Access the full text.
Sign up today, get DeepDyve free for 14 days.
A. Haselbeck, U. Panzner, J. Im, S. Baker, C. Meyer, F. Marks (2017)
Current perspectives on invasive nontyphoidal Salmonella diseaseCurrent Opinion in Infectious Diseases, 30
T. Sana, Nicolas Flaugnatti, Kyler Lugo, L. Lam, A. Jacobson, Virginie Baylot, E. Durand, L. Journet, E. Cascales, D. Monack (2016)
Salmonella Typhimurium utilizes a T6SS-mediated antibacterial weapon to establish in the host gutProceedings of the National Academy of Sciences, 113
Lise Petersen, Jonathan Bollback, Matthew Dimmic, Melissa Hubisz, Rasmus Nielsen (2007)
Genes under positive selection in Escherichia coli.Genome research, 17 9
Miguel Cruz, Weidong Zhao, C. Farenc, Gregory Gimenez, D. Raoult, C. Cambillau, J. Gorvel, S. Méresse (2013)
A Toxin-Antitoxin Module of Salmonella Promotes Virulence in MicePLoS Pathogens, 9
Amy Ma, J. Mekalanos (2010)
In vivo actin cross-linking induced by Vibrio cholerae type VI secretion system is associated with intestinal inflammationProceedings of the National Academy of Sciences, 107
J. Norton, M. Mulvey (2012)
Toxin-Antitoxin Systems Are Important for Niche-Specific Colonization and Stress Resistance of Uropathogenic Escherichia coliPLoS Pathogens, 8
S. Helaine, Jessica Thompson, Kathryn Watson, Mei Liu, C. Boyle, D. Holden (2010)
Dynamics of intracellular bacterial replication at the single cell levelProceedings of the National Academy of Sciences, 107
Stephanie Aoki, R. Pamma, Aaron Hernday, Jessica Bickham, B. Braaten, D. Low (2005)
Contact-Dependent Inhibition of Growth in Escherichia coliScience, 309
S. Poole, Elie Diner, Stephanie Aoki, B. Braaten, Claire Roodenbeke, D. Low, C. Hayes (2011)
Identification of Functional Toxin/Immunity Genes Linked to Contact-Dependent Growth Inhibition (CDI) and Rearrangement Hotspot (Rhs) SystemsPLoS Genetics, 7
S. Lovett, R. Hurley, V. Sutera, Rachel Aubuchon, M. Lebedeva (2002)
Crossing over between regions of limited homology in Escherichia coli. RecA-dependent and RecA-independent pathways.Genetics, 160 3
T. Ogura, S. Hiraga (1983)
Mini-F plasmid genes that couple host cell division to plasmid proliferation.Proceedings of the National Academy of Sciences of the United States of America, 80 15
K. Datsenko, B. Wanner (2000)
One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.Proceedings of the National Academy of Sciences of the United States of America, 97 12
B. Bochner (1984)
Curing bacterial cells of lysogenic viruses by using ucb indicator platesBioTechniques, 2
Michał Bukowski, R. Lyżeń, Weronika Helbin, Emilia Bonar, A. Szalewska-Pałasz, G. Węgrzyn, G. Dubin, A. Dubin, B. Władyka (2013)
A regulatory role for Staphylococcus aureus toxin–antitoxin system PemIKSaNature Communications, 4
R. Page, W. Peti (2016)
Toxin-antitoxin systems in bacterial growth arrest and persistence.Nature chemical biology, 12 4
J. Werren (2011)
Selfish genetic elements, genetic conflict, and evolutionary innovationProceedings of the National Academy of Sciences, 108
A. Takaya, Masato Suzuki, H. Matsui, T. Tomoyasu, H. Sashinami, A. Nakane, Tomoko Yamamoto (2003)
Lon, a Stress-Induced ATP-Dependent Protease, Is Critically Important for Systemic Salmonella enterica Serovar Typhimurium Infection of MiceInfection and Immunity, 71
Rachel Hood, Pragya Singh, F. Hsu, Tüzün Güvener, Mike Carl, R. Trinidad, J. Silverman, Brooks Ohlson, Kevin Hicks, R. Plemel, Mo Li, Sandra Schwarz, Wenzhuo Wang, A. Merz, D. Goodlett, J. Mougous (2010)
A type VI secretion system of Pseudomonas aeruginosa targets a toxin to bacteria.Cell host & microbe, 7 1
N. Vázquez-Laslop, Hyunwoo Lee, A. Neyfakh (2006)
Increased Persistence in Escherichia coli Caused by Controlled Expression of Toxins or Other Unrelated ProteinsJournal of Bacteriology, 188
K. Katoh, D. Standley (2013)
MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and UsabilityMolecular Biology and Evolution, 30
A. Jackson, G. Thomas, J. Parkhill, N. Thomson (2009)
Evolutionary diversification of an ancient gene family (rhs) through C-terminal displacementBMC Genomics, 10
G. Stewart, J. Patel, B. Robertson, A. Rae, D. Young (2005)
Mycobacterial Mutants with Defective Control of Phagosomal AcidificationPLoS Pathogens, 1
Stephanie Aoki, Elie Diner, B. Braaten (2016)
A widespread family of polymorphic contact-dependent toxin delivery systems in bacteria
Andrés Vazquez-Terres, J. Jones-Carson, A. Bäumler, S. Falkow, Raphael Valdivia, Raphael Valdivia, William Brown, Mysan Lo, Ruth Berggren, Ruth Berggren, W. Parks, F. Fang (1999)
Extraintestinal dissemination of Salmonella by CD18-expressing phagocytesNature, 401
Dapeng Zhang, Robson Souza, Robson Souza, Vivek Anantharaman, L. Iyer, L. Aravind (2012)
Polymorphic toxin systems: Comprehensive characterization of trafficking modes, processing, mechanisms of action, immunity and ecology using comparative genomicsBiology Direct, 7
J. Busby, S. Panjikar, M. Landsberg, M. Hurst, J., Shaun Lott (2013)
The BC component of ABC toxins is an RHS-repeat-containing protein encapsulation deviceNature, 501
Shaleen Korch, Heidi Contreras, J. Clark-Curtiss (2008)
Three Mycobacterium tuberculosis Rel Toxin-Antitoxin Modules Inhibit Mycobacterial Growth and Are Expressed in Infected Human MacrophagesJournal of Bacteriology, 191
Anirban Ghosh, Ö. Baltekin, Marcus Wäneskog, Dina Elkhalifa, Disa Hammarlöf, J. Elf, S. Koskiniemi (2018)
Contact‐dependent growth inhibition induces high levels of antibiotic‐tolerant persister cells in clonal bacterial populationsThe EMBO Journal, 37
R. Tucker, J. Beckmann, Nathaniel Leachman, J. Schöler, R. Chiquet‐Ehrismann (2011)
Phylogenetic Analysis of the Teneurins: Conserved Features and Premetazoan AncestryMolecular Biology and Evolution, 29
K. Livak, Thomas Schmittgen (2001)
Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.Methods, 25 4
Jiale Ma, Min-xuan Sun, Wenyang Dong, Z. Pan, Chengping Lu, Huochun Yao (2017)
PAAR‐Rhs proteins harbor various C‐terminal toxins to diversify the antibacterial pathways of type VI secretion systemsEnvironmental Microbiology, 19
K. Nomura, J. Kato, N. Takiguchi, H. Ohtake, A. Kuroda (2004)
Effects of Inorganic Polyphosphate on the Proteolytic and DNA-binding Activities of Lon in Escherichia coli*Journal of Biological Chemistry, 279
(1990)
Proceedings of the National Academy of Sciences of the United States of America. Annual subject and author indexes.Proceedings of the National Academy of Sciences of the United States of America, 87 Suppl
Kenn Gerdes, F. Bech, Steen Troels, Jorgensen, Anders Lobner-Olesen, Poul Rasmussen, T. Atlung, Lars Boe, Olle Karlstrom, Soren, Molin, Kaspar von, Meyenburg (1986)
Mechanism of postsegregational killing by the hok gene product of the parB system of plasmid R1 and its homology with the relF gene product of the E. coli relB operon.The EMBO Journal, 5
M. Muthuramalingam, John White, C. Bourne (2016)
Toxin-Antitoxin Modules Are Pliable Switches Activated by Multiple Protease PathwaysToxins, 8
Alistair Russell, S. Peterson, J. Mougous (2014)
Type VI secretion system effectors: poisons with a purposeNature Reviews Microbiology, 12
David Mulder, Colin Cooper, B. Coombes (2012)
Type VI Secretion System-Associated Gene Clusters Contribute to Pathogenesis of Salmonella enterica Serovar TyphimuriumInfection and Immunity, 80
S. Koskiniemi, F. Garza-Sánchez, Linus Sandegren, Julia Webb, B. Braaten, S. Poole, D. Andersson, C. Hayes, D. Low (2014)
Selection of Orphan Rhs Toxin Expression in Evolved Salmonella enterica Serovar TyphimuriumPLoS Genetics, 10
S. Helaine, Angela Cheverton, Kathryn Watson, Laura Faure, S. Matthews, D. Holden (2014)
Internalization of Salmonella by Macrophages Induces Formation of Nonreplicating PersistersScience, 343
R. Chaudhuri, E. Morgan, S. Peters, Stephen Pleasance, D. Hudson, Holly Davies, Jinhong Wang, P. Diemen, Anthony Buckley, A. Bowen, G. Pullinger, Daniel Turner, G. Langridge, A. Turner, J. Parkhill, Ian Charles, Duncan Maskell, Mark Stevens (2013)
Comprehensive Assignment of Roles for Salmonella Typhimurium Genes in Intestinal Colonization of Food-Producing AnimalsPLoS Genetics, 9
V. Kung, Sonal Khare, C. Stehlik, Elizabeth Bacon, Ami Hughes, A. Hauser (2012)
An rhs gene of Pseudomonas aeruginosa encodes a virulence protein that activates the inflammasomeProceedings of the National Academy of Sciences, 109
S. Koskiniemi, J. Lamoureux, K. Nikolakakis, Claire Roodenbeke, M. Kaplan, D. Low, C. Hayes (2013)
Rhs proteins from diverse bacteria mediate intercellular competitionProceedings of the National Academy of Sciences, 110
Carsten Kröger, A. Colgan, S. Srikumar, K. Händler, Sathesh Sivasankaran, Disa Hammarlöf, Rocío Canals, Joe Grissom, T. Conway, K. Hokamp, J. Hinton (2013)
An infection-relevant transcriptomic compendium for Salmonella enterica Serovar Typhimurium.Cell host & microbe, 14 6
A. Takaya, T. Tomoyasu, Akane Tokumitsu, M. Morioka, Tomoko Yamamoto (2002)
The ATP-Dependent Lon Protease of Salmonella enterica Serovar Typhimurium Regulates Invasion and Expression of Genes Carried on Salmonella Pathogenicity Island 1Journal of Bacteriology, 184
Myriam Wilbaux, Natacha Mine, A. Guérout, D. Mazel, L. Melderen (2007)
Functional Interactions between Coexisting Toxin-Antitoxin Systems of the ccd Family in Escherichia coli O157:H7Journal of Bacteriology, 189
J. Whitney, C. Beck, Y. Goo, Alistair Russell, Brittany Harding, J. León, David Cunningham, B. Tran, D. Low, D. Goodlett, C. Hayes, J. Mougous (2014)
Genetically distinct pathways guide effector export through the type VI secretion systemMolecular Microbiology, 92
A. Haraga, Maikke Ohlson, Samuel Miller (2008)
Salmonellae interplay with host cellsNature Reviews Microbiology, 6
S. Foster (1993)
Molecular analysis of three major wall‐associated proteins of Bacillus subtilis 168: evidence for processing of the product of a gene encoding a 258 kDa precursor two‐domain ligand‐binding proteinMolecular Microbiology, 8
R. Morse, K. Nikolakakis, Julia Willett, Elias Gerrick, D. Low, C. Hayes, C. Goulding (2012)
Structural basis of toxicity and immunity in contact-dependent growth inhibition (CDI) systemsProceedings of the National Academy of Sciences, 109
Yannick Brunet, Ahmad Khodr, Laureen Logger, L. Aussel, T. Mignot, S. Rimsky, E. Cascales (2015)
H-NS Silencing of the Salmonella Pathogenicity Island 6-Encoded Type VI Secretion System Limits Salmonella enterica Serovar Typhimurium Interbacterial KillingInfection and Immunity, 83
Juliana Diniz, Sarah Coulthurst (2015)
Intraspecies Competition in Serratia marcescens Is Mediated by Type VI-Secreted Rhs Effectors and a Conserved Effector-Associated Accessory ProteinJournal of Bacteriology, 197
A. Kuroda (2006)
