JAMA Ophthalmology

Li, Qian J.; Ashraf, M. Farooq; Shen, DeFen; Green, W. Richard; Stark, Walter J.; Chan, Chi-Chao; O'Brien, Terrence P.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1597pmid: 11709009

ObjectiveTo investigate the potential role of apoptosis in the pathogenesis of Fuchs endothelial dystrophy of the cornea.MethodsTwenty-one corneal buttons from patients with Fuchs dystrophy and 15 control corneas were studied. Apoptosis was assessed by the in situ end-labeling of double-stranded DNA breaks, and by immunohistochemical characterization of cellular markers associated with apoptosis (Fas, FasL, Bcl-2, and Bax). Expression of Bcl-2 and Bax mRNA in the corneal stroma and endothelium was separately analyzed by a semiquantitative reverse transcriptase polymerase chain reaction. Furthermore, cultivated keratocytes generated from diseased corneal buttons and donor rims were exposed to camptothecin, an apoptotic inducer, for 6 and 24 hours. They were then examined for protein and messenger RNA (mRNA) expression of apoptotic regulatory molecules.ResultsDNA fragmentation was seen in the epithelium, stroma, and endothelium in 6 of 7 corneas with Fuchs dystrophy. A statistically significant difference was identified in the expression of Bax and its mRNA in the stroma, but not in the endothelium of Fuchs dystrophy corneas. Following exposure to camptothecin, keratocytes from patients with Fuchs dystrophy responded with an increased level of Bax and a low level of Bcl-2. This trend was distinctively different from the response of normal keratocytes.ConclusionsThe evidence in this study points to a disease-related disturbance in the regulation of apoptosis in Fuchs dystrophy. Our findings suggest that excessive apoptosis may be an important mechanism in the pathogenesis of Fuchs dystrophy.IN THE United States, Fuchs endothelial dystrophy of the cornea (Fuchs dystrophy) is a significant cause of progressive corneal edema and loss of vision in elderly persons. Although statistics regarding its incidence are not available, this disease accounts for 10% to 30% of all penetrating keratoplasties.Fuchs dystrophy is a bilateral primary disease of the cornea that is characterized by a pleomorphic, attenuated corneal endothelium with an irregularly thickened Descemet membrane and central corneal guttatae.The diseased cornea will eventually develop epithelial and stromal edema, causing progressively decreased vision and pain. Pedigree studies have shown that the guttatae are inherited as an autosomal dominant trait.Population studies have found such guttatae in approximately 10% of 976 eyes in patients older than 60 years, in 3.3% of those from 20 to 40 years of age,and in 18% of corneal donors older than 50 years.A variety of theories have been proposed regarding the etiology of endothelial damage in Fuchs dystrophy. The abnormality in the endothelium may be associated with defects in the final differentiation of endothelial cells during the perinatal period.It may also be linked to hormonal changes during aging,aberrant fibrinogen metabolism,altered mitochondrial ionic metabolism,inflammation,and chromosome changes in keratocytes; however, no significant differences have been found in the endothelial permeability or the aqueous components and flow rate between healthy patients and those with Fuchs dystrophy.Thus, the mechanism of the progressive dysfunction of the corneal endothelium remains a mystery.Apoptosis is an active and well-defined process of cell death characterized by cell shrinkage, chromatin condensation, and DNA fragmentation.It occurs with minimal damage to the surrounding cells during development, homeostasis, and wound healing.Several serious disease processes have been associated with excessive apoptosis, such as neurodegeneration, aging, and autoimmune disorders.Apoptosis is a recognized mechanism of cell death in several ocular neurodegenerative diseases, such as retinitis pigmentosa and glaucoma.Since the endothelium and the posterior third of the cornea are derived from neuroectoderm,and since Fuchs dystrophy tends to occur in the elderly, we have reasoned that the pathogenesis of Fuchs dystrophy may well be similar to that of neurodegeneration and aging.There are at least 2 pathways that trigger cell death in mammals: (1) death receptors such as CD95/CD95L (Fas/FasL)and (2) the Bcl-2 protein family.The engagement of membrane protein Fas with its ligand (FasL) induces apoptotic cell death. In general, the Fas and Fas-associated death domain proteins participate in the killing of targets such as virus-infected cells, cancer cells, and inflammatory cells at immune-privileged sites.Numerous studies have indicated a role for the death receptor family in autoimmune disorders such as Hashimoto thyroiditis and posterior uveitis.Fas has also been implicated in Alzheimer diseaseand aging.The Bcl-2 family of proteins responds to signals from diverse cytotoxic stimuli, including cytokine deprivation and DNA damage.These proteins are important signaling molecules in the maintenance of tissue homeostasis and in the protection against pathogens. The mutation or dysregulation of the Bcl-2 family members may lead to excessive apoptosis or cancer. In a typical cell, proapoptotic and antiapoptotic family members (such as Bax and Bcl-2, respectively) seem to be in equilibrium. This equilibrium favors an equal concentration between Bax and one of its antagonists, such as Bcl-2.Any alteration in this balance may lead to the activation of cell death via an increase in Bax.In this study, we evaluated the occurrence of programmed cell death in corneas with Fuchs dystrophy or other corneal disorders, and in normal eye bank corneas. We examined the expression of the apoptotic regulatory molecules Fas, FasL, Bcl-2, and Bax in corneas with Fuchs dystrophy and in age-comparable normal eye-bank corneas. We also examined the messenger RNA (mRNA) expression of Bcl-2 and Bax in the corneal endothelium and stroma, respectively. To further investigate the regulation of apoptosis in Fuchs dystrophy, we cultured keratocytes derived from Fuchs dystrophy corneas and corneal donor rims. We then cocultured these keratocytes with camptothecin, a DNA synthesis inhibitor known to induce apoptosis in vitro.We evaluated the expression of apoptotic regulatory molecules in these keratocytes.MATERIALS AND METHODSCOLLECTION OF CORNEASThis research has followed the tenets of the Declaration of Helsinki and has been approved by the Institutional Joint Committee on Clinical Investigation at the Johns Hopkins University (Baltimore, MD). Corneal buttons from patients with Fuchs dystrophy (n = 21: 9 for immunostaining, 9 for mRNA study, and 3 for culture) were collected from patients who had undergone keratoplasty at the Wilmer Eye Institute, Baltimore. The average age of patients was 70.7 years and ranged from 56 to 88 years. The corneas were bisected with a razor blade; half of each cornea was used for experimental procedures, and the other half was used for routine histological examination. Three corneal buttons from patients with peudophakic bullous keratopathy, bacterial keratitis, and graft rejection were also used in the in situ end-labeling assay as controls.Normal control corneas (n = 12: 4 for immunostaining, 5 for mRNA study, and 3 donor rims for culture of keratocytes) were collected from the Maryland Eye Bank (Baltimore). The average age of donors was 55.8 years, and ranged from 46 to 66 years. The corneal buttons used in this study were graded to be in "good" or "very good" condition. The average death-to-preservation time of these buttons was 10.7 hours, and the average storage time in organ culture medium (Optisol; Bausch & Lomb, Rochester, NY) at 40°C was 5 days. Owing to practical difficulties, we did not use fresh corneas for normal controls. Apoptotic changes may occur in corneas during the storage period as shown in a previous study.Therefore, the baseline levels obtained from our control corneas may actually be higher than those of fresh normal corneas.HISTOLOGICAL ANALYSISThe corneas used for histological diagnosis were immediately fixed in 10% formaldehyde for at least 24 hours before processing. The eyes were then embedded in paraffin, serially sectioned, and stained with hematoxylin and eosin. Pathological diagnosis of the corneal buttons was made in the W. R. Green Eye Pathology Laboratory of the Wilmer Eye Institute.IN SITU END-LABELING ASSAYDetection of double-stranded DNA breaks (DNA fragmentation) in apoptotic cells was accomplished with the TACS Blue Label Detection kit (Trevigen, Gaithersburg, Md) according to the manufacturer's protocol, with modified tissue pretreatment to improve corneal stromal accessibility to the labeling reagent. Corneal sections with a thickness of 8 µm on superfrost slides (Fisher Scientific, Pittsburgh, Pa) were deparaffinized, dehydrated, and rehydrated. Slides were immersed in citrate buffer (0.01M; pH, 3.0), and boiled in a microwave for 5 minutes. After cooling them to room temperature, the slides were incubated for 10 minutes with 20 µg/mL of proteinase K and in situ labeled with dNTP mix (from the TACS Blue Label Detection kit) and terminal deoxynucleotidyl transferase in the presence of magnesium chloride at 37°C. The reaction was terminated with stop buffer. Streptavidin-horseradish peroxidase conjugate was then added to the tissue. The positive signal was visualized by TACS Blue Label, and the slides were counterstained with red counterstain C. The positive signal indicating DNA fragmentation could be recognized as a blue stain in a pink tissue background. To eliminate false-positive or false-negative results, staining was repeated, and both normal and diseased corneas were included in each experiment.KERATOCYTE CULTURECultivated keratocytes were generated from fresh corneal buttons and corneal donor rims according to a modified version of a previous protocol.Briefly, the epithelium and endothelium were dissected from the corneal stroma under a dissecting microscope. The stroma was cut into 2 × 2-mm slices, immersed in Eagle minimum essential medium (MEM) containing 2 mg/mL of collagenase (Life Science Inc, Gaithersburg, Md) and 0.5 µg/mL of hyaluronidase (Sigma Science Corp, St Louis, Mo), and incubated for 4 hours at 37°C in 5% carbon dioxide. Cells were washed once with 1% Penicillin-Streptomycin MEM containing 0.025% ethylenediamine–tetra-acetic acid. Cells were resuspended in 10% fetal bovine serum MEM and maintained at 37°C in 5% carbon dioxide. We used short-term keratocyte cultures (fewer than 4 subcultures) anticipating that the cells may maintain most of their original in vivo genetic characters.KERATOCYTE RESPONSE TO CAMPTOTHECINCamptothecin (Sigma Science Corp) was dissolved in dimethyl sulphoxide to make a stock solution (1mM). It was then added to serum-free culture medium (Opti-MEM I; Life Science Inc) at a final concentration of 2µM and 6µM. Keratocytes from normal corneas and and those with Fuchs dystrophy were incubated with camptothecin for 6 and 24 hours, respectively, at 37°C in 5% carbon dioxide. They were then evaluated by immunohistochemistry and reverse transcriptase polymerase chain reaction (RT-PCR) for the expression of apoptotic regulatory proteins and mRNA.IMMUNOHISTOCHEMISTRYThe expression of Fas, FasL, Bcl-2, and Bax in corneal buttons and keratocytes was evaluated by determining immunohistochemistry. Immunohistochemical staining was performed using an avidin-biotin-peroxidase complex (Vector Laboratories, Burlingame, Calif) technique.Primary antibodies consisted of polyclonal rabbit antibodies recognizing epitopes of Fas and FasL (clones M-20 and V-20, respectively; Santa Cruz Biotech, Santa Cruz, Calif), Bcl-2, and Bax (Pharmingen, San Diego, Calif); and nonspecific rabbit IgG (2 µg/mL). The primary antibodies were applied to corneal sections or keratocytes and incubated at room temperature for 1 hour. Biotin-labeled goat anti–rabbit immunoglobulin G (Vector Laboratories) was used as the secondary antibody. After incubation with the avidin-biotin-peroxidase complex (Vector Laboratories), slides were developed in 3,3′-diaminobenzidine and counterstained with 1% methyl green in methanol. Positively stained cells were then identified and graded arbitrarily according to the extent and intensity of the staining in the entire section. Cultivated keratocytes were counted in 3 representative ×40 fields or more than 200 cells, and the percentage of positive cells of total number of cells examined was recorded.TOTAL RNA EXTRACTION AND SEMIQUANTITATIVE RT-PCRCorneal endothelium with Descemet membrane was carefully separated from the stroma under a dissecting microscope, and the stromal tissue was then further cut into smaller pieces to maximize the yield of total RNA. Tissues were immediately immersed in 1 mL of RNA-STAT-60 (TEL-TEST Inc, Friendswood, Tex), and total RNA was extracted from corneal samples and/or pelleted keratocyte cultures according to the manufacturer's instructions. The RNA extracts were treated with RQ1 RNase-free DNase (Promega Corp, Madison, Wis) and quantified using a spectrophotometer. The same amount of total RNA from each sample was used for reverse transcription. First-strand complementary DNA (cDNA) synthesis was accomplished with the Superscript II RNase H-Reverse Transcriptase System (Life Technologies, Grand Island, NY) and the random primer (Promega, Madison, Wis).A 347–base pair (bp) or 255-bp fragment in the coding region of Bcl-2 and Bax cDNA was amplified using AmpliTaq Gold DNA polymerase (Perkin Elmer, Foster City, Calif). A total of 0.5 mg of cDNA was added to 4 nmol of each dNTP, 1.5 or 3.0 nmol of MgCl2, 3 pmol of phosphate 32–labeled forward primer, 3 pmol of reverse primer, 1 µL of GeneAmp, 10 × PCR buffer, and 0.5 U of AmpliTaq Gold polymerase (Perkin-Elmer Corp, Hayward, Calif). Water was added to adjust the total volume to 10 µL. The reaction mixture was then incubated in a Hybraid PCR Express thermocycler (Middlesex, England). Amplification involved denaturation at 94°C for 9 minutes, followed by 40 cycles of denaturation at 94°C for 45 seconds, primer annealing at 54°C for 45 seconds, and chain elongation at 72°C for 1 minute. The final step was a 7-minute incubation at 72°C. An aliquot of each reaction mixture was then analyzed by electrophoresis on a 16% polyacrylamide gel, followed by ethidium bromide staining and autoradiography. Observation of a band of the predicted size on gel electrophoresis indicated the presence of mRNA in the original corneal sample. The negative control consisted of the omission of the RNA template or reverse transcriptase from the cDNA synthesis reaction for each sample. Intensity of each band was measured using the NIH image analysis system (National Institutes of Health, Bethesda, Md) and was recorded in digital form.To verify that equal amounts of total RNA were added in each PCR reaction within an experiment and to assure a uniform amplification process, beta-actin mRNA was also transcribed and amplified for each sample. Sequences of the specific primers used for the current study were Bcl-2 forward, 5′ CTAATTGCTGGCTGGCTGCCTTT 3′; Bcl-2 reverse, 5′TTAACTCTGACCCTGGCCAGTGT3′; Bax forward, 5′AACGTCCTGCCTGGA -AGCATGCT 3′; and Bax reverse, 5′TCACGTGACCGCACCTGCCTCG 3′.STATISTICAL ANALYSISStatistical analysis was conducted under the supervision of a statistician in the Division of Clinical Trials and Biometry at the Wilmer Eye Institute. Immunohistochemical analyses were evaluated by Fisher exact test. The ttest was used to analyze digital densitometry data. A Pvalue less than or equal to .01 was chosen as the limit of statistical significance.RESULTSHISTOPATHOLOGICAL ANALYSISAll of the diseased corneas included in this study displayed the classical pathological changes of Fuchs dystrophy. These corneal buttons were marked by epithelial and stromal edema, thickened Descemet membranes with posterior nodularity, and an attenuated endothelium. The control corneal tissue from eye-bank eyes displayed normal morphology.APOPTOSIS IN THE CORNEAThe evidence of apoptosis in corneas with Fuchs dystrophy and in normal corneas was assessed by in situ DNA fragmentation (in situ end labeling). In corneas with Fuchs dystrophy, DNA fragmentation was seen in the epithelium and stroma in 5 of 7 samples, and in the endothelial cells in 6 of 7 samples. Figure 1is a representative photomicrograph showing the staining in a diseased cornea (Figure 1, A and C) and in controls (Figure 1, B and D). Excessive apoptosis could be seen in the epithelium, and the staining could also be identified in the stromal and endothelial cells of the diseased cornea. In contrast, under the same staining condition, little or no positive staining was observed in the epithelium, stroma, or endothelium of the 4 control corneas. We examined 3 additional corneal buttons from patients with peudophakic bullous keratopathy, bacterial keratitis, and graft rejection. Positive staining was observed in epithelial cells and in inflammatory cells infiltrating the stroma. The staining was not present in the keratocytes or endothelial cells of these corneas.Figure 1.A representative photomicrograph of apoptosis in corneas of patients with Fuchs dystrophy (A and C) and controls (B and D). In situ end labeling (ISEL) revealed double-stranded DNA breaks (arrows point to positive stains) in the epithelium (A), stroma, and endothelium (C) of a Fuchs dystrophy cornea. In a normal cornea, the positive stains were noted in the limbus (B, arrows) but not the stroma or endothelium (D). Note that the staining of slides for all panels was generated from the same staining experiment (ISEL, original magnification ×400).EXPRESSION OF APOPTOTIC MOLECULES IN THE CORNEATo assess the role of apoptotic regulatory molecules in Fuchs dystrophy corneas, we examined the expression of Fas, FasL, Bcl-2, and Bax by immunohistochemistry. Both the intensity of the staining and the percentage of positively stained corneas were evaluated for each cellular marker and compared between Fuchs dystrophy and control eye-bank corneas. In Fuchs dystrophy corneas, intense Fas, FasL, and Bax staining was seen in the epithelium, endothelium, and stroma (often adjacent to Descemet