Stem Cells

doi: 10.1002/stem.3176pmid: N/A

STEM CELLS 2019;37(11):1401-1415; doi: https://doi.org/10.1002/stem.306810.1002/stem.3068 Corrigendum to: SMYD2 Drives Mesendodermal Differentiation of Human Embryonic Stem Cells Through Mediating the Transcriptional Activation of Key Mesendodermal Genes Hua-Jun Bai, Peng Zhang, Li Ma, He Liang, Gang Wei, Huang-Tian Yang The authors report the following correction to Supporting Information Supplementary Figure 3A (Figure S3A): In the original Figure S3A, the data showing the morphology of SMYD2−/−-1 at mesendodermal (ME) differentiation day 0 (middle row, left panel) are the same as that of SMYD2−/−-2 (bottom row, left panel). In looking through the raw data, the first author realized that she had made a mistake when selecting from many images. The corrected image of SMYD2−/−-1 at ME differentiation day 0 in Figure S3A (middle row, left panel) is shown below. The description and the conclusion remain unchanged, as both groups showed similar morphology. S3 Open in new tabDownload slide Depletion of SMYD2 blocks ME differentiation of hESCs. (A): Morphology analysis of SMYD2+/+, SMYD2−/−-1 and SMYD2−/−-2 hESCs during ME differentiation. Scale bar = 200 μm. (corrected) S3 Open in new tabDownload slide Depletion of SMYD2 blocks ME differentiation of hESCs. (A): Morphology analysis of SMYD2+/+, SMYD2−/−-1 and SMYD2−/−-2 hESCs during ME differentiation. Scale bar = 200 μm. (corrected) S3 Open in new tabDownload slide Depletion of SMYD2 blocks ME differentiation of hESCs. (A): Morphology analysis of SMYD2+/+, SMYD2−/−-1 and SMYD2−/−-2 hESCs during ME differentiation. Scale bar = 200 μm. (original) S3 Open in new tabDownload slide Depletion of SMYD2 blocks ME differentiation of hESCs. (A): Morphology analysis of SMYD2+/+, SMYD2−/−-1 and SMYD2−/−-2 hESCs during ME differentiation. Scale bar = 200 μm. (original) The authors regret this error and apologize for any inconvenience that this mistake may have caused. The raw data of both images. Open in new tabDownload slide Open in new tabDownload slide © AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

doi: 10.1002/stem.3177pmid: 33880831

STEM CELLS 2010;28:743-752; doi: 10.1002/stem.400 Erratum to: Nuclear Transfer-Derived Epiblast Stem Cells Are Transcriptionally and Epigenetically Distinguishable from Their Fertilized-Derived Counterparts Julien Maruotti, Xiang Peng Dai, Vincent Brochard, Luc Jouneau, Jun Liu, Amélie Bonnet-Garnier, Hélène Jammes, Ludovic Vallier, I. Gabrielle M. Brons, Roger Pedersen, Jean-Paul Renard, Qi Zhou, Alice Jouneau The above-referenced article, published in 2010, examined the derivation process and the transcriptome of epiblast stem cells (EpiSCs) derived from either fertilized embryos (FT-EpiSCs) or somatic nuclear-transferred embryos (NT-EpiSCs). Nuclear-transferred embryos were obtained from cumulus cells injected into oocytes collected from B6D2F1 mice. Although the derivation process itself was very similar regardless of the origin of the cells, the comparison of the transcriptome by microarray did show a small number (25) of differentially expressed genes between 2 out of 3 NT lines, compared with 3 FT lines. The third line (called NT-1) was similar to FT. More recently, RNA sequencing of different EpiSC lines, including those previously characterized, was performed with the aim of looking at the allelic usage and imprinting in pluripotent cells [Dirks et al. Epigenetics & Chromatin 2019;12:14]. Allele-specific mapping was possible thanks to their hybrid genotype (B6D2F1). This in-depth analysis unexpectedly revealed that the recombined genotype structure of the two transcriptionally deviant EpiSCs (previously labeled as NT-2 and NT-LE) was only compatible with a parthenote origin. The third line used in the earlier study, NT-1, was clearly of NT-origin, according to its genotype. ©AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

doi: 10.1002/stem.3247pmid: N/A

Article PDF first page preview Close This content is only available as a PDF. © 2020 AlphaMed Press This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Atkinson, Stuart P.

doi: 10.1002/stem.3240pmid: 33856085

The multifunctional cytokine transforming growth factor-beta (TGF-β) controls a wide range of biological processes, including embryonic development, adult stem cell differentiation, wound healing, immune regulation, and inflammation. TGF-β family members signal through transmembrane serine/threonine kinase receptors via the canonical SMAD pathway to induce wide-ranging alterations to gene expression and via several non-canonical pathways to regulate the cytoskeleton, cell polarity, and microRNA maturation among other mechanisms. While TGF-β signaling controls the differentiation of mesenchymal stem cells (MSCs) into osteoblasts, chondrocytes, myoblasts, adipocytes, and tenocytes1; the secretion of TGF-β by MSCs also plays a crucial role in the immunomodulatory capacity of MSCs.2 MSCs derived from the umbilical cord or adipose tissue represent a readily available and patient-matched source of immunomodulatory cells that have been assessed at the preclinical and clinical levels in various diseases/disease models; however, we still lack a deep understanding of the mechanisms involved in TGF-β-mediated immunomodulation. In our first Featured Article published this month in STEM CELLS, Park et al. describe the TGF-β-mediated immunomodulatory mechanisms that mediate the alleviation of atopic dermatitis, a chronic allergic skin disorder, following the subcutaneous administration of human umbilical cord blood-derived MSCs (hUCB-MSCs).3 In a Related Article published recently in STEM CELLS Translational Medicine, Noh et al. reported that TGF-β secreted by MSCs polarized microglia, the macrophages of the central nervous system, from a classically-activated phenotype into an inflammation-resolving phenotype to inhibit the neuroinflammatory processes associated with neurodegenerative disorders.4 The SRY (sex-determining region Y)-box 2 (or SOX2) transcription factor is a member of the SOXB1 subfamily and shares 80% homology with the other group members (SOX1 and SOX3). A highly conserved high mobility group (HMG) domain in the N-terminus mediates DNA binding, with the C-terminus containing the transcription activation domain.5 Alongside OCT4 and NANOG, SOX2 forms part of the core network of transcription factors that maintains the pluripotent stem cell (PSC) phenotype. Indeed, SOX2 cooperates with OCT4 to drive the expression of other pluripotency factors, while SOX2 loss prompts PSC differentiation.6 SOX2 also forms part of both the Yamanaka (OCT4, SOX2, KLF4, and MYC) and Thompson (OCT4, SOX2, NANOG, and LIN28) reprogramming “cocktails” that were employed in the first studies describing the reprogramming of human somatic cells into induced pluripotent stem cells (iPSCs).7,8 Overall, a more in-depth understanding of those factors cooperating with SOX2 to control the pluripotent state may impact multiple research fields. In our second Featured Article published this month in STEM CELLS, Jing et al. report that the interaction between SOX2 and the LincQ long intergenic non-coding RNA (lincRNA) controls mouse embryonic stem cell (ESC) pluripotency by regulating the expression of pluripotency-associated genes.9 In a Related Article published recently in STEM CELLS Translational Medicine, Chen et al. described how ascorbic acid exposure prompted the acceleration of corneal epithelial wound healing by increasing the expression of the p63 and SOX2 stem cell markers in corneal epithelial stem/progenitor cells.10 FEATURED ARTICLES Deciphering the Crucial Role of Secreted TGF-β in the Treatment of Chronic Allergic Skin Disorder A previous STEM CELLS study from the laboratories of Kwang-Won Seo and Kyung-Sun Kang (Seoul National University, South Korea) reported that prostaglandin E2 (PGE2) and TGF-β1 secreted from hUCB-MSCs could alleviate the symptoms of atopic dermatitis, a chronic allergic skin disorder.11 Genetic predisposition, environmental factors, and immunological abnormalities all influence the onset of atopic dermatitis, although the complex pathogenesis remains incompletely understood. In their new STEM CELLS article, Park et al. explore the mechanisms by which MSC-secreted TGF-β modify the symptoms of atopic dermatitis.3 The subcutaneous administration of hUCB-MSCs in a mite allergen-induced mouse model of atopic dermatitis fostered beneficial alterations to histopathology, mast cell infiltration, tumor necrosis factor-alpha (TNF-α) expression, and serum immunoglobulin E (IgE) levels. Importantly, the depletion of TGF-β in hUCB-MSCs by small interfering RNA (siRNA) attenuated these changes, thereby underscoring the relative importance of TGF-β to any therapeutic outcome. TNF-α secretion by mast cells plays a crucial role in response to allergen stimulation,12 and this new study established that TGF-β-secretion by hUCB-MSCs significantly inhibited the secretion of TNF-α from mast cells via the modulation of the extracellular signal-related kinase (Erk) signaling pathway. Finally, TGF-β secreted by hUCB-MSCs also inhibited IgE secretion by activated B cells both by direct and indirect pathways. Overall, the authors believe that their findings support the treatment of allergic diseases such as atopic dermatitis with hUCB-MSCs. Open in new tabDownload slide Open in new tabDownload slide https://doi.org/10.1002/stem.3183 LincQ and Sox2 Team-up in Mouse Embryonic Stem Cells to Promote Pluripotency SOX2 mediates the expression of downstream target genes through cooperation with various partners, such as OCT4. Further examples include the interaction of SOX2 and the CHD7 chromatin remodeler to regulate gene expression in neural stem cells13 and the cooperation of SOX2 and the long non-coding RNAs (lncRNA) RMST to regulate neural-related gene expression.14 Recently, researchers from the laboratory of Songcheng Zhu and Jiuhong Kang (Tongji University, Shanghai, China) sought to explore SOX2-lncRNA interactions in mouse ESCs to further our understanding of the pluripotent state. Reporting in STEM CELLS,9 Jing et al. now describe the overarching importance of the LincQ lincRNA to the pluripotent state of mouse ESCs. Regulation by the OCT4, SOX2, and NANOG core pluripotency-associated transcription factors resulted in high LincQ expression in self-renewing ESCs and rapidly downregulated LincQ expression during differentiation. Interestingly, the authors established a requirement for the binding of LincQ to SOX2 but not OCT4 or NANOG for the maintenance of ESC pluripotency and the expression of pluripotency-associated genes such as Esrrb and Tfcp2l1. Finally, the authors noted that the LincQ-SOX2 interaction took place through the Soxp domain of SOX2, whose function currently remains undefined, and not the evolutionarily conserved HMG domain. Overall, this fascinating study further deepens our understanding of how SOX2 and lncRNAs can combine to control the pluripotency of ESCs. Open in new tabDownload slide Open in new tabDownload slide https://doi.org/10.1002/stem.3180 RELATED ARTICLES MSC-Derived TGF-β as a Critical Modulator of Microglial Anti-Inflammatory Activity TGF-β exposure can promote the transition of microglia, resident innate immune cells of the central nervous system, from a classically activated phenotype to an inflammation-resolving resting phenotype that supports the resolution of microglia-mediated inflammation and wound healing.15 In their recent STEM CELLS Translational Medicine article,4 researchers led by Min-Soo Kwon (Cha University) and Seung Hyun Kim (Hanyang University, South Korea) sought to fully clarify the influence of MSC-secreted TGF-β on primary cultured microglia with regards to microglial functional phenotype and neuroinflammation. Noh et al. discovered that the treatment of microglia previously activated by exposure to lipopolysaccharide (LPS) with MSC conditioned medium (MSC-CM) or recombinant TGF-β prompted a reduction in proinflammatory cytokine expression, the induction of inflammation-resolving microglial phenotypic markers, and enhanced phagocytosis (See Figure). Interestingly, TGF-β mediated this therapeutic effect by inhibiting the nuclear factor (NF)-κB pathway and promoting the reactivation of the TGF-β pathway in activated microglia. Overall, these data agree with previous clinical findings from the Kwon/Kim group (published in STEM CELLS16) that provided evidence for TGF-β as a biomarker determining the efficacy of intrathecally administered MSCs in amyotrophic lateral sclerosis patients with regards to the inhibition of neurodegenerative disease-associated neuroinflammation. Overall, this study suggests that the modulation of microglial function by MSCs engineered to release elevated levels of TGF-β may represent an effective means to treat neuroinflammatory disorders. Open in new tabDownload slide Open in new tabDownload slide https://doi.org/10.5966/sctm.2015-0217 Vitamin C Boosts Corneal Stem Cell Stemness and Therapeutic Capacity As ascorbic acid (otherwise known as vitamin C) is present at high concentrations in the corneal epithelium17 and can induce the expression of stemness-associated markers in adipose-derived MSCs18 and gingival stem cells,19 researchers from the laboratories of Patrik Danielson (Umeå University, Sweden) and Qingjun Zhou (Shandong Eye Institute, Qingdao, China) sought to evaluate the influence of ascorbic acid on corneal epithelial stem/progenitor cell function and wound healing. In their recent STEM CELLS Translational Medicine article,10 Chen et al. revealed that treatment with a stable form of ascorbic acid induced signs of stemness in mouse corneal epithelial stem/progenitor cells, as evidenced by elevated clone formation ability and the expression of corneal epithelial stem/progenitor cell markers such as p63 and pluripotency markers such as SOX2. Interestingly, modulation of Akt signaling or oxidative stress levels did not mediate this pro-regenerative effect; instead, ascorbic acid exposure increased stemness through the increased production of extracellular matrix components. In confirmation, the culture of corneal epithelial stem/progenitor cells on a collagen matrix similar to that of the corneal stroma prompted elevated levels of stem cell marker expression. Finally, the evaluation of ascorbic acid treatment in a mouse model revealed that the induction of corneal epithelial stem/progenitor cell stemness associated with significantly improved corneal epithelial wound healing. Overall, this exciting study provides evidence for the therapeutic effects of ascorbic acid on corneal epithelial wounds and delineates at least part of the controlling mechanisms. Open in new tabDownload slide Open in new tabDownload slide https://doi.org/10.1002/sctm.16-0441 REFERENCES 1 Grafe I , Alexander S, Peterson JR, et al. TGF-β family signaling in mesenchymal differentiation . Cold Spring Harb Perspect Biol . 2018 ; 10 :a022202. Google Scholar OpenURL Placeholder Text WorldCat 2 Shi Y , Wang Y, Li Q, et al. Immunoregulatory mechanisms of mesenchymal stem and stromal cells in inflammatory diseases . Nat Rev Nephrol . 2018 ; 14 : 493 - 507 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Park Hh LS , Yu Y, et al. TGF-β secreted by human umbilical cord blood-derived mesenchymal stem cells ameliorates atopic dermatitis by inhibiting secretion of TNF-α and IgE . Stem Cells . 2020 ; 38 : 00 - 000 . Google Scholar OpenURL Placeholder Text WorldCat 4 Noh MY , Lim SM, Oh K-W, et al. Mesenchymal stem cells modulate the functional properties of microglia via TGF-β secretion . Stem Cells Translational Medicine . 