A Polyphosphate-Lon Protease Complex in the Adaptation of Escherichia coli to Amino Acid StarvationBioscience, Biotechnology, and Biochemistry, 70
Petra Virtanen, Marcus Wäneskog, S. Koskiniemi (2019)
Class II contact‐dependent growth inhibition (CDI) systems allow for broad‐range cross‐species toxin delivery within the Enterobacteriaceae familyMolecular Microbiology, 111
M. Shneider, S. Buth, B. Ho, M. Basler, J. Mekalanos, P. Leiman (2013)
PAAR-repeat proteins sharpen and diversify the Type VI secretion system spikeNature, 500
_ATCC_BAA-1673/1-246 LR134153
S. Ting, D. Bosch, Sarah Mangiameli, M. Radey, Shuo Huang, Young-Jun Park, K. Kelly, Szymon Filip, Y. Goo, J. Eng, M. Allaire, D. Veesler, Paul Wiggins, S. Peterson, J. Mougous (2018)
Bifunctional Immunity Proteins Protect Bacteria against FtsZ-Targeting ADP-Ribosylating ToxinsCell, 175
Iris Keren, Devang Shah, A. Spoering, N. Kaldalu, K. Lewis (2004)
Specialized Persister Cells and the Mechanism of Multidrug Tolerance in Escherichia coliJournal of Bacteriology, 186
K. Gerdes, P. Rasmussen, S. Molin (1986)
Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells.Proceedings of the National Academy of Sciences of the United States of America, 83 10
Alexander Harms, D. Brodersen, N. Mitarai, K. Gerdes (2018)
Toxins, Targets, and Triggers: An Overview of Toxin-Antitoxin Biology.Molecular cell, 70 5
S. Linehan, D. Holden (2003)
The interplay between Salmonella typhimurium and its macrophage host--what can it teach us about innate immunity?Immunology letters, 85 2
RHS elements are components of conserved toxin-delivery systems, wide-spread within the bacterial kingdom and some of the most positively selected genes known. However, very lit- OPENACCESS tle is known about how Rhs toxins affect bacterial biology. Salmonella Typhimurium con- Citation: Stårsta M, Hammarlo ¨f DL, Wa ¨neskog M, tains a full-length rhs gene and an adjacent orphan rhs gene, which lacks the conserved Schlegel S, Xu F, Heden Gynnå A, et al. (2020) RHS-elements function as type II toxin-antitoxin delivery part of the Rhs protein. Here we show that, in addition to the conventional delivery, modules that regulate intra-macrophage replication Rhs toxin-antitoxin pairs encode for functional type-II toxin-antitoxin (TA) loci that regulate of Salmonella Typhimurium. PLoS Genet 16(2): S. Typhimurium proliferation within macrophages. Mutant S. Typhimurium cells lacking both e1008607. https://doi.org/10.1371/journal. Rhs toxins proliferate 2-times better within macrophages, mainly because of an increased pgen.1008607 growth rate. Thus, in addition to providing strong positive selection for the rhs loci under con- Editor: Sarah J. Coulthurst, University of Dundee, UNITED KINGDOM ditions when there is little or no toxin delivery, internal expression of the toxin-antitoxin sys- tem regulates growth in the stressful environment found inside macrophages. Received: August 6, 2019 Accepted: January 12, 2020 Published: February 13, 2020 Peer Review History: PLOS recognizes the Author summary benefits of transparency in the peer review Bacteria that reside and multiply inside of phagocytic cells are hard to treat with common process; therefore, we enable the publication of all of the content of peer review and author antibiotics, partly because subpopulations of bacteria are non-growing. Very little is responses alongside final, published articles. The known about how bacteria regulate their growth in the phagocytic vesicle. We show that editorial history of this article is available here: RHS elements, previously known to function as mobilizable toxins that inhibit growth of https://doi.org/10.1371/journal.pgen.1008607 neighboring bacteria, also function as internally expressed toxin-antitoxin systems that Copyright:© 2020 Stårsta et al. This is an open regulate Salmonella Typhimurium growth in macrophages. RHS elements were discov- access article distributed under the terms of the ered more than 30 years ago, but their role in biology has long remained unclear even Creative Commons Attribution License, which though they are some of the most positively selected genes known. Our results suggest an permits unrestricted use, distribution, and explanation to why rhs genes are under such strong positive selection in addition to sug- reproduction in any medium, provided the original author and source are credited. gesting a novel function for these toxins in regulating bacterial growth. Data Availability Statement: The data underlying the results presented in the study are available in S1 Data. PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 1 / 22 RHS-elements function as TA-systems that regulate Salmonella growth Funding: This study was supported by grants from Introduction the Swedish Foundation of Strategic Research How bacteria regulate their growth during infection is of fundamental interest for bacterial (ICA12-0025) (https://strategiska.se/), the Swedish physiology and for development of new improved treatment regimens for bacterial infections. research council (E0239301)(https://www.vr.se/), the European research council (ERC-2018-STG- Previous studies show that toxin-antitoxin (TA) modules are important for regulating the 804068)(https://erc.europa.eu/) and the Wenner- growth of bacteria within phagocytic vacuoles in immune cells [1, 2]. TA-systems are divided Gren foundations (https://www.swgc.org/) to S.K. into six classes (I-VI) depending on the nature of the toxin and antitoxin (protein or RNA) The funders had no role in study design, data and the way the antitoxin mediates protection (binding, degradation or regulation of expres- collection and analysis, decision to publish, or sion) (reviewed in [3]). The toxin and antitoxin of type II TA-systems are both proteins and preparation of the manuscript. the antitoxin protect against toxicity of the cognate toxin by binding and blocking its activity. Competing interests: The authors have declared The antitoxins of type II TA-systems are actively targeted by cellular proteases and therefore that no competing interests exist. less stable, i.e. have a shorter protein half-live than their cognate toxins [4, 5]. Degradation of antitoxins results in free unbound toxins that are able to corrupt essential cellular processes, which ultimately results in growth arrest [6, 7]. TA-modules were initially considered to func- tion as “addiction modules” or “selfish-genetic elements” found on low-copy-number plas- mids, where they provide plasmid stability through post-segregational distortion [8–10]. Daughter cells that lose the plasmid stop proliferating because the unstable antitoxin needs to be continuously produced from the plasmid to prevent self-intoxication by the more stable toxin [8–10]. Type II TA-systems were later also found to be abundant in bacterial genomes and have since been linked to bacterial virulence in many bacteria, including Escherichia coli [11], Mycobacterium tuberculosis [12], Staphylococcus aureus [13] and Salmonella enterica [14]. Salmonella enterica serovar Typhimurium (hereafter S. Typhimurium) is a facultative intra- cellular pathogen that causes mild self-limiting gastro-intestinal disease in humans [15] but also typhoid-like disease in many hosts including humans [15, 16]. S. Typhimurium has a number of virulence factors allowing it to survive and replicate within phagocytic cells and to cause systemic disease [17]. Previous findings suggest that S. Typhimurium cells enter a non- growing state upon entry to host macrophages, through a mechanism dependent on type-II TA-modules found in the S. Typhimurium chromosome [1]. Bacterial contact-dependent growth inhibition (CDI) systems comprise functional toxin- antitoxin modules, but where typical TA-modules are expressed inside the bacterial cell, the toxins of CDI systems are delivered between cells leaving the antitoxin inside the CDI produc- ing cell. Rhs proteins are widely distributed CDI toxins, common throughoutβ-,γ- andδ-pro- teobacteria and with distantly related YD-peptide repeat proteins found also in Gram-positive bacteria and in higher vertebrates [18, 19]. In Gram-negative bacteria, Rhs toxins are secreted and mobilized by the type VI secretion system (T6SS) [20–22], which forms a needle-like cell- puncturing device that penetrates the membrane of the target cell and can deliver multiple effectors to both prokaryotic and eukaryotic cells [23, 24]. Effectors can be delivered through the needle-tube or by attachment to the tip of the puncturing device. The tip of the T6S devise is formed by e.g. the PAAR-domain containing Rhs toxins [25, 26]. Rhs proteins contain a delivery part, which folds into a cone-like structure forming a shell that encapsulates the highly variable C-terminal toxin domains demarcated by the PxxxxDPxGL motif [27, 28]. These C- terminal toxins are delivered to target cells upon cell-cell contact [20]. To protect themselves from auto-inhibition, bacteria with Rhs toxins also encode small, highly specific antitoxins or immunity proteins, that bind and block the toxic activity of their cognate toxins [20]. The activities of the various C-terminal domains range from nucleases to ADP-ribosylating toxins and many of the toxic activities remain unknown [20, 29–31]. S. Typhimurium contains a single rhs locus with a full-length rhs gene and one adjacent orphan toxin, which lacks the Rhs shell, hereafter referred to as the delivery part of the Rhs PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 2 / 22 RHS-elements function as TA-systems that regulate Salmonella growth protein (Fig 1A). The rhs locus is found adjacent to the genes encoding a T6SS on Salmonella Pathogenicity Island 6 (SPI-6) [32, 33]. In addition to their role in antagonistic interactions [20, 34], Rhs proteins have been shown to modulate host inflammatory responses [35] and S. Typhimurium SL1344 mutants lacking rhs genes are completely attenuated in pig and cattle infection models [36], indicating a strong role for these systems in bacterial pathogenesis. In addition, removal of only the orphan toxin alone reduced S. Typhimurium proliferation in mice [33]. We were interested in finding out more about the role of Rhs toxins in S. Typhimurium biology. According to a genome-wide survey of the transcriptional response to infection-rele- vant conditions, multiple promoters were identified in the rhs locus (Fig 1A)[37], suggesting that while the full-length rhs gene was expressed rarely or not at all, strong expression of the main and orphan C-terminal toxins occurred at most conditions. We therefore set out to investigate if this expression resulted in functional toxin(s) being produced and if