Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

The use of cytochrome b and ryanodine polymorphism to identify DNA of animal and human origin

The use of cytochrome b and ryanodine polymorphism to identify DNA of animal and human origin Vol. 66, No 4/2019 415–418 https://doi.org/10.18388/abp.2019_2818 Regular paper The use of cytochrome b and ryanodine polymorphism to identify DNA of animal and human origin Małgorzata Natonek-Wiśniewska and Anna Radko The National Research Institute of Animal Production, Laboratory of Molecular Genetics, Balice near Kraków, Poland The aim of this study was to determine a match between when analyzing material whichis deficient in nuclear DNA recovered from evidence material, such as knocked DNA due to its nature. This analysis uses various frag- down red deer, and from comparative material in form of ments of the mitochondrial genome as necessary. The two brown traces on the bonnet of a car driven by a per- cytochrome b coding gene is most often used to identify son suspected of knocking down the animal. The spots conservative fragments of several species (Galimberti et coming from the car provided no DNA profile, which al., 2013; D’Amato et al., 2013). The nucleotide sequence questioned that they originated from a red deer and ruled of this gene shows high homology in the group of mam- out performance of a comparative DNA analysis. For this mals, and at the same time it is species specific. These reason, the material obtained from the blood smear was properties enable the conservative fragment to be ampli- analyzed for species identification. The method applied fied using one pair of primers, and later to distinguish can discriminate between cattle, red deer and roe deer them by using sequencing or restriction enzymes. based on restriction analysis (Tsp509I) of PCR product Microsatellite sequences (short tandem repeats, STR) (195 bp), obtained by amplifying a fragment of the cy- have found wide application for individual identification; tochrome b coding gene. Because the obtained restriction when automatically analyzed in DNA sequencers, they are profile confirmed the match with red deer DNA for one currently the most effective and fastest methods for indi- trace, and in the second case ruled out that the biologi- vidual identification of both, farmed and wild animals (So - cal traces originated from the species mentioned above, cratous et al., 2009; Radko et al., 2014; Szabolcsi et al., 2014). the PCR products were subjected to sequencing. In both The study presented here dealt with individual and cases, 195 bp PCR products that were 98% homologous species identification of biological traces in the form of with red deer DNA sequence-NC_007704.2-trace1 and brown spots, which were the subject of judicial exami- with the gene coding for the human ryanodine receptor- nation to determine whether the evidence material taken NC_008799.2-trace2. The quantity and quality of DNA ob- from the knocked down red deer matches the traces se- tained from the traces collected from the car bonnet did cured on the car of a person suspected of participating not allow confirmation of the involvement of a specific in a vehicle crash. animal in the event, but the applied method made it pos- sible to determine the species from which the obtained MATERIALS AND METHODS traces originated. Furthermore, the applied method, which was used earlier to determine cervine DNA, was The study material consisted of muscle tissue collected successfully used to detect human DNA. from a knocked down red deer (Cervus elaphus), as well as comparative traces in the form of brown spots col- Key words: individual identification, STR, species identification, real- lected from a vehicle driven by a person suspected of time PCR, sequencing knocking down the animal. DNA from the tissue and Received: 29 May, 2019; revised: 16 September, 2019; accepted: from the spots was isolated using the Sherlock AX kit 25 September, 2019; available on-line: 08 November, 2019 (A&A Biotechnology) according to the manufacturer’s protocol. The concentration and quality of the obtained e-mail: malgorzata.natonek@izoo.krakow.pl DNA were determined using a Nanodrop (NanoDrop Abbreviations: PCR, polymerase chain reaction; mtDNA, mitochon- drial DNA; RFLP, restriction fragments length polymorphism; STR, 2000, Thermo Scientific, USA). All of the analyses were short tandem repeats performed under sterile conditions (laminar flow cabinet, disposable gloves, disposable