2016 ; 5 : 1538 - 1549 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Kamachi Y , Kondoh H. Sox proteins: Regulators of cell fate specification and differentiation . Development . 2013 ; 140 : 4129 - 4144 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Adachi K , Suemori H, Yasuda SY, Norio N, Eihachiro K. Role of SOX2 in maintaining pluripotency of human embryonic stem cells . Genes Cells . 2010 ; 15 : 455 - 470 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 7 Yu J , Vodyanik MA, Smuga-Otto K, et al. Induced pluripotent stem cell lines derived from human somatic cells . Science . 2007 ; 318 : 1917 - 1920 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Takahashi K , Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors . Cell . 2007 ; 131 : 861 - 872 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Jing R , Guo X, Yang Y, et al. Long noncoding RNA Q associates with Sox2 and is involved in the maintenance of pluripotency in mouse embryonic stem cells . Stem Cells . 2020 ; 38 : 00 - 000 . Google Scholar Crossref Search ADS WorldCat 10 Chen J , Lan J, Liu D, et al. Ascorbic acid promotes the stemness of corneal epithelial stem/progenitor cells and accelerates epithelial wound healing in the cornea . Stem Cells Translational Medicine . 2017 ; 6 : 1356 - 1365 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Kim H-S , Yun J-W, Shin T-H, et al. Human umbilical cord blood mesenchymal stem cell-derived PGE2 and TGF-β1 alleviate atopic dermatitis by reducing mast cell degranulation . Stem Cells . 2015 ; 33 : 1254 - 1266 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Bradding P , Roberts JA, Britten KM, et al. Interleukin-4, −5, and −6 and tumor necrosis factor-alpha in normal and asthmatic airways: Evidence for the human mast cell as a source of these cytokines . Am J Respir Cell Mol Biol . 1994 ; 10 : 471 - 480 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Engelen E , Akinci U, Bryne JC, et al. Sox2 cooperates with Chd7 to regulate genes that are mutated in human syndromes . Nat Genet . 2011 ; 43 : 607 - 611 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Ng SY , Bogu GK, Soh BS, Stanton LW. The long noncoding RNA RMST interacts with SOX2 to regulate neurogenesis . Mol Cell . 2013 ; 51 : 349 - 359 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Saijo K , Glass CK. Microglial cell origin and phenotypes in health and disease . Nat Rev Immunol . 2011 ; 11 : 775 - 787 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Kim HY , Kim H, Oh K-W, et al. Biological markers of mesenchymal stromal cells as predictors of response to autologous stem cell transplantation in patients with amyotrophic lateral sclerosis: An investigator-initiated trial and in vivo study . Stem Cells . 2014 ; 32 : 2724 - 2731 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Brubaker RF , Bourne WM, Bachman LA, McLaren JW. Ascorbic acid content of human corneal epithelium . Invest Ophthalmol Vis Sci . 2000 ; 41 : 1681 - 1683 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 18 Yu J , Tu Y-K, Tang Y-B, Cheng NC. Stemness and transdifferentiation of adipose-derived stem cells using L-ascorbic acid 2-phosphate-induced cell sheet formation . Biomaterials . 2014 ; 35 : 3516 - 3526 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Van Pham P , Tran NY, Phan NLC, et al. Vitamin C stimulates human gingival stem cell proliferation and expression of pluripotent markers . In Vitro Cell Dev Biol Anim . 2016 ; 52 : 218 - 227 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Previews highlight research articles published in the current issue of Stem Cells, putting the results in context for readers. © AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Xie, Huafeng; Graf, Thomas

doi: 10.1002/stem.3173pmid: 32159910

Abstract The four transcription factors of the Yamanaka cocktail (Oct4, Sox2, Klf4, and Myc, termed OSKM) are famously capable of reprogramming somatic cells into induced pluripotent stem cells (iPSCs). In an article recently published in Nature Communications, Wang et al describe the unexpected discovery that short-term activation of OSKM expression in acute myeloid leukemia cells in vivo induces apoptosis while negligibly affecting normal hematopoietic stem and progenitor cells (Nat Commun 2019;10:5594). These findings have potential implications for novel anticancer strategies. Schematics of the experimental protocol used to demonstrate the selective anti-tumor effect of the OSKM factors in vivo. Briefly, HSPCs from reprogrammable mice were isolated, infected in culture for 2 days with a retrovirus containing MLL-AF9-GFP and transplanted into sublethally irradiated mice. One week later the percentage of GFP+ cells in the bone marrow and blood was determined and animals treated with doxycycline (doxy) for 1 week to activate OSKM in the donor cells or left untreated (no doxy). The mice were then monitored for several months for the onset of leukemia and death. While untreated animals died within 20 days, most of the mice with transient OSKM activation survived for at least 1 year. MLL-AF9-infected HSPCs from reprogrammable mice were competitively repopulated with control HSPCs from reprogrammable mice and the recipients treated with doxy. This showed that the MLL-AF9 cells died while the control HSPCs survived. Open in new tabDownload slide Open in new tabDownload slide A long-standing question in the reprogramming field is whether tumor cells, like normal cells, can be induced to convert into induced pluripotent stem cells (iPSCs) capable of generating the diversity of normal tissues and even animals. The overall picture is that, while some cancer cell lines, in particular leukemias, can be reprogrammed (typically at very low efficiencies), many others appear to be resistant (see, e.g., References 1 and 2). This could be ascribed to differences in the cells’ genetic and epigenetic status, with cells that are either insensitive to incoming signals or cells that are receptive but activate a stress response resulting in cell death, in both cases preventing rewiring of the cells’ genome required for the formation of a new and viable cell phenotype. In the recent study by Tao Cheng and colleagues, this question was revisited, using a leukemia induction model developed earlier by the authors. This consists of the retrovirus mediated transduction of MLL-AF9 fusion protein into bone-marrow (BM) derived hematopoietic stem and progenitor cells (HSPCs) followed by transplantation into mice.1 The result is an acute myeloid leukemia (AML) disseminated in the BM, spleen, and blood, causing the death of the mice within 2 months. They now repeated these experiments but using “reprogrammable” mice containing a doxycycline inducible OSKM cassette. With such mice the group of Manuel Serrano had shown that the formation of iPS cells can be induced in vivo.3 Wang et al asked whether HSPCs from reprogrammable mice transduced with MLL-AF9-GFP in culture and then transplanted into sublethally irradiated mice would convert into iPSCs following activation of the Yamanaka factors by doxycycline administration in the drinking water. Surprisingly, they observed that in the treated animals the green fluorescent MLL-AF9 cells disappeared and the mice were saved from death by AML, whereas uninduced control animals succumbed within a matter of months (Figure 1A). Strikingly, OSKM activation had essentially no effects on uninfected hematopoietic progenitors in the same animals, permitting the mice to survive long-term. The lack of sensitivity of normal HSPCs to OSKM activation was further corroborated in a competitive repopulation experiment between cells from reprogrammable mice and mice lacking OSKM, showing robust survival