membrane). Faint staining of Bcl-2 was seen occasionally in the epithelium and endothelium of these corneas. In contrast, only mild staining of Fas and/or FasL was seen in normal corneal epithelia and endothelia. Bcl-2 and Bax were mostly undetectable in normal corneas. Generally, the staining was found in the cytoplasm of corneal epithelial cells; however, the precise cellular location of the staining was somewhat difficult to determine because of the flattened morphology of endothelial cells and the compression of keratocytes by collagenous lamellae (Figure 2).Figure 2.Representative immunohistochemical staining in the epithelium, stroma, and endothelium of Fuchs dystrophy (A, C, and E) and control (B, D, and F) corneas. Intense Bax staining was seen in the epithelium (A, original magnification ×1000) and stroma (C, arrows, original magnification ×400) of a Fuchs dystrophy cornea, but not in the normal control cornea (D, original magnification ×1000). FasL was seen in areas of deep stroma adjacent to Descemet membrane and in endothelial cells (E, original magnification ×1000). Mild staining of Fas was seen in epithelial (B, original magnification ×1000) and endothelial cells (F, original magnification ×1000) of a control cornea.Figure 3summarizes the overall results of the immunohistochemical analysis. A statistical difference between Fuchs dystrophy and control corneas was present only in the group of stromal Bax expression (P= .007). A noticeable difference was also present in FasL stromal expression (P= .02); however, when evaluated by the intensity of the staining, a statistical difference was shown in groups of stromal FasL expression (P= .001), epithelial Bcl-2 expression (P= .01), epithelial Bax expression (P= .004), and stromal Bax expression (P<.001).Figure 3.Immunohistochemical analysis of the expression of apoptotic molecules in corneas with Fuchs dystrophy (n = 9) and control corneas (n = 4). Expression was measured by the number of positively stained corneas/total number of corneas examined. This ratio was recorded as a percentage (y-axis) for each specific corneal layer (x-axis). The asterisk indicates a statistically significant difference (P<.01). A, Fas expression in the cornea. B, FasL expression in the cornea. C, Bcl-2 expression in the cornea. D, Bax expression in the cornea.EXPRESSION OF Bcl-2 AND Bax mRNA IN THE CORNEASince immunohistochemical analysis indicated a significant difference in stromal Bax expression in Fuchs dystrophy corneas, we further compared the mRNA levels of Bcl-2 and Bax in normal and diseased corneas (Figure 4). Figure 4A is a representative polyacrylamide gel electrophoresis of DNA samples from RT-PCR of mRNA isolated from the stromal and endothelial layers of normal and Fuchs dystrophy corneas. The intensity of DNA bands, particularly bands with weak signals, is somewhat difficult to identify in the reproduction of the original autoradiographic image; therefore, they are reflected in Figure 4B using densitometric meaurement of these bands. Scatter graphs were made according to the densitometry measurements of DNA bands for all of the samples examined. Statistically significant differences were identified in stromal levels of Bcl-2 (P= .006) and Bax (P= .008) between Fuchs dystrophy (n = 9) and control corneas (n = 5).Figure 4.A, A representative polyacrylamide gel electrophoresis of DNA samples from reverse transcriptase polymerase chain reaction of messenger RNA (mRNA) isolated from the stromal and endothelial (Endo) layers of normal and Fuchs dystrophy corneas. Lanes 1, 3, 5, 7, and 9: samples from endothelium of Fuchs dystrophy patients 1 through 5. Lanes 2, 4, 6, and 8: samples from corneal stroma of Fuchs dystrophy patients 1 through 4. Lane 10: samples from normal corneal stroma (n = 2). Lanes 11 and 12: samples from normal corneal endothelium (n = 3). Lane 13: negative control, the omission of RNA template from the complementary DNA (cDNA) synthesis reaction. B, Summary of the gel electrophoresis findings (A). Scatter graphs were made according to the densitometry measurements of DNA bands for all of the samples examined. Note that the scales are different for each of the 4 graphs because of the markedly different signal intensity. Statistically significant differences were identified in stromal levels of Bcl-2 (P= .006) and Bax (P= .008) between Fuchs dystrophy (n = 9) and control groups (n = 5). X-axis numbers indicate lanes 1 to 3. bp indicates base pair.In the endothelium, the level of Bcl-2 and Bax mRNA expression was not appreciably different between normal and diseased corneas; however, significantly higher levels of Bcl-2 mRNA (P= .006) and Bax mRNA (P= .008) were identified in the stroma of diseased corneas when compared with those of normal controls.KERATOCYTE RESPONSES TO CAMPTOTHECINAs an antiapoptotic member of the Bcl-2 family, the cellular levels of Bcl-2 may increase when cells are exposed to cytotoxic stimuli; however, the elevated Bax mRNA and protein levels that we observed in the corneas with Fuchs dystrophy could occur at the late stage of DNA damage, or it could be the trigger that initiates apoptosis. To further delineate the role of the apoptotic regulatory molecules in Fuchs dystrophy, we used an in vitro approach. We stimulated cultivated keratocytes with camptothecin, an apoptotic inducer, and assessed protein and mRNA levels of apoptotic regulators.The protein expression of Fas, FasL, Bcl-2, and Bax was up-regulated after stimulation of both normal and diseased keratocytes with 6 mm of camptothecin; however, no statistical difference in protein expression could be identified to distinguish the 2 groups. Expression of Bcl-2 and Bax mRNA in these keratocytes, on the contrary, clearly showed a disease-specific trend (Figure 5). In normal keratocytes, cellular Bcl-2 and Bax mRNA increased proportionately after camptothecin stimulation, with levels of Bcl-2 exceeding levels of Bax. In keratocytes with Fuchs dystrophy, there was no Bcl-2 response with low-dose camptothecin and a low-magnitute Bcl-2 response with high-dose camptothecin, which was contrary to the highly elevated levels of Bax mRNA. The response patterns in both groups were consistent at 6 and 24 hours after camptothecin exposure. Although the changes in mRNA levels only indirectly reflect the possible changes in protein level, given the sensitivity and quantitative nature of RT-PCR and the overall up-regulation of protein levels in these cells, the alteration in mRNA levels should be a trustworthy reference to changes in protein levels.Figure 5.Camptothecin-induced Bcl-2 and Bax messenger RNA (mRNA) expression in keratocytes. A, A representative polyacrylamide gel electrophoresis of DNA samples from reverse transcriptase polymerase chain reaction (RT-PCR) products (24 hours after camptothecin [Camp] stimulation). Lanes 1, 2, 3: samples from normal keratocytes; lanes 4, 5, 6: samples from Fuchs dystrophy keratocytes. Lanes 1 and 3: unstimulated cells; lanes 2 and 4: 2µM Camp treatment; lane 3 and 6: 6µM Camp treatment. Lane 7: negative control, omission of RNA template from the complementary DNA (cDNA) synthesis reaction. B, Summary of the RT-PCR findings from samples obtained at 6 and 24 hours after Camp exposure. The y-axis represents the densitometry measurements of DNA bands. DMSO indicates dimethyl sulphoxide.COMMENTThe results of our preliminary study suggest that aberrant responses of apoptotic regulatory molecules in the cornea may play an important role in the pathogenesis of Fuchs dystrophy. Although dysfunction of the corneal endothelium has been considered to be the cause of corneal decompensation in Fuchs corneal dystrophy, stromal keratocytes may also play a crucial role in the development of the disease.As with the evaluation of cell viability, no single parameter can fully define cell death. Methods for studying cell death in tissue or individual cells include identifying cellular DNA fragmentation and analyzing apoptosis-associated proteins such as Bcl-2 homologues, caspases, and other signaling molecules.The key to the most accurate interpretation of apoptosis is the combination of multiple study methods with the careful interpretation of results. According to our study, distinctive pathological findings in the corneas with Fuchs dystrophy included DNA fragmentation in stromal and endothelial cells and an elevated expression of Bax mRNA and protein in the stroma. In addition, we noted alterations in expression of Bcl-2 and Bax mRNA following exposure to an apoptotic stimulus in keratocytes with Fuchs dystrophy.Excessive apoptosis was identified in the epithelium of the cornea. This was likely due to the epithelial and stromal edema of decompensated corneas. The evidence of apoptosis in the corneal epithelial, stromal, and endothelial layers indicated that it is part of the pathological process of Fuchs corneal dystrophy; however, whether it is a result of end-stage disease or a triggering mechanism is still unclear. Therefore, we further studied the regulatory molecule of programmed cell death.As discussed in the introduction, proapoptotic and antiapoptotic members of the family normally seemed to be in equilibrium. Thus, a lack of Bcl-2 production following camptothecin exposure would result in a relatively high level of cellular Bax and could subsequently activate the cell death process. The keratocyte responses to camptothecin in this study suggest that Bax may act as a trigger, rather than a passive by-product, for stromal apoptosis in Fuchs dystrophy. Expanding on these observations, we can speculate that various environmental stimuli to the cornea (such as hormonal changes with aging, inflammation, and other toxins) may lead to the development of Fuchs dystrophy by triggering excessive apoptosis in keratocytes.Fuchs dystrophy has been considered a primary disorder of the corneal endothelium, based on the unique and early morphological changes of the endothelium and its surroundings. We did identify apoptosis in endothelial cells of Fuchs dystrophy corneas, which was consistent with the findings of a recent electron microscopy study that documented a higher percentage of endothelial cell apoptosis in Fuchs dystrophy corneas; however, our study indicates that the most remarkable differences between normal and Fuchs dystrophy corneas were found in keratocytes. Interestingly, Calandra et alrevealed that Fuchs dystrophy corneas contained stromal collagens with altered biochemical properties, suggesting a possible abnormality in keratocytes.The spectrum of possible functions of keratocytes is growing in light of recent research.Keratocytes are highly active cells involved in the turnover of the extracellular matrix and in the maintenance of corneal transparency. They are important to the normal function of corneal endothelial cells because they provide physical support and secrete interactive growth factors. Growth factors and their receptors are expressed in the corneal epithelial cells, keratocytes, and endothelial cells.Senoo et alreported that the number of corneal endothelial cells increased 200% when cocultured with keratocytes, suggesting that keratocytes may secrete factors stimulating the proliferation of corneal endothelial cells. Therefore, when keratocytes undergo excessive apoptosis as in the case of Fuchs dystrophy, the stromal matrix turnover will deteriorate, and the function and morphology of endothelial cells may subsequently be altered. Physical support is only part of the function that the stroma has to offer to endothelial cells, stromal keratocyte–secreted cytokines may have a more important role in maintaining the well-being of endothelial cells. When keratocytes become hypersensitive to apoptotic induction, cytokine secretion of keratocytes may become insufficient to maintain normal endothelial cell function, subsequently, a prolonged degenerative process may eventually lead to the morphological and functional changes in the endothelial layer as seen in Fuchs dystrophy. The degeneration of the epithelium is the consequence of both keratocytes and endothelial cell decompensation. Although it is still unclear whether the functional changes in keratocytes precede changes in the endothelial cells, the aberrant response of Fuchs keratocytes to apoptotic stimuli leads us to consider this possibility.In conclusion, we have obtained strong preliminary evidence to indicate that a disturbance in the regulation of apoptosis may play a role in the pathogenesis of Fuchs dystrophy; however, this is only the first step in addressing many remaining questions. Are apoptotic changes found in this study unique to Fuchs dystrophy? What other genes may be involved in the aberrant expression of apoptotic regulators? How do the changes that occur in keratocytes influence the endothelial cells? Future studies are warranted to address these important questions.APAdamisVFilatovBJTripathiRTripathiFuchs' endothelial dystrophy of the cornea.Surv Ophthalmol.1993;38:149-168.WMBourneDHJohnsonRJCampbellThe ultrastructure of Descemet's membrane, III: Fuchs' dystrophy.Arch Ophthalmol.1982;100:1952-1955.MCJohnstonWMBourneRJCampbellThe ultrastructure of Descemet's membrane, I: changes with age in normal corneas.Arch Ophthalmol.1982;100:1942-1947.HECrossAEMaumeneeSJCantolinoInheritence of Fuchs' endothelial dystrophy.Arch Ophthalmol.1971;85:268-272.HEKaufmanJACapellaJERobbinsThe human corneal endothelium.Am J Ophthalmol.1966;61:835-841.TBramsenSStenbergFibrinolytic factors in aqueous humour and serum from patients with Fuchs' dystrophy and pateients with cataract.Acta Ophthalmol (Copenh).1979;57:470-476.MCKenneyULabermeierDHindsGOWaring IIICharacterization of the Descemet's membrane/posterior collagenous layer isolated from Fuchs' endothelial dystropy corneas.Exp Eye Res.1984;39:267-277.EPKayMENimniRESmithModulation of endothelial cell morphology and collagen synthesis by polymorphonuclear leukocytes.Invest Ophthalmol Vis Sci.1984;25:502-512.MJPettenatiAJSweattPLantzThe human cornea has a high incidence of acquired chromosome abnormalities.Hum Genet.1997;101:26-29.SEWilsonWMBournePCO'BrienRFBrubakerEndothelial function and aqueous humor flow rate in patients with Fuchs' dystrophy.Am J Ophthalmol.1988;106:270-278.SEWilsonWMBourneLJMaguireAqueous humor composition in Fuchs' dystrophy.Invest Ophthalmol Vis Sci.1989;30:449-453.JFRKerrAHWyllieARCurrieApoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics.Br J Cancer.1972;26:239-257.EWhiteLife, death, and the pursuit of apoptosis.Genes Dev.1996;10:1-15.LDTomeiSRUmanskyAging and apoptosis control.Neurol Clin.1998;16:735-745.CGiordanoGStassiRDeMariaPotential involvement of Fas and its legand in the pathogenesis of Hashimoto's thyroiditis.Science.1997;275:960-963.TGriffithTBrunnerSFletcherDGreenTFergusonFas ligand-induced apoptosis as a mechanism of immunoprivilege.Science.1995;270:1189-1192.C-CChanDMMattesonQLiSMWhitcupRBNussenblattApoptosis in patients with posterior uveitis.Arch Ophthalmol.1997;115:1559-1567.QLiBSunDMMattesonTPO'BrienC-CChanCytokines and apoptotic molecules in experimental melanin-induced uveitis and experimental autoimmune uveitis.Autoimmunity.1999;30:171-182.RWNickellsDJZackApoptosis in ocular disease: a molecular overview.Ophthalmic Genet.1996;17:145-165.APAdamisMLMolnarBJTripathiMSEmmersonKStefanssonRCTripathiNeuronal-specific enolase in human corneal endothelium and posterior keratocytes.Exp Eye Res.1985;41:665-668.AAshkenaziVMDixitDeath receptors: signaling and modulation.Science.1998;281:1305-1308.JMAdamsSCoryThe Bcl-2 protein family: arbiters of cell survival.Science.1998;281:1322-1326.SMMonteYKSohnJRWandsCorrelates of p53- and Fas (CD95)-mediated apoptosis in Alzheimer's disease.J Neurol Sci.1997;152:73-83.YHigamiIShimokawaMTomitaAging accelerates but life-long dietary restriction suppresses apoptosis-related Fas expression on hepatocytes.Am J Pathol.1997;151:659-663.RWNickellsApoptosis of retinal ganglion cells in glaucoma: an update of the molecular pathways involved in cell death.Surv Ophthalmol.1999;43(suppl 1):S151-S161.NJohnsonTTCNgJMParkinCamptothecin causes cell cycle perturbations within T-lymphoblastoid cells followed by dose dependent induction of apoptosis.Leuk Res.1997;21:961-972.AKomuroDOHodgeGJGoresWMBourneCell death during corneal storage at 40C.Invest Ophthalmol Vis Sci.1999;40:2827-2832.JVJesterPABarryGJLindWMPetrollRGaranaHDCavanaghCorneal keratocytes: in situ and in vitro organization of cytoskeletal contractile proteins.Invest Ophthalmol Vis Sci.1994;35:730-743.MCWillinghamCytochemical methods for the detection of apoptosis.J Histochem Cytochem.1999;47:1101-1109.VMBorderieMBaudrimontAVValleeTLEreauFGrayLLarocheCorneal endothelial cell apoptosis in patients with Fuchs' Dystrophy.Invest Ophthalmol Vis Sci.2000;41:2501-2505.ACalandraMChwaMCKenneyCharacterization of stroma from Fuchs' endothelial dystrophy corneas.Cornea.1989;8:90-97.EFiniKeratocyte and fibroblast phenotypes in the repairing cornea.Prog Retin Eye Res.1999;18:529-551.AThalmann-GoetschKEngelmannJBednarzComparative study on the effects of different growth factors on migration of bovine corenal endothelial cells during wound healing.Acta Ophthalmol Scand.1997;75:490-495.JImanishiKKamiyamaIIguchiMKitaCSotozonoSKinoshitaGrowth factors: importance in wound healing and maintenance of transparency of the cornea.Prog Retin Eye Res.2000;19:113-129.TSenooKTakahashiKChibaKHasegawaSYamaokaStimulation of corneal endothealia cell proliferation by interleukins, complete mitogens and corneal parenchymal cell-derived factors.Nippon Ganka Gakkai Zasshi.1996;100:845-852.Accepted for publication June 8, 2001.This study was supported by the Helen and Raymond Kwok (Hong Kong) Research Fund to the Wilmer Eye Institute.We thank Mr and Mrs Kwok for their generous support of the study. We also thank Michele Melia, MS, of the Division of Clinical Trials and Biometry at the Wilmer Eye Institute for her expertise in statistics and Melinda Hakim for her expert editorial assistance.This article was corrected November 14, 2001.Corresponding author and reprints: Terrence P. O'Brien, MD, Wilmer Eye Institute, The Johns Hopkins University School of Medicine, 600 N Wolfe St, Woods Bldg, Room 255, Baltimore, MD (e-mail: [email protected]).