these toxins had a biological function in the cell. Here we show that main and orphan rhs genes encode functional type-II TA-modules that regulate S. Typhimurium proliferation inside macrophages. Results rhs toxins are expressed from internal promoters in the rhs ORF According to a genome-wide survey of the transcriptional response to an array of 22 infection- relevant conditions encountered by S. Typhimurium 4/74, the main rhs gene (STM0291) encoding the Rhs shell and the associated T6SS genes are not transcribed during any condition (Fig 1A) [37]. However, the C-terminal toxin domains of both the main and orphan rhs genes, rhs-CT, as well as their cognate immunity genes, rhsI, were transcribed in several of the condi- tions assayed, including Early Stationary Phase (ESP), a condition which stimulates expression of the Salmonella pathogenicity island -1 (SPI-1) virulence genes and during intra-macrophage growth (MAC) (Fig 1A). To validate this expression, we performed quantitative real-time PCR delivery main using oligos that bind within the rhs , the main rhs-CT (rhs-CT ) or the orphan rhs-CT orphan (rhs-CT ) (Fig 1A, Table A in S1 Text). Contrary to the transcriptomics data, the qPCR delivery main orphan results suggest a small but significant expression of rhs . The rhs-CT and rhs-CT delivery are, however, expressed 100-fold higher than rhs in ESP and 5 to 9-fold higher respec- tively in MAC conditions (after 8h of growth) (Fig 1B and 1C). Transcriptional profiling revealed four transcriptional start sites (TSS’s) in the rhs locus region (here called P2-P5) (Fig 1A). Two of these TSS’s are located in a conserved region A B found in both the main and orphan rhs genes (P2 and P2 ). These TSS’s are located 89 nt upstream of the sequence encoding the conserved PxxxxDPXGL motif, which suggests that they could hypothetically generate an mRNA that would allow for the translation of a func- tional toxin and antitoxin. The other three TSS’s identified were unique to either the main or orphan rhs genes. To test whether these TSS’s (P2- P5) and an additional hypothetical TSS, delivery upstream from the start codon of the rhs gene (P1) allow for transcription, we con- structed transcriptional fusions with sYFP2 to these promoters on a pSC101 vector backbone (S1 Fig). We defined the promoter region as -100 nt from the hypothetical TSS, except for P1 where we decided to include 200 nt in the transcriptional constructs. These constructs were transformed into S. Typhimurium 14028S and fluorescent activity was assayed in over-night cultures (grown for 16–18 h) by flow cytometry. In line with the published transcriptomic dataset we found the highest fluorescent activity for the P2 constructs in LB (Fig 2A and 2B). Also promoters P4 and P5 were active in LB, whereas we could detect no activity for P1 and P3 A B (Fig 2A and 2B). We chose to focus the rest of this study on the P2 /P2 and their associated PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 3 / 22 RHS-elements function as TA-systems that regulate Salmonella growth Fig 1. Transcriptional activity of the rhs locus. A) Illustration showing transcriptional activity from the SalCom database. Predicted delivery main transcription start-sites are shown as arrows above the schematic gene. B-C) Relative expression of rhs , rhs-CT and rhs- orphan CT determined by qPCR in B) LB broth or C) in RAW 264.7 macrophages. Error-bars are SEM. Statistical significance was � � � � � � � � � � � � � � � determined using Mann-Whittney test where = P<0.05, = P<0.01 and = P<0.001, = P<0.0001, = P<0.00001. https://doi.org/10.1371/journal.pgen.1008607.g001 A B main and orphan rhs transcripts. The identified P2 /P2 TSS was confirmed by 5’RACE and bioinformatic analyses identified putative -10 and -35 regions upstream of the TSS (S2 Fig). In addition, putative ribosome binding sites (RBS’s) preceding several putative translation start sites (CTG (ORF1) or ATG (ORF2)) were identified in both the main and orphan transcripts (S2A and S2B Fig). These data suggest that the Rhs toxins could be expressed internally, simi- larly to type II TA-modules. Internal transcription results in toxic proteins main orphan A B Transcriptional activity from the rhs-CT and rhs-CT from P2 and P2 does not nec- essarily infer that a functional toxic protein is generated from these transcripts. For a func- tional toxin to be expressed, a translation start site is required. The downstream region of the confirmed TSS´s contained two potential translation start sites (S2A and S2B Fig). To investi- gate if either of these translation start sites produced a toxic protein, we cloned the putative PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 4 / 22 RHS-elements function as TA-systems that regulate Salmonella growth Fig 2. Transcriptional activity of P1-P5 promoters using transcriptional fusions. Transcriptional activity of P1-P5 promoters measured using fluorescence reporters with P1-P5 promoters to sYFP2. A) Representative flow graphs or B) mean YFP fluorescence of strains carrying pSK945-949 (P1-P5) or pEH167 (empty). � � � � � � � � � � Error-bars are SEM. Statistical significance was determined using two-tailed students T-test where = P<0.05, = P<0.01, = P<0.001 and = P<0.0001. https://doi.org/10.1371/journal.pgen.1008607.g002 ORFs (from the predicted start codon to the stop codon) under an arabinose inducible pro- moter on a p15A vector backbone. Toxicity of the internal transcripts was determined by transformation into NEB high-efficiency chemically competent cells in the presence or absence of the inducer (L-arabinose) and the ability of the cognate immunity protein to rescue this main toxic effect. NEB cells transformed with plasmids expressing the longer ORF1 of Rhs-CT orphan or Rhs-CT (from CTG) grew unaffectedly in glucose, with or without expression of their cognate immunity proteins, whereas 3- and 1.5- orders of magnitude less growth was main observed in L-arabinose in the absence of cognate immunity proteins for the Rhs-CT and orphan Rhs-CT toxin, respectively (Fig 3). In contrast, the growth of NEB cells transformed with main orphan plasmids expressing the shorter ORF2 of Rhs-CT or Rhs-CT was unaffected in the absence of cognate immunity when grown in either arabinose or glucose (S3 Fig). We con- cluded that translation of a functional toxin, originating from the CTG start codon (ORF1) was possible from the P2 transcript and that this toxin could be inactivated by the presence of its cognate immunity protein in the cell. Cells expressing adequate levels of cognate immunity protein are protected from the toxic- ity of C-terminally encoded toxins of CdiA and Rhs molecules [20, 29, 34]. For CdiA toxins, the immunity proteins neutralize the toxins by binding the toxin directly, similarly to known type-II-TA-systems [38]. To investigate if also RhsI mediates protection through direct inter- orphan action with the toxin we used co-immunoprecipitation. HA-tagged RhsI was detected in orphan cell lysates of cells expressing rhsI -HA as well as in immunoprecipitated samples using orphan anti-HA magnetic beads (Fig 4A). Similarly, Rhs-CT was present in all whole cell lysates orphan of strains expressing rhs-CT , but could only be detected in the immunoprecipitated frac- orphan orphan tions of cells expressing rhsI -HA (Fig 4B). Co-immunoprecipitation of Rhs-CT and PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 5 / 22 RHS-elements function as TA-systems that regulate Salmonella growth main orphan main Fig 3. Toxicity of Rhs-CT and Rhs-CT . Colony forming unit (CFU) values of NEB 5-α cells with or without immunity plasmid (No immunity/rhsI orphan main orphan pDAL923 /rhsI pDAL938) 21h after transformation with plasmids encoding arabinose inducible rhsCT pSK1913 /rhsCT pSK1914 (ORF1) grown on � � � either 1% glucose or 1% arabinose. n = 3, Error-bars are SEM. Statistical significance was determined using two-tailed students t-test where = P<0.05 and = P<0.01. https://doi.org/10.1371/journal.pgen.1008607.g003 PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 6 / 22 RHS-elements function as TA-systems that regulate Salmonella growth orph orph Fig 4. RhsCT and RhsI -HA interact upon co-expression. Immunoblot analysis of cleared cell lysates and immunoprecipitated samples (IP) using anti- orphan HA magnetic beads with (+) or without (-) formaldehyde treatment (FA). Cells contain either RhsCT expressed from an arabinose inducible plasmid orphan Orphan Orphan (pSK502) or RhsCT and RhsI -HA expressed from an arabinose inducible plasmid (pSK4251). A) RhsI -HA was detected with anti-HA orphan Orphan antibodies. B) RhsCT was detected using purified anti-RhsCT antiserum. https://doi.org/10.1371/journal.pgen.1008607.g004 orphan RhsI -HA was observed both in cell lysates treated with formaldehyde prior to lysis and in untreated cell lysates. This suggests that the Rhs orphan immunity neutralizes Rhs orphan toxin through direct interaction as observed for other CDI and type II-TA-systems. orphan The immunoprecipitations were done with a plasmid where the entire rhsCT-I locus orphan was cloned with its native translation starts. To be able to detect RhsCT by western blot, we had to over-express an inactive mutant of this toxin from a previously described vector [34]. This is not surprising as native levels of expression (from the CTG start codon) are expected to be much lower than from the artificial ATG start included in the over-expression construct. To see if the internal transcription also was able to produce protein from the native A B P2 and P2 transcripts and the CTG translation start site, we constructed translational reporter fusions where sYFP2 was inserted 3 aa downstream of the CTG start codon in ORF1, shown to give a toxic product (Fig 3). Protein levels were investigated by single molecule fluo- rescence microscopy. Using this construct, a small, yet significant level of YFP was detected orphan main from Rhs-CT , but not Rhs-CT . (S4A Fig), suggesting that both internal transcripts main could result in protein although at levels below the detection limit for the native Rhs-CT . main To further investigate if we could observe a signal from Rhs-CT we repeated the experi- ment at a higher laser voltage and longer exposure time. At these settings, a significant level of main expression could be observed from the native Rhs-CT (S4B Fig). PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 7 / 22 RHS-elements function as TA-systems that regulate Salmonella growth Rhs toxins repress S. Typhimurium proliferation within host macrophages Previous studies have shown that TA-systems are important for