantly its conformation. We also studied whether MAB172 had the capacity to interfere with CXCR4 signaling by measuring the dose‐dependent migration response to SDF‐1. MAB172‐treated UT7‐CXCR4‐GFP cells exhibited comparable migration responses to SDF‐1 as cells treated with the control antibody isotype or untreated cells (Fig. 5C). Other experiments (data not shown) showed that MAB172 did not interfere with SDF‐1 binding and signaling. These data allow us to conclude that MAB172 did not affect significantly the localization or the function of CXCR4 and, thus, can be used as a trafficking tracer for CXCR4. Figure 5. Open in new tabDownload slide MAB 172 did not affect the localization or the function of CXCR4. UT7‐CXCR4‐GFP cells were labeled with a saturating amount (5 μg/ml) of the anti‐CXCR4 MAB172 MoAb at 4°C, washed, and incubated at 37°C for 30 minutes to allow CXCR4 endocytosis. Cells were then treated with an acid buffer to stripe down the antibody molecules bound on the membrane. Cells were reincubated with MAB172 (A) or 12G5 (B) at 4°C, followed with PE‐anti‐IgG2b or PE‐anti‐IgG2a, respectively. Histograms of fluorescence show similar membrane expression of CXCR4 before incubation (bold line) and after 45 minutes of incubation at 37°C (thin line). Solid histograms are controls IgG2b (A) and IgG2a (B). (C): Chemotactic assay to SDF‐1. UT7‐CXCR4‐GFP cells were labeled with MAB172 or IgG2b and subjected to an in vitro transwell migration assay in response to different concentrations of SDF‐1. Data are expressed as the percentage of migration (in y axis). Results are from one representative experiment performed in triplicate. Each experiment was repeated three times with similar results. Abbreviations: GFP, green fluorescent protein; Ig, immunoglobulin; PE, phycoerythrin; SDF‐1, stromal cell–derived factor‐1. Figure 5. Open in new tabDownload slide MAB 172 did not affect the localization or the function of CXCR4. UT7‐CXCR4‐GFP cells were labeled with a saturating amount (5 μg/ml) of the anti‐CXCR4 MAB172 MoAb at 4°C, washed, and incubated at 37°C for 30 minutes to allow CXCR4 endocytosis. Cells were then treated with an acid buffer to stripe down the antibody molecules bound on the membrane. Cells were reincubated with MAB172 (A) or 12G5 (B) at 4°C, followed with PE‐anti‐IgG2b or PE‐anti‐IgG2a, respectively. Histograms of fluorescence show similar membrane expression of CXCR4 before incubation (bold line) and after 45 minutes of incubation at 37°C (thin line). Solid histograms are controls IgG2b (A) and IgG2a (B). (C): Chemotactic assay to SDF‐1. UT7‐CXCR4‐GFP cells were labeled with MAB172 or IgG2b and subjected to an in vitro transwell migration assay in response to different concentrations of SDF‐1. Data are expressed as the percentage of migration (in y axis). Results are from one representative experiment performed in triplicate. Each experiment was repeated three times with similar results. Abbreviations: GFP, green fluorescent protein; Ig, immunoglobulin; PE, phycoerythrin; SDF‐1, stromal cell–derived factor‐1. The kinetic of CXCR4 internalization was quantified in both UT7‐CXCR4‐GFP and MPB CD34+ cells by flow cytometry. Cells were incubated with saturating amounts of unlabeled MAB172 at 4°C, washed, and incubated at 37°C for different periods of time. At the end of each time point, cells were labeled at 4°C with a PE‐conjugated anti‐mouse IgG2b to stain the MAB172 molecules remaining at the cell surface. As measured by FACS analysis, the intensity of membrane fluorescence decreased rapidly in both UT7‐CXCR4‐GFP (Fig. 6A) and CD34+ cells (Fig. 6B), with a reduction reaching approximately 40% within 5 minutes (Table 2). No diminution of fluorescence was observed using UT7 cells expressing a C‐terminal truncated form of CXCR4 that cannot undergo endocytosis (data not