Madreperla, Steven A.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1606pmid: 11709010

ObjectiveTo describe a new treatment for vision loss caused by subretinal fluid associated with circumscribed choroidal hemangioma.MethodsThree patients were treated with photodynamic therapy using verteporfin for injection (Visudyne; QLT Phototherapeutics Inc, Vancouver, British Columbia). All patients had pretreatment and posttreatment fluorescein angiography and ultrasonography. Treatment parameters used were verteporfin, 6 mg/m2, and laser light at 689 nm delivered at 50 J/cm2with an intensity of 600 mW/cm2for 83 seconds.ResultsAll patients had complete resolution of subretinal fluid within 2 weeks of treatment. Fluorescein angiography performed 2 to 4 weeks after treatment showed absence of tumor leakage. All eyes had reduced tumor thickness or complete flattening. Visual acuity was improved in each eye. Average follow-up was 5.3 months. No complications were noted.ConclusionPhotodynamic therapy with verteporfin is effective in eliminating subretinal fluid and improving vision in patients with circumscribed choroidal hemangioma.CIRCUMSCRIBED choroidal hemangioma is a benign, vascular hamartoma that causes visual loss by transudative leakage with resultant retinal edema and macular detachment. Treatment strategies have included penetrating diathermy,xenon photocoagulation,laser photocoagulation,microwave hyperthermia,radioactive plaque,external beam radiotherapy,and infrared diode laser thermotherapy.Limitations of treatment have included recurrent subretinal fluidand complications of treatment, such as foveal damage resulting from treatment of macular tumors,leading eventually to permanent vision loss.Photodynamic therapy (PDT) using verteporfin for injection was recently shown to be effective in treating subfoveal, classic choroidal neovascularization from age-related macular degeneration.We report the results of the treatment of 3 eyes in 3 patients with decreased visual acuity secondary to circumscribed choroidal hemangioma with a single treatment using verteporforin PDT.PATIENTS AND METHODSAll patients were referred for evaluation and treatment of vision loss with an associated choroidal mass. Studies performed at presentation included standardized A-scan and B-scan ultrasonography and fluorescein angiography. The diagnosis of circumscribed choroidal hemangioma was based on fundus examination and the results of these studies. Standard treatment alternatives were discussed with the patients. The possibility of using PDT, including the unproven benefit of such treatment, was also discussed with the patients. Patients signed a standard informed consent form. Patients received an intravenous infusion of 6 mg/m2of verteporfin (Visudyne; QLT Phototherapeutics Inc, Vancouver, British Columbia). Fifteen minutes after the start of the infusion (approximately 5 minutes after completion of infusion), laser light at 689 nm was delivered with an intensity of 600 mW/cm2for 83 seconds (50 J/cm2).Three patients were treated during a 4-month period. Follow-up ranged from 3 to 9 months. Fluorescein angiography was performed during follow-up for all patients, and B-scan ultrasonography was performed on all patients at their last follow-up visit. Visual acuity was measured before treatment and at each follow-up visit using a backlit Snellen chart with the patient's current correction if any, and a pinhole.CASE REPORTSCASE 1A 31-year-old Hispanic man had been seen elsewhere for decreased vision and macular subretinal fluid that was thought to be related to central serous chorioretinopathy. A focal laser had been applied 1 month earlier, but subretinal fluid remained. On examination, visual acuity was 20/20 OD and 20/50 OS (Table 1). Fundus examination of the left eye revealed a pink choroidal tumor centered inferotemporal to the center of the macula, with the superior edge adjacent to the fovea. B-scan ultrasonography revealed a dome-shaped choroidal tumor, and standardized A-scan ultrasonography revealed high internal reflectivity. A thin layer of subretinal fluid was present over the tumor extending into the fovea. Choroidal hemangioma was diagnosed and, after obtaining informed consent, PDT was performed. Two weeks later, visual acuity was 20/30 OS, and subretinal fluid was absent. Fluorescein angiography at 1 month revealed cessation of tumor leakage (Figure 1). Three months later, visual acuity was 20/25 OS, and B-scan ultrasonography showed flattening of the tumor.Patient CharacteristicsCase No./Age, yFollow-up, moTreatment Spot Size, mmInitial Tumor Height, mmFinal Tumor Height, mmPretreatment AcuityFinal Acuity1/3136.02.41.220/50 OS20/25 OS2/7396.52.0020/70 OD20/20 OD3/7147.42.8020/50 OD20/40 ODFigure 1.Case 1. Late-phase fluorescein angiographic images of patient with choroidal hemangioma. A, Before treatment showing leakage. B, One month after photodynamic therapy showing staining but no leakage.CASE 2A 73-year-old white man was referred for a recent decrease in vision in his right eye. Visual acuity was 20/70 OD and 20/25 OS. Fundus examination of the right eye revealed a pink peripapillary tumor inferotemporal to the optic nerve, with a thin layer of subretinal fluid through the macula (Figure 2). Ultrasonography revealed a tumor height of 2.0 mm. Choroidal hemangioma with vision loss from associated submacular fluid was diagnosed. Photodynamic therapy was performed by treating the tumor but not overlapping the optic nerve with the laser. Two weeks later subretinal fluid was absent and visual acuity was 20/25 OD. Three months after treatment, visual acuity was 20/20 OD and the tumor was completely flat (Figure 3). Nine months after treatment the macula remained dry and visual acuity was 20/20.Figure 2.Case 2. Fundus photographs of patient with peripapillary choroidal hemangioma inferonasal to disc. A, Before treatment showing a pink-orange tumor with overlying subretinal fluid. B, One month after treatment showing a flat orange lesion with surrounding pigmentary change without subretinal fluid.Figure 3.Case 2. B-scan ultrasonograms of patient with peripapillary choroidal hemangioma. A, Before treatment; tumor adjacent to optic nerve shadow. B, Three months after photodynamic therapy, tumor is completely flattened.CASE 3A 70-year-old white woman had been followed up at another institution for 9 years and had a choroidal hemangioma centered temporal to the macula, with its nasal edge adjacent to the edge of the foveal avascular zone in the right eye. At presentation 9 years ago, visual acuity was 20/25 OD and 20/20 OS. Macular pigmentary changes were noted and were thought to be related to previous tumor leakage. Visual acuity remained relatively stable for 9 years, but it had recently decreased to 20/50 OD with associated macular subretinal fluid. External beam radiation was offered, but the patient declined treatment. The patient was referred to us, and the findings included a visual acuity of 20/50 OD a circumscribed choroidal hemangioma adjacent to the fovea, mild subretinal fluid, and mild macular pigmentary changes. B-scan ultrasonography revealed a dome-shaped choroidal tumor 2.8 mm thick, and standardized A-scan ultrasonography revealed high internal reflectivity. Because the patient felt that vision had been worsening during the past several months and subretinal fluid was present, PDT was offered. One month after treatment, the macula was dry, visual acuity was 20/40 OD, and the tumor was nearly flat (Figure 4and Figure 5). Four months after treatment, visual acuity remained 20/40 OD and no tumor was detectable.Figure 4.Case 3. Fundus photographs of patient with choroidal hemangioma adjacent to fovea. A, Before treatment. B, One month after photodynamic therapy.Figure 5.Case 3. B-scan ultrasonograms of patient with choroidal hemangioma. A, Before treatment. B, Four months after photodynamic therapy, the tumor is completely flattened.COMMENTCircumscribed choroidal hemangiomas are generally composed of thin-walled vessels lined by endothelial cells without evidence of proliferation.Associated vision loss is due to leakage and accumulation of fluid in the macula. Treatments have been aimed primarily at decreasing tumor leakage, and in some cases, at tumor destruction. Intense, confluent photocoagulation probably causes some tumor destruction while decreasing tumor leakage.Others have noted complications from intense photocoagulation, and they have advocated lighter grid treatment.Lighter treatment, however, may be associated with a higher rate of subretinal fluid recurrence. Long-duration, low-fluence infrared laser therapy (termed thermotherapy[TTT]) has been used to treat choroidal hemangioma. Decreased subretinal fluid and tumor height have been reported, but visual acuity results have been disappointing.Plaque radiotherapy has been shown to eliminate subretinal fluid and decrease tumor height in a high fraction of cases of choroidal hemangioma.Plaque radiotherapy requires an operative procedure and includes the theoretical risk of radiation complications.The indication for treatment in all 3 cases described in this article was symptomatic vision loss due to the presence of macular subretinal fluid. Photodynamic therapy was considered as an alternative to standard therapies in the first patient treated (case 1) because of the known high recurrence rate with standard laser treatment and the reported risk of visual loss with treatments such as TTT as a result of the proximity of the lesion to the fovea. Plaque radiotherapy would have had a high chance of improving vision, but it would have required an operative procedure and would have carried the theoretical risk of radiation complications. Judging by the lack of complications in patients treated with PDT for age-related macular degeneration, the risk of adverse results in patients with choroidal hemangioma seemed low.All cases reported here had 1 session of PDT and showed resolution of subretinal fluid, improved vision, and decreased tumor height. It should be noted that in all of these cases, the tumors were relatively small, there was early development of subretinal fluid, and the preoperative vision was relatively good. All of these could be considered good prognostic factors for vision recovery. In a recent report, 2 patients treated with multiple PDT sessions also showed reduction in subretinal fluid and flattening of choroidal hemangiomas.The reason that multiple treatments were used in these patients is not clear. All eyes described in the present series had early resolution of subretinal fluid but slower tumor shrinkage. Therefore, it seems reasonable to wait at least 3 months before considering retreatment, Also, since the aim of treatment is resolution of subretinal fluid, retreatment may not be necessary for incompletely flattened nonfoveal tumors that stop leaking.Photodynamic therapy has been shown to eliminate subretinal fluid caused by subfoveal neovascularization. Although the nongrowing vascular channels in choroidal hemangiomas are different than those of neovascular tissue, we postulated that PDT might be able to cause atrophy of the hemangioma vessels and thereby decrease leakage and associated vision loss. The reason for the relative specificity of PDT for the hemangioma vessels with respect to normal choroidal and retinal vessels can only be postulated. Perhaps the relatively large caliber of the cavernous hemangioma vessels, and thereby the greater blood volume relative to the thinness of their vascular walls, leads to greater treatment effect from activated verteporfin.The results in the 3 patients treated so far suggest that a single session of PDT can cause substantial if not complete atrophy of circumscribed choroidal hemangioma with resultant cessation of leakage. Two of the patients had tumors adjacent to the fovea, and treatment involved the foveal avascular zone. Both patients had significant improvement in vision without apparent compromise of the normal retinal or choroidal circulation. This suggests that PDT will be particularly valuable in treatment of macular hemangiomas where standard laser treatment and TTT are associated with poor results in patient vision.The follow-up in this study is short. Recurrence of subretinal fluid after scatter laser treatment occurred 2 months to 6.5 years after treatment.Although the tumors were completely flattened in 2 of 3 cases reported here, longer follow-up will be necessary to determine whether subretinal fluid recurrence occurs.ALMacLeanAEMaumeneeHemangioma of the choroid.Am J Ophthalmol.1960;50:3-11.CLSchepensASchwartzIntraocular tumors, I: bilateral hemangioma of the choroid.Arch Ophthalmol.1958;60:72-83.GMeyer-SchickerathExperiences with light coagulation of the retina and the iris.Doc Ophthalmol.1956;10:91-131.JLSmithDJNobleLMHartHemangioma of the choroid.Arch Ophthalmol.1963;9:51-54.EWNortonFGutmanFluorescein angiography and hemangioma of the choroid.Arch Ophthalmol.1967;78:121-125.JDMGassStereoscopic Atlas of Macular Diseases: Diagnosis and Treatment.2nd ed. St Louis, Mo: CV Mosby; 1977:130-5, 393.JJAugsburgerJAShieldsKPMoffatCircumscribed choroidal hemangiomas: long-term visual prognosis.Retina.1981;1:56-61.GESanbornJJAugsburgerJAShieldsTreatment of circumscribed choroidal hemangiomas.Ophthalmology.1982;89:1374-1380.RAnandJJAugsburgerJAShieldsCircumscribed choroidal hemangiomas.Arch Ophthalmol.1989;107:1338-1342.SAMadreperlaJLHungerfordPNPlowmanChoroidal hemangiomas: visual and anatomic results of treatment by photocoagulation or radiation therapy.Ophthalmology.1997;104:1773-1778.PTFingerRWPaglioneSPackerMicrowave thermotherapy for choroidal hemangioma.Am J Ophthalmol.1991;111:240-241.WAlbertiHGreberVJohnRadiotherapy of the hemangioma of the choroid.Strahlentherapie.1983;159:160-167.LZografosCGailloudLBercherIrradiation treatment of choroidal hemangiomas.J Fr Ophtalmol.1989;12:797-807.ISOthmnaneCLShieldsJAShieldsCircumscribed choroidal hemangioma managed by transpupillary thermotherapy.Arch Ophthalmol.1999;117:136-137.ERapizziWSGrizzardACaponeTranspupillary thermotherapy in the management of circumscribed choroidal hemangioma.Am J Ophthalmol.1999;127:481-482.Treatment of Age-Related Macular Degeneration With Photodynamic Therapy (TAP) Study GroupPhotodynamic therapy of subfoveal choroidal neovascularization in age-related macular degeneration with verteporfin: one-year results of 2 randomized clinical trials—TAP report.Arch Ophthalmol.1999;117:1329-1345.JGarcia-ArumiLSRamsayBCGurayaTranspupillary thermotherapy for circumscribed choroidal hemangiomas.Ophthalmology.2000;107:351-356.HWitschelRLFontHemangioma of the choroid: a clinicopathologic study of 71 cases and a review of the literature.Surv Ophthalmol.1976;20:415-431.IBarbazettoUSchmidt-ErfurthPhotodynamic therapy of choroidal hemangioma: two case reports.Graefes Arch Clin Exp Ophthalmol.2000;238:214-221.Accepted for publication July 10, 2000.Corresponding author: Steven A. Madreperla, MD, PhD, Retina Associates of New Jersey, 628 Cedar Ln, Teaneck, NJ 07666 (e-mail: [email protected]).

Honavar, Santosh G.; Shields, Carol L.; Shields, Jerry A.; Demirci, Hakan; Naduvilath, Thomas J.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1613pmid: 11709011