S. Typhimurium growth regu- main orphan lation within macrophages [1]. Our results suggest that the Rhs-CT and Rhs-CT tox- ins are expressed intracellularly similar to type-II TA-systems, but whether this has an effect on bacterial physiology is unclear. To test if Rhs toxins were important for S. Typhimurium proliferation within macrophages, we infected RAW264.7 macrophage cells with wild type or main main orphan or- mutant S. Typhimurium bacteria lacking rhs-CT (Δrhs-CT ), rhs-CT (Δrhs-CT phan main orphan main+orphan complete ), rhs-CT and rhs-CT (Δrhs-CT ) or the entire rhs-locus (Δrhs ) (Fig 5A). To reduce fluctuation between biological replicates due to variation in the number of RAW 264.7 cells in individual wells, we labelled wild type S. Typhimurium with one antibiotic resistance marker (CAM) and wild type/mutant with another antibiotic resistance marker (KAN) and infected each well with a mixture of wild type/wild type or wild type/mutant S. Typhimurium. The survival of wild type and wild type/mutant bacteria was monitored by plat- ing cell lysates on LB agar plates containing either KAN or CAM antibiotics. This allowed us to calculate an accurate intramacrophage survival of our mutants relative to wild type for each biological replicate. Relative intramacrophage survival was calculated as the ratio of colony forming units (CFU) on KAN/CAM at 15h divided by the same ratio at 0h. To avoid competi- tion and potential Rhs toxin delivery between wild type and mutants during the infection experiment, we used a low multiplicity of infection (MOI = 10) to ensure that only one infecting bacterium would be found per macrophage. Interestingly, we find that theΔrhs- main+orphan complete CT andΔrhs mutants proliferate approximately 2-times better within the macrophages than wild type S. Typhimurium (Fig 5B), suggesting that the Rhs toxins slow down or arrest growth of S. Typhimurium within macrophages. To control that no other mutations (that could have accumulated during strain construction) affected the growth of complete S. Typhimurium in our assay, we whole genome sequenced theΔrhs mutant. (The complete main+orphan Δrhs mutant was generated by P22 transduction into theΔrhs-CT mutant, orphan which in turn was generated by P22 transduction into the rhs-CT mutant. Thus, the rhs- orphan main+orphan CT andΔrhs-CT mutant should not contain additional mutations). Whole genome sequencing revealed 3 additional SNPs in wild type S. Typhimurium LT2 (listed in Table B in S1 Text). These mutations reflect the fact that our genetic engineering was per- formed in S. typhiumurium LT2 after which the constructs were moved to 14028S by P22 transduction. To ensure that these SNPs were not contributing to the observed phenotype of our mutants, we constructed a complemented strain where the entire Rhs-locus was reconsti- complete tuted in its native genetic location in theΔrhs mutant (carrying all three SNPs). No increase in survival could be observed in this mutant (Fig 5B). Previous studies indicate that only a subpopulation of S. Typhimurium cells will start to replicate during infection and that a large fraction remains non-growing [39]. Thus, the observed outgrowth could be the result of two different scenarios where either; i) a larger frac- tion of mutant bacteria resume growth after entry into the macrophages, ii) the bacteria that resume growth proliferate faster within the macrophage or a combination of the above. To test which of these scenarios was the case we used a previously described fluorescent dilution assay, where the bacteria were transformed with a plasmid constitutively expressing GFP and where RFP (dsRed) expression is under the control of an arabinose inducible promoter. By expressing RFP prior to infection (by growing the bacteria in media supplemented with arabi- nose), the fraction of growing S. Typhimurium cells within the macrophages can be detected as the RFP signal will be diluted by 50% with each cell division [39]. The fraction of growing cells was calculated as 1-fraction non-growing cells (S5 Fig) and adjusted to account for the number of generations the growing bacteria had undergone during the experiment (for PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 8 / 22 RHS-elements function as TA-systems that regulate Salmonella growth main orphan Fig 5. Internal expression of rhs-CT and rhs-CT reduce S. Typhimurium growth in RAW 264.7 macrophages. A) Illustration showing the genetic main orphan main+orphan complete mutants used in B-D. B) Relative intra-macrophage survival of wild type,Δrhs-CT ,Δrhs-CT ,Δrhs-CT ,Δrhs mutants after 16 h. main orphan Relative survival was calculated as ratio of mutant/wild type at 16h as compared to the same ratio at 0 h. C) Average wild type,Δrhs-CT ,Δrhs-CT ,Δrhs- main+orphan complete CT ,Δrhs mutants that starts to replicate after 16 h in RAW 264.7 macrophages relative to wild type. D) Relative growth rate of wild type and rhs mutants during 16 h infection. Error-bars are SEM. Statistical significance was determined using Mann-Whittney test where = P<0.05. https://doi.org/10.1371/journal.pgen.1008607.g005 calculations see methods section). Surprisingly, no significant differences could be observed in the population of bacteria that resumed growth after entry into the macrophages in wild type or mutant S. Typhimurium (Fig 5C). In contrast, 27% more bacteria started to replicate in PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 9 / 22 RHS-elements function as TA-systems that regulate Salmonella growth main main macrophages in S. Typhimurium lacking rhs-CT (Δrhs-CT ), suggesting that this muta- tion affected the proportion of cells resuming growth. The increased proliferation observed for the other mutants could, however, not be accounted for by an increased fraction of cells resuming growth. To investigate if instead the mutant bacteria grew faster within the macro- phage, we calculated the fold replication and number of generations the bacteria underwent during the time-frame of the experiment. The fold replication bacteria undergo during 16h of growth within macrophages can be calculated as the change in median RFP intensity between the initial population (0h) and the growing population after 16h (S5 Fig). The relative fold rep- lication was then calculated as the fold replication of the mutant over wild type. S. Typhimur- ium cells lacking the entire rhs operon grew ~30% faster than wild type during the experiment, allowing the mutant bacteria to divide one extra time during the experiment (~7 generations compared to ~6 generation) (Fig 5D). One extra division could account for the 2-fold increase orphan in CFU observed in Fig 5B. Similarly, for the single rhs-CT and the double CT deletion main mutants grew 20% faster than wild type (Fig 5D). For the rhs-CT deletion mutant no increase in growth rate could be observed, suggesting that the increase in fraction of cells resuming growth must account for the increase in CFU. Taken together, our results suggest that the internal expression of the Rhs toxins contribute mainly to the growth rate of S. Typhi- murium after entry into macrophages and not the fraction of cells resuming growth. RhsI antitoxins are degraded by proteases. A remaining question is how Rhs toxins arrest growth. A plausible hypothesis is that they function similarly to toxins belonging to type II TA-systems and CdiA toxins, where the antitoxin is degraded by a stress-induced protease; Lon [40, 41]. Lon is up-regulated in S. Typhimurium after entry into macrophages [42], suggest- ing a faster turnover of antitoxin degradation in this condition. This could result in that cells with the Rhs TA-system arrest growth because they lack sufficient levels of antitoxin, whereas mutant cells lacking the TA-system can grow less hindered. To test if RhsI was susceptible to degradation by the Lon protease, we cloned C-terminally HA-tagged versions of the RhsI pro- teins under an arabinose inducible promoter expressed from the pBAD33 vector. Protein stabil- ity was measured in wild type andΔlon bacteria using western blot with anti-HA antibodies after the addition of either DL-Serine hydroxamate (SHX), a seryl-tRNA synthetase inhibitor, or the macrolide antibiotic Erythromycin, an inhibitor of protein synthesis, to cultures express- main orphan orphan ing RhsI or RhsI . The RhsI protein was stable over the course of 1h inΔlon bacte- ria compared to wild type where degradation occurred already after 15 min after SHX addition main (Fig 6A, lower panel). In contrast, the RhsI protein was degraded 30 min after SHX addition in both wild type andΔlon bacteria, suggesting that another protease is responsible for the deg- radation of this protein (Fig 6A, upper panel). Both proteins were completely stable in both wild type andΔlon background upon Erythromycin treatment (Fig 6B). These results suggest that Rhs immunities do not have a fast turn-over under favorable conditions but are unstable and subject to proteolytic degradation when the cell is stressed. From these results it appears that Rhs toxins could arrest growth upon entry to macrophages through stress-mediated activation of cellular proteases, resulting in RhsI antitoxin degradation. Discussion RHS elements have previously been described as weapons used in antagonistic bacterial inter- actions. Here we show that Rhs toxins are not only being delivered between cells but are also expressed and functional within a bacterial cell. We also show that Rhs toxins affect prolifera- tion of Salmonella cells during macrophage infection by changing the growth rate of S. typhi- murium within macrophages. Thus, Rhs toxins comprise functional type-II TA loci that repress S. Typhimurium growth in vivo. Previous analysis of more than 150 Salmonella PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 10 / 22 RHS-elements function as TA-systems that regulate Salmonella growth main orphan Fig 6. RhsI and RhsI are degraded by proteases (including Lon) upon stringent-response activation. main orphan Immunoblot analysis of RhsI-HA or RhsI-HA protein (11.6 and 18.5 kDa respectively) stability in the presence (Sty PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 11 / 22 RHS-elements function as TA-systems that regulate Salmonella growth wt) and absence (StyΔlon) of Lon protease before and after A) SHX or B) Erythromycin treatment for 1 h. Levels of the RNA polymeraseβ-subunit are shown as control. https://doi.org/10.1371/journal.pgen.1008607.g006 genomes showed that all Salmonella serovars contain at least one Rhs toxin, with some strains having up to 11 different orphan toxins [34]. Bioinfomatic analyses of all