shown), excluding the possibility that the time‐dependent decrease in fluorescence after incubation at 37°C was related to a simple detachment of MAB172 from the cells. The reduction in membrane fluorescence is associated with a parallel augmentation of intracellular fluorescence (Figs. 6H, 6I). Interestingly, when MAB172‐treated UT7‐CXCR4‐GFP (Fig. 6C) or CD34+ cells (Fig. 6D) were stained with APC‐12G5 to assess cell‐surface expression, very little change in CXCR4 membrane expression was detected, suggesting a redistribution of intra‐cellular CXCR4 receptors to the cell surface. Examination by confocal microscopy of cells incubated at 37°C with MAB172 and treated with acid buffer to remove cell surface–associated antibodies revealed MAB172 staining (Fig. 6E) and numerous fluorescence‐tagged vesicles inside the cells (Fig. 6F), and merged images (Fig. 6G) showed colocalization of GFP‐tagged CXCR4 and internalized CXCR4 stained with the antibody. Kinetics of CXCR4 internalization were not affected by incubation of UT7‐CXCR4 and CD34+ cells with neutralizing antibodies to SDF‐1 (data not shown). These results show that CXCR4 receptors cycle continuously to and from the cell surface in a ligand‐independent manner. Table 2. Constitutive internalization of CXCR4 on UT7‐CXCR4‐GFP cells and CD34+ cells Percentage of internalization (%) Time (minutes) UT7‐CXCR4‐GFP CD34+  1 9.0 ± 5.6 17 ± 1  5 36.4 ± 10.9 39.1 ± 9  15 39.8 ± 10.1 49.3 ± 9  45 58.6 ± 3.9 55 ± 6.5 Percentage of internalization (%) Time (minutes) UT7‐CXCR4‐GFP CD34+  1 9.0 ± 5.6 17 ± 1  5 36.4 ± 10.9 39.1 ± 9  15 39.8 ± 10.1 49.3 ± 9  45 58.6 ± 3.9 55 ± 6.5 UT7‐CXCR4‐GFP cells and CD34+ cells were subjected to the same experiment as described in Figure 6A. The disappearance of MAB172 was presented as percentage of internalization calculated by the following ratio: (mean fluorescence at 0 minutes – mean fluorescence at each time point)/(mean fluorescence at 0 minutes). Results are means ± standard deviation from four independent experiments. Open in new tab Table 2. Constitutive internalization of CXCR4 on UT7‐CXCR4‐GFP cells and CD34+ cells Percentage of internalization (%) Time (minutes) UT7‐CXCR4‐GFP CD34+  1 9.0 ± 5.6 17 ± 1  5 36.4 ± 10.9 39.1 ± 9  15 39.8 ± 10.1 49.3 ± 9  45 58.6 ± 3.9 55 ± 6.5 Percentage of internalization (%) Time (minutes) UT7‐CXCR4‐GFP CD34+  1 9.0 ± 5.6 17 ± 1  5 36.4 ± 10.9 39.1 ± 9  15 39.8 ± 10.1 49.3 ± 9  45 58.6 ± 3.9 55 ± 6.5 UT7‐CXCR4‐GFP cells and CD34+ cells were subjected to the same experiment as described in Figure 6A. The disappearance of MAB172 was presented as percentage of internalization calculated by the following ratio: (mean fluorescence at 0 minutes – mean fluorescence at each time point)/(mean fluorescence at 0 minutes). Results are means ± standard deviation from four independent experiments. Open in new tab Figure 6. Open in new tabDownload slide Cycling of CXCR4 between the cell surface and intracellular stores in UT7‐CXCR4‐GFP and MPB CD34+ cells. UT7‐CXCR4‐GFP cells (A, C) and CD34+ cells (B, D) were labeled with a saturating amount, 5 μg/ml, of unlabeled MAB172 at 4°C, washed, and incubated at 37°C for different times. At the end of each time point, half of the cells were labeled at 4°C with PE‐anti‐IgG2b to detect MAB172 remains on the cell surface (A, B). Half of the cells were treated with an acidic buffer to strip down the MAB172 on membrane and reincubated with APC‐12G5 (C, D). (A, B): Time‐dependent internalization of CXCR4 on UT‐7‐CXCR4‐GFP cells (A) and MPB CD34+ cells (B). (C, D): Stable surface expression of CXCR4 on UT7‐CXCR4‐GFP (C) and MPB CD34+ (D) cells. Solid histograms, control IgG2b; bold line, 0 minutes; thin line, 1 minute; dotted line, 5 minutes; dashed line, 45 minutes. (E–G): Detection of internalized CXCR4 by confocal microscopy. UT7‐CXCR4‐GFP cells