ObjectivesTo analyze the results of intraocular surgery in patients treated for retinoblastoma and to assess the ocular and systemic outcomes.DesignRetrospective noncomparative case series.PatientsForty-five consecutive patients who underwent an introcular surgery after treatment for retinoblastoma.Main Outcome Measures(1) Recurrence of retinoblastoma, (2) need for enucleation, and (3) systemic metastasis. Overall outcome was defined as favorable in the absence of any of these measures and unfavorable in the presence of 1 or more.ResultsThirty-four patients (76%) underwent a single procedure of cataract surgery, a scleral buckling procedure, or pars plana vitrectomy and 11 (24%) underwent a combination of 2 or more surgical procedures. In all, 16 patients (36%) achieved final visual acuity better than 20/200. Unfavorable outcomes included recurrence of retinoblastoma in 14 patients (31%), enucleation in 16 (36%), and systemic metastasis in 3 (7%). Five patients (20%) who underwent cataract surgery, 5 (63%) who underwent a scleral buckling procedure, and 9 (75%) who underwent pars plana vitrectomy manifested an unfavorable outcome. The median interval between completion of treatment for retinoblastoma and intraocular surgery was 26 months in patients with a favorable outcome vs 6 months in those with an unfavorable outcome.ConclusionsIntraocular surgery after treatment for retinoblastoma may be justified in certain exceptional clinical situations. Cataract surgery is safe and effective in most cases. However, the need for a scleral buckling procedure and pars plana vitrectomy may be associated with a higher risk for recurrence of retinoblastoma, enucleation, and systemic metastasis, and a cautious approach is warranted.MANAGEMENT of retinoblastoma is complex and tailored to the individual patient.Primary enucleation is still the preferred treatment for advanced unilateral cases.The direction in the management of less advanced cases of retinoblastoma has now shifted toward conservative measures aimed at salvaging the eye and possibly vision. External beam radiotherapy was one of the favored modalities for management until the recent emergence of chemoreduction coupled with sequential focal treatment to the eye.Focal treatment modalities, including episcleral plaque brachytherapy, cryotherapy, laser photocoagulation, and transpupillary thermotherapy, remain important as organ-conserving treatments.Conservative treatment methods, however, can lead to various ocular complications.The major ocular complications of external beam radiotherapy and episcleral plaque brachytherapy include radiation-induced cataract and retinopathy.Radiotherapy can lead to atrophic retinal breaks and consequent rhegmatogenous retinal detachment.The main posterior segment complications of cryotherapy, laser photocoagulation, and transpupillary thermotherapy are retinal vascular obstruction, retinal traction, transient retinal detachment (ablatio fugax), retinal break, rhegmatogenous retinal detachment, and vitreous hemorrhage.Opacification of ocular media, whether from cataract, rhegmatogenous retinal detachment, or vitreous hemorrhage, complicates the management of retinoblastoma by precluding visualization of the tumor and may necessitate enucleation if there is suspicion of tumor recurrence. However, surgical intervention for cataract, rhegmatogenous retinal detachment, or vitreous hemorrhage may be justified in certain exceptional clinical situations, especially if the eye in question is the only potentially seeing eye and the tumor is judged to be clinically stable and in regression.There is limited information in the literature regarding the ideal timing and expected outcome of intraocular surgery after treatment for retinoblastoma.It is not known whether surgery in eyes harboring regressed retinoblastoma allows for a reasonable visual outcome or could be complicated by recurrence of retinoblastoma, need for enucleation, or systemic metastasis.Intraocular surgery in these eyes raises genuine concerns about the patient's systemic outcome because of the risks for viable tumor seeding.In this article, we review our experience with 45 patients with treated retinoblastoma who subsequently underwent necessary intraocular surgery for cataract, rhegmatogenous retinal detachment, or vitreous hemorrhage and address the ocular and systemic outcomes.PATIENTS AND METHODSWe reviewed the computerized diagnostic records of 900 consecutive patients with retinoblastoma treated on the Oncology Service at Wills Eye Hospital, Philadelphia, Pa, between June 1974 and January 2000. The medical charts of patients who underwent intraocular surgery after treatment for retinoblastoma were selected for detailed analysis.The collected patient data included age at initial presentation, race (black, Asian, white, or Hispanic), sex (male or female), laterality (unilateral or bilateral), and heredity (hereditary or sporadic). Initial visual acuity, Reese-Ellsworth group (Ia-Vb), tumor number, tumor type (endophytic, exophytic, mixed, or diffuse infiltrative), tumor dimensions, tumor proximity to the optic disc and foveola, the presence of vitreous or subretinal seeds, and the presence of subretinal fluid were recorded. Detailed information was collected regarding initial management (thermotherapy, photocoagulation, cryotherapy, episcleral plaque brachytherapy, external beam radiotherapy, and chemotherapy) and outcome of retinoblastoma (regression and recurrence). The regression of retinoblastoma was judged to be clinically stable by an experienced observer (C.L.S. or J.A.S.). Continued clinical regression for a minimum of 3 months was a prerequisite for considering intraocular surgery. Information regarding intraocular surgery included timing, indications, type (cataract surgery: intracapsular extraction, extracapsular extraction, pars plana/pars plicata/limbal lensectomy, intraocular lens implantation, primary posterior capsulotomy, anterior vitrectomy, or Nd:YAG laser posterior capsulotomy; scleral buckling procedure: drainage of subretinal fluid or anterior chamber paracentesis; or pars plana vitrectomy: number and location of ports), results of intraocular surgery (success, failure, and complications), and the status of the tumor before and after intraocular surgery (not visualized, regressed, or recurrent). If retinoblastoma recurred after intraocular surgery, the time and location of tumor recurrence and the modality of management of the recurrent tumor were recorded. Histopathologic features, including tumor involvement in the orbit, Tenon fascia, cataract surgical incision site, subretinal fluid drainage site, vitrectomy ports, episclera, anterior chamber, iris, vitreous, ciliary body, choroid, and optic nerve, were reviewed if the involved eye underwent enucleation, orbital exenteration, or an orbital biopsy.Surgical, visual, tumor, ocular, and systemic outcomes were noted on follow-up. Cataract surgery was deemed successful if the visual axis could be cleared of lens opacity, with or without primary or secondary posterior capsulotomy. The scleral buckling procedure was termed successful if the retina could be reattached. The success of pars plana vitrectomy was assessed depending on the indication. Clearance of vitreous hemorrhage if vitrectomy was performed for vitreous hemorrhage, resolution of vitreous exudates if vitrectomy was performed for endophthalmitis, and reattachment of retina if vitrectomy was performed for retinal detachment indicated the success of the procedure. The tumor outcome (regression vs recurrence) was assessed cumulatively during the entire follow-up period, and the visual (Snellen visual acuity better than 20/200 vs 20/200 or worse), ocular (enucleation performed vs enucleation not performed), and systemic (systemic metastasis present vs systemic metastasis absent) outcomes were assessed at the final follow-up visit. Patients were categorized using the most recent intraocular surgery to assess overall outcome. Overall outcome was defined as favorable in the absence of recurrence of retinoblastoma, enucleation, and systemic metastasis and as unfavorable in the presence of 1 or more of the following: recurrence of retinoblastoma, need for enucleation, and systemic metastasis.RESULTSOf 900 consecutive patients with retinoblastoma treated on the Oncology Service over a 26-year period, 45 eyes of 45 patients (5%) underwent intraocular surgery after treatment for retinoblastoma. Mean patient age at diagnosis of retinoblastoma was 23 months (median, 12 months; range, 1 month to 31 years). There were 36 white patients (80%), 3 blacks (7%), 3 Asians (7%), and 3 Hispanics (7%); 30 patients (67%) were male and 15 (33%) were female. Retinoblastoma was unilateral in 5 patients (11%) and bilateral in 40 (89%). The mean basal diameter of the largest tumor measured 13 mm (median, 12 mm; range, 2-22 mm), and the mean thickness of the largest tumor was 7 mm (median, 7 mm; range, 2-15 mm). The mean proximity of the largest tumor to the optic disc was 1 mm (median, 0 mm; range, 0-12 mm) and to the foveola was 2 mm (median, 0 mm; range, 0-12 mm). Most eyes (27 [60%] of 45) had advanced tumor, categorized as Reese-Ellsworth group Va or Vb at initial examination.Initial management of retinoblastoma consisted of cryotherapy in 24 patients (53%), laser photocoagulation in 11 (24%), episcleral plaque brachytherapy in 14 (31%), chemotherapy in 19 (42%), and external beam radiotherapy in 29 (64%). Fifteen patients (33%) were treated with a single modality and 30 (67%) received multiple treatment modalities. Mean duration of initial treatment of retinoblastoma was 12 months (median, 9 months; range, 1-57 months). The mean interval between completion of treatment for retinoblastoma and intraocular surgery was 21 months (median, 18 months; range, 3-57 months). The mean interval between documented regression of retinoblastoma and intraocular surgery was 18 months (median, 16 months; range, 3-54 months).INTRAOCULAR SURGERYThirty-four patients (76%) underwent a single procedure of cataract surgery, a scleral buckling procedure, or pars plana vitrectomy and 11 (24%) had a combination of 2 or more surgical procedures. Intraocular surgical procedures included cataract surgery in 34 patients (76%), a scleral buckling procedure in 11 (24%), and pars plana vitrectomy in 12 (27%).Cataract SurgeryOf 34 patients who underwent cataract surgery, 25 underwent cataract surgery alone and 9 needed a further scleral buckling procedure, pars plana vitrectomy, or both. The surgical approach to cataract included intracapsular cataract extraction in 1 patient with a subluxated cataractous lens, extracapsular cataract extraction in 28, and pars plana lensectomy in 5. A posterior chamber intraocular lens was implanted in 13 patients and primary posterior capsulotomy was performed in 8 patients who underwent extracapsular extraction. In all, 14 patients had a posterior capsule defect. Cataract surgery was successful in clearing the visual axis in 33 patients (97%).Complications included clinically significant posterior capsule opacification necessitating Nd:YAG laser posterior capsulotomy in 4 patients, rhegmatogenous retinal detachment in 2, vitreous hemorrhage in 1, endophthalmitis in 1, and corneal decompensation in 1. Three patients had preexisting rhegmatogenous retinal detachment and 2 had preexisting vitreous hemorrhage. One patient with a dense posterior capsule opacification required pars plana membranectomy, which was performed in combination with pars plana vitrectomy for vitreous hemorrhage. In all, 4 patients underwent a scleral buckling procedure, 4 underwent pars plana vitrectomy, and 1 underwent both a scleral buckling procedure and pars plana vitrectomy after the initial cataract surgery.Scleral Buckling ProcedureOf 11 patients who underwent a scleral buckling procedure, 5 had undergone previous cataract surgery. Eight patients (18%) underwent a scleral buckling procedure alone, 2 underwent a simultaneous pars plana vitrectomy, and 1 was followed by pars plana vitrectomy. Subretinal fluid drainage was internal in 2 patients and external in 4. Of 5 patients who underwent nondrainage surgery, 1 had a dry tap and no further drainage was attempted and all had anterior chamber paracentesis. Subretinal fluid was available for cytologic examination in 3 patients, none of whom showed retinoblastoma cells. The scleral buckling procedure resulted in retinal reattachment in 8 patients (73%). Of 3 patients who had residual retinal detachment, 1 subsequently underwent pars plana vitrectomy. There was no complication related to the scleral buckling procedure.Pars Plana VitrectomyStandard 3-port pars plana vitrectomy was performed in 12 patients (27%), 4 of whom had undergone previous cataract surgery, 1 of whom had undergone a previous scleral buckling procedure, and 1 of whom had undergone both cataract surgery and a scleral buckling procedure. Indications for pars plana vitrectomy were vitreous hemorrhage in 8 patients, rhegmatogenous retinal detachment with proliferative vitreoretinopathy in 2, endophthalmitis in 1, and vitreous hemorrhage with rhegmatogenous retinal detachment in 1. Additional procedures performed in combination with pars plana vitrectomy included a scleral buckling procedure in 2 patients, pars plana lensectomy in 2, and pars plana membranectomy in 1. Two patients with radiation retinopathy underwent endolaser panretinal photocoagulation. Findings from vitrectomy fluid cytologic examination were available in 5 patients, of whom 2 showed viable retinoblastoma cells, prompting immediate enucleation. Pars plana vitrectomy was successful (clearance of vitreous hemorrhage in 6 patients, resolution of endophthalmitis in 1, and retinal reattachment in 1) in 8 patients (67%). Neovascular glaucoma occurred in 4 patients (33%) who underwent pars plana vitrectomy.OUTCOMESMean follow-up in our series was 9 years (median, 8 years; range, 1-30 years) after the initial diagnosis of retinoblastoma. Tumor outcome was assessed cumulatively during the entire follow-up period, and visual, ocular, and systemic outcomes were assessed at the final follow-up visit. Patients were categorized using the most recent intraocular surgery to assess overall outcome. Overall outcome was categorized as favorable or unfavorable using the predefined criteria. Table 1demonstrates the tumor characteristics and outcome in patients categorized by the most recent intraocular surgery. Table 2provides outcome data for groups of patients segregated by the specific type of intraocular surgery.Table 1. Type of Most Recent Intraocular Surgery and Outcome in 45 Patients*FeatureCataract Surgery (n = 25)Scleral Buckling Procedure (n = 8)Pars Plana Vitrectomy (n = 12)Age at initial presentation, median, mo13.011.013.0Tumor characteristics at initial presentationReese-Ellsworth stageGroup I000Group II4 (16)1 (13)1 (8)Group III1 (4)00Group IV7 (28)2 (25)2 (17)Group V13 (52)5 (63)9 (75)Vitreous seeds present12 (48)5 (63)6 (50)Subretinal seeds present11 (44)4 (50)4 (33)Age at intraocular surgery, median, mo52.021.541.0Visual outcome†Final visual acuity better than 20/20012 (48)3 (38)1 (8)Final visual acuity 20/200 or worse8 (32)1 (12)4 (33)Tumor outcomeRegression of retinoblastoma20 (80)3 (38)8 (67)Recurrence of retinoblastoma5 (20)5 (62)4 (33)Ocular outcome: enucleation5 (20)4 (50)7 (58)Systemic outcomeSystemic metastasis absent25 (100)7 (88)10 (83)Systemic metastasis present01 (12)2 (17)Overall outcome‡Favorable20 (80)3 (38)3 (25)Unfavorable5 (20)5 (62)9 (75)*Data are given as number (percentage) of patients, except as noted otherwise. Patients were categorized by the most recent intraocular surgery to assess overall outcome.†Excludes enucleations.‡Overall outcome was defined as favorable in the absence of recurrence of retinoblastoma, enucleation, and systemic metastasis and as unfavorable in the presence of 1 or more of the following: recurrence of retinoblastoma, need for enucleation, and systemic metastasis.Table 2. Specific Type of Intraocular Surgery and Outcome in 45 Patients*Intraocular SurgeryFailure of Intraocular Surgery†Poor Visual Outcome‡Recurrence of RetinoblastomaEnucleationSystemic MetastasisUnfavorable Outcome§Single intraocular surgical procedure (n = 34)Cataract surgery (n = 25)08 (32)5 (20)5 (20)05 (20)Scleral buckling procedure (n = 4)2 (50)04 (100)3 (75)04 (100)Pars plana vitrectomy (n = 5)4 (80)2 (40)1 (20)3 (60)1 (20)4 (80)Multiple intraocular surgical procedures (n = 11)Cataract surgery + scleral buckling procedure (n = 4)01 (25)1 (25)1 (25)1 (25)1 (25)Cataract surgery + pars plana vitrectomy (n = 4)01 (25)1 (25)2 (50)03 (75)Scleral buckling procedure + pars plana vitrectomy (n = 2)1 (50)02 (100)2 (100)1 (50)2 (100)Cataract surgery + scleral buckling procedure + pars plana vitrectomy (n = 1)01 (100)0000*Data are given as number (percentage) of patients.†In cases with multiple surgical procedures, failure refers to the last-performed (last-mentioned) intraocular surgery.‡Visual acuity better than 20/200, excluding enucleations.§Overall outcome was defined as favorable in the absence of recurrence of retinoblastoma, enucleation, and systemic metastasis and as unfavorable in the presence of 1 or more of the following: recurrence of retinoblastoma, need for enucleation, and systemic metastasis.Visual OutcomeExcluding 16 patients (36%) who underwent enucleation, final visual acuity could be assessed in 29 patients. Visual acuity better than 20/200 was achieved in 16 patients (36%) in all, including 12 (48%) who underwent cataract surgery, 3 (38%) who underwent scleral buckling procedure, and 1 (8%) who underwent pars plana vitrectomy as the most recent intraocular surgery. In 13 patients (29%) overall who attained visual acuity of 20/200 or worse, the main clinically apparent cause for poor visual acuity was a regressed retinoblastoma scar involving the fovea in 6 eyes, radiation retinopathy in 3, optic atrophy in 2, and residual subretinal fluid in 2.Tumor OutcomeAll patients were evaluated for tumor characteristics immediately after intraocular surgery (n = 34) or as soon as the ocular media clarity was attained (n = 11) and were monitored periodically (1- to 6-month intervals) thereafter. Retinoblastoma continued to remain regressed after intraocular surgery in 31 patients (69%). Viable tumor was detected by cytologic examination of the vitrectomy fluid in 2 patients (4%) in whom dense vitreous hemorrhage had precluded visualization of the tumor immediately before intraocular surgery; both patients underwent immediate enucleation. Twelve patients (27%) had clinical evidence of tumor recurrence a mean of 6 months (median, 4 months; range, 1-19 months) after intraocular surgery. In all, 14 patients (31%) had evidence of recurrent retinoblastoma after intraocular surgery. Recurrent retinoblastoma was detected in 5 patients (20%) who underwent cataract surgery, 5 (62%) who underwent the scleral buckling procedure, and 4 (33%) who had pars plana vitrectomy as the most recent intraocular surgical procedure (Table 1). Twelve of 14 patients with recurrent retinoblastoma underwent enucleation (6 immediately after detection of recurrent retinoblastoma and 6 after a trial of one or a combination of episcleral plaque brachytherapy, external beam radiotherapy, subconjunctival chemotherapy, and systemic chemotherapy). One patient with recurrence of retinoblastoma was treated successfully with cryotherapy and photocoagulation, and another with episcleral plaque brachytherapy.Ocular OutcomeSixteen patients (36%) underwent enucleation after intraocular surgery. Indications for enucleation were retinoblastoma recurrence (12 eyes) and symptomatic neovascular glaucoma (4 eyes). Enucleation was performed in 5 (20%) of those who underwent cataract surgery, 4 (50%) who underwent a scleral buckling procedure, and 7 (58%) who had pars plana vitrectomy as their most recent surgical procedure (Table 1). Histopathologic examination of the enucleated eyes (n = 16) showed evidence of viable tumor in 11 eyes (69%), all of which were enucleated for clinical evidence of retinoblastoma recurrence. Five patients had histopathologic risk factors for metastasis, including 1 or more of anterior chamber infiltration (3 eyes), choroidal infiltration (3 eyes), and extrascleral extension (1 eye). Four of 5 patients with histopathologic risk factors for metastasis received standard adjuvant chemotherapy.Systemic OutcomeOf 45 patients in our series, 42 (93%) were without systemic metastasis at the final follow-up visit. Three patients (7%) (1 from the scleral buckling procedure group and 2 from the pars plana vitrectomy group) died of systemic metastasis at a mean of 44 months (median, 31 months; range, 29-71 months) after intraocular surgery. Of 3 patients who died of metastasis, 1 had bilateral retinoblastoma, with one eye enucleated immediately after the diagnosis and the other eye treated with cryotherapy and external beam radiotherapy for a Reese-Ellsworth group II disease. The patient underwent cataract surgery (extracapsular extraction with primary posterior capsulotomy) followed by a scleral buckling procedure 3 months after retinoblastoma regression. Retinoblastoma recurred 12 months after the scleral buckling procedure, and the eye was enucleated. Anterior segment seeding with retinoblastoma cells found on histopathologic examination prompted adjuvant chemotherapy. However, systemic metastasis developed 30 months after the scleral buckling procedure. Systemic metastasis developed in 2 patients who underwent pars plana vitrectomy. Both had Reese-Ellsworth group V disease treated with multiple modalities, including laser photocoagulation, cryotherapy, episcleral plaque brachytherapy, and external beam radiotherapy, for 2 years. Both had bilateral retinoblastoma, with the worse eye of each patient having undergone primary enucleation. One of these patients developed vitreous hemorrhage after initial retinoblastoma regression. Pars plana vitrectomy was performed within 4 months of regression of retinoblastoma. There was no clinically detectable recurrence of retinoblastoma, but metastasis developed 29 months after pars plana vitrectomy. The other patient developed rhegmatogenous retinal detachment and underwent the scleral buckling procedure and subsequent pars plana vitrectomy 3 months after regression of retinoblastoma. Recurrence of retinoblastoma was noted 1 month after pars plana vitrectomy, which was treated with episcleral plaque brachytherapy and finally enucleation. There was choroidal infiltration with retinoblastoma cells on histopathologic evaluation of the enucleated eye. Systemic metastasis developed 71 months after pars plana vitrectomy.Overall OutcomeOverall outcome was favorable in 26 patients (58%) and unfavorable in 19 (42%). Most patients who underwent cataract surgery (20 [80%] of 25 patients) had a favorable outcome compared with 37% (3/8) who underwent the scleral buckling procedure and 25% (3/12) who underwent pars plana vitrectomy. Table 3depicts differences in clinical presentation, treatment, and outcome between the group with a favorable outcome and the group with an unfavorable outcome. In the 26 patients with a favorable outcome, 12 (46%) had retinoblastoma Reese-Ellsworth group V, with median duration of treatment for retinoblastoma of 4 months; median interval between completion of treatment for retinoblastoma and intraocular surgery of 26 months; and 25 patients (96%) underwent cataract surgery, 4 (15%) underwent the scleral buckling procedure, and 3 (12%) underwent pars plana vitrectomy. Intraocular surgery was successful in all the patients in this group, and 16 (62%) attained visual acuity better than 20/200. In contrast, in the 19 patients with an unfavorable outcome, 15 (79%) had retinoblastoma Reese-Ellsworth group V, with median duration of treatment for retinoblastoma of 12 months; the median interval between completion of treatment for retinoblastoma and intraocular surgery of 6 months; and 9 (47%) underwent cataract surgery, 7 (37%) underwent the scleral buckling procedure, and 9 (47%) underwent pars plana vitrectomy. Only 2 patients (11%) in this group attained visual acuity better than 20/200. Recurrence of retinoblastoma occurred in 14 patients (74%), 6 (32%) needed enucleation, and 3 (16%) developed systemic metastasis.Table 3. Clinical Presentation, Treatment of Retinoblastoma, and Intraocular Surgery in 45 Patients With Favorable and Unfavorable Outcomes*FeatureFavorable Outcome (n = 26)Unfavorable Outcome (n = 19)Clinical PresentationAge at initial presentation, median, mo12.512.0Tumor characteristics at initial examinationTumor base diameter, median, mm11.516.0Tumor thickness, median, mm6.08.0Subretinal seeds present9 (35)10 (53)Vitreous seeds present11 (42)12 (63)Reese-Ellsworth group V12 (46)15 (79)Treatment for RetinoblastomaDuration of treatment, median, mo4.012.0Treatment modalityFocal treatment alone†2 (8)3 (16)Iodine 125–labeled plaque brachytherapy4 (15)10 (53)External beam radiotherapy19 (73)10 (53)Chemotherapy10 (38)9 (47)Intraocular SurgeryAge at intraocular surgery, median, mo46.043.0Interval between the last treatment for retinoblastoma and intraocular surgery, median, mo26.06.0Type of intraocular surgery‡Cataract surgery25 (96)9 (47)Posterior capsulotomy or capsulectomy15 (60)5 (56)Intraocular lens implantation9 (36)4 (44)Scleral buckling procedure4 (15)7 (37)Pars plana vitrectomy3 (12)9 (47)Multiple intraocular surgeries6 (23)5 (26)Outcome of intraocular surgeryCataract surgery successful25 (100)8 (89)Scleral buckling procedure successful4 (100)4 (57)Pars plana vitrectomy successful3 (100)5 (56)Visual OutcomeFinal visual acuity better than 20/200§16 (62)2 (11)Tumor OutcomeRecurrence of retinoblastoma014 (74)Ocular OutcomeEnucleation016 (84)Indication for enucleationRecurrence of retinoblastomaNA12 (75)Neovascular glaucomaNA4 (25)Histopathologic findings in the enucleated eyeViable tumorNA11 (69)High-risk factor for metastasis&par;NA5 (31)Systemic OutcomeSystemic metastasis present03 (16)*Data are given as number (percentage) of patients, except as noted otherwise. Overall outcome was defined as favorable in the absence of tumor recurrence, enucleation, or systemic metastasis and as unfavorable in the presence of 1 or more of the following: tumor recurrence, need for enucleation, and systemic metastasis.