of the OSKM-induced cells after doxycycline treatment (Figure 1B). This raised the question as to whether the immune system is involved, which was not the case as the effects could also be observed in immunodeficient mice and after depletion of macrophages. Instead, the relevant mechanism was found to consist in the induction of apoptosis, with OSKM induction in MLL-AF9 cells leading to increased levels of P53, Puma, and cleaved caspase 3, resulting in the selective increase of annexin V in these cells compared to normal cKit+ progenitors. Figure 1 Open in new tabDownload slide A, Schematics of the experimental protocol used to demonstrate the selective antitumor effect of the OSKM factors in vivo. Briefly, HSPCs from reprogrammable mice were isolated, infected in culture for 2 days with a retrovirus containing MLL-AF9-GFP and transplanted into sublethally irradiated mice. One week later the percentage of GFP+ cells in the bone marrow and blood was determined and animals treated with doxycycline (doxy) for 1 week to activate OSKM in the donor cells or left untreated (no doxy). The mice were then monitored for several months for the onset of leukemia and death. While untreated animals died within 20 days, most of the mice with transient OSKM activation survived for at least 1 year. B, MLL-AF9 infected HSPCs from reprogrammable mice were competitively repopulated with control HSPCs from reprogrammable mice and the recipients treated with doxy. This showed that the MLL-AF9 cells died while the control HSPCs survived Figure 1 Open in new tabDownload slide A, Schematics of the experimental protocol used to demonstrate the selective antitumor effect of the OSKM factors in vivo. Briefly, HSPCs from reprogrammable mice were isolated, infected in culture for 2 days with a retrovirus containing MLL-AF9-GFP and transplanted into sublethally irradiated mice. One week later the percentage of GFP+ cells in the bone marrow and blood was determined and animals treated with doxycycline (doxy) for 1 week to activate OSKM in the donor cells or left untreated (no doxy). The mice were then monitored for several months for the onset of leukemia and death. While untreated animals died within 20 days, most of the mice with transient OSKM activation survived for at least 1 year. B, MLL-AF9 infected HSPCs from reprogrammable mice were competitively repopulated with control HSPCs from reprogrammable mice and the recipients treated with doxy. This showed that the MLL-AF9 cells died while the control HSPCs survived To elucidate the molecular mechanism behind the activation of apoptosis by OSKM in MLL-AF9 cells, Wang et al performed chromatin accessibility assays (ATAC-seq) after OSKM induction. They found that MLL-AF9 cells reorganize global genome accessibility more extensively than wild type cKit+ cells. This included transitions from open to closed and closed to open chromatin regions. When they analyzed the newly opened chromatin regions, likely representing sites bound by incoming or newly activated transcription factors, they found an enrichment for the sequence motifs Ets, Runt, Sox, and Klf, but strikingly not that of the well-defined Oct4 motif. This raised the possibility that only a subset of the factors in the Yamanaka cocktail is sufficient for the apoptosis-inducing effect in the leukemic cells and that Oct4 is not among them. Indeed, when they tested the factors individually, they discovered that Sox2 and Klf4 are sufficient to induce the effect in the leukemic cells. To determine the mechanism at the epigenetic level, they analyzed OSKM-induced changes in histone modifications and found a reduction of global H3K9me3 levels in MLL-AF9 cells not seen in wild-type cells. Searching for the dysregulation of enzymes known to be involved either in the deposition or erasure of methyl residues in H3K9me3, they found the selective downregulation of the methyltransferases Suv39h1/h2 and the upregulation of the demethylase KDM3a. Consistent with a role of these enzymes in the process, the apoptosis inducing capacity of OSKM in MLL-AF9 cells could be impaired both with chaetocin, an inhibitor of H3K9 methylation, and by knocking down the histone demethylase Kdm3a. Moreover, overexpression of Kdm3a in normal cKit+ progenitors caused cell death by apoptosis. Finally, they showed that OSKM-induced apoptosis is not restricted to MLL-AF9 cells, as three additional tumor types (mouse models of Notch1-ALL and NRIP3-AML leukemia and cultured THP-1 monocytic leukemia cells) exhibited a similar response. Table 1 summarizes the major differences in the response to OSKM activation between MLL-AF9 and normal HSPCs. Table 1 Effects of OSKM activation in AML cells and normal hematopoietic progenitors . MLL-AF9 cells . cKit+ HSPCs . P53, Puma, activated caspase 3 Increase No change % 7AAD/Annexin positive cells Increase No change Global H3K9me3 levels Decrease No change Suv39h1/h2 expression Strong decrease Decrease Kdm3a expression Strong increase Increase Chaetocin-induced apoptosis High Low . MLL-AF9 cells . cKit+ HSPCs . P53, Puma, activated caspase 3 Increase No change % 7AAD/Annexin positive cells Increase No change Global H3K9me3 levels Decrease No change Suv39h1/h2 expression Strong decrease Decrease Kdm3a expression Strong increase Increase Chaetocin-induced apoptosis High Low Open in new tab Table 1 Effects of OSKM activation in AML cells and normal hematopoietic progenitors . MLL-AF9 cells . cKit+ HSPCs . P53, Puma, activated caspase 3 Increase No change % 7AAD/Annexin positive cells Increase No change Global H3K9me3 levels Decrease No change Suv39h1/h2 expression Strong decrease Decrease Kdm3a expression Strong increase Increase Chaetocin-induced apoptosis High Low . MLL-AF9 cells . cKit+ HSPCs . P53, Puma, activated caspase 3 Increase No change % 7AAD/Annexin positive cells Increase No change Global H3K9me3 levels Decrease No change Suv39h1/h2 expression Strong decrease Decrease Kdm3a expression Strong increase Increase Chaetocin-induced apoptosis High Low Open in new tab An antitumor effect of transcription factors associated with cell fate has been observed before, prominently by the activation of endogenous RARa in acute promyelocytic leukemia cells treated with all trans-retinoic acid. However, in this case the mechanism is not primarily the induction of apoptosis but that of terminal differentiation.4 Likewise, the antitumorigenic effect of overexpressing C/EBPa in human acute B-cell leukemia cells is a consequence of their induced transdifferentiation into nonmalignant macrophages. However, macrophages were never recovered in vivo, raising the possibility that they were eliminated following apoptosis.5 In another study, B-ALL cells carrying a BCR-ABL oncogene have been shown to spontaneously transdifferentiate into myeloid cells. In this scenario, macrophages could be identified in patients carrying the same immunoglobulin rearrangements as in the leukemic cells of the same patient, showing that a malignant B cell to normal myeloid cell transition can also happen in vivo and with no apparent cell death.6 In contrast, as shown by Wang et al,7 overexpression of either Sox2 or Klf4 in AML cells does not initiate a differentiation program and their coexpression only caused a slight increase in apoptosis, suggesting that they act redundantly through the same pathway. However, what they have in common to set this machinery in motion selectively in cancer cells remains unclear. An intriguing possibility is that they somehow share the capacity to discriminate differences in the heterochromatic landscape between cancer and normal cells. Studies by Zaret and colleagues have described that a large proportion of the mouse cell genome decorated with H3K9me3 is initially resistant to the binding of the OSKM pluripotency factors.8 