were stained with MAB172, incubated for 30 minutes at 37°C, treated with acid to strip down the remaining MAB172 combined on the cell membrane, fixed, permeabilized, and incubated with tetramethylrhodamine isothiocyanate–conjugated anti‐mouse IgG2b. The yellow color in merged image indicated significant colocalization of MAB172 and GFP staining. (H, I): Time‐dependent endocytosis of CXCR4 on UT7‐CXCR4‐GFP cells (bar = 10 μm) (H) and CD34+ cells (bar = 5 μm) (I). CXCR4 membrane expression (0 minutes) and internalized antibody for different times (1, 5, 15, and 45 minutes) are shown. Background staining was determined by labeling the cells with an IgG2b isotype antibody. A representative experiment out of three performed is shown. Abbreviation: GFP, green fluorescent protein; IgG2b, immunoglobulin G2b; PE, phycoerythrin. Figure 6. Open in new tabDownload slide Cycling of CXCR4 between the cell surface and intracellular stores in UT7‐CXCR4‐GFP and MPB CD34+ cells. UT7‐CXCR4‐GFP cells (A, C) and CD34+ cells (B, D) were labeled with a saturating amount, 5 μg/ml, of unlabeled MAB172 at 4°C, washed, and incubated at 37°C for different times. At the end of each time point, half of the cells were labeled at 4°C with PE‐anti‐IgG2b to detect MAB172 remains on the cell surface (A, B). Half of the cells were treated with an acidic buffer to strip down the MAB172 on membrane and reincubated with APC‐12G5 (C, D). (A, B): Time‐dependent internalization of CXCR4 on UT‐7‐CXCR4‐GFP cells (A) and MPB CD34+ cells (B). (C, D): Stable surface expression of CXCR4 on UT7‐CXCR4‐GFP (C) and MPB CD34+ (D) cells. Solid histograms, control IgG2b; bold line, 0 minutes; thin line, 1 minute; dotted line, 5 minutes; dashed line, 45 minutes. (E–G): Detection of internalized CXCR4 by confocal microscopy. UT7‐CXCR4‐GFP cells were stained with MAB172, incubated for 30 minutes at 37°C, treated with acid to strip down the remaining MAB172 combined on the cell membrane, fixed, permeabilized, and incubated with tetramethylrhodamine isothiocyanate–conjugated anti‐mouse IgG2b. The yellow color in merged image indicated significant colocalization of MAB172 and GFP staining. (H, I): Time‐dependent endocytosis of CXCR4 on UT7‐CXCR4‐GFP cells (bar = 10 μm) (H) and CD34+ cells (bar = 5 μm) (I). CXCR4 membrane expression (0 minutes) and internalized antibody for different times (1, 5, 15, and 45 minutes) are shown. Background staining was determined by labeling the cells with an IgG2b isotype antibody. A representative experiment out of three performed is shown. Abbreviation: GFP, green fluorescent protein; IgG2b, immunoglobulin G2b; PE, phycoerythrin. Ligand‐Independent CXCR4 Internalization Is Clathrin Mediated Hypertonic sucrose medium blocks the assembly of coated pits and prevents endocytosis of receptors that use clathrin for internalization. In addition, it has been established that SDF‐1 and phorbol myristate acetate–induced CXCR4 endocytosis occurs via coated pits and is blocked by hyper‐ tonic sucrose [28]. To determine whether the ligand‐independent endocytosis of CXCR4 also occurs via coated pits, MPB CD34+ cells were incubated at 37°C in medium lacking or containing high sucrose (0.45 M) for different lengths of time. Upon incubation for 3–15 minutes in sucrose‐rich medium, an increase in CXCR4 membrane expression was observed (Fig. 7A), whereas no significant variation was detected in cells maintained in control medium (Fig. 7B). On the other hand, expression of CD45 and CD34 was not affected by sucrose treatment (data not shown). These results are consistent with the notion that CXCR4 undergoes a constitutive internalization through coated pits. Figure 7. Open in new tabDownload slide Spontaneous internalization of CXCR4 is clathrin mediated. MPB CD34+ cells were incubated with (A) or without (B) sucrose (0.45 