†Focal treatment includes cryotherapy, laser photocoagulation, or both.‡A single intraocular surgery was performed in 34 patients (cataract surgery in 25 patients, a scleral buckling procedure in 4, and pars plana vitrectomy in 5). Eleven patients underwent multiple intraocular surgeries (4 patients underwent cataract surgery + a scleral buckling procedure, 4 underwent cataract surgery + pars plana vitrectomy, 2 underwent a scleral buckling procedure + pars plana vitrectomy, and 1 underwent cataract surgery + a scleral buckling procedure + pars plana vitrectomy). In all, 34 patients underwent cataract surgery, 11 underwent a scleral buckling procedure, and 12 underwent pars plana vitrectomy.§Excludes enucleations.&par;Tumor infiltration of the anterior segment, iris, ciliary body, choroids, laminar or postlaminar optic nerve, and sclera and extrascleral extension on histopathologic examination were considered high-risk factors.COMMENTApplication of modern treatment techniques in the management of retinoblastoma has resulted in a decrease in the frequency of enucleation.In some patients, preservation of visual acuity after retinoblastoma treatment can be accomplished, and this is important when it is being attempted for the patient's only potentially seeing eye. The main causes for reversible visual loss in such eyes include radiation-induced cataract, rhegmatogenous retinal detachment, and vitreous hemorrhage.Management of these problems not only improves visual acuity but also allows for better tumor monitoring. During the past 6 decades there have been several reports of successful and innovative surgical procedures in patients treated for retinoblastoma,but there still remains legitimate concern regarding the safety and efficacy of performing intraocular surgery in such patients. This concern prevails because of known risks for tumor dissemination and systemic metastasis after open globe manipulation of eyes with retinoblastoma.In 1939, Reese first reported successful intracapsular cataract extraction after radiotherapy for retinoblastoma.Since then, extracapsular cataract extraction, intraocular lens implantation, and numerous other innovations in pediatric cataract surgery have evolved.In 1990, our group contributed to a multicenter collaborative studyof 38 patients with radiation-induced cataract who underwent surgery a mean of 29 months after external beam radiotherapy. Eleven patients included in this earlier series are part of the present series. There was retinoblastoma recurrence in 3 eyes (8%), necessitating enucleation of 2 eyes. In 1 case, orbital exenteration was performed for subconjunctival retinoblastoma recurrence that developed at the site of cataract incision. Retinoblastoma recurrence was confined primarily to eyes with persistent vitreous haze or vitreous hemorrhage at the time of surgery. There was no systemic metastasis in this series. Use of a limbal approach and avoidance of primary posterior capsulotomy and scleral incision was recommended. Portellos and Buckleylater demonstrated the safety of extracapsular cataract extraction and posterior chamber intraocular lens implantation in combination with pars plana posterior capsulotomy and anterior vitrectomy in a series of 8 patients (11 eyes) with radiation-induced cataract after retinoblastoma treatment. In their series, surgery was performed a mean of 54 months after external beam radiotherapy, and mean follow-up after cataract surgery was 20 months. They did not report retinoblastoma recurrence or systemic metastasis in their patients.In the present study, 25 patients underwent cataract surgery alone, 13 of those with intraocular lens implantation, a mean of 26 months after the final treatment for retinoblastoma. Recurrence of retinoblastoma was observed in 5 patients (20%), all of whom underwent subsequent enucleation. The approach to cataract surgery, intraocular lens implantation, and posterior capsule status seemed to have minimal influence on the ocular or systemic outcome. None of the patients who underwent cataract surgery developed metastasis. Thus, modern techniques for cataract surgery are successful and appropriate for radiation-induced cataracts after complete regression of retinoblastoma. However, when realizing a 7% to 20% risk for tumor recurrence, we advise a cautious approach, including clear corneal incision, extracapsular cataract extraction, and preservation of the posterior capsule if possible. The clear corneal incision may reduce the risk of inadvertent conjunctival implantation of viable tumor cells and may allow for direct inspection of the incision site for tumor recurrence (unlike the limbal or scleral incision, which may be obscured by the overlying conjunctival flap). Presence of a posterior capsule defect theoretically increases the risk of dissemination of viable retinoblastoma cells to the anterior chamber and extraocular extension through the incision site. If retinoblastoma regression has been deemed stable for at least 6 to 12 months after cataract surgery, Nd:YAG laser posterior capsulotomy may be cautiously performed where required. Implantation of an intraocular lens by itself may not increase the risk of recurrence of retinoblastoma, enucleation, or systemic metastasis and could be considered for providing optimal visual rehabilitation after cataract surgery.Since the study by Pruettin 1975, there have been several publications of a successful scleral buckling procedure after treatment for retinoblastoma.Our review of the literature found 18 cases of rhegmatogenous retinal detachment managed with a scleral buckling procedure 1 week to 15 years after treatment for retinoblastoma.External drainage of subretinal fluid was performed in 14 eyes (78%) and nondrainage surgery was performed in 4 (22%). The surgery was successful in reattaching the retina in 14 eyes (78%) and unsuccessful in 4 (22%). Four eyes (22%) developed recurrence of retinoblastoma, all of which underwent enucleation. There was no study of systemic metastasis. In our series of 8 patients who underwent a scleral buckling procedure at a mean of 14 months after completion of treatment for retinoblastoma, the retina was reattached in 6 (75%), comparable to published results, but 5 (62%) developed retinoblastoma recurrence, 4 (50%) needed enucleation, and 1 (12%) developed systemic metastasis. It has been stated that failure to reattach the retina may indicate active retinoblastoma.However, we found complete reattachment of the retina in 3 of 5 patients in whom retinoblastoma later recurred. It should be realized that more than 60% of eyes requiring a scleral buckling procedure had Reese-Ellsworth group V disease with vitreous tumor seeds at initial examination. These advanced eyes carry a poor ocular outcome. Considering the high risk of retinoblastoma recurrence in eyes with retinal detachment, it may be prudent to restrict the scleral buckling procedure to only exceptional situations when complete tumor control has been achieved for 6 to 12 months and attempt nondrainage surgery when possible.Pars plana vitrectomy is rarely performed after treatment for retinoblastoma.Monge and associatesdescribed 2 patients who underwent pars plana vitrectomy for complications of external beam radiotherapy. Our review of the literature revealed only 8 patients who underwent pars plana vitrectomy after retinoblastoma treatment for reasons of retinal detachment in 6, vitreous hemorrhage in 1, and persistent vitreous haze in 1. In these 8 patients, retinoblastoma recurred in 1 (13%) and systemic metastasis occurred in none at 1- to 3-year follow-up.Surgery in these patients was performed 3 weeks to 13 years after treatment for retinoblastoma. In our series, pars plana vitrectomy was performed in 12 patients a mean of 15 months after completion of treatment for retinoblastoma. In all cases, the surgery was performed in the patient's only potentially seeing eye in a desperate attempt to provide hope for visual rehabilitation. All eyes had tumor control for a mean of 21 months after completion of treatment of retinoblastoma and had remained so when the ocular fundus was last visualized, no more than 3 months before pars plana vitrectomy. Recurrence of retinoblastoma was detected in 4 patients (33%), 2 of whom had viable retinoblastoma cells on cytologic evaluation of vitrectomy fluid, prompting immediate enucleation. Two patients (17%) developed systemic metastasis. Seven patients (58%) needed enucleation, 3 for retinoblastoma recurrence and 4 for symptomatic neovascular glaucoma. It should be realized that 75% of these eyes treated with pars plana vitrectomy had Reese-Ellsworth group V disease and most had previous chemotherapy and radiotherapy by the time the patient was referred to us or manifested vitreous media opacity. These advanced eyes carry a known poor ocular prognosis. Our results indicate that treated cases of retinoblastoma undergoing pars plana vitrectomy may have a high risk for subsequent enucleation, retinoblastoma recurrence, and systemic metastasis. Thus, this procedure is useful only in exceptional clinical situations.The optimal interval between completion of treatment of retinoblastoma and intraocular surgery is not clearly established. Based on our results, we believe that 6 to 12 months of cautious observation after complete retinoblastoma regression is necessary before attempting intraocular surgery for visual rehabilitation.We realize that proper monitoring of the neoplasm may be especially difficult in an eye with opaque media. In addition, observation for a prolonged interval may not be practical in certain situations, such as retinal detachment occurring in a child's only seeing eye. Tumor status and risks of surgery must be assessed individually in such cases and discussed in detail with the family before arriving at a decision.Our study involves patients with retinoblastoma managed during a period of 26 years. Several changes have occurred in the techniques of cataract surgery and pars plana vitrectomy during this period, which might affect the outcome. Because of the small number of patients in our series, we are unable to analyze this issue. Moreover, most patients (82%) in our series who underwent intraocular surgery were treated in the past 15 years, and with surgical techniques comparable to the current standard in the given clinical situation. The success of intraocular surgery in clearing lens opacity from the papillary axis, reattaching the detached retina, clearing vitreous hemorrhage, and resolving endophthalmitis, was reasonably good (87%) in our series. Visual recovery after intraocular surgery, however, depends largely on factors such as the location of the scar of regressed retinoblastoma, the presence of radiation retinopathy, or the presence of optic atrophy. Excluding those who underwent enucleation, 13 patients in our series (29%) achieved final visual acuity of only 20/200 or worse. On the other hand, satisfactory visual results (visual acuity better than 20/200) were achieved in 16 patients (36%), in most of whom it was their only potentially seeing eye.Recurrence of retinoblastoma after intraocular surgery is a potentially serious problem. Tumor recurrence has been reported to range from 0% to 45% after various intraocular procedures.Recurrence of retinoblastoma was observed in 14 patients (31%) in our series at a mean of 6 months after intraocular surgery. Most recurrences occurred within the first year, with the longest interval being 19 months in our series. Importantly, patients needing a scleral buckling procedure or pars plana vitrectomy seemed to be at greater risk for retinoblastoma recurrence compared with those needing cataract surgery. We do not imply that the particular intraocular surgical procedure precipitated the recurrence of retinoblastoma. Conversely, eyes that need a scleral buckling procedure or pars plana vitrectomy may have advanced retinoblastoma, with higher risk for recurrence. Close monitoring of ocular and systemic status is warranted in these children.The anatomic and functional outcomes of intraocular surgery in eyes treated with retinoblastoma should be carefully considered before planning any surgery. Enucleation for retinoblastoma recurrence or failed surgery is ultimately required in 20% to 44% of these patients.In our series, 16 patients (36%) needed enucleation, 12 for recurrent retinoblastoma and 4 for painful blind eye. Advanced tumor at presentation (Reese-Ellsworth group Va or Vb) and the need for a scleral buckling procedure or pars plana vitrectomy seem to increase the risk for enucleation.There is concern that surgical violation of an eye with viable or regressed retinoblastoma may predispose to extraocular tumor spread and metastasis.Retinoblastoma invasion through the cataract surgery incision has been observed.We found extraocular extension in only 1 enucleated eye in our series, which had previous pars plana vitrectomy. It may be difficult to judge microscopic extraocular extension unless an eye is enucleated or the orbit undergoes biopsy. Cytologic examination of subretinal and vitrectomy fluid is a reasonable precaution in anticipating extraocular spread.Prompt enucleation and adjuvant chemotherapy are warranted if there is cytologic evidence of viable tumor cells.Of 8 patients who had cytologic examination of subretinal or vitrectomy fluid, results were positive in 2 (25%) for viable retinoblastoma cells, prompting immediate enucleation.Three patients (7%) in our series had systemic metastasis. It is believed that the presence of anterior chamber, choroidal, postlaminar optic nerve, or extrascleral extension of retinoblastoma on histopathologic examination of the enucleated eye is a risk factor for systemic metastasis.We suggest that patients with histopathologic risk factors for metastasis be considered for prophylactic chemotherapy to prevent systemic metastasis.Overall outcome was favorable in 26 patients (58%) and unfavorable in 19 (42%). Most patients who underwent cataract surgery (20 [80%] of 25 patients) had a favorable outcome compared with 37% (3/8) who underwent the scleral buckling procedure and 25% (3/12) who underwent pars plana vitrectomy. The 19 patients with an unfavorable outcome included a higher proportion of patients (79%) with retinoblastoma Reese-Ellsworth group V at initial examination, with a longer median duration of treatment for retinoblastoma (12 months) and a shorter median interval between completion of treatment for retinoblastoma and intraocular surgery (6 months) (Table 3). Other factors, including initial tumor characteristics, modality of initial treatment for retinoblastoma, and the need for multiple intraocular surgical procedures, seemed no different in the 2 groups.In conclusion, in our series of 45 patients who underwent cataract surgery, a scleral buckling procedure, or pars plana vitrectomy at a median of 18 months after completion of treatment for retinoblastoma, intraocular surgery was successful in 87%, and 36% achieved final visual acuity better than 20/200. Retinoblastoma, however, recurred in 31% of patients, enucleation was needed in 36%, and systemic metastasis occurred in 7%. Although surgery for radiation-induced cataract can be gratifying, the need for a scleral buckling procedure and pars plana vitrectomy may be associated with a high risk for retinoblastoma recurrence, enucleation, and systemic metastasis. Despite the modest success in visual outcome and concern for tumor recurrence and ultimate enucleation, intraocular surgery may still be warranted in selected clinical situations, especially if it is the patient's only potentially seeing eye. The clinician should weigh the risk of tumor recurrence, enucleation, and metastasis against the expected benefit of visual rehabilitation and discuss the facts with the family before making a decision. Intraocular surgery should be withheld if the tumor is viable or if there is uncertainty about its activity. Even in patients with documented tumor regression, it may be worthwhile to allow observation of at least 6 months before attempting intraocular surgery. Cataract surgery may be planned with clear corneal incision and posterior capsule salvage, with or without intraocular lens implantation. When indicated, a scleral buckling procedure can be performed, without external drainage of subretinal fluid if possible. Cytologic examination of subretinal and vitrectomy fluid samples can provide direct intraoperative evidence of viable retinoblastoma. Prompt enucleation and adjuvant chemotherapy with or without orbital radiotherapy may be considered in such situations. Close observation is warranted after intraocular surgery for several years to detect possible tumor recurrence and systemic metastasis.JAShieldsCLShieldsManagement and prognosis of retinoblastoma.In: Shields JA, Shields CL, eds. Intraocular Tumors: A Text and Atlas.Philadelphia, Pa: WB Saunders Co; 1992:377-392.CLShieldsJAShieldsRecent advances in the management of retinoblastoma.J Pediatr Ophthalmol Strabismus.1999;36:8-18.CLShieldsPDePotterBPHimelsteinChemoreduction in the initial management of intraocular retinoblastoma.Arch Ophthalmol.1996;114:1330-1338.BLGallieABudningGDeBoerChemotherapy with focal therapy can cure intraocular retinoblastoma without radiation.Arch Ophthalmol.1996;114:1321-1328.ALMurphreeJGVillablancaWFDeeganChemotherapy plus local treatment in the management of intraocular retinoblastoma.Arch Ophthalmol.1996;114:1348-1356.CLShieldsJAShieldsMNeedleCombined chemoreduction and adjuvant treatment for intraocular retinoblastoma.Ophthalmology.1997;104:2101-2111.CLShieldsJAShieldsIOthmanePlaque radiotherapy for retinoblastoma: long term tumor control and treatment complications in 208 cases.Ophthalmology.In press.JAShieldsHParsonsCLShieldsMEGiblinThe role of cryotherapy in the management of retinoblastoma.Am J Ophthalmol.1989;108:260-264.JAShieldsHParsonsCLShieldsMEGiblinThe role of photocoagulation in the management of retinoblastoma.Arch Ophthalmol.1990;108:205-208.CLShieldsJAShieldsHKiratliPDePotterTreatment of retinoblastoma with indirect ophthalmoscopic laser photocoagulation.J Pediatr Ophthalmol Strabismus.1995;32:317-322.CLShieldsCSantosWDinizThermotherapy for retinoblastoma.Arch Ophthalmol.1999;117:885-893.PREgbertLFFajardoSSDonaldsonKMoazedPosterior ocular abnormalities after irradiation for retinoblastoma: a histopathological study.Br J Ophthalmol.1980;64:660-665.ABReeseOperative treatment of radiation cataract.Arch Ophthalmol.1939;21:476-485.RCPruettScleral buckling in retinoblastoma: case report.Ann Ophthalmol.1975;7:1115-1120.SMBuzneyRCPruettCDJReganScleral buckling for retinal detachment in patients with retinoblastoma.Am J Ophthalmol.1984;98:473-477.LHBrooks JrDMeyerJAShieldsRemoval of radiation-induced cataracts in patients treated for retinoblastoma.Arch Ophthalmol.1990;108:1701-1708.DRMongeTFlageRHatlevollHVermundSightsaving therapy in retinoblastoma: experience with external megavoltage radiotherapy.Acta Ophthalmol (Copenh).1986;64:414-420.PBMullaneyEBAbboudSAAl-MesferRetinal detachment associated with type III regression after cryotherapy and external beam radiotherapy.Am J Ophthalmol.1997;123:140-142.MPortellosEGBuckleyCataract surgery with intraocular lens implantation in patients with retinoblastoma.Arch Ophthalmol.1998;116:449-452.CRBaumalCLShieldsJAShieldsWSTasmanSurgical repair of rhegmatogenous retinal detachment after treatment for retinoblastoma.Ophthalmology.1998;105:2134-2139.EHBoveyAFernandez-RegazABalmerFLMunierRhegmatogenous retinal detachment after treatment of retinoblastoma.Ophthalmic Genet.1999;20:141-151.THLimDMRobertsonPresumed rhegmatogenous retinal detachment in patients with retinoblastoma.Retina.2000;20:22-27.SAMedreperlaJLHungerfordRJCoolingPSullivanRepair of late retinal detachment after successful treatment of retinoblastoma.Retina.2000;20:28-32.AGSpauldingJCFuhsRetinoblastoma and retinal detachment.Surv Ophthalmol.1968;13:152-156.KEStevensonJHungerfordAGarnerLocal extraocular extension of retinoblastoma following intraocular surgery.Br J Ophthalmol.1989;73:739-742.CLShieldsSGHonavarJAShieldsVitrectomy in eyes with unsuspected retinoblastoma.Ophthalmology.2000;107:2250-2255.SGHonavarADSinghCLShieldsDoes post-enucleation prophylactic chemotherapy in high-risk retinoblastoma prevent metastasis [abstract]?Invest Ophthalmol Vis Sci.2000;41:S953.Accepted for publication March 30, 2001.This study was supported by the Hyderabad Eye Research Foundation, Hyderabad, India (Dr Honavar); Orbis International, New York, NY (Dr Honavar); the Macula Foundation, New York (Dr C. L. Shields); the Eye Tumor Research Foundation, Philadelphia, Pa (Drs C. L. Shields and J. A. Shields); and the Paul Kayser International Award of Merit in Retina Research, Houston, Tex (Dr J. A. Shields).Corresponding author and reprints: Carol L. Shields, MD, Oncology Service, Wills Eye Hospital, 900 Walnut St, Philadelphia, PA 19107.