laboratory equipment, solu- tion for DNA decontamination of laboratory surfaces). INTRODUCTION Individual identification . The individual identi- fication tests were conducted with 12 STR markers: The study presented here dealt with individual and BM1818, OarAE129, OarFCB5, OarFCB304, RM188, species identification of biological traces in the form of RT1, RT13, T26, T156, T193, T501, TGLA53. Multiplex brown spots, which were the subject of examination ini- PCR was carried out in a 12μl reaction mixture using tiated by law enforcement authorities. Analysis of mito- Master Mix reagents (Qiagen) and primer sequences la- chondrial DNA (mtDNA) and DNA profiling at micros - beled with 6-Fam, VIC, NED and PET fluorescent dyes. atellite loci are routinely used in criminological studies of The primer sequences were synthesized by BIONOVO. species identification (Galimberti et al., 2013; D’Amato et The obtained PCR products were electrophoresed in a al., 2013) and individual identification. Traces in the form 3130xl sequencer on a 7% denaturing polyacrylamide gel of blood spots are the most common biological traces (POP-7) in the presence of a GeneScan 500-LIZ length found at the scene of an incident. mtDNA analysis can standard. The results of electrophoretic separation were be performed using highly degraded traces (Jaiprakash, analyzed by GeneMapper Software 4.0. 2016). This analysis is very helpful and most often used 416 M. Natonek-Wiśniewska and A. Radko 2019 Individual identification . The analysis of STR mark- Table 1. DNA isolation parameters ers determined the complete DNA profile at 12 micros - atellite loci (Table 2) for the evidence material. However, DNA sample c [ng/μl] A260/280 no DNA profile was obtained for the comparative mate - Evidence material (knocked down red 33.9 1.73 rial. deer) Species identification. PCR-RFLP . Primers flank - Comparative material (trace 1) 18.1 1.53 ing a fragment of the cytochrome b encoding gene were used for analysis. PCR was performed using universal Comparative material (trace 2) 19.3 1.48 primers for cattle, goat, pig, sheep, red deer and roe deer DNA (Pfeiffer et al., 2004), as well as HotStarTaq DNA for the evidence material. No DNA profile was obtained Polymerase (Qiagen) at annealing temperature of 54°C for the comparative material. Because of the doubts that for 32 cycles, using standard amounts of reagents recom- the material obtained from the traces really comes from mended by Qiagen. The PCR product was fragmented the red deer, it was decided to analyze it in direction of with Tsp509I restriction enzyme detecting the AATT se- the species identification. quence, which was aimed to distinguish between DNA fragments from red deer, sheep, cattle, roe deer, and Species identification goat. Restriction patterns for different species are as fol- lows: red deer – 20/54/121, sheep – 13/77/105, cattle Primers reported by Pfeifer amplified a 195 bp frag - – 13/68/114, roe deer and goat – 182 bp) (Pfeiffer et ment for DNA isolated from brown spots. Restriction al., 2004). analysis with Tsp509I enzyme for the first trace ( Fig. 1, The obtained results were analyzed by electrophore- RFLP sample) indicated a pattern that did not match any sis in a 3% agarose gel. The lengths of separated DNA of the identifiable species (red deer, sheep, cattle, roe fragments were determined as absolute base pair (bp) deer and goat) (Pfeiffer et al., 2004) and, for the second numbers, by comparing them with a DNA marker with trace, a pattern matching red deer DNA (Fig. 1, RFLP 1 known fragment lengths (25 bp DNA). sample). To eliminate the problem, and further determin Sequencing. Both strands of PCR product were se- the origin of traces, the obtained PCR products were quenced by ABI Prism BigDye Terminator v1.1 Cy- subjected to sequencing reactions and gave products 195 cle Sequencing Kit in the presence of 5 ng PCR. The bp in size with the following sequence: sequencing products were isolated and subjected to >trace 1 capillary electrophoresis on an ABI 3130 × l sequenc- er (Applied Biosystems) using POP7 polymer (Applied Biosystems), the rapid sequencing module and a set of CGTACGCAACCTTACGATCAATCCCTAACAAATT- filters E. The separation was conducted for 30 min at AGGAGGCGTATTAGAACTCATATCTTCCTTTCT- 50°C and at 15 kV. The results were analyzed by Finch CATTCTAGCAGTTATTCCCATACTTCACA- TV software (Geospiza, Inc). CATCTAAACAACAAAGGGTAATATTCCAGC- Identification of PCR produc t. The sequence