M) for 0 minutes (bold line), 3 minutes (thin line), or 15 minutes (dotted line). Membrane CXCR4 was detected by phycoerythrin‐12G5 and analyzed by flow cytometry. A representative experiment out of three performed is shown. Abbreviation: MPB, mobilized peripheral blood. Figure 7. Open in new tabDownload slide Spontaneous internalization of CXCR4 is clathrin mediated. MPB CD34+ cells were incubated with (A) or without (B) sucrose (0.45 M) for 0 minutes (bold line), 3 minutes (thin line), or 15 minutes (dotted line). Membrane CXCR4 was detected by phycoerythrin‐12G5 and analyzed by flow cytometry. A representative experiment out of three performed is shown. Abbreviation: MPB, mobilized peripheral blood. Discussion In this report, we analyzed in detail the cellular localization of CXCR4 in freshly isolated human CD34+ hematopoietic progenitor cells, and we studied its intracellular trafficking. Several conclusions can be drawn from our study. First, mobilized CD34+ cells and their BM counterparts exhibit a low membrane expression but a high intracytoplasmic pool. Second, intracellular CXCR4 is mainly localized in endocytic and recycling endosomal compartments displaying EEA‐1, clathrin, Rab4, Rab5, and Rab11 immunoreactivity. Third, CXCR4 distribution is dynamically regulated by a lig‐and‐independent endocytosis involving clathrin‐coated pits. We used freshly isolated human BM or mobilized CD34+ cells and a human multipotent cell line (UT7) stably transduced with different forms of CXCR4 to analyze CXCR4 expression and its intracellular localization by confocal imaging. UT7 cells overexpressing a wild‐type or a GFP‐tagged CXCR4 protein exhibited both an important surface expression and an intracellular pool of CXCR4. Interestingly, a pool of preformed CXCR4 receptors was also observed in primary CD34+ cells, although these cells displayed a low surface expression . Previous studies have indicated a similar intracellular expression of CXCR4 in CD34+ cells [29]. The contrast between a high intracellular pool of CXCR4 in CD34+ cells with a low expression at the surface raised the question about how this distribution was achieved. It was also shown that CXCR4, like other G protein–coupled receptors, such as type A cholecystokinin receptor [30] and GABAA receptors [31], can undergo spontaneous internalization that may account for very low or no surface expression, depending on the cellular context. In UT7 cells overexpressing a GFP‐tagged CXCR4 protein, a striking colocalization of CXCR4 and tetramethyrhodamine‐conjugated transferrin was seen, suggesting that CXCR4 was mainly localized in the endosome compartment, as recently reported for several cell lines [20]. Because CD34+ hematopoietic cells express a low level of Tf receptors, we used markers of intracellular compartments to determine the intracellular location of CXCR4 in this cell type. CXCR4 receptors were colocalized with EEA‐1 and clathrin, which identify early endosomes, and with Rab4, Rab5, and Rab11, located in early and recycling endosomes, but not with lysosome compartments labeled with anti‐Lamp‐1 and anti‐CD63 antibodies. Thus, in freshly isolated CD34+ cells and in the absence of an exogenous stimulus, CXCR4 was mainly distributed in the early and recycling endosomes. To gain insights into the mechanisms involved in the intracellular localization of CXCR4 in CD34+ cells, we used an indirect immunofluorescence technique with a monoclonal anti‐CXCR4 antibody (MAB172) as a reporter molecule to measure receptor endocytosis. Such an approach was chosen in part because of the lack of specific antibodies available for biochemical studies and the rarity of CD34+ cells. With this approach, we found that CXCR4 receptors underwent significant endocytosis, with a rate of receptor internalization of 9% or 8% of the cell‐surface pool