Mayer, D. Luisa; Hansen, Ronald M.; Moore, Bruce D.; Kim, Suejin; Fulton, Anne B.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1625pmid: 11709012

ObjectivesTo provide a description of refractive errors in healthy, term-born children, aged 1 through 48 months, and to test the hypotheses that spherical equivalent becomes significantly less hyperopic and less variable with increasing age.MethodsFollowing a prospective, cross-sectional design, cycloplegic retinoscopy was used to measure the refractive error in both eyes of 514 healthy, term-born children in 12 age groups. Three hundred were aged 12 months or younger. Spherical equivalent and cylindrical power and axis were analyzed as a function of age. Prediction limits for spherical equivalent were calculated.ResultsSpherical equivalents of right and left eyes did not differ at any age. Hyperopia declined significantly with increasing age. The variability in spherical equivalent also decreased significantly with age. Cylindrical error of 1 diopter or more was found in 25% of the children; the proportion with astigmatism was highest in infancy and then waned. Myopia and anisometropia were rare, occurring in 3% and 1% of the sample, respectively.ConclusionsSignificant declines in hyperopia and variability of spherical equivalent appear to be features of emmetropization. The normal prediction limits provide guidelines against which data from individual patients can be compared.IT HAS BEEN long and widely recognized that infants, on average, are hyperopic, and that the hyperopia gradually decreases during infancy and early childhood. These changes in normal refractive error are presumed to reflect finely regulated eye growth,controlled at least in part by the retina.The involved processes, known collectively as emmetropization, are accompanied by a high prevalence of astigmatism in infants.Despite numerous studies of refractive development, the new millenium has been entered without sufficient specification of refractive development in healthy infants and young children to support quantitative comparison with populations with disease, or to diagnose abnormal refraction in an individual youngster. This is because previous studies have sampled only a few ages during infancy when the change in hyperopia is thought to be rapid,because the children studied were drawn from clinical populations,or both. On occasion, the refractive errors were measured using nonstandard procedures.Herein we report the results of cycloplegic retinoscopy in 514 normal subjects. The data permit specification of normal refractive characteristics, including the limits of normal spherical equivalent for each of 12 age groups ranging from 1 through 48 months.SUBJECTS AND METHODSRefractive errors were measured in 514 healthy subjects, aged 1, 1.5, 2.5, 4, 6, 9, 12, 18, 24, 30, 36, and 48 months. Three hundred of the subjects were aged 12 months or younger. Age at refraction varied from the nominal age by no more than 10 days in the first year, and 14 days thereafter. The median number of subjects per age group was 43 (range, 32-52). These subjects had been recruited to participate in a study of normal visual acuity.About 85% were white. All subjects were born at term (gestational age, ≥37 weeks) with Apgar scores of at least 8, had an uncomplicated neonatal course, were free of medical problems, and, by parental report, were experiencing normal development. Of 545 subjects undergoing refraction, 31 were excluded because of an ophthalmic abnormality (cataract [n = 2], disc anomaly [n = 1], esotropia [n = 2]) or incomplete cycloplegia (n = 26) as judged by the retinoscopist at the time of measurement. The study was approved by the Children's Hospital Committee on Clinical Investigation, Boston, Mass. Written informed consent was obtained from each subject's parent.Each subject underwent a complete eye examination, including cycloplegic retinoscopy. Retinoscopy was performed by two of us (B.D.M. and A.B.F.) in dim room light with a streak retinoscope, at least 30 minutes after instillation of 1% cyclopentolate hydrochloride using punctal occlusion. Scheduling limitations resulted in 1 examiner (B.D.M.) conducting more (52%) eye examinations. Interexaminer reliability was evaluated in a subgroup of 43 subjects randomly selected from the sample. Each refractionist was masked as to the other's results.For each eye of the 514 subjects, spherical equivalent and power and axis of cylinder were recorded. Astigmatism was defined as 1.0 diopter (D) or more of cylinder. Axis of cylinder was categorized as with the rule (minus cylinder axis at 180° ± 15°), against the rule (minus cylinder axis at 90° ± 15°), or oblique (all else). Myopia was defined as spherical equivalent of at least −0.5 D. Anisometropia was defined as a difference of at least 1.0 D between eyes in spherical equivalent or cylinder. The mean spherical equivalent and the mean cylinder did not differ significantly between right and left eyes at any age. Therefore, data from the subject's right eye were used to summarize the results.Preliminary analyses indicated that the spherical equivalents at each age did not differ significantly from a normal distribution (Lilliefors test).The 95% and 99% prediction limits were calculated for each age group.Components of refraction were analyzed for significant variation with age. The intraclass correlation coefficient and ttests were used to analyze interexaminer differences.Statistical significance was accepted for tests with Pvalues of no greater than .01 (2-tailed).RESULTSFigure 1shows the spherical equivalents (n = 514), along with the mean spherical equivalent and the 95% and 99% prediction limits for each age group. Myopia and anisometropia were rare in this sample. Myopia was found in 14 (3%) of 514. Four (1%) of 514 had anisometropia. There was a significant decline in hyperopia with age (F11,502= 7.96; P≤.01). Distributions of spherical equivalent appeared broader at younger ages (Figure 2). Indeed, the SD of spherical equivalent (Table 1) was significantly larger at 1 month than at 48 months (F31,32= 3.55; P<.01).Figure 1.Spherical equivalent of the right eye in 514 subjects in 12 age groups. For each group, the mean spherical equivalent (open squares) and prediction limits connected by line segments are shown. D indicates diopters.Figure 2.Distributions of spherical equivalent for the 12 groups. Data are plotted in 2-diopter (D) bins; the midpoint of each bin is indicated.Spherical Equivalent (Diopters) and Prediction Limits*Age, mo (No. of Patients)Spherical Equivalent, Mean (SD), D95% Prediction Limits, D99% Prediction Limits, DUpperLowerUpperLower1 (32)2.20 (1.60)5.51−1.126.66−2.271.5 (40)2.08 (1.12)4.36−0.205.13−0.982.5 (46)2.44 (1.32)5.13−0.266.05−1.174 (43)2.03 (1.56)5.21−1.166.28−2.236 (52)1.79 (1.27)4.39−0.815.27−1.699 (45)1.32 (1.13)3.63−0.994.41−1.7712 (42)1.57 (0.78)3.16−0.013.69−0.5518 (47)1.23 (0.91)3.09−0.643.72−1.2724 (40)1.19 (0.83)2.89−0.503.47−1.0830 (51)1.25 (0.89)3.07−0.573.68−1.1936 (43)1.00 (0.76)2.56−0.563.09−1.0948 (33)1.13 (0.85)2.89−0.623.50−1.23*D indicates diopters.Astigmatism was found in 126 (25%) of 514. High cylindrical errors were uncommon. Only 14 (3%) of 514 had 2 D or more of cylinder. The 2.5-, 4-, 6-, and 9-month age groups had the highest prevalence of astigmatism (Figure 3). The percentage of subjects with astigmatism was not uniform across age groups (χ211= 77; P<.01). Against-the-rule astigmatism was more common (71 [56%]) than with-the-rule (37 [29%]) or oblique (18 [14%]) astigmatism. In all those with oblique astigmatism, the axes of right and left eyes were mirror images.Figure 3.Percentage of subjects with astigmatism in each age group. The number of subjects with astigmatism in each age group is shown above the bar. The axis of astigmatism is as indicated. D indicates diopter.For the 43 subjects undergoing refraction by both examiners, the correlation between spherical equivalents was high (intraclass correlation coefficient, 0.757). However, 1 examiner (B.D.M.) found significantly more hyperopia (mean difference, 0.6 D) (within-subject ttest, t42= 5.67; P≤.01). For the whole sample, the mean spherical equivalent in the several age groups was 0.3 to 1.0 D (median, 0.5 D) more hyperopic for the subjects examined by B.D.M. This small but consistent discrepancy, which suggests procedural differences between examiners, is within the range of reported interexaminer variations and is similar to the intraexaminer test-retest differences for cycloplegic retinoscopy in cooperative adults.The power of cylinder does not differ significantly between examiners in the subset of 43 subjects or in the whole sample.COMMENTThe mean spherical equivalents analyzed herein and those reported in other studiesare plotted in Figure 4. There are no conspicuous discrepancies between the results for healthy children and those with presumptively normal eyes. Compared with previous studies,we sampled more ages during the first year, when the rate of change appears to be rapid.Emmetropia had yet to be reached at 4 years of age (Figure 1, Figure 2, Figure 3, and Figure 4). A reasonable (r2= 0.90), empirical summary of the course of emmetropization is provided by a simple exponential function (smooth curve; Figure 4), implying that the overall effect of the many biological processes involved in the control of refractive development is to decrease spherical equivalent at a constantly declining rate. Besides gradually decreasing hyperopia, we find another feature of normal development is the significant decrease in variability of the spherical equivalent (Figure 2and Table 1). Furthermore, as development proceeds, there is a significant variation in cylindrical power (Figure 3) that in healthy infants is determined mainly at the cornea.Figure 4.Mean spherical equivalents plotted in Figure 1 and those reported in Mutti et al,Larsen,Lue et al,and Zadnik et al.The smooth curve is a simple exponential function (time constant, 3.6 years) fit to all of the plotted points. D indicates diopters.Two applications of these data are envisioned. One pertains to analyses of data from groups of patients, such as those with retinal disorders of early onset. In Figure 5, the distribution of spherical equivalent in our healthy 12-month age group is compared with distributions from the Cryotherapy for Retinopathy of Prematurity study.At 12 months postterm, the former preterm infants who had o retinopathy of prematurity have a distribution indistinguishable from that of the healthy, term-born 12-month-old infants. On the other hand, those with mild retinopathy of prematurityshow some increase in the frequency of mild myopia, and those with moderate and severe retinopathy of prematurity have distributions clearly skewed to myopic spherical equivalents.Figure 5.Distributions of spherical equivalent at 12 months of age plotted in Figure 2 and the Cryotherapy for Retinopathy of Prematurity study (data from Figure 1 in Quinn et al). The midpoint of each 2-diopter (D) bin, −7 to 5 D, is indicated. Myopia of at least 8 D is indicated by no greater than −8 D. ROP indicates retinopathy of prematurity.The other application of these data pertains to diagnosis in the individual child. Data from the 514 healthy children provide a definition of the limits of normal spherical equivalent in infants and young children. The results from an individual child can be specified as within, or outside, these limits (Table 1). The broad prediction interval during infancy may bear consideration when planning screening programs that depend on refraction. Given the broad prediction intervals during infancy (Figure 1), screening refractions at 12 months of age or older may be more efficient. Nevertheless, detection of high cylindrical errors and anisometropia can contribute to the diagnosis of amblyogenic factors in infancy.In conclusion, our data further define the characteristics of refractive errors in the healthy, developing eye, and so specify limits of normal refractive error at 1 through 48 months of age.ERaviolaTNWieselNeural control of eye growth and experimental myopia in primates.In: Block G, Widdows K, eds. Ciba Foundation Symposium.New York, NY: John Wiley & Sons Inc; 1990:22-44.DTroiloJWallmanThe regulation of eye growth and refractive state: an experimental study of emmetropization.Vision Res.1991;31:1237-1250.JWallmanRetinal control of eye growth and refraction.Prog Retin Eye Res.1992;12:133-153.JAtkinsonOBraddickJFrenchInfant astigmatism: its disappearance with age.Vision Res.1980;20:891-893.ABFultonVDobsonDSalemCycloplegic refractions in infants and young children.Am J Ophthalmol.1980;90:239-247.IMohindraRHeldJGwiazdaSBrillAstigmatism in infants.Science.1978;202:329-330.DOMuttiSLFraneNEFriedmanOcular component changes during emmetropization in infancy [ARVO abstract].Invest Ophthalmol Vis Sci.2000;41:S300. Abstract 1580.JLarsenThe saggital growth of the eye, I: ultrasonic measurement of the depth of the anterior chamber from birth to puberty.Acta Ophthalmol (Copenh).1971;49:239-262.C-LLueRMHansenDSReisnerThe course of myopia in children with mild retinopathy of prematurity.Vision Res.1995;35:1329-1335.JAtkinsonOBraddickKDurdenPGWatsonSAtkinsonScreening for refractive development in 6-9 month old infants by photorefraction.Br J Ophthalmol.1984;68:105-112.IMohindraRefraction in humans from birth to five years.Doc Ophthalmol.1981;28:19-27.DLMayerASBeiserAFWarnerMonocular acuity norms for the Teller acuity cards between ages 1 month and 4 years.Invest Ophthalmol Vis Sci.1995;36:671-685.MJNorusisSPSS 6.1: Base System User's Guide.Chicago, Ill: SPSS Inc; 1994:91-93.GAWhitmorePrediction limits for a univariate normal observation.Am Statistician.1986;40:141-143.JLFleissThe Design and Analysis of Clinical Experiments.New York, NY: John Wiley & Sons Inc; 1986:1-29.LHyamsASafirJPhilpotStudies in refraction, II: bias and accuracy of retinoscopy.Arch Ophthalmol.1971;85:33-41.ASafirLHyamsJPhilpotLSJagermanStudies in refraction, I: the precision of retinoscopy.Arch Ophthalmol.1970;84:49-61.KZadnikDOMuttiNEFriedmanAJAdamsInitial cross-sectional results from the Orinda Longitudinal Study of Myopia.Optom Vis Sci.1993;70:750-758.HCHowlandNSaylesPhotokeratometric and photorefractive measurements of astigmatism in infants and young children.Vision Res.1985;25:73-81.GEQuinnVDobsonJKivlinPrevalence of myopia between 3 months and 5½ years in preterm infants with and without retinopathy of prematurity: Cryotherapy for Retinopathy of Prematurity Cooperative Group.Ophthalmology.1998;105:1292-1300.MAbrahamssonGFabianJSjostrandChanges in astigmatism between the ages of 1 and 4 years: a longitudinal study.Br J Ophthalmol.1988;72:145-149.Accepted for publication March 30, 2001.This study was supported in part by grants EY 07776 and EY 10597 from the National Institutes of Health, Bethesda, Md.Corresponding author and reprints: Anne B. Fulton, MD, Department of Ophthalmology, Children's Hospital Boston, 300 Longwood Ave, Boston, MA 02115 (e-mail: [email protected]).