genomes on NCBI showed that the P2 promoter is found upstream of at least 50 different Rhs toxins in Salmo- nella spp. but also in E. coli, Shigella, Pseudomonas and Erwinia spp, suggesting that also these toxins could be expressed internally as seen in S. Typhimurium (S6 Fig). This raises an inter- esting question; does the presence of other Rhs toxins affect Salmonella growth in vivo and, if so, what are the consequences of having up to 12 toxins for Salmonella’s lifestyle and ability to replicate in macrophages? On the other hand, it is not obvious why S. Typhimurium has two Rhs toxins, when one alone (the orphan) has a strong effect on intramacrophage replication. A possible explanation could be that the two toxins are used for different things. For example, the main Rhs toxin can be delivered between bacteria, whereas mobilization of the orphan toxin requires a pre-existing duplication of the locus followed by a recombination event [34]. Our results here suggest that the orphan toxin mainly functions in controlling intramacroph- age replication, whereas very little contribution can be seen from the main Rhs toxin. It is also main possible that the contribution of rhsCT cannot be fully evaluated in the single mutant as main orphan removal of rhsCT allows for a recombination event that will fuse rhsCT to the rhs- delivery mechanism [34]. Such recombination events between hundreds of base pairs of exact homology are very frequent [43], but are prevented in wild type Salmonella by the internal expression of RhsCT/I main (which upon loss would cause a growth defect to that cell). Changing the chromosomal organization of the locus could result in a number of changes orphan including altered expression levels of the RhsCT as well as potential delivery of the toxin between cells, which could affect proliferation in our infection assay. So, what could be the benefit of maintaining these Rhs toxins in Salmonella genomes? One possible explanation is that there is no benefit, but that Rhs toxins represent selfish elements and are expressed internally simply to maintain selection of themselves. This fits nicely with the observation that these internal promoters are expressed under all conditions tested and could also explain why Rhs proteins are some of the most positively selected genes known [44]. Selfish genetic elements can either consist of sequences that frequently transfer between strains but can also consist of elements that provide a benefit to the cell, or a combination of both [45]. These selfish genetic elements may have been domesticated or co-opted by the bac- teria to provide positive effects for the cell, like defense against phage, or ability to compete with other bacteria. The Rhs toxins in S. Typhimurium can be mobilized and used to outcom- pete bacteria lacking these systems [34]. But, the toxins are found on the H-NS silenced SPI-6 [46], previously shown to be important for colonization of mice [33]. Thus, it is possible that the internal expression of Rhs toxins provides a selection to maintain the full-length Rhs toxin and/or SPI-6 in conditions when they are not expressed. Another possibility is that growth arrest after entry into macrophages could be important for S. Typhimurium in vivo. Replica- tion in macrophages occurs mainly during systemic spread of the disease within the lymph orphan nodes, liver and spleen. Interestingly, a previous study showed that Rhs-CT , but not main RhsI is important for systemic dissemination in mice [33], suggesting that internal expres- sion could be important for virulence. Salmonella gastroenteritis infections are often self-limit- ing and do not proceed beyond the lamnia propria. However, during typhoid fever, the Salmonella infected phagocytes gain access to the lymphnodes, liver and spleen [47]. It is possi- ble that regulation of growth upon entry to phagocytes is an important factor in deciding whether the infection stays local or becomes systemic. PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 12 / 22 RHS-elements function as TA-systems that regulate Salmonella growth The full-length Rhs toxins or the adjacent T6SS genes are not expressed during any of the conditions assayed in Kro ¨ger et al. [37]. Previous findings suggest that SPI-6 is strongly silenced by H-NS and that only in conditions where H-NS expression is decreased or absent can T6SS activity be observed [32, 46]. Other contact-dependent competition systems have been suggested to contribute to kin selection by exclusion of others (by inhibiting the growth of non-self bacteria) [48]. Rhs toxins have also been shown to be important during intestinal colonization [32, 49]. As the intra-macrophage population most likely is clonal, there is proba- bly no competition with non-kin cells in this niche. Thus, expression of a system that is only used as a competition system, in these conditions, could be considered a waste of resources. We cannot, however, exclude the possibility that the ability to deliver toxins between isogenic strains adds to the growth regulation observed in our experiments. We have previously shown that self-delivery of CdiA toxins increases the fraction of non-growing cells in the population [41], so it is possible that Rhs toxins expressed at a low level (undetectable by RNA seq) are delivered between isogenic cells within the phagocytic vesicle. This could potentially explain the increased effect observed in the complete mutant as compared to the one lacking both toxins. A remaining question is how Rhs toxins arrest growth. Our results suggest that both RhsI proteins are susceptible protease mediated degradation under conditions when translation is arrested by induction of the stringent response, but not when translation is arrested by antibi- orphan otics. For one of the immunity proteins, RhsI , this degradation was completely abolished in cells lacking Lon protease. Lon protease becomes activated by poly-phosphate under condi- tions when stringent response is active [50, 51], suggesting that activated Lon is required for orphan degradation of RhsI . As Lon is up-regulated in S. Typhimurium after entry into macro- phages [42], it is likely that antitoxin turnover is increased in this condition. This would result in that cells with the Rhs TA-system arrest growth because they lack sufficient levels of anti- toxin, whereas mutant cells lacking the Rhs TA-system can grow unhindered. Previous find- ings show similar results where lack of certain toxin-antitoxin pairs decrease the non-growing Salmonella population within macrophages [1]. It is likely that each individual toxin adds a lit- tle to the effect and it would be interesting to see how a combined mutant lacking both type II-TA-systems and Rhs toxins would behave during macrophage infection. Interestingly, we orphan observe a stronger phenotype in vivo for the Rhs toxin even though it is less toxic than main Rhs when expressed from an arabinose inducible promoter (as seen in Fig 3). A possible explanation is that the two immunity proteins are not degraded to the same extent or at the orphan same time in the macrophages. RhsI is degraded by the Lon protease, whereas another protease, possibly not activated to the same extent or at the same time within the macrophage, main degrades RhsI (as seen in Fig 6). Protease mutants are non-viable in macrophages [52], making it difficult to test how protease mediated degradation of the antitoxin affects Salmo- nella growth within macrophages. An interesting and logical follow up question is of course how the growth arrested cells are able to resume growth? As with many type II toxins, CDI toxins are rarely lethal, depending on their toxic activity. It is easy to envision that cells undergone toxicity that results in degraded RNA molecules or dissipation of the proton motive force, easily can resume growth once the toxicity has been removed through degradation or neutralization of the toxin by pro- teases or newly synthesized antitoxin respectively. The toxic activity of the Rhs toxins in S. Typhimurium is not known. Structural or functional predictions suggest no membrane associ- ation for either the toxins or immunities, implying that the Rhs toxins do not act on the mem- main brane. PFAM database search reveals a known toxin domain (NTox) in the Rhs toxin, orphan suggesting that this protein is an RNAse [53]. For Rhs toxin, no clues to its activity could be revealed from its sequence. PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 13 / 22 RHS-elements function as TA-systems that regulate Salmonella growth Orphan toxins that lack the secretion component of the toxin are not only found for Rhs toxins, but are also often present in cdiBAI loci [54]. A fundamental question is how these orphan modules are maintained in bacterial populations. One possible selection pressure could be that these toxins provide a silent arsenal of novel toxins that can be mobilized by bac- teria and used in future competitions against neighboring bacteria. For example, this would facilitate a clonal selection in a population of genetically identical bacteria [34]. Our findings that orphan Rhs toxins represent functional TA-modules expressed inside the bacteria pro- vides an additional explanation to how these orphan toxins can be maintained when not used for competition. The remaining question is whether also CdiA toxins, colicins, microcins and other T6SS toxic effector proteins also contain internal transcription and translation start sites allowing them to be expressed internally, and if that expression would have a function on said bacteria’s physiology. Methods Bacterial strains and growth conditions Bacterial strains used in the study are derivatives of either Salmonella enterica subsp. Enterica serovar Typhimurium strain LT2 or strain 14028S (ATCC 14028) and are listed in Table C in S1 Text. Liquid media was Luria-Broth (LB) (Miller, 1972). Over-night cultures were grown for 16–18 hr at 37˚C and 200 rpm. For solid media LB was supplemented with 10 g/L agar. Antibiotics were used at the following concentrations; 50 mg/l Kanamycin (KAN), 15 mg/L Tetracycline (TET), 12.5 mg/L Chloramphenicol (CAM), mg/L Carbenicillin (CARB) and 100 mg/L Ampicillin (AMP). Genetic mutations in the chromosome were made usingλ red recombineering [55]. Markers were moved between Salmonella strains using P22 transduc- tions. Transductants were purified on EBU plates [56] and clones were confirmed by PCR and sequencing. Antibiotic resistance markers were excised using Flp recombinase expressed from the pcp20 vector as described previously [55]. More detailed information about strain con- structions can be found in the S1 Text. Expression of transcriptional fluorescent protein reporters measured through flow cytometry Bacteria from over-night cultures were washed 2x with 1 ml sterile-filtered PBS and diluted to 1x10 CFU/ml in PBS. Flow cytometry was performed using a MACSQuant VYB (Miltenyi Biotec), measuring 100,000 events. YFP was excited with a blue laser (488 nm; bandpass filter 525/50 channel B1), dsRed was excited with a yellow laser (561 nm; bandpass filter 615/20 nm channel Y2). The MACSQuantifyTM Software (Miltenyi Biotec) was used to aquire the data and the FlowJo Software (FlowJo, LLC) for analysis. 