per minute in CD34+ and UT7‐CXCR4‐GFP cells, respectively, and reached almost steady‐state levels in 5 minutes, when 40% of the initial pool was internalized. However, previous studies have observed antibody‐promoted internalization of membrane under certain conditions. In the study of Forster et al. [21], the internalization and recycling of CXCR4 were observed at high frequency using anti‐CXCR4 mAbs. These data have been interpreted as an effect of anti‐CXCR4, because intracellular stores of CXCR4 were not detected in their model (ESIII cells). Another study [23] using similar approaches suggested that CXCR4 on T‐cell lines undergoes constitutive endocytosis and recycling. Although our experiments cannot, at present time, completely rule out some effects of the anti‐CXCR4 mAb on receptor trafficking, we were unable to observe any significant influence of the anti‐CXCR4 mAb on the distribution of CXCR4. First, MAB172 binding completely failed to induce variation of CXCR4 membrane expression; second, MAB172 did not interfere with SDF‐1 signaling assessed by measuring SDF‐1–induced migration in tran‐swell assay. Accordingly, we observed in control experiments that SDF‐1 and MAB172 did not compete for binding to CXCR4. These findings together with the observation that high intracellular stores of CXCR4 can be detected in both UT7 and CD34+ cells indicate a continuous circulation of CXCR4. Moreover, the spontaneous recycling of CXCR4 was confirmed by its colocalization with the endosome compartment in UT7 over expressing CXCR4‐GFP fusion protein and in freshly isolated CD34+ cells. To rule out the possibility that CXCR4 internalization was promoted by endogenous production of SDF‐1 by CD34+ cells [32,33], we examined the kinetics of receptor internalization in the presence of a blocking antibody to SDF‐1 (data not shown). No difference was seen, indicating that CXCR4 endocytosis must occur constitutively. However, although our data indicate that CXCR4 was significantly internalized, the expression on the cell surface remained constant over the period of the study, suggesting that intracellular receptors might recycle to the surface. This hypothesis is consistent with a previous observation performed with a similar approach, showing that approximately 1% of surface CXCR4 receptors were internalized and recycled per minute in T‐cell lines [23]. In contrast, transfected CHO cells exhibited faster constitutive endocytosis. Nevertheless, the rate of internalization and recycling was higher in CD34+ cells compared with T‐cell lines [23], indicating that the degree of constitutive endocytosis may vary among cells. Although numerous studies have investigated the mechanisms involved in SDF‐1 or PKC‐induced internalization, little is known about the mechanisms involved in constitutive CXCR4 endocytosis. For instance, CXCR4 internalization in response to phorbol esters is mediated by clathrin‐coated vesicles [23]. Similarly, a clathrin‐dependent CXCR4 internalization induced by SDF‐1 or gp120 was reported in several cell lines. It is demonstrated that CXCR4 internalization induced by phorbol esters and SDF‐1 require the phosphorylation of the receptor at the cytoplasmic tail [34,35]. To investigate whether constitutive endocytosis in CD34+ cells occurs through clathrin‐coated pits, we exposed CD34+ cells to hypertonic sucrose. Under these conditions, the surface expression of CXCR4 was increased, suggesting an involvement of clathrin‐coated pits. Together, these data suggest that the constitutive endocytosis of CXCR4 is mediated by clathrin‐coated pits. In addition, proteins that associate with CXCR4 likely contribute to ligand‐independent receptor modulation. It has been shown that the association of CXCR4 with G protein–coupled receptor kinase 3 may mediate the sequestration of this receptor [36]. Additional experiments using dominant‐negative forms of GRKs will be required to investigate their implication in CXCR4 trafficking. The reasons for a constitutive recycling of CXCR4 receptors in CD34+ cells are currently unknown, but several possible explanations may be envisioned. CXCR4 recycling may provide a subtle control for its membrane expression. Because SDF‐1 is produced at a high level within the marrow environment, it might be necessary to tightly regulate the expression of CXCR4 molecules on the cell surface of hematopoietic progenitor cells. Alternatively, this intracellular pool may serve as a reservoir, allowing a rapid response to SDF‐1. A better understanding of CXCR4 trafficking and its regulation will be required to understand how this process may affect hematopoietic progenitor cell migration in steady‐state hematopoiesis and on mobilization. Acknowledgements We are grateful to Novartis for recombinant human granulocyte‐macrophage colony‐stimulating factor. We are grateful to the surgeons for providing bone marrow samples and to Dr. C. Bocaccio at Institut Gustave Roussy (Villejuif, France) for mobilized peripheral blood samples. We thank Pascal Roux (Institut Pasteur, Paris) for confocal microscopy images, and Frederic Larbret and Yann Lecluse (IFR54, Villejuif, France) for cell‐sorting experiments. We are also grateful to Dr. Francoise Wendling, Inserm U362, Villejuif, France, for discussion and critical reading of the manuscript. This work was supported by grants from the Institut National de la Santé et de la Recherche Médicale, the Institut Gustave Roussy, and the Association pour la Recherche contre le Cancer (grant 4309 to F.L.). Y.Z., A.F., and D.B. are supported by a fellowship from the Ministère de la Recherche. M.B. is supported by la Ligue Nationale contre le Cancer (comité Yvelines). J.F.G. was a recipient of Comité de Recherche Clinique (Institut Gustave Roussy). Yanyan Zhang and Adlen Foudi, contributed equally to this study. References 1 Nagasawa T , Kikutani H, Kishimoto T. Molecular cloning and structure of a pre‐B‐cell growth‐stimulating factor . Proc Natl Acad Sci U S A 1994 ; 91 : 2305 – 2309 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Bleul CC , Farzan M, Choe H, et al. . The lymphocyte chemo‐attractant SDF‐1 is a ligand for LESTR/fusin and blocks HIV‐1 entry . Nature 1996 ; 382 : 829 – 832 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Oberlin E , Amara A, Bachelerie F, et al. . The CXC chemokine SDF‐1 is the ligand for LESTR/fusin and prevents infection by T‐cell‐line‐adapted HIV‐1 . Nature 1996 ; 382 : 833 – 835 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Nagasawa T , Hirota S, Tachibana K, et al. . Defects of B‐cell lymphopoiesis and bone marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF‐1 . Nature 1996 ; 382 : 635 – 638 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Ma Q , Jones D, Borghesani PR, et al. . Impaired B‐lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4‐ and SDF‐1‐deficient mice . Proc Natl Acad Sci U S A 1998 ; 95 : 9448 – 9453 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Tachibana K , Hirota S, Iizasa H, et al. . The chemokine receptor CXCR‐4 is essential for the gastrointestinal tract . Nature 1998 ; 393 : 591 – 594 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Zou Y‐R , Kottman AH, Kuroda M, et al. . Function of the chemokine receptor CXCR‐4 in haematopoiesis and in cerebellar development . Nature 1998 ; 393 : 595 – 599 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Aiuti A , Webb IJ, Bleul C, et al. . The chemokine SDF‐1 is a chemoattractant for human CD34+ hematopoietic progenitor cells and provides a new mechanism to explain the mobilization of CD34+ pogenitors to peripheral blood . J Exp Med 1997 ; 185 : 111 – 120 