Jun, Albert S.; Liu, Sammy H.; Koo, Ellen H.; Do, Diana V.; Stark, Walter J.; Gottsch, John D.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1629pmid: 11709013

ObjectivesTo use microarray analysis to identify genes expressed in human donor corneas and to create a preliminary, comprehensive database of human corneal gene expression.MethodsA complementary DNA (cDNA) library was constructed from transplant-quality, human donor corneas. Biotin-labeled RNA was transcribed from the cDNA library and hybridized in duplicate to microarrays containing approximately 5600 human genes. Results were analyzed using a gene database of the National Institutes of Health, Bethesda, Md. Reverse transcriptase polymerase chain reaction analysis was performed to confirm corneal expression of genes identified by microarray analysis.ResultsDuplicate microarrays identified the expression of 1200 genes in human donor corneas. Chromosomal loci had been assigned to 1025 (85%) of these genes. A preliminary database of human corneal gene expression was compiled. A Web site containing these genes was created. Six collagen genes were identified that had not previously been localized within the cornea. Five apoptosis-related genes were identified, 4 of which had not previously been localized within the cornea. Three genes previously shown to cause corneal diseases were identified. Reverse transcriptase polymerase chain reaction analysis of genes identified by microarray analysis confirmed the corneal expression of 2 apoptosis-related genes and 1 collagen gene.ConclusionsMicroarray analysis of healthy human donor corneas has produced a preliminary, comprehensive database of corneal gene expression. Large-scale analysis of gene expression has the potential to generate large amounts of data, which should be made readily accessible to the scientific community. The Internet offers many potential advantages as a medium for the maintenance of these large data sets.Clinical RelevanceIdentification of structural, apoptosis-related, and disease-causing genes within the cornea by microarrays may increase the understanding of normal and abnormal corneal function with likely relevance to corneal diseases and transplants.FUNDAMENTAL to understanding normal tissue function is a global knowledge of the thousands of genes expressed in the various cell types that comprise that tissue. This baseline knowledge should facilitate the identification of alterations from normal gene expression that play important roles in disease pathogenesis. Efforts to comprehensively study gene expression patterns in normal tissues and altered gene expression patterns in diseased tissues will require a complete knowledge of the human genetic sequence and methods to accurately and simultaneously analyze large amounts of genetic information. Both of these requirements have recently become available through the ongoing progress of the Human Genome Project and breakthroughs in high-efficiency genetic analysis techniques such as DNA microarrays.DNA microarrays are a new and powerful technique to study the expression of thousands of genes in a single experiment.A microarray is a solid substrate such as a glass slide or nylon membrane to which known, single-stranded DNA molecules are attached at distinct locations. The density of these locations on a microarray can reach upwards of 250 000/cm2, as demonstrated by van Hal et al.Experimental messenger RNA (mRNA) is labeled as a complex mixture and exposed to the microarray. Labeled mRNA molecules will bind to complementary sequences on the microarray and can be detected in a semiquantitative manner using automated techniques. Advantages of DNA microarrays include simultaneous screening for the expression of large numbers of genes, the ability to use small amounts of starting material, and mass production, which enables standardized, comparative analysis between samples.The acceptance of this technology is growing rapidly as microarrays are being used in an increasing number of experimental applications. These include analysis of gene expression in normal embryonic developmentand pathologic states such as breast cancerand myocardial infarction.Microarrays also have been used to identify novel genes expressed in brain tissueand for positional cloning of a disease gene in Niemann-Pick disease, type C.Given the successful use of microarray analysis in other biological systems, we sought to apply this technique to study gene expression in human donor corneal tissue. Such analysis may be useful for understanding the genetic basis of normal corneal function as well as corneal disease processes such as graft failure, inflammation, degenerations, and dystrophies. Knowledge of what genes are or are not expressed in a given corneal disorder could lead to new and definitive treatment strategies, including interventional drugs and gene therapies. These strategies may be particularly relevant and feasible for the cornea because the tissue is relatively less complex, can be manipulated ex vivo, and can be easily assessed visually.Microarray analysis is a feasible method to begin compiling a comprehensive database of genes expressed in human corneas. Such a database of genes may have broad applications for corneal genetics research. Any comprehensive database of corneal genes would be expected to be relatively large and to grow as more genes are identified in this tissue and as the assembly phase of the Human Genome Project defines novel genes from currently available sequence information. Such a large database would be most useful if it could be readily updated, freely accessible to the global research community, and effectively interfaced with preexisting gene databases. Given these desirable features, an Internet Web site could be an ideal format for a comprehensive corneal gene database. Such a Web site could potentially enhance the progress of corneal genetics research by increasing the accessibility of relevant genetic information and facilitating discussion among corneal genetics researchers. As the proposed comprehensive corneal gene database grows and becomes more clinically relevant, it also could serve as a model for similar efforts in other clinical disciplines.MATERIALS AND METHODSTwenty corneal-scleral rims were obtained at the time of penetrating keratoplasty, and peripheral corneal tissue was carefully dissected, placed in microcentrifuge tubes, and immediately stored at −80°C. Two entire transplant-quality donor corneal buttons were placed in microcentrifuge tubes and immediately stored at −80°C. The death to preservation time of all tissues used in this study was less than 12 hours. All tissues used in this study were obtained from donors younger than age 65 years. A complementary DNA (cDNA) library was constructed using standard methods from the pooled corneal tissues described.The number of clones contained in the primary cDNA library was estimated to be 1.0 × 106.Standard methods were used to recover phagemids by mass excision protocol (pBluescript; Stratagene, La Jolla, Calif). The number of plasmids excised was 1.6 × 106. The ratio of clones excised to the number of independent clones in the library was 1.6:1. Excised clones were used to transfect a large-volume cell culture (SOLR; Stratagene, and plasmid "maxi-preps" were performed with a standard kit and protocol (Qiagen, Valencia, Calif). Plasmids were digested using restriction endonuclease (NotI; Life Technologies, Rockville, Md), phenol-chloroform extracted, and ethanol precipitated.Biotin-labeled cRNA molecules were produced by in vitro transcription (Enzo Diagnostics, Farmingdale, NY), digested with DNase I (Life Technologies), and purified using commercially available spin columns (RNeasy; Qiagen). Analysis of biotin-labeled cRNA using the HuGeneFL microarray (Affymetrix, Santa Clara, Calif) was performed in duplicate (Research Genetics, Huntsville, Ala) by hybridizing the same labeled cRNA sample to 2 identical microarrays within a 6-week time period.Microarray analysis results were analyzed using GenBankand LocusLink,online genetic databases sponsored by the National Library of Medicine of the National Institutes of Health, Bethesda, Md. A corneal genetics web site was created using the y-Base Informatics Engine (y-DNA Inc, Palo Alto, Calif).Total RNA was extracted using TRIZOL reagent (Life Technologies) from 2 pooled, whole, transplant-quality donor corneas. Reverse transcriptase polymerase chain reaction (RTPCR) was performed using standard methods (Applied Biosystems, Foster City, Calif). One microgram of total RNA was used as template for first-strand cDNA synthesis. Polymerase chain reaction (PCR) was performed using 5 µL of each cDNA sample in a final reaction volume of 100 µL. A final concentration of 2.5 µM was used for each PCR primer. The PCR cycling conditions included an initial denaturation for 105 seconds at 95°C, followed by 35 cycles of denaturation for 15 seconds at 95°C, annealing for 30 seconds at 60°C, and extension for 7 minutes at 72°C. The PCR primers for α1 type IV collagen included (sense) 5′-CAAGTTCAGCACAATGCCCTTC-3′ and (antisense) 5′-AATGGTCTGGCTGTGCACGGC-3′. The predicted PCR fragment corresponds to nucleotide positions +141 to +351 for an overall length of 211 base pairs (bp).The PCR primers for caspase 7 included (sense) 5′-ATGGCAGATGATCACGGCTGTATTG-3′ and (antisense) 5′-TATAGACAATCACGTCAAAACCCA-3′. The predicted PCR fragment corresponds to nucleotide positions +44 to +377 for an overall length of 334 bp.The PCR primers for TRAIL (tumor necrosis factor–related apoptosis-inducing ligand) included (sense) 5′-GAAGGAAGGGCTTCAGTGACCGG-3′ and (antisense) 5′-CTAACGAGCTGACGGAGTTGC-3′. The predicted PCR fragment corresponds to nucleotide positions +33 to +361 for an overall length of 329 bp.The RTPCR products were visualized after dilution (caspase 7, 1:3; TRAIL, 1:10; and α1 collagen IV, 1:5), electrophoresis in 1.2% agarose gels, and staining with 1-µg/mL ethidium bromide.RESULTSMicroarray analysis of a cDNA library constructed from transplant-quality human donor corneas was performed in duplicate. The first microarray identified the expression of 1794 human genes. The second microarray identified the expression of 1406 human genes. A total of 1200 shared genes were identified on both microarrays. The concordance rate between microarrays was 67%, calculated as the number of shared genes identified on both microarrays (1200) divided by the larger number of genes identified on a single microarray (1794). Only the 1200 genes confirmed by both microarrays as expressed in the cornea were used in subsequent analyses in this study. As the microarrays used in both experiments contained approximately 5600 human genes, the 1200 genes with confirmed corneal expression represent approximately 22% of the total genes contained on the microarrays.The 1200 genes with confirmed corneal expression were analyzed using GenBankand LocusLink.Of the 1200 confirmed corneal genes, 1025 (85%) had assigned chromosomal loci in GenBank or LocusLink (Table 1).Thus, 175 confirmed corneal genes (15%) had unassigned chromosomal loci in GenBank or LocusLink (Table 1).Table 1. Chromosome Loci of Genes Identified in Human Donor Corneas by Microarray Analysis*ChromosomeNo. of Corneal Genes Identified11182703454375426677538359291044116712691323144015331628174818171948202321172229X42Y1Unmapped†175*Chromosome loci of confirmed corneal genes were determined using GenBankand LocusLink.†Chromosome loci not assigned in GenBankor LocusLink.The 1200 genes with confirmed corneal expression were used as the basis of a corneal genetics Web site named CorneaNet.CorneaNet includes the 1200 genes identified in the present study in addition to 53 genes identified from the literature as being expressed in human corneas or cultured human corneal cell lines. Each entry in CorneaNet includes a gene name, symbol, chromosome locus, and GenBank accession number with an active link to the GenBank entry for the specified gene. CorneaNet is open to contributions from the research community and is updated regularly with genes newly reported in the literature as being expressed in human corneal tissues.Six types of collagen subunits were included among the confirmed corneal genes identified by microarray analysis (Table 2). These included α1 type IV, α1 type XI, α1 type XVI, α2 type V, α3 type IV, and α3 type VI collagens (Table 2). Mutations in α1 type XI collagen cause Stickler syndrome with a "beaded" type 2 vitreous phenotype.Mutations in α2 type V collagen cause Ehlers-Danlos syndrome type II.Mutations in α3 type IV collagen cause autosomal recessive Alport syndrome.Mutations in α3 type VI collagen cause Bethlem myopathy.None of these 6 collagen subunits has previously been identified in human corneas.Table 2. Detection of Collagen Gene Expression by MIcroarray Analysis of Human Donor Corneas*Collagen TypeChromosome LocusGenBankAccession No.Associated DiseaseReferenceCOL4A113q34M26576. . .14COL11A11p21J04177Stickler syndrome15COL16A11p34-p35M92642. . .16COL5A22q14-q32M11718Ehlers-Danlos syndrome type II17COL4A32q36-q37M81379Alport syndrome18COL6A32q37X52022Bethlem myopathy19*Ellipses indicate no associated disease reported.Five apoptosis-related genes were included among the confirmed corneal genes identified by microarray analysis (Table 3).These included caspase-like apoptosis regulatory protein 2, TRAIL, Bcl-xL, Bcl2/p53-binding protein (BBP/53BP2), and caspase 7 (Table 3). Caspase-like apoptosis regulatory protein 2 is a protein with a homologous sequence to caspase 8 and caspase 10 that may stimulate apoptosis through regulatory effects on caspase 8.The TRAIL is a member of the tumor necrosis factor family that can induce apoptosis of activated T lymphocytes.Bcl-xL is an inhibitor of apoptosis that is often overexpressed in solid tumors and shares sequence homology with Bcl-2, another apoptosis inhibitor.BBP/53BP2 is a proapoptotic protein that interacts with p53, Bcl-2, and the p65 subunit of NF-kappaBand is overexpressed in lung cancer cell lines and in vitro cell lines exposed to UV stress.Caspase 7 is a proapoptotic cysteine protease that induces massive apoptosis when overexpressed in human prostate cell lines.Selective inhibition of caspase 7 prevents apoptosis and maintains cell functionality.Of these 5 genes, only Bcl-xL has previously been identified in human corneal cells.Table 3. Detection of Apoptosis-Related Gene Expression in Human Donor Corneas by Microarray AnalysisGene Name*Chromosome LocusGenBankAccession No.ReferenceCLARP2q33-q34AF00577521TRAIL3q26U3751822, 23Bcl-xL20Z2311524, 25Bcl2/p53 binding protein (BBP/53BP2)1q42.1U5833426-29Caspase 710q25NM00122730, 31*CLARP indicates caspase-like apoptosis regulatory protein 2; TRAIL, tumor necrosis factor–related apoptosis-inducing ligand.Three corneal disease–causing genes were included among the confirmed corneal genes identified by microarray analysis (Table 4).These included keratoepithelin (BIGH3), keratin 12 (KRT12), and PAX6(Table 4). Numerous mutations in the BIGH3gene produce an abnormal protein that accumulates in the cornea and produces granular dystrophy I, lattice dystrophies I and IIIA, Avellino dystrophy, Reis-Bucklers dystrophy, and Thiel-Behnke dystrophy.Six mutations in the keratin 12 gene have been demonstrated to cause Meesmann dystrophy.Mutations in the PAX6gene cause anterior segment abnormalities such as aniridia and Peter anomaly, as well as autosomal-dominant keratitis.Table 4. Detection of Genes Causing Corneal Diseases by Microarray Analysis of Human Donor CorneasGene NameChromosome LocusGenBankAccession No.Corneal Disease(s)ReferenceTransforming growth factor β–induced gene product (BIGH3,keratoepithelin)5q31M77349Granular dystrophy I, lattice dystrophies I and IIIA, Avellino dystrophy, Reis-Bucklers dystrophy, Thiel-Behnke dystrophy33, 34Keratin 12 (KRT12)17q12D78367Meesmann dystrophy34-36PAX611p13M93650Peters anomaly, autosomal dominant keratitis37-39Three genes, caspase 7, TRAIL, and α1 collagen IV, were selected at random for RTPCR analysis to confirm corneal expression as determined by microarray analysis. Specific amplification products of the expected sizes were detected for all 3 genes (Figure 1).Reverse transcriptase polymerase chain reaction analysis of human corneal total RNA. Lane 1, DNA size ladder; lane 2, caspase 7 (334 base pairs [bp]); lane 3, tumor necrosis factor–related apoptosis-inducing ligand (TRAIL) (329 bp); lane 4, α1 collagen IV (211 bp).COMMENTThe recent completion of the sequencing phase of the Human Genome Project provides a wealth of genetic information that should facilitate clinically relevant studies of normal and abnormal cellular processes. One potentially useful application of this information is the creation of comprehensive databases of genes expressed in a given normal or abnormal tissue or cell type. An initial attempt to investigate quantitative and qualitative aspects of gene expression in the corneal epithelium was performed using the conventional technique of sequencing 1069 randomly selected cDNA clones.A similar study reported the sequencing of 1060 cDNA clones from a human trabecular meshwork cDNA library.DNA microarrays represent a powerful technique to screen large amounts of genetic material for known sequences. This method has been used in ophthalmology to study alterations in gene expression caused by the photoreceptor homeobox gene CRXand elevations in intraocular pressure.In the present study, this technique was used to identify the expression of 1200 known genes in transplant-quality human donor corneas. Only those genes positively identified on 2 identical microarrays were included in this study with a concordance rate of 67%. This conservative approach was followed to minimize the possibility of false-positive genes. Further studies are in progress to confirm corneal expression for the genes identified by only a single microarray in these experiments.As this study exemplifies, current techniques of genetic analysis can generate extremely large amounts of information in a single experiment. Disseminating this information via the Internet offers the advantages of being easily accessible and modifiable. Furthermore, the Internet allows such gene databases to interface with preexisting, high-quality, and authoritative online genetic Web sites such as GenBankand Online Mendelian Inheritance in Man.This approach was used in the creation of CorneaNet,which may become a useful resource for the cornea research community by improving the dissemination of genetic information. If successful, CorneaNet may serve as a model for online databases of gene expression in other tissues.One limitation of microarray analysis is the inability to identify previously unreported genes. However, the ongoing assembly phase of the Human Genome Project should identify all of the estimated 30 000 genes in the human genome. This information, combined with continuing advances in microarray construction, should yield full-genome microarrays in the near future. Such tools should greatly facilitate the development of truly comprehensive gene expression databases.Microarray analysis is an efficient way to investigate the genetic basis of normal and abnormal biological processes.In this study, microarray analysis identified corneal expression of 6 collagen genes, none of which had previously been localized to this tissue. These results may lead to a more sophisticated understanding of the contributions of various collagens to the structural integrity of the corneal stroma. Similarly, the expression of 5 apoptosis-related genes were identified in the donor-quality corneas used in this study. Four of these genes had not been previously localized to the cornea. These results may provide insights into the possible role of apoptosis in the ultimate success or failure of corneal grafts. Caspase 7 is a powerful initiator of apoptosis,and potent inhibitors of its activity have been shown to block caspase 7–mediated apoptosis.Such inhibitors could ultimately be useful additives to corneal storage solutions to improve the viability of donor corneas.Much progress has been made recently in identifying genes causing corneal dystrophies.Several corneal dystrophies such as central crystalline dystrophy, posterior polymorphous dystrophy, congenital hereditary endothelial dystrophies I and II, keratoconus, and X-linked megalocornea have been mapped to chromosome loci but await identification of causative genes (Table 5).The search for these disease-causing genes might be facilitated by knowledge of which genes present at specific chromosome loci are expressed in the cornea. Thus, the database of corneal genes identified by microarray analysis includes chromosome loci when available.Table 5. Genes Expressed in Human Donor Corneas That Map to Chromosome Loci Associated With Corneal DystrophiesCorneal DystrophyInheritance*Chromosome LocusNo. of Corneal Genes at LocusReferenceCentral crystallineAD1p361245Posterior polymorphousAD20q11246Congenital hereditary endothelial IAD20p747Congenital hereditary endothelial IIAR20 tel248KeratoconusAD21q21.1-q21.1249X-linked megalocorneaXRXq12-q261650*AD indicates autosomal dominant; AR, autosomal recessive; and XR, X-linked recessive.The present study is the first to our knowledge to apply microarray analysis to study corneal gene expression. The results were used to create a preliminary, online database of genes expressed in normal donor corneas. Microarray analyses of corneal ulcers, dystrophies, graft rejection, and others may provide insights into the genetic bases of these pathologic processes that may, in turn, lead to better treatments for corneal diseases.ABrazmaJViloGene expression data analysis.FEBS Lett.2000;480:17-24.NLWvan HalOVorstAMMLvan HouwelingenThe application of DNA microarrays in gene expression analysis.J Biotechnol.2000;78:271-280.TSTanakaSAJaradatMKLimGenome-wide expression profiling of mid-gestation placenta and embryo using a 15 000 mouse developmental cDNA microarray.Proc Natl Acad Sci.2000;97:9127-9132.CMPerouTSorlieMBElsenMolecular portraits of human breast tumors.Nature.2000;406:747-752.LWStantonLJGarrardDDammAltered patterns of gene expression in response to myocardial infarction.Circ Res.2000;86:939-945.TYoshikawaYNagasugiTAzumaIsolation of novel mouse genes differentially expressed in brain using cDNA microarray.Biochem Biophys Res Commun.2000;275:532-537.DAStephanYChenYJiangPositional cloning utilizing genomic DNA microarrays: the Niemann-Pick type C gene as a model system.Mol Genet Metab.2000;70:10-18.JDGottschWJStarkSHLiuCloning and sequence analysis of human and bovine corneal antigen (CO-Ag) cDNA: identification of host-parasite protein calgranulin C.Trans Am Ophthalmol Soc.1997;95:111-125.Not AvailableGenBank resources page.National Center for Biotechnology Information Web site. Available at: http://www.ncbi.nlm.nih.gov/Genbank/. Accessibility verified July 19, 2001.Not AvailableLocusLink resources page.National Center for Biotechnology Information Web site. Available at: http://www.ncbi.nlm.nih.gov/locuslink. Accessibility verified July 19, 2001.TPihlajaniemiKTryggvasonJCMyerscDNA clones coding for the pro-α1(IV) chain of human type IV procollagen reveal and unusual homology of amino acid sequences in two halves of the carboxyl-terminal domain.J Biol Chem.1985;260:7681-7687.MMarcelliGRCunninghamSJHaidacherCaspase-7 is activated during lovastatin-induced apoptosis of the prostate cancer cell line LnCaP.Cancer Res.1998;58:76-83.QWangYJiXWangBMEversIsolation and molecular characterization of the 5′-upstream region of the human TRAIL gene.Biochem Biophys Res Commun.2000;276:466-471.YSadoMKagawaINaitoOrganization and expression of basement membrane collagen IV genes and their roles in human disorders.J Biochem (Tokyo).1998;123:767-776.SMartinAJRichardsJRYatesJDScottMPopeMPSneadStickler syndrome: further mutations in COL11A1 and evidence for additional locus heterogeneity.Eur J Hum Genet.1999;7:807-814.NYamaguchiSKimuraOWMcBrideMolecular cloning and partial characterization of a novel collagen chain, alpha 1 (XVI), consisting of repetitive collagenous domains and cysteine-containing non-collagenous segments.J Biochem (Tokyo).1992;112:856-863.AJRichardsSMartinACNichollsJBHarrisonFMPopeNPBurrowsA single base mutation in COL5A2 causes Ehlers-Danlos syndrome type II.J Med Genet.1998;35:846-848.RTorraCBadenasFCofanLCallisLPerez-OllerADarnellAutosomal recessive Alport syndrome: linkage analysis and clinical features in two families.Nephrol Dial Transplant.1999;14:627-630.GJJobsisHKeizersJPVreijlingType VI collagen mutations in Bethlem myopathy, and autosomal dominant myopathy with contractures.Nat Genet.1996;14:113-115.ASJunWJStarkJDGottschThe Cornea Information Network.CorneaNet Web site, The Wilmer Eye Institute, Johns Hopkins Medical Institutions, Baltimore, Md. Available at: http://www.corneanet.net. Accessibility verified July 17, 2001.NInoharaTKosekiYHuSChenGNunezCLARP, a death effector domain-containing protein interacts with caspase-8 and regulates apoptosis.Proc Natl Acad Sci U S A.1997;94:10717-10722.SRWileyKSchooleyPJSmolakIdentification and characterization of a new member of the TNF family that induces apoptosis.Immunity.1995;3:673-682.QWangYJiXWangBMEversIsolation and molecular characterization of the 5′-upstream region of the human TRAIL gene.Biochem Biophys Res Commun.2000;276:466-471.LHBoiseMGonzalez-GarciaCEPostemabcl-x, A bcl-2-related gene that functions as a dominant regulator of apoptotic cell death.Cell.1993;74:597-608.UZangemeister-WittkeSHLeechRAOlieA novel bispecific antisense oligonucleotide inhibiting both bcl-2 and bcl-xL expression efficiently induces apoptosis in tumor cells.Clin Cancer Res.2000;6:2547-2555.LNaumovskiMLClearyThe p53-binding protein 53BP2 also interacts with bcl2 and impedes cell cycle progression at G2/M.Mol Cell Biol.1996;16:3884-3892.JPYangMHoriNTakahashiTKawabeHKatoTOkamotoNF-kappaB subunit p65 binds to 53BP2 and inhibits cell death induced by 53BP2.Oncogene.1999;18:5177-5186.TMoriHOkamotoNTakahashiRUedaTOkamotoAberrant overexpression of 53BP2 mRNA in lung cancer cell lines.FEBS Lett.2000;465:124-128.CDLopezYAoLHRohdeProapoptotic p53-interacting protein 53BP2 is induced by UV irradiation but suppressed by p53.Mol Cell Biol.2000;20:8018-8025.MMarcelliTCShaoXLiInduction of apoptosis in BPH stromal cells by adenoviral-mediated overexpression of caspase-7.J Urol.2000;164:518-525.DLeeSALongSLAdamsPotent and selective nonpeptide inhibitors of caspases 3 and 7 inhibit apoptosis and maintain cell functionality.J Biol Chem.2000;275:16007-16014.SEWilsonQLiJWengThe Fas-Fas ligand system and other modulators of apoptosis in the cornea.Invest Ophthalmol Vis Sci.1996;37:1582-1592.EKorvatskaFLMunierPChaubertOn the role of kerato-epithelin in the pathogenesis of 5q31-linked corneal dystrophies.Invest Ophthalmol Vis Sci.1999;40:2213-2219.ABronGenetics of the corneal dystrophies: what we have learned in the past twenty-five years.Cornea.2000;19:699-711.ADIrvineLDCordenOSwenssonMutations in cornea-specific keratin K3 or K12 genes cause Meesmann corneal dystrophy.Nat Genet.1997;16:184-187.KNishidaYHonmaADotaIsolation and chromosomal localization of a cornea-specific human keratin 12 gene and detection of four mutations in Meesmann corneal epithelial dystrophy.Am J Hum Genet.1997;61:1268-1275.TGlaserDSWaltonRLMaasGenomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene.Nat Genet.1992;2:232-239.IMHansonJMFletcherTJordanMutations at the PAX6 locus are found in heterogeneous anterior segment malformations including Peters' anomaly.Nat Genet.1994;6:168-173.FMirzayansWGPearceIMMacDonaldMAWalterMutation of the PAX6 gene in patients with autosomal dominant keratitis.Am J Hum Genet.1995;57:539-548.KNishidaWAdachiAShimizu-MatsumotoA gene expression profile of corneal epithelium and the isolation of human keratin 12 cDNA.Invest Ophthalmol Vis Sci.1996;37:1800-1809.PGonzalezDLEpsteinTBorrasCharacterization of gene expression in human trabecular meshwork using single-pass sequencing of 1060 clones.Invest Ophthalmol Vis Sci.2000;41:3678-8693.FJLiveseyTFurukawaMASteffenGMChurchCLCepkoMicroarray analysis of the transcriptional network controlled by the photoreceptor homeobox gene Crx.Curr Biol.2000;10:301-310.PGonzalezDLEpsteinTBorrasGenes up-regulated in the human trabecular meshwork in response to elevated intraocular pressure.Invest Ophthalmol Vis Sci.2000;41:352-361.Not AvailableOnline Mendelian Inheritance in Man resource page.National Center for Biotechnology Information Web site. Available at: http://www.ncbi.nlm.nih.gov/omim. Accessibility verified July 19, 2001.AMShearmanTJHudsonJMAndresenThe gene for Schnyder's crystalline corneal dystrophy maps to human chromosome 1p34-p36.Hum Mol Genet.1996;5:1667-1672.EHeonWDMathersWLAlwardLinkage of posterior polymorphous dystrophy to 20q11.Hum Mol Genet.1995;4:485-488.NMTomaNDEbenezerCFInglehearnCPlantLAFickerSSBhattacharyaLinkage of congenital hereditary endothelial dystrophy to chromosome 20.Hum Mol Genet.1995;4:2395-2398.CKHandDLHarmonSMKennedyJSFitzsimonLMCollumNAParfreyLocalization of the gene for autosomal recessive congenital hereditary endothelial dystrophy (CHED2) to chromosome 20 by homozygosity mapping.Genomics.1999;61:1-4.YSRabinowitzLZuHYangYWangJRotterSPulstKeratoconus: further gene linkage studies on chromosome 21.Invest Ophthalmol Vis Sci.2000;41(suppl):S539.DAMackeyRGButteryGMWiseMJDentonDescription of X-linked megalocornea with identification of the gene locus.Arch Ophthalmol.1991;109:829-833.Accepted for publication June 8, 2001.This work was supported by unrestricted grants from Research to Prevent Blindness Inc, New York, NY; Tissue Banks International, Baltimore, Md (Dr Gottsch); the Irvin and Ginger Gomprecht Research Fund (Dr Gottsch); the Deborah Black Research Fund (Dr Stark); and the Raymond Kwok Research Fund (Dr Stark).The authors are thankful to Morton F. Goldberg, MD, for continued support of this work and Elizabeth Bell for research assistance.Corresponding author and reprints: John D. Gottsch, MD, Cornea and External Disease Division, Wilmer Ophthalmological Institute, The Johns Hopkins Medical Institutions, Maumenee 317, 600 N Wolfe St, Baltimore, MD 21287 (e-mail: [email protected].).