5’RACE 5’ RACE (rapid amplification of cDNA ends) was carried out with or without treatment by 5´!3´ exoribonuclease XRN-1 (NEB), using DNase I-digested total RNA isolated from early stationary phase (ESP). RNA was ligated with an RNA adaptor (5’ CGACUGGAGCACGAG GACACUGACAUGGACUGAAGGAGUAGAAA) and the product was reverse transcribed to cDNA using gene-specific oligo SK332 and Maxima first strand cDNA Synthesis Kit for RT-qPCR (K1641, Thermo Scientific). The DNA fragment was amplified in two consecutive rounds of PCR with DreamTaq DNA polymerase (ThermoScientific), first step with adapter- specific oligo FS17 and in the second, nested step with PCR oligo FS354, both in combination with gene specific reverse oligo SK332. The XRN-1-enriched DNA fragments were gel purified PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 14 / 22 RHS-elements function as TA-systems that regulate Salmonella growth and cloned into TOPO vector pCR-BLUNT-II (Thermofisher), and 10 clones were sequenced to validate the transcriptional start site. Western blot 500 μl of an OD = 0.7 culture of exponentially growing S. Typhimurium cells, induced with 0.2% arabinose at OD = 0.3, were harvested by centrifugation at 4˚C for 5 min at 21000 x g. Cells were re-suspended in 100 μl of sample buffer (50mM Tris pH 6.8, 1% SDS (w/v), 1% Tri- ton X-100, 10% Glycerol, 0.2% bromophenol blue) and boiled for 5min at 95˚C. 150mM DTT was then added to each sample followed by the pelleting of membrane debris and undigested genomic DNA at 21000 x g for 5 min before the supernatant were separated on a Mini-PRO- TEAN TGX gel (Biorad, USA). PageRuler Prestained Protein Ladder (Thermo Scientific, USA) was used as size marker. Proteins were then transferred to a Trans-Blot Turbo Mini 0.2 μm main PVDF membrane (BioRad, USA) using the Trans-Blot Turbo system (Biorad, USA). RhsI - oprhan HA and RhsI -HA proteins were detected using anti-HA antibody (11867423001, Sigma- Aldrich, Germany). Equal loading was confirmed by probing for RNA polymeraseβ-subunit using an anti-RNAPβ-subunit antibody (ab191598, Abcam, United Kingdom). Secondary anti- body towards anti-HA antibodies was anti-rat IgG coupled to HRP (GENA935, Sigma-Aldrich, Germany) and secondary antibody towards anti-RNAP antibodies was anti-rabbit IgG coupled to HRP (A1949, Sigma-Aldrich, Germany). Bands were visualized with Clarity Western ECL Substrate (Biorad, USA) and a ChemiDoc MP system (Biorad, USA). Co-Immunopurification (Co-IP) orphan (H208A) Exponentially growing cultures of SK502 (pCH450::rhsCT ), SK4251(pBAD24:: orphan orphan (H208A) orphan rhsCT-I -HA), SK4292 (pCH450::rhsCT and pBAD24::rhsCT-I -HA) (OD ~0.9–1.2) were induced with 0.5% L-arabinose (f.c.) at OD = 0.3 for ~1h. 90 ml of 600 600 cells were harvested by centrifugation and washed once with 1 x PBS. Cells were resuspended in 5 ml 1 x PBS supplemented with 2% formaldehyde (f.c.) and incubated for 10 min at RT. Residual formaldehyde was quenched by addition of 5 ml 1M Tris-Cl pH 8.0 and two subse- quent washes with 0.5 M Tris-Cl pH 8.0. Cells were resuspended in lysis buffer (20 mM Tris- Cl pH 7.5, 0.1% Tween-20, 0.25% Triton-X-100, 1x Halt-TM EDTA-free protease inhibitor mix) and broken by 6 cycles of sonication for 10 sec at 50% amplitude on ice. Debris and remaining cells were removed by centrifugation at 21.000 x g for 15 min at 4˚C. Cleared cell TM lysates were incubated with Pierce anti-HA magnetic beads (Thermo Scientific) according to the manufacturer’s instructions. Bound proteins were eluted with 50 μl 0.2 M glycine pH 2. Cleared cell lysates and eluates from the magnetic beads were dissolved in NuPAGE LDS sam- ple buffer (Thermo Fisher Scientific) supplemented with 0.1 M dithiotreitol (f.c.) and incu- bated at 60˚C for 10 min prior to loading. Of each cleared cell lysate, a volume corresponding to 1ml of bacteria with OD = 0.14 (for detection of RhsI -HA) or OD = 0.014 (for 600 orph 600 orph detection of RhsCT ) was separated on a 10% NuPAGE Bis-Tris gels (Novagen) using MES running buffer supplemented with antioxidant. Proteins were transferred to a PVDF-mem- TM orph brane using pre-assembled iBlot transfer stacks (Thermo Fisher Scientific). RhsCT was orph detected using purified anti-RhsCT antiserum [34] and anti-rabbit IgG coupled to HRP orph (Sigma). RhsI -HA was detected using anti-HA-antibody as described above. RAW264.7 culturing conditions The murine macrophage-like cell line RAW264.7 (ATCC) was cultured in 1x Dulbecco’s Mod- ified Eagle Media (DMEM, GIBCO) supplemented with 1% GlutaMAX (GIBCO), 1% non- essential amino acids (Sigma), 10% heat inactivated Fetal Bovine Serum (HI-FBS) (GIBCO) at PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 15 / 22 RHS-elements function as TA-systems that regulate Salmonella growth 37˚C with 10% CO in T-25 bottles (Sarstedt). Cells were passaged when confluent or every 48 h. RAW264.7 infection assay 1x10 /ml RAW264.7 cells were seeded in 24-well plates (Sarstedt) in pH buffered DMEM (high glucose, HEPES, no phenol red, GIBCO) supplemented with, 1% non-essential amino acids (Sigma) and 10% HI-FBS (GIBCO) and grown at 37˚C with 10% CO for 48 h before the infec- tion. Over-night cultures of S. Typhimurium 14028S were centrifuged at 6000 RPM and washed with sterile 1x PBS before being diluted to OD = 0.4. Bacteria were then opsonized in Balb/ cAnCrl mouse serum for 30 min. The old growth medium was removed and fresh pH buffered DMEM without FBS was added before infection at MOI 10. The infection was synchronized by centrifuging the cells for 5 min at 1200 rpm followed by 45 min incubation at 37˚C with 10% CO . The wells were washed with 1x PBS before adding fresh pH buffered DMEM + gentamicin (100 mg/l). Cells were incubated 45 min at 37˚C to kill off extracellular bacteria followed by washing with 1x PBS before being lysed with 0.1% Triton-X solution (Sigma). Lysates were immediately plated for CFU counts of the 0 h time point. Fresh pH buffered DMEM + gentami- cin (20 mg/l) was added to the remaining wells for later time points and incubated at 37˚C with 10% CO . Relative intra-macrophage survival was calculated as the ratio of WT and mutant CFU/ml at 16 h divided by the ratio of WT and mutant CFU/ml at 0 h. Fluorescence dilution assay S. Typhimurium 14028S (ATCC) transformed with pDiGc (Helaine et al., 2010) was used for infection according to infection protocol above. After lysing the RAW264.7 cells the lysates were washed once with sterile filtered PBS followed by analysis by flow cytometry (MACS, Miltenyi). Samples were gated for bacteria, GFP and dsRed (see “Fluorescent reporter assays” for settings). The % of bacteria that started to replicate was calculated by dividing the fraction of cells which lost RFP signal with at least 50% (S5 Fig) by 2 where n is the number of genera- tions the bacteria underwent during the experiment. The number of generations was deter- mined by taking the log of the relative change in mean RFP value between the initial non- divided population and the dividing population (S5 Fig). Toxicity assay Electro-competent SK4287, SK4288 and SK4289 were transformed with pSK1913, pSK1914, pSK1915 or pSK1918 by electroporation at 2.5 kV, 200 O, 25 μF and resuspended in 1 ml LB directly after. The transformed cells were incubated at 37˚C for 1 h to recover. After recovery the transformed samples were split in two to which glucose or arabinose was added to a final concentration of 1% alongside with appropriate antibiotics for plasmid selection. Cultures were grown for 20 h at 30˚C and plated for CFU counts on selective LA plates, supplemented with 1% glucose, by spotting. Quantitative RT-PCR Bacteria for RNA extraction were grown over-night in LB or for 8h in RAW264.7 macro- phages. LB cultures were diluted 1:1000 in LB broth and grown until OD = 2.0 (ESP). RNA degradation and transcription were stopped by the addition of 2/5 v/v 95% ethanol and 5% phenol (pH 4.3) on ice for 30 min—2 h. Cells pellets were stored at -80˚C until RNA extraction was performed using TRIzol (Invitrogen). DNA was removed using Turbo DNase I (Thermo- fisher) according to the manufacturer’s instructions. Successful DNA removal was confirmed PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 16 / 22 RHS-elements function as TA-systems that regulate Salmonella growth by PCR using oligos SK411/SK412 (40 cycles), and RNA integrity vas validated on 2% agarose in 1xTEB, run at 80V. Total RNA was diluted to 5 ng/μl and RT-qPCR was performed using Brilliant Ultra-Fast SYBR Green QRT-PCR Master Mix (Agilent) with oligos SK362/SK363 main orphan (delivery) SK3/SK4 (rhs-CT ) and SK5/SK6 (rhs-CT ). The reactions were run on a Ste- pOnePlus Real-Time PCR System (Applied biosystems). Relative gene expression was calcu- -ΔΔCT lated using the 2 method, normalizing the amount of target mRNA to expression of house-keeping gene recA amplified with oligos SK7/SK8 and wild type [57]. Bioinformatic analyses P2 promoter sequence from S. Typhimurium (CGGCTGCCGGGGCAGTATTTTGACGAC GAGACAGGGCTGCATTACAATCTGTTCAGATATTATGCACCGGAGTGTGGACGG TTTGTCAGTCAGGATCCGATCGGGCTG, 108bp) was used as the query for BLASTN search against the nt database (2019-04-29 release). 