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Wang JF , Park IW, Groopman JE. Stromal cell‐derived factor‐1alpha stimulates tyrosine phosphorylation of multiple focal adhesion proteins and induces migration of hematopoietic progenitor cells: roles of phosphoinositide‐3 kinase and protein kinase C . Blood 2000 ; 95 : 2505 – 2513 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Cashman J , Clark‐Lewis I, Eaves A, et al. . Stromal‐derived factor 1 inhibits the cycling of very primitive human hematopoietic cells in vitro and in NOD/SCID mice . Blood 2002 ; 99 : 792 – 799 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Broxmeyer HE , Cooper S, Kohli L, et al. . Transgenic expression of stromal cell‐derived factor‐1/CXC chemokine lig‐and 12 enhances myeloid progenitor cell survival/antiapoptosis in vitro in response to growth factor withdrawal and enhances myelopoiesis in vivo . J Immunol 2003 ; 170 : 421 – 429 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Jo DY , Rafii S, Hamada T, et al. . Chemotaxis of primitive hematopoietic cells in response to stromal cell‐derived factor‐1 . J Clin Invest 2000 ; 105 : 101 – 111 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Durig J , Rosenthal C, Elmaagacli A, et al. . Biological effects of stroma‐derived factor‐1 alpha on normal and CML CD34+ haemopoietic cells . Leukemia 2000 ; 14 : 1652 – 1660 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Mohle R , Bautz F, Rafii S, et al. . The chemokine receptor CXCR‐4 is expressed on CD34+ hematopoietic progenitors and leukemic cells and mediates transendothelial migration induced by stromal cell‐derived factor‐1 . Blood 1998 ; 91 : 4523 – 4530 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Peled A , Petit I, Kollet O, et al. . Dependence of human stem cell engraftment and repopulation of NOD/SCID mice on CXCR4 . Science 1999 ; 283 : 845 – 848 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Plett PA , Frankovitz SM, Wolber FM, et al. . Treatment of circulating CD34(+) cells with SDF‐1alpha or anti‐CXCR4 antibody enhances migration and NOD/SCID repopulating potential . Exp Hematol 2002 ; 30 : 1061 – 1069 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Petit I , Szyper‐Kravitz M, Nagler A, et al. . G‐CSF induces stem cell mobilization by decreasing bone marrow SDF‐1 and up‐regulating CXCR4 . Nat Immunol 2002 ; 3 : 687 – 694 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Levesque JP , Hendy J, Takamatsu Y, et al. . Disruption of the CXCR4/CXCL12 chemotactic interaction during hematopoietic stem cell mobilization induced by GCSF or cyclophosphamide . J Clin Invest 2003 ; 111 : 187 – 196 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Christopherson KW 2nd, Hangoc G, Broxmeyer HE. Cell surface peptidase CD26/dipeptidylpeptidase IV regulates CXCL12/stromal cell‐derived factor‐1 alpha‐mediated chemotaxis of human cord blood CD34+ progenitor cells . J Immunol 2002 ; 169 : 7000 – 7008 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Tarasova NI , Stauber RH, Michejda CJ. Spontaneous and ligand‐induced trafficking of CXC‐chemokine receptor 4 . J Biol Chem 1998 ; 273 : 15883 – 15886 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Forster R , Kremmer E, Schubel A, et al. . Intracellular and surface expression of the HIV‐1 coreceptor CXCR‐4/Fusin on various leukocyte subsets: rapid internalization and recycling upon activation . J Immunol 1998 ; 160 : 1522 – 1531 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 22 Zaitseva M , Blauvelt A, Lee S, et al. . Expression and function of CCR5 and CXCR4 on human Langerhans cells and macrophages: implications for HIV primary infection . Nat Med 1997 ; 3 : 1369 – 1375 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Signoret N , Oldridge J, Pelchen‐Matthews A, et al. . Phorbol esters and SDF‐1 induce rapid endocytosis and down