They recently showed that these regions are specifically associated with almost 200 proteins, and proteins tested individually were found to impair reprogramming.9 An intriguing hypothesis therefore is that AML differs from normal hematopoietic progenitors in the distribution of heterochromatin subdomains and that the interaction with Sox2 and Klf4, but not Oct4, leads to H3K9me3 demethylation that activates apoptosis specifically in the cancer cells. However, things may turn out to be more complex, as OSKM factors have been described to not only induce reprogramming into iPSCs, but also cause apoptosis in fibroblasts.8 In addition, Klf4 has been described to behave as an antiapoptotic oncogene in some cellular contexts and as an apoptosis-inducing suppressor gene in others.10 Another example for such a context dependency is the interaction of OSKM and MLL-AF9 cells itself: Earlier work by the Cheng lab has shown that when the factors are activated in culture conditions that favor the outgrowth of pluripotent stem cells, iPSC colonies can be obtained.1 In contrast, under the in vivo conditions described here, where MLL-AF9 cells grow in the environment of normal hematopoietic cells, this does not seem to occur. Together, these observations suggest that both the cells’ epigenetic state and their environment influence the outcome of the effect induced by cell fate-instructive transcription factors. In relationship to the possible clinical relevance of the described phenomenon, it is worth pointing out that a broad array of cancers are enriched in mutations within genes that encode enzymes affecting H3K9 methylation.11 The experiments described by Wang et al, pointing to a selective demethylation by the Yamanaka factors of H3K9 in malignant blood cells, therefore warrant searching for combinations of compounds that mimic the effect of OSKM in cancer cells. In this context it would be interesting to know if soluble factors or chemical compounds that have been described to functionally replace Sox2 or Klf4 during reprogramming (see, e.g., References 12 and 13) induce apoptosis of MLL-AF9 cells but not that of normal cells and whether the combination with H3K9me3 inhibitors enhances the effects. The search for compounds active in such screens could represent an as yet unexplored therapeutic approach for leukemia therapy that promises to yield drugs that exhibit lower tissue toxicity than currently used chemotherapeutic regimens. ACKNOWLEDGMENTS H.X. was supported by funds form the National Key R&D Program of China (2018YFA0108200) and the National Natural Science Foundation of China (31970625). T.G. was supported by funds from MINECO (Plan Estatal 2015, SAF2015-68740-P) and the European Research Council (Synergy Grant 4D-Genome). CONFLICT OF INTEREST The authors declared no potential conflicts of interest. REFERENCES 1 Liu Y , Cheng H, Gao S, et al. Reprogramming of MLL-AF9 leukemia cells into pluripotent stem cells . Leukemia . 2014 ; 28 : 1071 - 1080 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Hochedlinger K , Blelloch R, Brennan C, et al. Reprogramming of a melanoma genome by nuclear transplantation . Genes Dev . 2004 ; 18 : 1875 - 1885 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Abad M , Mosteiro L, Pantoja C, et al. Reprogramming in vivo produces teratomas and iPS cells with totipotency features . Nature . 2013 ; 502 : 340 - 345 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Lo-Coco F , Avvisati G, Vignetti M, et al. Retinoic acid and arsenic trioxide for acute promyelocytic leukemia . N Engl J Med . 2013 ; 369 : 111 - 121 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Rapino F , Robles EF, Richter-Larrea JA, Kallin EM, Martinez-Climent JA, Graf T. C/EBPα induces highly efficient macrophage transdifferentiation of B lymphoma and leukemia cell lines and impairs their tumorigenicity . Cell Rep . 2013 ; 3 : 1153 - 1163 . Google Scholar Crossref Search ADS PubMed WorldCat 6 McClellan JS , Dove C, Gentles AJ, Ryan CE, Majeti R. Reprogramming of primary human Philadelphia chromosome-positive B cell acute lymphoblastic leukemia cells into nonleukemic macrophages . Proc Natl Acad Sci U S A . 2015 ; 112 : 4074 - 4079 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Wang Y , Lu T, Sun G, et al. Targeting of apoptosis gene loci by reprogramming factors leads to selective eradication of leukemia cells . Nat Commun . 2019 ; 10 : 5594 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Soufi A , Garcia MF, Jaroszewicz A, Osman N, Pellegrini M, Zaret KS. Pioneer transcription factors target partial DNA motifs on nucleosomes to initiate reprogramming . Cell . 2015 ; 161 : 555 - 568 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Becker JS , RL MC, Sidoli S, et al. Genomic and proteomic resolution of heterochromatin and its restriction of alternate fate genes . Mol Cell . 2017 ; 68 : 1023 - 1037 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Ghaleb AM , Yang VW. Krüppel-like factor 4 (KLF4): what we currently know . Gene . 2017 ; 611 : 27 - 37 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Tollefsbol TO , ed. Epigenetics in Human Disease . Vol 6 . 2nd ed. London : Academic Press ; 2018 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 12 Ichida JK , Blanchard J, Lam K, et al. A small-molecule inhibitor of Tgf-β signaling replaces Sox2 in reprogramming by inducing Nanog . Cell Stem Cell . 2009 ; 5 : 491 - 503 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Chen J , Liu J, Yang J, et al. BMPs functionally replace Klf4 and support efficient reprogramming of mouse fibroblasts by Oct4 alone . Cell Res . 2011 ; 21 : 205 - 212 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes This article was published online on 21 March 2020. An error was subsequently identified in the authors affiliations section. This notice is included in the online and print versions to indicate that both have been corrected on 9 April 2020. Funding information H2020 European Research Council, Grant/Award Number: Synergy Grant 4D-Genome; MINECO, Grant/Award Number: SAF2015-68740-P; National Key R&D Program of China, Grant/Award Number: 2018YFA0108200; National Natural Science Foundation of China, Grant/Award Number: 31970625 © AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Zhao, Ming-Tao; Shao, Ning-Yi; Garg, Vidu

doi: 10.1002/stem.3178pmid: 32232889

Abstract Patient-derived pluripotent stem cells (PSCs) have greatly transformed the current understanding of human heart development and cardiovascular disease. Cardiomyocytes derived from personalized PSCs are powerful tools for modeling heart disease and performing patient-based cardiac toxicity testing. However, these PSC-derived cardiomyocytes (PSC-CMs) are a mixed population of atrial-, ventricular-, and pacemaker-like cells in the dish, hindering the future of precision cardiovascular medicine. Recent insights gleaned from the developing heart have paved new avenues to refine subtype-specific cardiomyocytes from patients with known pathogenic genetic variants and clinical phenotypes. Here, we discuss the recent progress on generating subtype-specific (atrial, ventricular, and nodal) cardiomyocytes from the perspective of embryonic heart development and how human pluripotent stem cells will expand our current knowledge on molecular mechanisms of cardiovascular disease and the future of precision medicine. Significance statement This review summarizes the recent progress on how to generate chamber-specific cardiomyocytes from human pluripotent stem cells from the perspective of developmental biology. Precise generation of atrial-, ventricular-, and pacemaker-like cardiomyocytes will greatly facilitate the translational applications of patient-derived induced pluripotent stem cells. Generation of subtype-specific