de- CATTCAGTCACTGCCTATTCTGAATCCTAGTGGCT- termined from the analyzed DNA was searched among GACTTATTCACACTCACATGAATTGGAGGCCAGA sequences deposited in GenBank using the BLAST al- gorithm (Altschul et al., 1997). The product obtained was subjected to in-silico restriction analysis using the NEBcutter software (http://tools.neb.com/NEBcutter2/ index.php). Verification of human DNA identification meth - od. To validate identification of human DNA with the primers used in the present study, PCR was performed using the same thermal profile and reagents kit with DNA isolated from human blood. The PCR product was subjected to sequencing. RESULTS DNA isolation from the evidence material (knocked down red deer) and the comparative material (biological traces secured from the vehicle of the person suspected of the incident) resulted in DNA with parameters pre- sented in Table 1. Figure 1. Results of PCR reaction and its restriction analysis. PCR-products of PCR reaction of trace 1, RFLP – its restriction anal- ysis with Tsp509I; PTC – positive control for PCR for bovine DNA; Individual identification NTC – negative control for PCR; RFLP PTC – RFLP for PTC; PCR1 – Analysis of STR markers enabled complete DNA pro- products of PCR reaction of trace 2; RFLP1 – its restriction analysis with Tsp509I. M – size marker 25 bp (Promega) files to be determined in 12 microsatellite loci ( Table 2) Table 2. DNA genotype obtained for the evidence material loci BM1818 OarAE129 OarFCB5 OarFCB304 RM188 RT1 evidence material 239/245 154/ 85/101 139/143 127/ 265/271 loci T26 T156 T193 T501 RT13 TGLA53 evidence material 352/360 163/169 194/ 248/260 296/ 157/163 Vol. 66 Identification of human and animal DNA 417 Figure 2. Result of sequencing of PCR product for trace 1 >trace 2 DISCUSSION The use of mtDNA in criminological analyses has TGCGTACGCAATCTTACGATCAATTCCTAACAAAC- been practiced since the 1990s (Davis, 1998). The cur- TAGGAGGAGTACTAGCCCTAATCTCATCAATC- rent study successfully identified species affiliation of bi - CTAATCTTGATCCTTATACCCCTCCTCCACA- ological traces in the form of brown spots. The issues CATCTAAACAACGCAGTATAATGTTCCGGCCATT- presented in this study are highly important because TAGTCAATGCTTATTCTGAATCCTAGTAGCTGACCT- blood spots or gastric content are the most frequent ev- ATTAACACTCACATGAATTGGAGGCCAG idence or comparative material in addition to feathers, Comparison with the sequences deposited in Gen- hairs, bones, and stomach contents (Parson et al., 2000; Bank revealed 98% homology between the analyzed se- Zehner et al., 1998). quence (trace 1) and the human ryanodine receptor gene Methods that use restriction enzymes are convenient (NC_008799.2), and the same homology with a red deer because they allow testing for several species potentially mtDNA fragment – NC_007704.2 (trace 2). The se- present in the analyzed sample. What is more, compared quencing result for trace 1 subjected to in-silico RFLP to multiplex reactions, the use of restriction enzymes re- analysis was found for TSP509I, where the restriction duces the costs of analysis. On the other hand, Sanger pattern 30/151/14 is consistent with that in Fig. 1 sequencing can determine samples where other methods (Fig. 1, RFLP sample) and Fig. 2. The analytical cycle is fail. This procedure determines DNA sequence present shown in Fig. 3. in the analyzed sample. The primers used can identify not only bovine, caprine, roe deer and red deer DNA, Verification of human DNA identification method as shown by Pfeiffer, but also human DNA. This is a novel observation for the primers used, that is they al- The method applied resulted in a 195 bp amplifica - low the extension of the identification method also to tion product obtained for human DNA. The sequencing human DNA. In animals, they anneal to mtDNA frag- reaction confirmed 100% consistency with the sequence ment in the cytochrome b section, and for human DNA that had been obtained from the analyzed trace 1. Figure 3. The analytical cycle used in this study. 