Chuck, Roy S.; Behrens, Ashley; Wellik, Sarah; Liaw, Leacky L. H.; Dolorico, Arlene M. T.; Sweet, Paula; Chao, Lawrence C.; Osann, Kathryn E.; McDonnell, Peter J.; Berns, Michael W.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1637pmid: 11709014

ObjectiveTo describe the epithelial healing rates observed in freshly cultured rabbit corneas chemically burned with high-concentration hydrochloric acid (HCl) and sodium hydroxide (NaOH) and subsequently treated with phototherapeutic keratectomy (PTK).MethodsWe obtained 126 fresh corneoscleral rims from cadaveric New Zealand white rabbits. Each cornea was exposed to 4-mm cellulose sponges soaked in a solution of topical 0.9% isotonic sodium chloride solution, 2M HCl, or 0.5M NaOH. A transepithelial PTK (6-mm zone; 100-µm ablation depth) was then performed using the excimer laser (150-mJ/cm2energy pulse; 20 nanosecond duration; and 10-Hz frequency). Corneas were placed in tissue culture, and 1 cornea from each group was taken out of culture each day after treatment. Re-epithelialization was monitored by means of fluorescein staining, slitlamp photography, and histopathological analysis.ResultsCorneas treated with HCl and NaOH exhibited immediate epithelial defects that slowly healed over time. In PTK-treated corneas, the re-epithelialization rate was accelerated compared with that of controls (P= .003 for the HCl group, and P<.001 for the NaOH group). The new epithelial layers were smoother in PTK-treated corneas, as confirmed by results of histopathological analysis.ConclusionCorneal damage caused by HCl and NaOH may be modulated in vitro by PTK in this rabbit model.Clinical RelevanceAfter corneal chemical damage, 193-nm excimer laser PTK accelerates epithelial wound healing.IT IS OFTEN difficult to manage chemical burns of the corneal surface.After such an injury, it is very important to irrigate the ocular surface quickly and remove any remaining chemical. Subsequent medical therapy is aimed toward promoting re-epithelialization of the ocular surface. Early surgical therapy, if required, is aimed toward removal of necrotic epithelium and stroma to promote re-epithelialization. If an insufficient number of stem cells remain to repopulate the corneal surface, then further limbal and corneal transplantation may be needed.We herein present preliminary results of our attempts to use excimer laser ablation to remove chemically damaged rabbit corneal tissue in hopes of achieving faster re-epithelialization. Ablative treatment of this chemically damaged tissue removes devitalized cornea, which may impede healing and visual clarity, and may also remove any residual chemical. In these initial studies, strong acidic (hydrochloric acid [HCl]) and basic (sodium hydroxide [NaOH]) solutions were damaging chemical agents applied to the central cornea. With the use of an in vitro whole-organ rabbit cornea culture system,the rates of re-epithelialization of the corneal surface after chemical injury alone and followed by excimer laser phototherapeutic keratectomy (PTK) are examined and compared.MATERIALS AND METHODSRABBIT GLOBE HARVESTWe followed the guidelines of the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Vision and Ophthalmic Research and approval from the Institutional Animal Care and Use Committee of the University of California–Irvine to enucleate a total of 162 eyes from cadaveric New Zealand white rabbit heads within 8 hours of death. Globes were maintained in a cold and moist chamber until use.TITRATION EXPERIMENTSIn preliminary trials, concentrations and exposure times required for superficial corneal damage of up to 150 µm in depth were determined for both chemicals. Thirty-six rabbit corneas were exposed to 4-mm disks of methylcellulose surgical sponges (Visitec Inc, Sarasota, Fla) soaked in increasing concentrations of NaOH (0.025M-0.5M) or HCl (0.5M-2M). The disks were applied to the central cornea for variable exposure times of 5, 8, and 10 seconds. The chemically exposed corneas were then rinsed copiously with balanced salt solution and fixed for histological analysis.CORNEAL CHEMICAL BURNSThe globes selected for the study (n = 126) were assigned to the following 3 different groups of 14 eyes each: (1) HCl group, (2) NaOH group, and (3) control group. Each group was then subdivided into non–PTK-(n = 7) and PTK-treated corneas (n = 7). The experiments were performed in triplicate. The presence of epithelial defects, corneal scars, or signs of ocular-corneal inflammation were used as exclusion criteria.Corneas were exposed to a solution of 2M HCl for 10 seconds or 0.5M NaOH for 5 seconds to induce chemical burns, or to 0.9% isotonic sodium chloride solution as a control. Immediately after exposure, all globes were washed 3 times in a 100-mL bath of 0.9% isotonic sodium chloride solution for 5 minutes to remove chemical residues. Corneas and a 2- to 3-mm scleral skirt were excised using curved corneal scissors. Any attached iris and ciliary body were gently removed without damaging the endothelium.PREPARATION OF WHOLE-ORGAN RABBIT CORNEA CULTUREWith the use of a jigsaw, the ends of laboratory test tubes (2059; Falcon, Oxnard, Ca) were cut at the indicator line nearest the bottom. The cut edges of the domes were smoothed, and the domes were autoclaved in a screw-cap jar. After sterilization, the cut edges of the domes were coated with autoclaved high-vacuum grease (Dow-Corning, Midland, Mich) and aseptically placed firmly concave-side down into each well of a 12-well tissue culture plate. Dulbecco Modified Eagle Medium (Gibco BRL, Life Technologies Inc, Rockville, Md) supplemented with 10% fetal bovine serum was then added to each well to just cover each dome (Figure 1).Figure 1.A, Schematic of the culture system in a lateral view. The end of the test tube is placed upside down. B, Overview of the culture system with corneas in place. The top right well of the plate has no cornea to show the dome.EXCIMER LASER PTK OF CHEMICALLY BURNED CORNEASA clinical excimer laser system (VISX Star Smoothscan; VISX Inc, Santa Clara, Calif)was used to perform transepithelial PTK ablations on 7 corneas from each group, immediately after rinsing. Laser settings of 150 mJ/cm2, 20 nanosecond pulse duration, and 10-Hz repetition rate were used with a 6-mm ablation zone. Four hundred sixteen pulses were applied to the selected corneas to remove approximately 100 µm of anterior corneal tissue.Ablated and nonablated corneas were pooled and washed 3 times with Dulbecco Modified Eagle Medium supplemented with penicillin G sodium, streptomycin sulfate, and amphotericin B. We used sterile forceps, grasping only the scleral rims and not the cornea, to place each cornea over a single dome with culture medium in the previously prepared well plates. Incubations were performed in 7.5% carbon dioxide and 92.5% air at 37°C for the duration of the experiments, with culture medium changed every 2 days.MONITORING OF EPITHELIAL WOUND HEALINGEach day after treatment, 1 PTK- and 1 non–PTK-treated cornea from each group were removed from culture. Each removed cornea was placed in a tissue well plate provided with domes as a support but devoid of medium, and was stained with 1% sodium fluorescein solution. The plate was vertically fixed in a slitlamp, where cobalt blue photography at 16× original magnification was performed (Nikon FS-3; Nikon Corp, Torrance, Calif). Thereafter, corneas were fixed in 10% buffered formaldehyde for histopathological analysis.The obtained 35-mm slides from the slitlamp photography were digitally scanned at a resolution of 1280 × 960 pixels (Scan Maker 35T; Microtek, Compton, Calif). The images were subsequently processed with digital imaging software (Scion Image; Scion Corp, Frederick, Md) to quantitatively assess the fluorescein staining area corresponding to the epithelial defect.STATISTICAL ANALYSISNumerical data were analyzed using commercially available software (SYSTAT 9.0 for Windows; SPSS Inc, Chicago, Ill). Epithelial defect area from each group per day and percentage of change from baseline were described using mean and SD. Because of small numbers, defect areas between the PTK- and non–PTK-treated subgroups were compared using nonparametric tests (Mann-Whitney rank sum test). A Pvalue of .05 or less was considered statistically significant.RESULTSDETERMINATION OF CHEMICAL BURN DEPTHSHistological analysis of the chemically burned corneas from a titration experiment demonstrated that methylcellulose sponges soaked in 2M HCl solution and applied to the central cornea for 10 seconds caused denaturation of the anterior 25% of the corneal thickness. Under these experimental conditions, we could not achieve any deeper chemical burns with HCl. Similarly, sponges soaked in 0.5M NaOH solution and applied to the central cornea for 5 seconds caused denaturation of the anterior 25% of the corneal thickness.EFFECT OF PTK ON RE-EPITHELIALIZATION AFTER CHEMICAL BURNSAfter a 6-mm PTK ablation under standard clinical conditions, re-epithelialization occurs on approximately day 3 in this whole-organ cornea culture system.This finding was corroborated in the corneas from the control group. Damaged corneas exposed to HCl and NaOH showed mean epithelial defects of 2.86 and 7.80 mm2, respectively, after 4 days in culture. They were unable to re-epithelialize completely during the time monitored (6 days). In contrast, in those chemically exposed corneas that were subsequently treated with enough PTK to ablate the damaged tissue, mean re-epithelialization was almost complete at day 4 of the observation period (Table 1). The change was more evident in the NaOH group, showing significant differences in epithelial defect area at every day of the study when comparing PTK with non–PTK-treated corneas. That is, PTK accelerated the rate of epithelial wound closure in both types of chemical burn (Figure 2). In both cases, PTK resulted in closure of a wound that remained open without such treatment during the experiments (Figure 3).Percentage of Change per Day in Epithelial Defect Area in Groups of Study*HCIHCI + PTKP ValueNaOHNaOH + PTKP ValueDay129.663.6.0495−14.774.4.0495226.778.2.1370.391.2.049533.987.8.049572.597.2.0495477.085.6.8338.698.1.0495Overall34.378.8.00341.790.2<.001*Percentage of change is compared with baseline. Negative value indicates a larger epithelial defect than baseline. Unless otherwise indicated, data are given as percentages. HCI indicates hydrochloric acid; PTK, phototherapeutic keratectomy; and NaOH, sodium hydroxide. Chemical burns are described in the "Titration Experiments" subsection of the "Materials and Methods" section.Figure 2.Phototherapeutic keratectomy (PTK) curve shows a progressive and faster epithelial defect closure pattern over time. In the non–PTK-treated corneas, epithelial closure is more erratic in the hydrochloric acid (HCl) group (A) compared with the sodium hydroxide (NaOH) group (B). However, the NaOH group showed reversal of the healing process at day 3.Figure 3.Day 4. A, Hydrochloric acid (HCl)–induced burn with irregular surface and epithelial defect. B, HCl-induced burn followed by PTK shows complete re-epithelialization and a smooth surface. C, Sodium hydroxide (NaOH)–induced burn with central necrotic tissue (arrows). D, NaOH-induced burn followed by PTK shows smooth surface without defects (original magnification ×16).Light microscopy revealed that epithelial cells seemed to migrate more readily over the laser-ablated stroma, as compared with the non–PTK-treated specimens in the HCl and NaOH groups. Remnants of necrotic tissue appeared to block the cell repopulation of the epithelial defect, especially in the NaOH group. Although a normal appearance of the rabbit epithelial cell layers was not achieved in this organ culture system, a multilayered aspect resembling a normal epithelium was more likely to be observed in the laser-ablated corneas (Figure 4). The HCl group displayed a hypocellular stroma during the 3 days after the exposure, but after this period, a normal appearance in keratocyte cell density was again observed.Figure 4.Day 3. A, Hydrochloric acid (HCl)–induced burn with loose epithelium and marked hypocellularity underneath. B, HCl-induced burn followed by PTK shows re-epithelialization with smoother surface hypocellularity. C, Sodium hydroxide (NaOH)–induced burn with stroma covered with epithelial cells. D, NaOH-induced burn followed by PTK shows smoother epithelial layer pattern (hematoxylin-eosin, original magnification ×400).COMMENTSeveral organ culture models have been proposed to study the corneal in vitro wound-healing process.Air/liquid organ cultures seem to improve the epithelial cell morphology while decreasing the intercellular edema usually observed in conventional submerged models.With this in mind, we have developed a simple model that allows corneal re-epithelialization after excimer laser-induced injury.Our goal was to adopt these models to evaluate the effects of corneal chemical burns in the re-epithelialization process in vitro. Furthermore, we sought to evaluate the potential therapeutic benefits of PTK after such chemical exposures. Survival time is an important limiting factor with this culture system, since corneas remained intact for only 5 days. After the sixth day in culture, signs of system failure were seen.The healing of rabbit corneal alkali wounds in vitro has previously been investigated in a whole-organ culture model.In that study, a 5.5-mm disk of filter paper soaked with a 1N NaOH solution was applied for 60 seconds to the central cornea, and then the cornea was copiously rinsed and placed in culture. Re-epithelialization of the wound was complete in 5 days at 37°C incubation. We expected to accelerate this healing process by laser-ablative removal of chemically damaged tissue from the central corneal region of our whole-organ cornea culture injury model. Almost complete epithelial defect closure was achieved after 3 days in culture in the PTK-treated corneas, in contrast to larger defects and delayed re-epithelialization rates in the non–PTK-treated corneas. The PTK-treated corneas showed constant and progressive re-epithelialization rates over time, whereas the non–PTK-treated corneas exhibited more erratic patterns. In the non–PTK-treated corneas, the epithelial defect was found to be enlarged at days 3 (in the HCl group) and 4 (in the NaOH group), showing a regression of the healing process. In addition, the epithelial defect increased the first day after NaOH exposure, indicating a persistent, deleterious effect of the chemical even 24 hours after exposure.In this study, we have demonstrated that, in a controlled ex vivo tissue culture system, the excimer laser may be used to remove damaged central corneal tissue shortly after exposure to strong acidic and basic solutions. This process might even promote a faster re-epithelialization process. However, we cannot confidently state that these results would mimic the in vivo situation. In corneal scrape wounds, a 3-day epithelial repair has been observed in live animal studies.Despite clinical evidence that PTK may be helpful to promote epithelial healing in patients with recurrent erosions late after a chemical injury,a similar effect has not been documented, to our knowledge, in the immediate acute phase after a chemical burn. Using the same corneal damage variables determined in this study, experiments are under way to reproduce these results in a live rabbit model. It is our belief that PTK after chemical burns of the cornea may be beneficial to limit the extension of the corneal damage and to promote a more adequate substrate for epithelial migration. In the clinical situation, we would advocate initial manual removal of loose necrotic tissue followed by PTK removal of remaining chemically damaged stroma. In our study, remnants of necrotic tissue appeared to further impede epithelial healing. Removing this dead tissue should enhance the subsequent PTK effect. Confirmatory experiments are currently in progress.Excimer laser corneal ablation is now such a widespread technique that this method could become widely available. However, the main difficulty lies in the judgment of the necessary depth of ablation. We are currently characterizing the spectral properties of the cornea during excimer laser ablation of normal and chemically damaged corneas in hopes of defining an optical indicator of the transition between normal and diseased tissue.Pulse-to-pulse monitoring of corneal tissue fluorescence might allow the surgeon to determine precisely when abnormal tissue has been sufficiently ablated to accelerate the healing process. However, further in vivo work is needed to assess the potential efficacy of this method in a clinical environment. We would expect immediate PTK to be most effective. Even copious rinsing of chemically damaged tissue is unlikely to remove all of the offending chemical agent, which will further diffuse into the cornea unless mechanically removed. It remains to be seen exactly how sensitively ablative excimer laser–induced corneal fluorescence detects chemical and chemically damaged tissue.MDWagonerChemical injuries of the eye: current concepts in pathophysiology and therapy.Surv Ophthalmol.1997;41:275-313.EJHollandEpithelial transplantation for the management of severe ocular surface disease.Trans Am Ophthalmol Soc.1996;94:677-743.SRWellikRSChuckABehrensRe-epithelialization in a whole organ rabbit cornea culture model after in vitro excimer laser ablation [ARVO abstract].Invest Ophthalmol Vis Sci.2000;41(4):S682. Abstract 3626.MYanoffIn vitro biology of corneal epithelium and endothelium.Trans Am Ophthalmol Soc.1976;73:571-620.KUSandvigBNicolaissenEHaaskjoldMorphology and proliferation of human corneal epithelium in organ culture.Acta Ophthalmol Copenh.1991;69:234-240.DRTanelianKBislaA new in vitro corneal preparation to study epithelial wound healing.Invest Ophthalmol Vis Sci.1992;33:3024-3028.TMøller-PedersenHJMøllerViability of human corneal keratocytes during organ culture.Acta Ophthalmol Scand.1996;74:449-455.VPTHoppenreijsEPelsGFJVrensenWFTreffersBasic fibroblast growth factor stimulates corneal endothelial cell growth and endothelial wound healing of human corneas.Invest Ophthalmol Vis Sci.1994;35:931-944.NRRichardJAAndersonJLWeissPSBinderAir/liquid corneal organ culture: a light microscopic study.Curr Eye Res.1991;10:739-749.DMForemanSPancholiJJarvis-EvansDMcLeodMEBoultonA simple organ culture model for assessing the effects of growth factors on corneal re-epithelialization.Exp Eye Res.1996;62:555-564.HBCollinJAAndersonNRRichardPSBinderIn vitro model for wound healing: organ-cultured human corneas.Curr Eye Res.1995;14:331-339.JHChungHealing of rabbit corneal alkali wounds in vitro.Cornea.1990;9:36-40.JHChungPFagerholmCorneal alkali wound healing in the monkey.Acta Ophthalmol Copenh.1989;67:685-693.AAKottekCRedbrakeBWSchlossmacherRKuckelkornTherapy of persistent erosion after severe chemical eye burn with the excimer laser.Klin Monatsbl Augenheilkd.1996;208:251-253.RSChuckMEArnoldussenABehrensLaser-induced fluorescence during 193-nm excimer laser ablation of rabbit cornea damaged by hydrochloric acid [ARVO abstract].Invest Ophthalmol Vis Sci.2000;41:S459. Abstract 2436.PJMcDonnellRSChuckMEArnoldussen193-nm excimer laser-induced fluorescence in fresh cadaveric rabbit and human eye bank corneas: spectral component analyses [ARVO abstract].Invest Ophthalmol Vis Sci.2000;41:S459. Abstract 2435.Accepted for publication July 10, 2001.This work was supported by grant N0014-94-087 from the Office of Naval Research, Bethesda, Md.Corresponding author: Roy S. Chuck, MD, PhD, Department of Ophthalmology, University of California–Irvine, 2118 Med Surge I, Irvine, CA 92697 (e-mail: [email protected]).

Dithmar, Stefan; Sharara, Nariman A.; Curcio, Christine A.; Le, Ngoc-Anh; Zhang, Youwen; Brown, Stephanie; Grossniklaus, Hans E.

2001 JAMA Ophthalmology

doi: 10.1001/archopht.119.11.1643pmid: 11709015

ObjectiveTo examine the histologic, histochemical, and ultrastructural changes in Bruch membrane in mice on a high-fat diet with and without laser photochemical injury.MethodsFive groups of C57BL/6 mice were studied. Group 1 included 2-month-old mice on a normal diet; group 2 included 8-month-old mice on a normal diet; group 3 included 8-month-old mice on a high-fat diet; groups 4 and 5 included 8-month-old mice on a normal diet or high-fat diet, respectively, that underwent laser application of one eye with argon blue laser (488 nm). The mice were killed and plasma lipid levels were measured. The eyes were examined by standard electron microscopy, filipin histochemistry for unesterified cholesterol (UC) and esterified cholesterol (EC), and the osmium–tannic acid–phenylenediamine method for preserving extracellular lipid particles.ResultsThe plasma cholesterol level was significantly higher in the mice on the high-fat diet than the controls (P<.001). Bruch membrane was thicker in group 2 than group 1 (P= .04) and group 3 had a thicker Bruch membrane than group 2 (P= .003). All eyes in group 3 exhibited accumulation of electron-lucent debris. There was no histochemical and ultrastructural evidence that this material represented accumulated UC or EC. Seven of 9 laser-injured eyes in group 5 accumulated basal laminar deposit (BlamD)–like material in Bruch membrane (P= .02).ConclusionsElectron-lucent debris accumulates in murine Bruch membrane, and the amount correlates with age and high-fat diet. This debris has some similarities with basal linear deposits, although the debris does not form a discrete layer external to the basement membrane of the retinal pigment epithelium as occurs in basal linear deposits. These deposits do not appear to be UC or EC. Laser photochemical injury of the retinal pigment epithelium may result in the appearance of BlamD-like deposits in eyes with electron-lucent debris. The BlamD-like deposits in this model are similar to the basal laminar deposits that occur in age-related macular degeneration.Clinical RelevanceThis is an animal model of ultrastructural BlamD-like material in Bruch membrane that is very similar to the deposits that occur in age-related macular degeneration.DEBRIS accumulation within and internal to Bruch membrane occurs with age, and this debris is involved with the pathogenesis of exudative and nonexudative age-related macular degeneration (AMD).Basal linear deposit (BlinD) is an ultrastructurally identified accumulation of membranous debris between the basement membrane of the retinal pigment epithelium (RPE) and the inner collagenous zone of Bruch membrane.Basal laminar deposit (BlamD) is an accumulation of material with similar electron density to the basement membrane of the RPE and so-called fibrous long-spacing collagenbetween the plasma membrane and the basement membrane of the RPE.The presence of BlinD and the amount of BlamD may be specific for AMD.Understanding the formation and constituents of BlinD and BlamD is essential for understanding the pathobiology of AMD.Lipids, including unesterified cholesterol (UC) and esterified cholesterol (EC), accumulate in Bruch membrane with aging.Accumulation of lipid-rich material in Bruch membrane is thought to interfere with metabolic exchange between the choriocapillaris and RPE, thus impeding retinal function.It is also possible that cholesterol and other lipids in Bruch membrane contribute to the formation of BlinD and/or BlamD. Our laboratory has observed the accumulation of electron-lucent debris in membrane-bound and non–membrane-bound forms in Bruch membrane of hypercholesterolemic mice, either induced by apolipoprotein E (apo E) deficiencyor a high-fat diet.To investigate if the electron-lucent debris in Bruch membrane of hypercholesterolemic mice is composed of UC and/or EC, we examined the histochemical and ultrastructural changes in Bruch membrane of different aged mice on normal vs high-fat diets. In addition, because we have observed BlamD-like material in the eye of a patient who had a phototoxic injury,we sought to determine whether argon blue laser photochemical injury of the RPE enhanced the accumulation of BlamD-like material in mice on either normal or high-fat diets.MATERIALS AND METHODSMICETwo-month-old, female C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, Me). All experiments were conducted according to the Declaration of Helsinki and Guiding Principles in the Care and Use of Animals.Five groups of mice were studied: 2-month-old mice on a normal diet (n = 10, group 1); 8-month-old mice on a normal diet (n = 10, group 2); 8-month-old mice on a high-fat diet for 6 months (n = 10, group 3); 8-month-old mice on a normal diet for 6 months that underwent laser photochemical injury in one eye (n = 4, group 4); and 8-month-old mice on a high-fat diet for 6 months that underwent argon laser photochemical injury in one eye (n = 9, group 5).DIETGroups of mice were fed either a standard rodent chow (laboratory rodent diet 5001; PMI Nutrition Int Inc, Brentwood, Mo) or a high-fat atherogenic diet. The synthetic high-fat diet was delivered by ICN Biochemicals Inc (Aurora, Ohio) and contained the following constituents: 50% sucrose, 15% cocoa butter, 1.25% cholesterol, 0.5% sodium cholate, 1% corn oil, 20% casein, 4.82% alphacel nonnutritive bulk, 5% American Institute of Nutrition mineral mix, 1% American Institute of Nutrition vitamin mix, 1% cholin chloride, 0.3% DL-methionine, and 0.13% vitamin E. This diet is recommended for raising lipid levels without causing liver damage and gallstone formation.The mice had free access to food and water, were housed in plastic cages, and were kept on a 12-hour light-dark cycle. All mice were housed approximately 1 m from the floor where standard day lighting was 50 foot-candles.ARGON LASER PHOTOCHEMICAL INJURYEight-month-old C57BL6 mice fed a normal (group 4) or high-fat (group 5) diet for 6 months were exposed to argon laser photochemical injury in the right eye similar to a previously described protocol.The mice were exposed to blue light argon laser (488 nm) attached to an indirect ophthalmoscope. The eye was dilated with 2.5% phenylephrine, and the light was focused with a 20-diopter lens onto the center of the retina in the posterior pole. The exposure time was 7 seconds, the power was 20 mJ, and the spot size was 50 µm. This laser exposure was given every other day for 14 days. The wavelength and power settings were chosen to compromise RPE function without causing thermal or phototoxic injury.PLASMA LIPID CHEMISTRYAt the end of the experiment, the mice were killed and blood samples for lipid analyses were taken. An enzymatic method was used to determine total triglyceride and cholesterol levels. Plasma samples from animals from the same groups were pooled together and then fractionated over a fast protein liquid chromatography column.TISSUE PREPARATIONAt the time of death, the 12-o'clock position of the eyes was marked. The eyes were then enucleated, and the right eyes placed in 2.5% phosphate-buffered glutaraldehyde. The left eyes and livers of mice in groups 2 and 3 were fixed with 4% paraformaldehyde in phosphate-buffered saline and evaluated for extracellular lipids using filipin histochemistry and osmium–tannic acid–phenylenediamine (OTAP) methods. After 24 hours, the central area of the posterior pole was identified according to the 12-o'clock mark, and a rectangular piece of tissue measuring 1.5 × 1 mm, including the optic nerve head, was cut off. Central areas of the right eyes from mice in groups 1 through 4 were again placed in 2.5% glutaraldehyde and processed for electron microscopy.CONVENTIONAL ELECTRON MICROSCOPYFor electron microscopy, tissue was postfixed with 1% osmium tetroxide in 0.1M cacodylate buffer. Standard dehydration was performed, the specimen was embedded in epoxy resin (LX-112; Ladd Research Industries Inc, Burlington, Vt), and semithin sections (1.0 µm) were cut and stained with 2% toluidine blue in 2% sodium borate. Ultrathin (silver) sections were cut, stained with uranyl acetate and lead citrate, and examined using an electron microscope (JEOL 100CXII; JEOL, Peabody, Mass). A section containing the optic nerve head and central area was scanned at ×1900 magnification with ×10 binoculars. Representative photographs were taken at approximately 1 mm from the optic nerve head at ×29 000 and printed at ×72 500 magnification. The thickness of Bruch membrane was measured in 2 representative photomicrographs per case. The smallest and largest part of Bruch membrane was measured and the average thickness was determined.Ultrastructural changes within and internal to Bruch membrane were compared to those previously described for hum