cardiomyocytes for modeling cardiovascular disease and precision medicine. Open in new tabDownload slide Open in new tabDownload slide atrial cardiomyocytes, human pluripotent stem cells, nodal cardiomyocytes, subtype-specific cardiomyocytes, ventricular cardiomyocytes INTRODUCTION Human pluripotent stem cells (PSCs), including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs), have greatly revolutionized modern cardiovascular medicine due to their ability to generate any cell type in the cardiovascular system. Human ESCs are derived from the inner cell mass of developing embryos (blastocysts), and thus they cannot be patient-specific 1. Patient-specific PSCs can be generated by two reprograming mechanisms: somatic cell nuclear transfer (SCNT) 2 and iPSC reprograming 3. SCNT is the process of cellular reprogramming of somatic cells by injecting the nucleus of a somatic cell into an enucleated oocyte that is both technically and ethically challenging. In contrast, human iPSCs can be derived by transient overexpression of four transcription factors (OCT4/SOX2/CMYC/KLF4), thus circumventing the ethical barriers for translational medicine. Although differentiated cells from isogenic SCNT-ESCs and iPSCs are equivalent in the aspects of molecular and functional properties 4, patient-specific iPSCs have become prevalent in current biomedical research. Large banks of disease-specific iPSCs have been created and distributed around the world, which are transforming our understanding of cardiovascular science and health. Human iPSCs have been extensively employed to model prevalent heart disease, such as long QT syndrome 5-7, Brugada syndrome 8, arrhythmogenic right ventricular dysplasia 9, dilated cardiomyopathy (DCM) 10,11, and hypertrophic cardiomyopathy (HCM) 12. In addition, human iPSC-derived cardiomyocytes (iPSC-CMs) are considered powerful platforms for novel drug screening and cardiac toxicity testing 13. Recent CiPA (Comprehensive in vitro Proarrhythmia Assay) studies, initiated by the US Food and Drug Administration (FDA), have highlighted the importance of using human iPSC-CMs to evaluate drug-induced arrhythmic effects 14. Moreover, drug-induced cardiac toxicity, as seen with the chemotherapeutic agent doxorubicin, can be recapitulated in patient-derived iPSC-CMs, where genetic variance responsible for cardiac toxicity may be inferred for clinical references 15, 16. This has paved the way to an innovative high-throughput approach to screen novel drugs that can prevent and reverse cardiac toxicity caused by anticancer chemotherapy drugs 17. Though human cardiomyocytes can now be derived in a patient-specific manner through iPSC reprogramming, most of these studies have been carried out with a mixed population of atrial-, ventricular-, and pacemaker-like cardiomyocytes. The mixed subtypes of cardiomyocytes may confound the disease phenotypes in the dish and compromise the therapeutic outcomes of transplanted cells in vivo 18-21. Therefore, it is becoming increasingly important to develop subtype-specific differentiation protocols for precise generation of atrial-, ventricular-, and nodal-like cardiomyocytes in the petri dish. The protocols for cardiac differentiation from human PSCs have been greatly improved in the past decade, transitioning from embryoid body (EB) and growth factor-based differentiation to small molecule-mediated monolayer differentiation. Numerous excellent review articles on cardiac differentiation methods have been well documented and readers can refer therein 22,23. In this review, we will discuss how to generate subtype-specific cardiomyocytes using strategies mimicking embryonic heart chamber development, and how the precise production of chamber-specific cardiomyocytes will impact the future of cardiovascular disease modeling and precision medicine. While epicardial- and endocardial-derived cells also make important contributions to the mature heart, a comprehensive discussion of these cellular contributors is beyond the scope of this review and excellent reviews on human PSC-derived endothelial and epicardial cells (cardiac fibroblasts) have been recently published elsewhere 20,24. Here we will focus on different cardiomyocyte subtypes (atrial, ventricular, and nodal) generated by human PSC differentiation. DEVELOPMENTAL ORIGIN OF CHAMBER-SPECIFIC CARDIOMYOCYTES The human heart has four chambers: two atria and two ventricles. Multiple cell types comprise the four-chambered adult heart, where cardiomyocytes are the essential components responsible for maintaining the biochemical, mechanical, and electrical functions of the beating heart. The myocardium forms the muscular walls of the cardiac chambers and is primarily composed of atrial and ventricular cardiomyocytes. Pacemaker cells and Purkinje fibers are specialized cardiomyocytes capable of generating and conducting electrical impulses. Cardiomyocytes work together with other cell types in the heart, such as the endocardial cells that line the inner surface of the cardiac chambers, the endothelial cells, and smooth muscle cells in the coronary vasculature, and the epicardial-derived fibroblasts, to pump blood to the entire body. Recent single-cell transcriptomic analysis of developing human heart further defines chamber-specific cell identity and reflects the developmental trajectories of various cell types in a spatiotemporal manner 25. This work has provided potential clues to refine transcriptional signatures of subtype-specific cardiomyocytes derived from PSCs at the single-cell level 26 (Figure 1). FIGURE 1 Open in new tabDownload slide Single-cell transcriptomic profiles of atrial and ventricular chambers of human fetal heart. A, Anatomy of human heart chambers (image by courtesy of Centers for Disease Control and Prevention, National Center on Birth Defects and Developmental Disabilities). B, Visualization of the clusters of single-cell transcriptomes from human fetal ventricles (LV and RV) and atria (LA and RA) using the UMAP algorithm. The single-cell RNA-seq data were extracted from the study by Cui et al., Cell Reports 2019 25. C, Rankings of chamber-specific genes in one cluster compared to the rest of clusters. Notably, single-cell transcriptomic analysis has identified ventricular-specific genes MYL2 and MYH7, and atrial-specific genes MYH6 in human fetal heart. LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle FIGURE 1 Open in new tabDownload slide Single-cell transcriptomic profiles of atrial and ventricular chambers of human fetal heart. A, Anatomy of human heart chambers (image by courtesy of Centers for Disease Control and Prevention, National Center on Birth Defects and Developmental Disabilities). B, Visualization of the clusters of single-cell transcriptomes from human fetal ventricles (LV and RV) and atria (LA and RA) using the UMAP algorithm. The single-cell RNA-seq data were extracted from the study by Cui et al., Cell Reports 2019 25. C, Rankings of chamber-specific genes in one cluster compared to the rest of clusters. Notably, single-cell transcriptomic analysis has identified ventricular-specific genes MYL2 and MYH7, and atrial-specific genes MYH6 in human fetal heart. LA, left atrium; LV, left ventricle; RA, right atrium; RV, right ventricle During the initial stages of heart development, the precursors of subtype-specific cardiomyocytes (atrial, ventricular, and pacemaker cells) originate from distinct cellular populations in the first heart field (FHF) and second heart field (SHF) 27 (Figure 2). Mammalian cardiogenesis starts with the formation of cardiac mesoderm shortly after gastrulation. Mesoderm induction is triggered by multiple growth factors secreted from the adjacent endoderm, including bone morphogenetic protein 4 (BMP4) and Nodal. Nodal signaling in the proximal