418 M. Natonek-Wiśniewska and A. Radko 2019 this fragment is compatible with the DNA segment of REFERENCES chromosome 1. The available literature confirms suit - D’Amato M, Alechine E, Cloete K, Davison S, Corach D (2013) ability of cytochrome b to discriminate between cattle, Where is the game? Wild meat products authentication in South Af- sheep, goats, and buffaloes (Lanzilao et al., 2005). In ad- rica: a case study. Investig Genet 4: 6. https://doi.org/10.1186/2041- dition, it is often typed in barcoding to select sequences 2223-4-6 for species differentiation (Jaiprakash et al., 2016). Typing Davis C (1998) Mitochondrial DNA: State of Tennessee v. Paul Ware “Profiles in DNA”. GenePrint 103: 6–7. https://doi. such a fragment by sequencing and aligning the obtained org/10.1186/1471-2156-5-30 sequence to that in GenBank database allows for a rapid, Galimberti A, De Mattia F, Losa A, Bruni I, Federici S, Casiraghi M reliable, easy to automate and profitable identification (2013) DNA barcoding as a new tool for food traceability. Food Res of species. It should be highlighted that the method in Int 50: 55–63. https://doi.org/10.1016/j.foodres.2012.09.036 Iyengar A (2014) Forensic DNA analysis for animal protection and which DNA is amplified with universal primers, and biodiversity conservation: a review. J Nat Conserv 22: 195–205. htt- then individual species are distinguished by sequencing, ps://doi.org/10.1016/j.jnc.2013.12.001 is often applied in species identification tests. This type Jaiprakash G, Shewale R, Liu H (2016) Forensic DNA Analysis: Current of tests is conducted not only in mammals, but also in Practices and Emerging Technologies; 1–141 Lanzilao I, Burgalassi F, Fancelli S, Settimelli M, Fani R (2005) Poly- fish (Sultana et al., 2018). The application of the meth- merase chain reaction-restriction fragment length polymorphism od described in this publication was the optimal choice analysis of mitochondrial cytb gene from species of dairy interest. because it allowed to identify the DNA of species that J AOAC Int 88: 128–135. PMID: 15759735 were of interest in the study of the described microtrac- Parson W, Pegoraro K, Niederstätter H, Föger M, Steinlechner M (2000) Species identification by means of the cytochrome b gene. es. Its advantage was in 100% selection of the marked Int J Legal Med 114: 23–28. https://doi.org/10.1007/s004140000134 species for the problem – we were interested in cervids Pfeiffer I, Burger J, Brenig B (2004) Diagnostic polymorphisms in the and their analysis was enabled by the proposed method. mitochondrial cytochrome b gene allow discrimination between cat- The extension of the panel of identified species to hu - tle, sheep, goat, roe buck and deer by PCR-RFLP. BMC Genet 5: 30–35. https://doi.org/10.1186/1471-2156-5-30 man DNA is very useful in the analysis of biological Radko A, Zalewski D, Rubiś D, Szumiec A (2014) Genetic differenti- traces because human microtraces very often accompany ation among 6 populations of red deer ( Cervus elaphus L.) in Poland animal traces resulting from road accidents. based on microsatellite DNA polymorphism. Acta Biol Hung 65: Forensic traces are often largely degraded, as a re- 414–427. https://doi.org/10.1556/ABiol.65.2014.4.6 Socratous E, Graham E, Rutty G (2009) Forensic DNA profiling of sult of which their DNA is strongly fragmented, mak- Cervus elaphus species in the United Kingdom. Forensic Sci Int Genet ing amplification difficult. In such cases, amplification of Suppl 2: 281–282. https://doi.org/10.1016/j.fsigss.2009.08.127 short fragments is the only alternative. Universal primers Sultana S, Ali M, Hossain M, Naquiah N, Zaidul I (2018) Universal should be used which minimize PCR deviations caused mini COI barcode for the identification of fish species in pro - cessed products. Food Res Int 105: 19–28. https://doi.org/10.1016/j. by variable mismatching of the matrix to different spe- foodres.2017.10.065 cies, so as to ensure that all of the components are de- Szabolcsi Z, Egyed B, Zenke P, Padar Z, Borsy A, Steger V, Pasztor tected. E, Csanyi S, Buzas Z, Orosz L (2014) Constructing STR Multiplex- In the described case, the obtained DNA was of in- es for Individual Identification of Hungarian Red Deer. J Forensic Sci 59: 1090–1099. https://doi.org/10.1111/1556-4029.12403 adequate quality to determine the DNA profile, but it Zehner R, Zimmermann S, Mebs D (1998) RFLP and sequence analy- proved suitable for sequencing, which allowed us to con- sis of the cytochrome b gene of selected animals and man: meth- firm that one of the spots found on the bonnet comes odology and forensic application. Int J Legal Med 111: 323–327. htt- from red deer. The procedure in respect of the second, ps://doi.org/10.1007/s004140050180 human trace, was left for the Court do decide. Declaration of interest statement The authors declares that they have no relevant interest(s) to disclose. http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Acta Biochimica Polonica Unpaywall