modulation of the chemokine receptor CXCR4 . J Cell Biol 1997 ; 139 : 651 – 664 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Dugray A , Geay JF, Foudi A, et al. . Rapid generation of a tetracycline‐inducible BCR‐ABL defective retrovirus using a single auto regulatory retroviral cassette . Leukemia 2001 ; 15 : 1658 – 1662 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Rivière C , Subra F, Cohen‐Solal K, et al. . Phenotypic and functional evidence for the expression of CXCR‐4 receptor during megakaryocytopoïesis . Blood 1999 ; 93 : 1511 – 1523 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Lok CN , Loh TT. Regulation of transferrin function and expression: review and update . Biol Signals Recept 1998 ; 7 : 157 – 178 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Lemmon SK , Traub LM, Lok CN, et al. . Sorting in the endosomal system in yeast and animal cells . Curr Opin Cell Biol 2000 ; 12 : 457 – 466 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Zhu SJ , Hatcher LI, Brown JC 3rd, et al. . Effects of hypertonic sucrose and potassium depletion on the binding properties of beta and alpha 1 adrenergic receptors measured on intact cells . Recept Signal Transduct 1996 ; 6 : 131 – 140 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 29 Kollet O , Petit I, Kahn J, et al. . Human CD34+CXCR4− sorted cells harbor intracellular CXCR4, which can be functionally expressed and provide NOD/SCID repopulation . Blood 2002 ; 100 : 2778 – 2786 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Tarasova NI , Stauber RH, Choi JK, et al. . Visualization of G protein‐coupled receptor trafficking with the aid of the green fluorescent protein: endocytosis and recycling of cholecystokinin receptor type A . J Biol Chem 1997 ; 272 : 14817 – 14824 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Connolly CN , Uren JM, Thomas P, et al. . Subcellular localization and endocytosis of homomeric gamma2 subunit splice variants of gamma‐aminobutyric acid type A receptors . Mol Cell Neurosci 1999 ; 13 : 259 – 271 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Aiuti A , Turchetto L, Cota M, et al. . Human CD34+ cells express CXCR4 and its ligand stromal cell‐derived factor‐1: implications for infection by T‐cell tropic human immunodeficiency virus . Blood 1999 ; 94 : 62 – 73 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Lataillade JJ , Clay D, Bourin P, et al. . Stromal cell‐derived factor 1 regulates primitive hematopoiesis by suppressing apoptosis and by promoting G(0)/G(1) transition in CD34+ cells: evidence for an autocrine/paracrine mechanism . Blood 2002 ; 99 : 1117 – 1129 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Haribabu B , Richardson RM, Fisher I, et al. . Regulation of human chemokine receptors CXCR4: role of phosphorylation in desensitization and internalization . J Biol Chem 1997 ; 272 : 28726 – 28731 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Signoret N , Rosenkilde MM, Klasse PJ, et al. . Differential regulation of CXCR4 and CCR5 endocytosis . J Cell Sci 1998 ; 111 : 2819 – 2830 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Wang J , Guan E, Roderiquez G, et al. . Role of tyrosine phosphorylation in ligand‐independent sequestration of CXCR4 in human primary monocytes‐macrophages . J Biol Chem 2001 ; 276 : 49236 – 49243 . Google Scholar Crossref Search ADS PubMed WorldCat Copyright © 2004 AlphaMed Press This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)
TI - Intracellular Localization and Constitutive Endocytosis of CXCR4 in Human CD34+ Hematopoietic Progenitor Cells
JF - Stem Cells
DO - 10.1634/stemcells.22-6-1015
DA - 2004-11-01
UR - https://www.deepdyve.com/lp/oxford-university-press/intracellular-localization-and-constitutive-endocytosis-of-cxcr4-in-0GxFeiAdDI
SP - 1015
EP - 1029
VL - 22
IS - 6
DP - DeepDyve
ER -