epiblast triggers Bmp4 expression in the extraembryonic ectoderm adjacent to the epiblast. BMP4 then induces Wnt3 expression in the epiblast, which further leads to the commitment of mesoderm marked by the expression of T (brachyury) and Eomes 35. Cardiac commitment is initiated by the induction of the transcription factors NKX2.5 (NK2 transcription factor related, locus 5) and MESP1 36,37. The homeobox protein, NKX2.5, is expressed in early cardiac mesoderm, cardiac progenitors, and early cardiomyocytes in the left ventricular and atrial chambers where it cooperates with the zinc finger transcription factors of the GATA family to activate cardiac gene expression. MESP1 (mesoderm posterior 1), one of the earliest molecular markers of cardiac progenitors, is then transiently expressed in the newly formed cardiac mesoderm. MESP1 is a master regulator of multipotent cardiac progenitor specification for both FHF and SHF during early gastrulation 38. MESP1+ progenitors consist of two temporarily distinct ancestors: FHF MESP1+ cells contribute to myocardium whereas SHF MESP1+ progenitors contribute to both the endocardium and myocardium 39. Recent studies have shown that SHF progenitors from human PSCs can generate cardiomyocytes, smooth muscle cells, and endothelial cells 40. FIGURE 2 Open in new tabDownload slide Schematic view of the developmental scenarios of cardiomyocyte commitment. Cardiac mesoderm is induced in response to signals (BMP4 and WNT) originated from the adjacent endoderm shortly after gastrulation. Cardiac commitment is initiated by early cardiogenic transcription factors such as MESP1 and cardiac mesoderm is marked by MESP1, KDR, and PDGFRA 28,29. Early cardiovascular progenitors (ISL1+) migrate and contribute to the first heart field (FHF) and the second heart field (SHF) progenitors 30. The FHF progenitors (NKX2.5+ISL1−) contribute to the left ventricle and portions of the atria, whereas the SHF progenitors (NKX2.5+ISL1+) generate the right ventricle, outflow tract, and parts of atria 31,32. Other sources of progenitors may also contribute to the final cardiac subtype lineages. For example, HCN4+ FHF cells contribute to SAN conduction cells 33; in chicks SAN pacemaker cells are derived from the tertiary heart field 34. The cardiac subtype commitment is regulated by the cooperative interactions of the extrinsic signaling pathways (BMP, RA, and NOTCH) and the intrinsic transcriptional regulatory network (NKX2.5, GATA4, MEF2C, and TBX5) FIGURE 2 Open in new tabDownload slide Schematic view of the developmental scenarios of cardiomyocyte commitment. Cardiac mesoderm is induced in response to signals (BMP4 and WNT) originated from the adjacent endoderm shortly after gastrulation. Cardiac commitment is initiated by early cardiogenic transcription factors such as MESP1 and cardiac mesoderm is marked by MESP1, KDR, and PDGFRA 28,29. Early cardiovascular progenitors (ISL1+) migrate and contribute to the first heart field (FHF) and the second heart field (SHF) progenitors 30. The FHF progenitors (NKX2.5+ISL1−) contribute to the left ventricle and portions of the atria, whereas the SHF progenitors (NKX2.5+ISL1+) generate the right ventricle, outflow tract, and parts of atria 31,32. Other sources of progenitors may also contribute to the final cardiac subtype lineages. For example, HCN4+ FHF cells contribute to SAN conduction cells 33; in chicks SAN pacemaker cells are derived from the tertiary heart field 34. The cardiac subtype commitment is regulated by the cooperative interactions of the extrinsic signaling pathways (BMP, RA, and NOTCH) and the intrinsic transcriptional regulatory network (NKX2.5, GATA4, MEF2C, and TBX5) Descendants of MESP1+ cardiac progenitors colonize and form all of the myocardium 41. The cardiac mesoderm gives rise to the endocardium, the FHF, the SHF, and the proepicardial mesenchyme. The FHF forms the left ventricle and parts of the atria, and the SHF contributes to the right ventricle, outflow tract, and portions of the atria. Further myocardial differentiation is initiated by the transcriptional activation of key myocardial transcription factors, such as NKX2.5, GATA4, MEF2C, TBX5, HAND2, and ISL1 42. Mutations in many of these cardiac transcription factors have been linked to congenital heart defects in humans 43. MESP1-mediated cardiac transcriptional activation is dependent on the signaling pathways induced by BMPs and fibroblast growth factor 27, and MESP1 promotes cardiovascular differentiation by blocking Dkk-1 mRNA expression in the canonical Wnt signaling pathway 44. Cardiac mesoderm progenitors converge and form a primitive heart tube that includes an interior layer (endocardium) and exterior layer (myocardium). Consequently, FHF- and SHF-derived cardiac progenitor cells incorporate and proliferate within the heart tube. Cardiomyocyte differentiation and proliferation is initiated in response to NOTCH signaling from the endocardium. Retinoic acid (RA) from the epicardium regulates myocardial proliferation by inducing FGF signaling 45-47. These two signaling pathways play essential roles in the subsequent cardiovascular development, including endocardial-to-mesenchymal transition/endocardial cushion formation, valve development, epithelial-to-mesenchymal transition, ventricular trabeculation, and cardiac outflow tract morphogenesis 48,49. Recent studies have demonstrated that they are prospective signal pathways that could be manipulated to derive subtype-specific cardiomyocytes from human PSCs 18. Thus, in the following sections, we will discuss the mechanistic insights into the pivotal functions of the NOTCH and RA signaling in cardiomyocyte differentiation and heart development, and how we can manipulate these signals to coax PSCs into a more defined cardiomyocyte subtype. NOTCH SIGNALING PATHWAY AND CARDIAC DEVELOPMENT NOTCH signaling plays an essential role in the cell fate determination and morphogenesis of cardiac chambers in the developing heart. NOTCH modulates cardiomyocyte proliferation and differentiation and is required for ventricular chamber formation and coronary vessel specification 48,50. NOTCH signaling is also a key regulator of artery formation during arteriovenous specification in the vessel development. The core components of the NOTCH pathway include four receptors (NOTCH1-4) and two families of ligands (JAG1-2, DLL1, DLL3, and DLL4). Receptor-ligand interactions lead to a series of proteolytic cleavages and ultimately the release of the NOTCH intracellular domain (NICD) from the cell membrane (Figure 3A). This allows for NICD to translocate to the nucleus where it forms an activation complex with the RBPJ (Recombining binding protein suppressor of hairless) protein by evicting a histone deacetylase corepressor (CoR). The activation complex further recruits histone acetyltransferase (HAc) and MAML1 (Mastermind-like protein 1), and triggers the transcriptional activation of NOTCH target genes including the bHLH transcriptional repressors HEY1 (Hairy/enhancer-of-split related with YRPW motif protein 1) and HEY2 51,52. FIGURE 3 Open in new tabDownload slide NOTCH signaling pathway and roles in ventricular chamber development and heart disease. A, Schematic illustration of NOTCH signal transduction. Membrane-bound NOTCH ligands (JAG1-2, DLL1, DLL3, and DLL4) bind to transmembrane NOTCH receptors (NOTCH1-4) in neighboring cells. The interaction between NOTCH receptors and ligands leads to a series of proteolytic cleavages of the receptor. The cleavage by γ-secretase results in the release of NOTCH intracellular domain (NICD) from the membrane. The NICD then translocates to the nucleus and forms an activation complex with the RBPJ by replacing a histone deacetylase corepressor (CoR). The activation complex further recruits the histone