The use of cytochrome b and ryanodine polymorphism to identify DNA of animal and human origin

Natonek-Wiśniewska, Małgorzata; Radko, Anna
Acta Biochimica Polonica – Nov 8, 2019
Download PDF
4 pages

Loading next page...
 
/lp/unpaywall/the-use-of-cytochrome-b-and-ryanodine-polymorphism-to-identify-dna-of-sHoQjGXQMB

References

References for this paper are not available at this time. We will be adding them shortly, thank you for your patience.

Publisher
Unpaywall
ISSN
0001-527X
DOI
10.18388/abp.2019_2818
Publisher site
See Article on Publisher Site

Abstract

Vol. 66, No 4/2019 415–418 https://doi.org/10.18388/abp.2019_2818 Regular paper The use of cytochrome b and ryanodine polymorphism to identify DNA of animal and human origin Małgorzata Natonek-Wiśniewska and Anna Radko The National Research Institute of Animal Production, Laboratory of Molecular Genetics, Balice near Kraków, Poland The aim of this study was to determine a match between when analyzing material whichis deficient in nuclear DNA recovered from evidence material, such as knocked DNA due to its nature. This analysis uses various frag- down red deer, and from comparative material in form of ments of the mitochondrial genome as necessary. The two brown traces on the bonnet of a car driven by a per- cytochrome b coding gene is most often used to identify son suspected of knocking down the animal. The spots conservative fragments of several species (Galimberti et coming from the car provided no DNA profile, which al., 2013; D’Amato et al., 2013). The nucleotide sequence questioned that they originated from a red deer and ruled of this gene shows high homology in the group of mam- out performance of a comparative DNA analysis. For this mals, and at the same time it is species specific. These reason, the material obtained from the blood smear was properties enable the conservative fragment to be ampli- analyzed for species identification. The method applied fied using one pair of primers, and later to distinguish can discriminate between cattle, red deer and roe deer them by using sequencing or restriction enzymes. based on restriction analysis (Tsp509I) of PCR product Microsatellite sequences (short tandem repeats, STR) (195 bp), obtained by amplifying a fragment of the cy- have found wide application for individual identification; tochrome b coding gene. Because the obtained restriction when automatically analyzed in DNA sequencers, they are profile confirmed the match with red deer DNA for one currently the most effective and fastest methods for indi- trace, and in the second case ruled out that the biologi- vidual identification of both, farmed and wild animals (So - cal traces originated from the species mentioned above, cratous et al., 2009; Radko et al., 2014; Szabolcsi et al., 2014). the PCR products were subjected to sequencing. In both The study presented here dealt with individual and cases, 195 bp PCR products that were 98% homologous species identification of biological traces in the form of with red deer DNA sequence-NC_007704.2-trace1 and brown spots, which were the subject of judicial exami- with the gene coding for the human ryanodine receptor- nation to determine whether the evidence material taken NC_008799.2-trace2. The quantity and quality of DNA ob- from the knocked down red deer matches the traces se- tained from the traces collected from the car bonnet did cured on the car of a person suspected of participating not allow confirmation of the involvement of a specific in a vehicle crash. animal in the event, but the applied method made it pos- sible to determine the species from which the obtained MATERIALS AND METHODS traces originated. Furthermore, the applied method, which was used earlier to determine cervine DNA, was The study material consisted of muscle tissue collected successfully used to detect human DNA. from a knocked down red deer (Cervus elaphus), as well as comparative traces in the form of brown spots col- Key words: individual identification, STR, species identification, real- lected from a vehicle driven by a person suspected of time PCR, sequencing knocking down the animal. DNA from the tissue and Received: 29 May, 2019; revised: 16 September, 2019; accepted: from the spots was isolated using the Sherlock AX kit 25 September, 2019; available on-line: 08 November, 2019 (A&A Biotechnology) according to the manufacturer’s protocol. The concentration and quality of the obtained e-mail: malgorzata.natonek@izoo.krakow.pl DNA were determined using a Nanodrop (NanoDrop Abbreviations: PCR, polymerase chain