1147 hits with percent identity > = 80%, -10 alignment length > = 95 bp and e-value < = 1e were kept, corresponding to 800 different genomes. Full-length genomes were then retrieved from NCBI, and sub-sequences matching the given promoter were obtained for further analysis, as well as an additional 138 bp downstream sequence directly after the promoter region. Promoter and the downstream sequences were aligned separately using MAFFT [58] v7.407 with the L-INS-i option, and the alignments were then merged and ordered after the similarity of the aligned promoter sequences. Supporting information S1 Fig. Overview of the plasmid encoding transcriptional reporters for the P1-P5 promot- ers. (PDF) A B S2 Fig. P2 promoter. Overview of the A) P2 or B) P2 promoter sequences. -35 (yellow) and -10 (blue) regions were predicted using the softberry BPROM software. Transcription start sites (TSS´s) (bold and underlined) were determined using C) 5’RACE. Potential start codons are in green, RBS’s in orange and in-frame stop codons in pink. (PDF) S3 Fig. Toxicity of Rhs-CTmain and Rhs-CTorphan. CFU counts from transformations of main orphan plasmids encoding arabinose inducible rhs-CT /rhs-CT (ORF2) into NEB 5-α harbor- main orphan ing no immunity or rhsI /rhsI on a plasmids grown in either 1% glucose or 1% arabi- nose. n = 3, Error-bars are SEM. Statistical significance was determined using two-tailed � � � students t-test where = P<0.005. (PDF) A-B S4 Fig. Detection of the translational activity of the P2 promoter driven toxin. Single main orphan molecule fluorescence of strains with translational fusions of Rhs-CT and Rhs-CT ORF1’s (CTG) to sYFP2. Strains were grown in M9-glucose to reduce background fluores- cence. A) YFP fluorescence (au). B) Repeated experiment at higher laser voltage. Error-bars � � � are SEM. Statistical significance was determined using two-tailed students t-test where = � � � � � P<0.001 and = P<0.00001. (PDF) S5 Fig. Flow cytometric analyses to identify the dividing population of bacteria. Represen- tative graph of flowcytometric data used to identify the dividing population of bacteria after 16h of growth in RAW264.7 macrophages. The growing population is determined as the cells PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 17 / 22 RHS-elements function as TA-systems that regulate Salmonella growth where the dsRed fluorescent signal is decreased to levels below half of the mean fluorescent sig- nal of the non-growing population. (PDF) S6 Fig. Alignment of P2 promoter sequences and corresponding toxins. Alignment showing P2 promoter-like sequences in bacterial genomes from NCBI. Downstream sequences illus- trates different types of toxins the P2 promoters are found adjacent to. Homologous residues are shown in blue. Promoter sequences (-10, -35, TSS) and the conserved PxxxDPxGL motif are annotated above the sequences and demarcated with a black box. (PDF) S1 Text. Supplementary methods and Tables A-C. (PDF) S1 Data. Raw data for all experiments included in this work. (XLSX) Acknowledgments We thank Prune Leroy for the help with fluorescent microscopy and data analysis, Erik Holmqvist for the generous gift of the pEH167 plasmid and Fredrik So ¨derbom for the FS17 and FS354 oligos used in the study. Author Contributions Conceptualization: Magnus Stårsta, Disa L. Hammarlo ¨f, Marcus Wa ¨neskog, Sanna Koskiniemi. Data curation: Magnus Stårsta, Disa L. Hammarlo ¨ f, Arvid Heden Gynnå, Sanna Koskiniemi. Formal analysis: Magnus Stårsta, Disa L. Hammarlo ¨f, Marcus Wa ¨neskog, Susan Schlegel, Fei- fei Xu, Arvid Heden Gynnå, Malin Borg, Sanna Koskiniemi. Funding acquisition: Sanna Koskiniemi. Investigation: Magnus Stårsta, Disa L. Hammarlo ¨f, Marcus Wa ¨neskog, Susan Schlegel, Feifei Xu, Malin Borg, Sten Herschend. Methodology: Magnus Stårsta, Disa L. Hammarlo ¨f, Marcus Wa ¨neskog, Susan Schlegel, Feifei Xu, Malin Borg, Sanna Koskiniemi. Project administration: Sanna Koskiniemi. Resources: Sanna Koskiniemi. Supervision: Disa L. Hammarlo ¨f, Sanna Koskiniemi. Validation: Magnus Stårsta, Disa L. Hammarlo ¨ f, Marcus Wa ¨neskog, Malin Borg, Sten Herschend. Visualization: Magnus Stårsta, Sanna Koskiniemi. Writing – original draft: Magnus Stårsta, Disa L. Hammarlo ¨f, Sanna Koskiniemi. Writing – review & editing: Magnus Stårsta, Disa L. Hammarlo ¨ f, Marcus Wa ¨neskog, Susan Schlegel, Feifei Xu, Arvid Heden Gynnå, Sanna Koskiniemi. PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 18 / 22 RHS-elements function as TA-systems that regulate Salmonella growth References 1. Helaine S, Cheverton AM, Watson KG, Faure LM, Matthews SA, Holden DW. Internalization of Salmo- nella by macrophages induces formation of nonreplicating persisters. Science. 2014; 343(6167):204–8. Epub 2014/01/11. https://doi.org/10.1126/science.1244705 PMID: 24408438. 2. Korch SB, Contreras H, Clark-Curtiss JE. Three Mycobacterium tuberculosis Rel toxin-antitoxin mod- ules inhibit mycobacterial growth and are expressed in infected human macrophages. J Bacteriol. 2009; 191(5):1618–30. Epub 2008/12/31. https://doi.org/10.1128/JB.01318-08 PMID: 19114484; PubMed Central PMCID: PMC2648211. 3. Page R, Peti W. Toxin-antitoxin systems in bacterial growth arrest and persistence. Nat Chem Biol. 2016; 12(4):208–14. Epub 2016/03/19. https://doi.org/10.1038/nchembio.2044 PMID: 26991085. 4. Muthuramalingam M, White JC, Bourne CR. Toxin-Antitoxin Modules Are Pliable Switches Activated by Multiple Protease Pathways. Toxins (Basel). 2016; 8(7). Epub 2016/07/15. https://doi.org/10.3390/ toxins8070214 PMID: 27409636; PubMed Central PMCID: PMC4963847. 5. Wilbaux M, Mine N, Guerout AM, Mazel D, Van Melderen L. Functional interactions between coexisting toxin-antitoxin systems of the ccd family in Escherichia coli O157:H7. J Bacteriol. 2007; 189(7):2712–9. Epub 2007/01/30. https://doi.org/10.1128/JB.01679-06 PMID: 17259320; PubMed Central PMCID: PMC1855815. 6. Keren I, Shah D, Spoering A, Kaldalu N, Lewis K. Specialized persister cells and the mechanism of mul- tidrug tolerance in Escherichia coli. J Bacteriol. 2004; 186(24):8172–80. Epub 2004/12/04. https://doi. org/10.1128/JB.186.24.8172-8180.2004 PMID: 15576765; PubMed Central PMCID: PMC532439. 7. Vazquez-Laslop N, Lee H, Neyfakh AA. Increased persistence in Escherichia coli caused by controlled expression of toxins or other unrelated proteins. J Bacteriol. 2006; 188(10):3494–7. Epub 2006/05/05. https://doi.org/10.1128/JB.188.10.3494-3497.2006 PMID: 16672603; PubMed Central PMCID: PMC1482871. 8. Ogura T, Hiraga S. Mini-F plasmid genes that couple host cell division to plasmid proliferation. Proc Natl Acad Sci U S A. 1983; 80(15):4784–8. Epub 1983/08/01. https://doi.org/10.1073/pnas.80.15.4784 PMID: 6308648; PubMed Central PMCID: PMC384129. 9. Gerdes K, Bech FW, Jorgensen ST, Lobner-Olesen A, Rasmussen PB, Atlung T, et al. Mechanism of postsegregational killing by the hok gene product of the parB system of plasmid R1 and its homology with the relF gene product of the E. coli relB operon. EMBO J. 1986; 5(8):2023–9. Epub 1986/08/01. PMID: 3019679; PubMed Central PMCID: PMC1167073. 10. Gerdes K, Rasmussen PB, Molin S. Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells. Proc Natl Acad Sci U S A. 1986; 83(10):3116–20. Epub 1986/05/01. https:// doi.org/10.1073/pnas.83.10.3116 PMID: 3517851; PubMed Central PMCID: PMC323463. 11. Norton JP, Mulvey MA. Toxin-antitoxin systems are important for niche-specific colonization and stress resistance of uropathogenic Escherichia coli. PLoS Pathog. 2012; 8(10):e1002954. Epub 2012/10/12. https://doi.org/10.1371/journal.ppat.1002954 PMID: 23055930; PubMed Central PMCID: PMC3464220. 12. Stewart GR, Patel J, Robertson BD, Rae A, Young DB. Mycobacterial mutants with defective control of phagosomal acidification. PLoS Pathog. 2005; 1(3):269–78. Epub 2005/12/03. https://doi.org/10.1371/ journal.ppat.0010033 PMID: 16322769; PubMed Central PMCID: PMC1291353. 13. Bukowski M, Lyzen R, Helbin WM, Bonar E, Szalewska-Palasz A, Wegrzyn G, et al. A regulatory role for Staphylococcus aureus toxin-antitoxin system PemIKSa. Nat Commun. 2013; 4:2012. Epub 2013/ 06/19. https://doi.org/10.1038/ncomms3012 PMID: 23774061. 14. De la Cruz MA, Zhao W, Farenc C, Gimenez G, Raoult D, Cambillau C, et al. A toxin-antitoxin module of Salmonella promotes virulence in mice. PLoS Pathog. 2013; 9(12):e1003827. Epub 2014/01/05. https://doi.org/10.1371/journal.ppat.1003827 PMID: 24385907; PubMed Central PMCID: PMC3868539. 15. Haraga A, Ohlson MB, Miller SI. Salmonellae interplay with host cells. Nat Rev Microbiol. 2008; 6 (1):53–66. Epub 2007/11/21. https://doi.org/10.1038/nrmicro1788 PMID: 18026123. 16. Haselbeck AH, Panzner U, Im J, Baker S, Meyer CG, Marks F. Current perspectives on invasive nonty- phoidal Salmonella disease. Curr Opin Infect Dis. 2017; 30(5):498–503. Epub 2017/07/22. https://doi. org/10.1097/QCO.0000000000000398 PMID: 28731899. 17. Linehan SA, Holden DW. The interplay between Salmonella typhimurium and its macrophage host— what can it teach us about innate immunity? Immunol Lett. 2003; 85(2):183–92. Epub 2003/01/16. https://doi.org/10.1016/s0165-2478(02)00227-4 PMID: 12527226. 18. Tucker RP, Beckmann J, Leachman NT, Scholer J, Chiquet-Ehrismann R. Phylogenetic analysis of the teneurins: conserved features and premetazoan ancestry. Molecular biology and evolution. 2012; 29 PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 19 / 22 RHS-elements function as TA-systems that regulate Salmonella growth (3):1019–29. Epub 2011/11/03. https://doi.org/10.1093/molbev/msr271 PMID: 22045996; PubMed Central PMCID: PMC3278476. 19. Foster SJ. Molecular analysis of three major wall-associated proteins of Bacillus subtilis 168: evidence for processing of the product of a gene encoding a 258 kDa precursor two-domain ligand-binding pro- tein. Molecular microbiology. 1993; 8(2):299–310. Epub 1993/04/01. https://doi.org/10.1111/j.1365- 2958.1993.tb01574.x PMID: 8316082. 20. Koskiniemi S, Lamoureux JG, Nikolakakis KC, T’Kint de Roodenbeke C, Kaplan MD, Low DA, et al. Rhs proteins from diverse bacteria mediate intercellular competition. Proceedings of the National Acad- emy of Sciences of the United States of America. 2013; 110(17):7032–7. Epub 2013/04/11. https://doi. org/10.1073/pnas.1300627110 PMID: 23572593; PubMed Central PMCID: PMC3637788. 21. Whitney JC, Beck CM, Goo YA, Russell AB, Harding BN, De Leon JA, et al. Genetically distinct path- ways guide effector export through the type VI secretion system. Mol Microbiol. 2014; 92(3):529–42. https://doi.org/10.1111/mmi.12571 PMID: 24589350. 22. Alcoforado Diniz J, Coulthurst SJ. Intraspecies Competition in Serratia marcescens Is Mediated by Type VI-Secreted Rhs Effectors and a Conserved Effector-Associated Accessory Protein. Journal of bacteriology. 2015; 197(14):2350–60. Epub 2015/05/06. https://doi.org/10.1128/JB.00199-15 PMID: 25939831; PubMed Central PMCID: PMC4524185. 23. Hood RD, Singh P, Hsu F, Guvener T, Carl MA, Trinidad RR, et al. A type VI secretion system of Pseu- domonas aeruginosa targets a toxin to bacteria. Cell Host Microbe. 2010; 7(1):25–37. Epub 2010/02/ 02. https://doi.org/10.1016/j.chom.2009.12.007 PMID: 20114026; PubMed Central PMCID: PMC2831478. 24. Ma AT, Mekalanos JJ. In vivo actin cross-linking induced by Vibrio cholerae type VI secretion system is associated with intestinal inflammation. Proc Natl Acad Sci U S A. 2010; 107(9):4365–70. Epub 2010/ 02/13. https://doi.org/10.1073/pnas.0915156107 PMID: 20150509; PubMed Central PMCID: PMC2840160. 