reaction; mtDNA, mitochon- drial DNA; RFLP, restriction fragments length polymorphism; STR, 2000, Thermo Scientific, USA). All of the analyses were short tandem repeats performed under sterile conditions (laminar flow cabinet, disposable gloves, disposable laboratory equipment, solu- tion for DNA decontamination of laboratory surfaces). INTRODUCTION Individual identification . The individual identi- fication tests were conducted with 12 STR markers: The study presented here dealt with individual and BM1818, OarAE129, OarFCB5, OarFCB304, RM188, species identification of biological traces in the form of RT1, RT13, T26, T156, T193, T501, TGLA53. Multiplex brown spots, which were the subject of examination ini- PCR was carried out in a 12μl reaction mixture using tiated by law enforcement authorities. Analysis of mito- Master Mix reagents (Qiagen) and primer sequences la- chondrial DNA (mtDNA) and DNA profiling at micros - beled with 6-Fam, VIC, NED and PET fluorescent dyes. atellite loci are routinely used in criminological studies of The primer sequences were synthesized by BIONOVO. species identification (Galimberti et al., 2013; D’Amato et The obtained PCR products were electrophoresed in a al., 2013) and individual identification. Traces in the form 3130xl sequencer on a 7% denaturing polyacrylamide gel of blood spots are the most common biological traces (POP-7) in the presence of a GeneScan 500-LIZ length found at the scene of an incident. mtDNA analysis can standard. The results of electrophoretic separation were be performed using highly degraded traces (Jaiprakash, analyzed by GeneMapper Software 4.0. 2016). This analysis is very helpful and most often used 416 M. Natonek-Wiśniewska and A. Radko 2019 Individual identification . The analysis of STR mark- Table 1. DNA isolation parameters ers determined the complete DNA profile at 12 micros - atellite loci (Table 2) for the evidence material. However, DNA sample c [ng/μl] A260/280 no DNA profile was obtained for the comparative mate - Evidence material (knocked down red 33.9 1.73 rial. deer) Species identification. PCR-RFLP . Primers flank - Comparative material (trace 1) 18.1 1.53 ing a fragment of the cytochrome b encoding gene were used for analysis. PCR was performed using universal Comparative material (trace 2) 19.3 1.48 primers for cattle, goat, pig, sheep, red deer and roe deer DNA (Pfeiffer et al., 2004), as well as HotStarTaq DNA for the evidence material. No DNA profile was obtained Polymerase (Qiagen) at annealing temperature of 54°C for the comparative material. Because of the doubts that for 32 cycles, using standard amounts of reagents recom- the material obtained from the traces really comes from mended by Qiagen. The PCR product was fragmented the red deer, it was decided to analyze it in direction of with Tsp509I restriction enzyme detecting the AATT se- the species identification. quence, which was aimed to distinguish between DNA fragments from red deer, sheep, cattle, roe deer, and Species identification goat. Restriction patterns for different species are as fol- lows: red deer – 20/54/121, sheep – 13/77/105, cattle Primers reported by Pfeifer amplified a 195 bp frag - – 13/68/114, roe deer and goat – 182 bp) (Pfeiffer et ment for DNA isolated from brown spots. Restriction al., 2004). analysis with Tsp509I enzyme for the first trace ( Fig. 1, The obtained results were analyzed by electrophore- RFLP sample) indicated a pattern that did not match any sis in a 3% agarose gel. The lengths of separated DNA of the identifiable species (red deer, sheep, cattle, roe fragments were determined as absolute base pair (bp) deer and goat) (Pfeiffer et al., 2004) and, for the second numbers, by comparing them with a DNA marker with trace, a pattern matching red deer DNA (Fig. 1, RFLP 1 known fragment lengths (25 bp DNA). sample). To eliminate the problem, and further determin Sequencing. Both strands of PCR product were se- the origin of traces, the obtained PCR products were quenced by ABI Prism BigDye Terminator v1.1 Cy- subjected to sequencing reactions and gave products 195 cle Sequencing Kit in the presence of 5 ng PCR. The bp in size with the following sequence: sequencing products were isolated and subjected to >trace 1 capillary electrophoresis on an ABI 3130 × l sequenc- er (Applied Biosystems) using POP7 polymer (Applied Biosystems), the rapid sequencing module and a set of CGTACGCAACCTTACGATCAATCCCTAACAAATT- filters E. The separation was conducted for 30 min at AGGAGGCGTATTAGAACTCATATCTTCCTTTCT- 50°C and at 15 kV. The results were analyzed by Finch CATTCTAGCAGTTATTCCCATACTTCACA- TV software (Geospiza, Inc). CATCTAAACAACAAAGGGTAATATTCCAGC- Identification of PCR produc t. The sequence de- CATTCAGTCACTGCCTATTCTGAATCCTAGTGGCT- termined from the analyzed DNA was searched among GACTTATTCACACTCACATGAATTGGAGGCCAGA sequences deposited in GenBank using the BLAST al- gorithm (Altschul et al., 1997). The product obtained was subjected to in-silico restriction analysis using the NEBcutter software (http://tools.neb.com/NEBcutter2/ index.php). Verification of human DNA identification meth - od. To validate identification of human DNA with the primers used in the present study, PCR was performed using the same thermal profile and reagents kit with DNA isolated from human blood. The PCR product was subjected to sequencing. RESULTS DNA isolation from the evidence material (knocked down red deer) and the comparative material (biological traces secured from the vehicle of the person suspected of the incident) resulted in DNA with parameters pre- sented in Table 1. Figure 1. Results of PCR reaction and its restriction analysis. PCR-products of PCR reaction of trace 1, RFLP – its restriction anal- ysis with Tsp509I; PTC – positive control for PCR for bovine DNA; Individual identification NTC – negative control for PCR; RFLP PTC – RFLP for PTC; PCR1 – Analysis of STR markers enabled complete DNA pro- products of PCR reaction of trace 2; RFLP1 – its restriction analysis with Tsp509I. M – size marker 25 bp (Promega) files to be determined in 12 microsatellite loci ( Table 2) Table 2. DNA genotype obtained for the evidence material loci BM1818 OarAE129 OarFCB5 OarFCB304 RM188 RT1 evidence material 239/245 154/ 85/101 139/143 127/ 265/271 loci T26 T156 T193 T501 RT13 TGLA53 evidence material 352/360 163/169 194/ 248/260 296/ 157/163 Vol. 66 Identification of human and animal DNA 417 Figure 2. Result of sequencing of PCR product for trace 1 >trace 2 DISCUSSION The use of mtDNA in criminological analyses has TGCGTACGCAATCTTACGATCAATTCCTAACAAAC- been practiced since the 1990s (Davis, 1998). The cur- TAGGAGGAGTACTAGCCCTAATCTCATCAATC- rent study successfully identified species affiliation of bi - CTAATCTTGATCCTTATACCCCTCCTCCACA- ological traces in the form of brown spots. The issues CATCTAAACAACGCAGTATAATGTTCCGGCCATT- presented in this study are highly important because TAGTCAATGCTTATTCTGAATCCTAGTAGCTGACCT- blood spots or gastric content are the most frequent ev- ATTAACACTCACATGAATTGGAGGCCAG idence or comparative material in addition to feathers, Comparison with the sequences deposited in Gen- hairs, bones, and stomach contents (Parson et al., 2000; Bank revealed 98% homology between the analyzed se- Zehner et al., 1998). quence (trace 1) and the human ryanodine receptor gene Methods that use restriction enzymes are convenient (NC_008799.2), and the same homology with a red deer because they allow testing for several species potentially mtDNA fragment – NC_007704.2 (trace 2). The se- present in the analyzed sample. What is more, compared quencing result for trace 1 subjected to in-silico RFLP to multiplex reactions, the use of restriction enzymes re- analysis was found for TSP509I, where the restriction duces the costs of analysis. On the other hand, Sanger pattern 30/151/14 is consistent with that in Fig. 1 sequencing can determine samples where other methods (Fig. 1, RFLP sample) and Fig. 2. The analytical cycle is fail. This procedure determines DNA sequence present shown in Fig. 3. in the analyzed sample. The primers used can identify not only bovine, caprine, roe deer and red deer DNA, Verification of human DNA identification method as shown by Pfeiffer, but also human DNA. This is a novel observation for the primers used, that is they al- The method applied resulted in a 195 bp amplifica - low the extension of the identification method also to tion product obtained for human DNA. The sequencing human DNA. In animals, they anneal to mtDNA frag- reaction confirmed 100% consistency with the sequence ment in the cytochrome b section, and for human DNA that had been obtained from the analyzed trace 1. Figure 3. The analytical cycle used in this study. 