25. Russell AB, Peterson SB, Mougous JD. Type VI secretion system effectors: poisons with a purpose. Nat Rev Microbiol. 2014; 12(2):137–48. Epub 2014/01/05. https://doi.org/10.1038/nrmicro3185 PMID: 26. Shneider MM, Buth SA, Ho BT, Basler M, Mekalanos JJ, Leiman PG. PAAR-repeat proteins sharpen and diversify the type VI secretion system spike. Nature. 2013; 500(7462):350–3. Epub 2013/08/09. https://doi.org/10.1038/nature12453 PMID: 23925114; PubMed Central PMCID: PMC3792578. 27. Jackson AP, Thomas GH, Parkhill J, Thomson NR. Evolutionary diversification of an ancient gene fam- ily (rhs) through C-terminal displacement. BMC genomics. 2009; 10:584. Epub 2009/12/09. https://doi. org/10.1186/1471-2164-10-584 PubMed Central PMCID: PMC2935791. PMID: 19968874 28. Busby JN, Panjikar S, Landsberg MJ, Hurst MR, Lott JS. The BC component of ABC toxins is an RHS- repeat-containing protein encapsulation device. Nature. 2013; 501(7468):547–50. Epub 2013/08/06. https://doi.org/10.1038/nature12465 PMID: 23913273. 29. Aoki SK, Pamma R, Hernday AD, Bickham JE, Braaten BA, Low DA. Contact-dependent inhibition of growth in Escherichia coli. Science. 2005; 309(5738):1245–8. Epub 2005/08/20. https://doi.org/10. 1126/science.1115109 PMID: 16109881. 30. Aoki SK, Diner EJ, de Roodenbeke CT, Burgess BR, Poole SJ, Braaten BA, et al. A widespread family of polymorphic contact-dependent toxin delivery systems in bacteria. Nature. 2010; 468(7322):439–42. Epub 2010/11/19. https://doi.org/10.1038/nature09490 PMID: 21085179; PubMed Central PMCID: PMC3058911. 31. Ting SY, Bosch DE, Mangiameli SM, Radey MC, Huang S, Park YJ, et al. Bifunctional Immunity Pro- teins Protect Bacteria against FtsZ-Targeting ADP-Ribosylating Toxins. Cell. 2018. Epub 2018/10/23. https://doi.org/10.1016/j.cell.2018.09.037 PMID: 30343895. 32. Sana TG, Flaugnatti N, Lugo KA, Lam LH, Jacobson A, Baylot V, et al. Salmonella Typhimurium utilizes a T6SS-mediated antibacterial weapon to establish in the host gut. Proc Natl Acad Sci U S A. 2016; 113 (34):E5044–51. Epub 2016/08/10. https://doi.org/10.1073/pnas.1608858113 PMID: 27503894; PubMed Central PMCID: PMC5003274. 33. Mulder DT, Cooper CA, Coombes BK. Type VI secretion system-associated gene clusters contribute to pathogenesis of Salmonella enterica serovar Typhimurium. Infection and immunity. 2012; 80(6):1996– 2007. Epub 2012/04/12. https://doi.org/10.1128/IAI.06205-11 PMID: 22493086; PubMed Central PMCID: PMC3370595. 34. Koskiniemi S, Garza-Sanchez F, Sandegren L, Webb JS, Braaten BA, Poole SJ, et al. Selection of Orphan Rhs Toxin Expression in Evolved Salmonella enterica Serovar Typhimurium. PLoS Genet. 2014; 10(3):e1004255. Epub 2014/03/29. https://doi.org/10.1371/journal.pgen.1004255 PMID: PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 20 / 22 RHS-elements function as TA-systems that regulate Salmonella growth 35. Kung VL, Khare S, Stehlik C, Bacon EM, Hughes AJ, Hauser AR. An rhs gene of Pseudomonas aerugi- nosa encodes a virulence protein that activates the inflammasome. Proceedings of the National Acad- emy of Sciences of the United States of America. 2012; 109(4):1275–80. Epub 2012/01/11. https://doi. org/10.1073/pnas.1109285109 PMID: 22232685; PubMed Central PMCID: PMC3268321. 36. Chaudhuri RR, Morgan E, Peters SE, Pleasance SJ, Hudson DL, Davies HM, et al. Comprehensive assignment of roles for Salmonella typhimurium genes in intestinal colonization of food-producing ani- mals. PLoS genetics. 2013; 9(4):e1003456. Epub 2013/05/03. https://doi.org/10.1371/journal.pgen. 1003456 PMID: 23637626; PubMed Central PMCID: PMC3630085. 37. Kroger C, Colgan A, Srikumar S, Handler K, Sivasankaran SK, Hammarlof DL, et al. An infection-rele- vant transcriptomic compendium for Salmonella enterica Serovar Typhimurium. Cell Host Microbe. 2013; 14(6):683–95. Epub 2013/12/18. https://doi.org/10.1016/j.chom.2013.11.010 PMID: 24331466. 38. Morse RP, Nikolakakis KC, Willett JL, Gerrick E, Low DA, Hayes CS, et al. Structural basis of toxicity and immunity in contact-dependent growth inhibition (CDI) systems. Proceedings of the National Acad- emy of Sciences of the United States of America. 2012; 109(52):21480–5. Epub 2012/12/14. https://doi. org/10.1073/pnas.1216238110 PMID: 23236156; PubMed Central PMCID: PMC3535622. 39. Helaine S, Thompson JA, Watson KG, Liu M, Boyle C, Holden DW. Dynamics of intracellular bacterial replication at the single cell level. Proc Natl Acad Sci U S A. 2010; 107(8):3746–51. Epub 2010/02/06. https://doi.org/10.1073/pnas.1000041107 PMID: 20133586; PubMed Central PMCID: PMC2840444. 40. Harms A, Brodersen DE, Mitarai N, Gerdes K. Toxins, Targets, and Triggers: An Overview of Toxin- Antitoxin Biology. Mol Cell. 2018; 70(5):768–84. Epub 2018/02/06. https://doi.org/10.1016/j.molcel. 2018.01.003 PMID: 29398446. 41. Ghosh A, Baltekin O, Waneskog M, Elkhalifa D, Hammarlof DL, Elf J, et al. Contact-dependent growth inhibition induces high levels of antibiotic-tolerant persister cells in clonal bacterial populations. EMBO J. 2018. Epub 2018/03/25. https://doi.org/10.15252/embj.201798026 PMID: 29572241. 42. Takaya A, Tomoyasu T, Tokumitsu A, Morioka M, Yamamoto T. The ATP-dependent lon protease of Salmonella enterica serovar Typhimurium regulates invasion and expression of genes carried on Sal- monella pathogenicity island 1. J Bacteriol. 2002; 184(1):224–32. Epub 2001/12/14. https://doi.org/10. 1128/JB.184.1.224-232.2002 PMID: 11741864; PubMed Central PMCID: PMC134781. 43. Lovett ST, Hurley RL, Sutera VA Jr., Aubuchon RH, Lebedeva MA. Crossing over between regions of limited homology in Escherichia coli. RecA-dependent and RecA-independent pathways. Genetics. 2002; 160(3):851–9. Epub 2002/03/20. PMID: 11901106; PubMed Central PMCID: PMC1462031. 44. Petersen L, Bollback JP, Dimmic M, Hubisz M, Nielsen R. Genes under positive selection in Escherichia coli. Genome research. 2007; 17(9):1336–43. Epub 2007/08/07. https://doi.org/10.1101/gr.6254707 PMID: 17675366; PubMed Central PMCID: PMC1950902. 45. Werren JH. Selfish genetic elements, genetic conflict, and evolutionary innovation. Proc Natl Acad Sci U S A. 2011; 108 Suppl 2:10863–70. Epub 2011/06/22. https://doi.org/10.1073/pnas.1102343108 PMID: 21690392; PubMed Central PMCID: PMC3131821. 46. Brunet YR, Khodr A, Logger L, Aussel L, Mignot T, Rimsky S, et al. H-NS Silencing of the Salmonella Pathogenicity Island 6-Encoded Type VI Secretion System Limits Salmonella enterica Serovar Typhi- murium Interbacterial Killing. Infect Immun. 2015; 83(7):2738–50. Epub 2015/04/29. https://doi.org/10. 1128/IAI.00198-15 PMID: 25916986; PubMed Central PMCID: PMC4468533. 47. Vazquez-Torres A, Jones-Carson J, Baumler AJ, Falkow S, Valdivia R, Brown W, et al. Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature. 1999; 401(6755):804–8. Epub 1999/11/05. https://doi.org/10.1038/44593 PMID: 10548107. 48. Virtanen P, Waneskog M, Koskiniemi S. Class II contact-dependent growth inhibition (CDI) systems allow for broad-range cross-species toxin delivery within the Enterobacteriaceae family. Mol Microbiol. 2019. Epub 2019/02/03. https://doi.org/10.1111/mmi.14214 PMID: 30710431. 49. Ma J, Sun M, Dong W, Pan Z, Lu C, Yao H. PAAR-Rhs proteins harbor various C-terminal toxins to diversify the antibacterial pathways of type VI secretion systems. Environ Microbiol. 2017; 19(1):345– 60. Epub 2016/11/22. https://doi.org/10.1111/1462-2920.13621 PMID: 27871130. 50. Kuroda A. A polyphosphate-lon protease complex in the adaptation of Escherichia coli to amino acid starvation. Biosci Biotechnol Biochem. 2006; 70(2):325–31. Epub 2006/02/24. https://doi.org/10.1271/ bbb.70.325 PMID: 16495646. 51. Nomura K, Kato J, Takiguchi N, Ohtake H, Kuroda A. Effects of inorganic polyphosphate on the proteo- lytic and DNA-binding activities of Lon in Escherichia coli. J Biol Chem. 2004; 279(33):34406–10. Epub 2004/06/10. https://doi.org/10.1074/jbc.M404725200 PMID: 15187082. 52. Takaya A, Suzuki M, Matsui H, Tomoyasu T, Sashinami H, Nakane A, et al. Lon, a stress-induced ATP- dependent protease, is critically important for systemic Salmonella enterica serovar typhimurium infec- tion of mice. Infect Immun. 2003; 71(2):690–6. Epub 2003/01/24. https://doi.org/10.1128/IAI.71.2.690- 696.2003 PMID: 12540547; PubMed Central PMCID: PMC145356. PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 21 / 22 RHS-elements function as TA-systems that regulate Salmonella growth 53. Zhang D, de Souza RF, Anantharaman V, Iyer LM, Aravind L. Polymorphic toxin systems: Comprehen- sive characterization of trafficking modes, processing, mechanisms of action, immunity and ecology using comparative genomics. Biology direct. 2012; 7:18. Epub 2012/06/27. https://doi.org/10.1186/ 1745-6150-7-18 PMID: 22731697; PubMed Central PMCID: PMC3482391. 54. Poole SJ, Diner EJ, Aoki SK, Braaten BA, t’Kint de Roodenbeke C, Low DA, et al. Identification of func- tional toxin/immunity genes linked to contact-dependent growth inhibition (CDI) and rearrangement hot- spot (Rhs) systems. PLoS genetics. 2011; 7(8):e1002217. Epub 2011/08/11. https://doi.org/10.1371/ journal.pgen.1002217 PMID: 21829394; PubMed Central PMCID: PMC3150448. 55. Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America. 2000; 97(12):6640–5. Epub 2000/06/01. https://doi.org/10.1073/pnas.120163297 PMID: 10829079; PubMed Central PMCID: PMC18686. 56. B B. Curing bacterial cells of lysogenic viruses by using UCB indicator plates. BioTechniques. 1984; 2:234–40. 57. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25(4):402–8. Epub 2002/02/16. https://doi.org/10. 1006/meth.2001.1262 PMID: 11846609. 58. Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in per- formance and usability. Mol Biol Evol. 2013; 30(4):772–80. Epub 2013/01/19. https://doi.org/10.1093/ molbev/mst010 PMID: 23329690; PubMed Central PMCID: PMC3603318. PLOS Genetics | https://doi.org/10.1371/journal.pgen.1008607 February 13, 2020 22 / 22
PLoS Genetics – Public Library of Science (PLoS) Journal
Published: Feb 13, 2020
You can share this free article with as many people as you like with the url below! We hope you enjoy this feature!
Read and print from thousands of top scholarly journals.
Already have an account? Log in
Bookmark this article. You can see your Bookmarks on your DeepDyve Library.
To save an article, log in first, or sign up for a DeepDyve account if you don’t already have one.
Copy and paste the desired citation format or use the link below to download a file formatted for EndNote
Access the full text.
Sign up today, get DeepDyve free for 14 days.
All DeepDyve websites use cookies to improve your online experience. They were placed on your computer when you launched this website. You can change your cookie settings through your browser.