418 M. Natonek-Wiśniewska and A. Radko 2019 this fragment is compatible with the DNA segment of REFERENCES chromosome 1. The available literature confirms suit - D’Amato M, Alechine E, Cloete K, Davison S, Corach D (2013) ability of cytochrome b to discriminate between cattle, Where is the game? Wild meat products authentication in South Af- sheep, goats, and buffaloes (Lanzilao et al., 2005). In ad- rica: a case study. Investig Genet 4: 6. https://doi.org/10.1186/2041- dition, it is often typed in barcoding to select sequences 2223-4-6 for species differentiation (Jaiprakash et al., 2016). Typing Davis C (1998) Mitochondrial DNA: State of Tennessee v. Paul Ware “Profiles in DNA”. GenePrint 103: 6–7. https://doi. such a fragment by sequencing and aligning the obtained org/10.1186/1471-2156-5-30 sequence to that in GenBank database allows for a rapid, Galimberti A, De Mattia F, Losa A, Bruni I, Federici S, Casiraghi M reliable, easy to automate and profitable identification (2013) DNA barcoding as a new tool for food traceability. Food Res of species. It should be highlighted that the method in Int 50: 55–63. https://doi.org/10.1016/j.foodres.2012.09.036 Iyengar A (2014) Forensic DNA analysis for animal protection and which DNA is amplified with universal primers, and biodiversity conservation: a review. J Nat Conserv 22: 195–205. htt- then individual species are distinguished by sequencing, ps://doi.org/10.1016/j.jnc.2013.12.001 is often applied in species identification tests. This type Jaiprakash G, Shewale R, Liu H (2016) Forensic DNA Analysis: Current of tests is conducted not only in mammals, but also in Practices and Emerging Technologies; 1–141 Lanzilao I, Burgalassi F, Fancelli S, Settimelli M, Fani R (2005) Poly- fish (Sultana et al., 2018). The application of the meth- merase chain reaction-restriction fragment length polymorphism od described in this publication was the optimal choice analysis of mitochondrial cytb gene from species of dairy interest. because it allowed to identify the DNA of species that J AOAC Int 88: 128–135. PMID: 15759735 were of interest in the study of the described microtrac- Parson W, Pegoraro K, Niederstätter H, Föger M, Steinlechner M (2000) Species identification by means of the cytochrome b gene. es. Its advantage was in 100% selection of the marked Int J Legal Med 114: 23–28. https://doi.org/10.1007/s004140000134 species for the problem – we were interested in cervids Pfeiffer I, Burger J, Brenig B (2004) Diagnostic polymorphisms in the and their analysis was enabled by the proposed method. mitochondrial cytochrome b gene allow discrimination between cat- The extension of the panel of identified species to hu - tle, sheep, goat, roe buck and deer by PCR-RFLP. BMC Genet 5: 30–35. https://doi.org/10.1186/1471-2156-5-30 man DNA is very useful in the analysis of biological Radko A, Zalewski D, Rubiś D, Szumiec A (2014) Genetic differenti- traces because human microtraces very often accompany ation among 6 populations of red deer ( Cervus elaphus L.) in Poland animal traces resulting from road accidents. based on microsatellite DNA polymorphism. Acta Biol Hung 65: Forensic traces are often largely degraded, as a re- 414–427. https://doi.org/10.1556/ABiol.65.2014.4.6 Socratous E, Graham E, Rutty G (2009) Forensic DNA profiling of sult of which their DNA is strongly fragmented, mak- Cervus elaphus species in the United Kingdom. Forensic Sci Int Genet ing amplification difficult. In such cases, amplification of Suppl 2: 281–282. https://doi.org/10.1016/j.fsigss.2009.08.127 short fragments is the only alternative. Universal primers Sultana S, Ali M, Hossain M, Naquiah N, Zaidul I (2018) Universal should be used which minimize PCR deviations caused mini COI barcode for the identification of fish species in pro - cessed products. Food Res Int 105: 19–28. https://doi.org/10.1016/j. by variable mismatching of the matrix to different spe- foodres.2017.10.065 cies, so as to ensure that all of the components are de- Szabolcsi Z, Egyed B, Zenke P, Padar Z, Borsy A, Steger V, Pasztor tected. E, Csanyi S, Buzas Z, Orosz L (2014) Constructing STR Multiplex- In the described case, the obtained DNA was of in- es for Individual Identification of Hungarian Red Deer. J Forensic Sci 59: 1090–1099. https://doi.org/10.1111/1556-4029.12403 adequate quality to determine the DNA profile, but it Zehner R, Zimmermann S, Mebs D (1998) RFLP and sequence analy- proved suitable for sequencing, which allowed us to con- sis of the cytochrome b gene of selected animals and man: meth- firm that one of the spots found on the bonnet comes odology and forensic application. Int J Legal Med 111: 323–327. htt- from red deer. The procedure in respect of the second, ps://doi.org/10.1007/s004140050180 human trace, was left for the Court do decide. Declaration of interest statement The authors declares that they have no relevant interest(s) to disclose.

Journal

Acta Biochimica Polonica – Unpaywall

Published: Nov 8, 2019

There are no references for this article.