acetyltransferase (HAc) and initiates the transcriptional activation of the downstream NOTCH target genes including the transcriptional repressors, HEY1 and HEY2. B, During embryonic heart development, the crosstalk between endocardial NOTCH receptors and myocardial ligands is required for ventricular trabeculation, cardiac valve formation, and outflow tract development. Dysregulation of cardiac NOTCH signaling in the developing heart leads to congenital heart defects and cardiomyopathy FIGURE 3 Open in new tabDownload slide NOTCH signaling pathway and roles in ventricular chamber development and heart disease. A, Schematic illustration of NOTCH signal transduction. Membrane-bound NOTCH ligands (JAG1-2, DLL1, DLL3, and DLL4) bind to transmembrane NOTCH receptors (NOTCH1-4) in neighboring cells. The interaction between NOTCH receptors and ligands leads to a series of proteolytic cleavages of the receptor. The cleavage by γ-secretase results in the release of NOTCH intracellular domain (NICD) from the membrane. The NICD then translocates to the nucleus and forms an activation complex with the RBPJ by replacing a histone deacetylase corepressor (CoR). The activation complex further recruits the histone acetyltransferase (HAc) and initiates the transcriptional activation of the downstream NOTCH target genes including the transcriptional repressors, HEY1 and HEY2. B, During embryonic heart development, the crosstalk between endocardial NOTCH receptors and myocardial ligands is required for ventricular trabeculation, cardiac valve formation, and outflow tract development. Dysregulation of cardiac NOTCH signaling in the developing heart leads to congenital heart defects and cardiomyopathy In mouse embryos, the Notch receptor (Notch1) and ligands Dll4 and Jag1 are first detected in primitive E7.5 endocardium, suggesting a regulatory role of Notch signaling in early cardiogenesis 53. In E8.0 embryos, with the separation of the inner endocardium and outer myocardium, Jag1 is expressed in the primitive myocardium, whereas Dll4, Notch1, Notch2, and Notch4 are restricted to the endocardium (Figure 3B). At E9.5, the epicardium, which differentiates from the proepicardial organ, emerges and expresses several Notch components, including Notch1, Dll4, Jag1, Notch2, Notch3, and Hey1, and subsequently migrates to cover the entire myocardial surface by E11.0 54,55. Epicardium, myocardium, and endocardium mutually interact, and cooperate in a series of coordinated patterns of proliferation and differentiation to form a mature 4-chambered heart. The endocardium lines the lumen of the cardiac chambers and contributes to the atrioventricular valves and part of outflow tract (semilunar) valves; the myocardium consists of contractile cardiomyocytes; and the epicardium gives rise to smooth muscle cells and vasculature structure. Notch signaling is required for normal ventricular chamber development and spatial allocation of cardiomyocytes to their proper morphological position in the ventricular wall. Notch1 mutant embryos display defective trabeculation with abnormal cardiomyocyte proliferation and differentiation 45,56. The loss-of-function of Notch1 results in extensive expansion of cardiac progenitor cells (CPCs) and impairs their differentiation through regulation of cardiac transcription factor, Isl1, which is required for CPCs differentiation into cardiomyocytes and smooth muscle cells 57. Recent studies demonstrate that Notch signaling first incorporates cardiac endocardium and myocardium to sustain trabeculation, and then coordinates ventricular patterning and compaction with coronary artery development to generate a mature ventricular chamber 58. In addition, pathogenic variants in NOTCH signaling pathway members have been associated with congenital cardiac malformations, such as bicuspid aortic valve and tetralogy of Fallot, along with cardiomyopathy in humans 59-63. RETINOIC ACID, CARDIOGENESIS, AND CONGENITAL HEART DEFECTS RA, a derivative of vitamin A, is the first diffusible morphogen identified during vertebrate development 64. It binds to retinoic acid receptors (RARα, β, and γ), which are nuclear receptors and can act as transcription factors (Figure 4). RARs act as ligand-inducible activators by forming heterodimers with any of three retinoid X receptors (RXRα, β, and γ) 68. The RAR-RXR heterodimer complex regulates transcription by binding to RA response elements (RAREs) near target genes. In the absence of RA signaling (a repressive state), RAR-RXR heterodimer recruits CoRs such as nuclear receptor CoR 1 (NCOR1) and NOCR2 that further recruit histone deacetylase (HDAC) and Polycomb repressive complex 2 (PRC2), leading to condensed chromatin and gene silencing deposited by H3 lysine 27 trimethylation (H3K27me3) 69,70. The RA binding triggers a functional change in the RAR-RXR heterodimer, which evicts repressive factors and recruits coactivators such as nuclear receptor coactivator 1 (NCOA1) or NCOA2. These coactivators initiate the recruitment of HAc complexes and Trithorax proteins that modulate H3K4me3 and result in permissive chromatin and gene activation 71. FIGURE 4 Open in new tabDownload slide Retinoic acid signaling and its regulatory roles in atrial cardiomyocyte lineage commitment. Retinol binds to retinol binding protein 4 (RBP4) and is transported to the cytosol by the cooperation of a cell-surface RBP receptor, STRA6 (stimulated by retinoic acid gene 6). With the assistance of cellular retinol bind protein (CRBP), retinol is transformed to retinaldehyde that is catalyzed by retinol dehydrogenase (RDH). Retinaldehyde is further converted to retinoic acid (RA) by the retinaldehyde dehydrogenase (RALDH). RA then binds to the cellular retinoic acid binding protein (CRABP) and translocates into the nucleus, where RA binds to RA receptors (RARs). RARs are ligand-inducible activators by forming heterodimers with any of three retinoid X receptors (RXR). The RAR-RXR heterodimer complex binds to the RA response elements (RAREs) and regulates nearby gene expression. Alternatively, excessive RA is either secreted outside the cytosol as paracrine signal or degraded by the cytochrome P450 family 26 (CYP26) enzyme. During embryonic cardiogenesis, RA signal determines the atrial chamber morphogenesis and mediates atrial cardiomyocyte differentiation, possibly through interacting with the transcription factor COUP-TFII that is a RA-activated nuclear receptor 65 and could potentially suppress the RXR-mediated RA signaling pathway 66,67 FIGURE 4 Open in new tabDownload slide Retinoic acid signaling and its regulatory roles in atrial cardiomyocyte lineage commitment. Retinol binds to retinol binding protein 4 (RBP4) and is transported to the cytosol by the cooperation of a cell-surface RBP receptor, STRA6 (stimulated by retinoic acid gene 6). With the assistance of cellular retinol bind protein (CRBP), retinol is transformed to retinaldehyde that is catalyzed by retinol dehydrogenase (RDH). Retinaldehyde is further converted to retinoic acid (RA) by the retinaldehyde dehydrogenase (RALDH). RA then binds to the cellular retinoic acid binding protein (CRABP) and translocates into the nucleus, where RA binds to RA receptors (RARs). RARs are ligand-inducible activators by forming heterodimers with any of three retinoid X receptors (RXR). The RAR-RXR heterodimer complex binds to the RA response elements (RAREs) and regulates nearby gene expression. Alternatively, excessive RA is either secreted outside the cytosol as paracrine signal or degraded by the cytochrome P450 family 26 (CYP26) enzyme. During embryonic cardiogenesis, RA signal determines the atrial chamber morphogenesis and mediates atrial cardiomyocyte differentiation, possibly through interacting with the transcription factor COUP-TFII that is a RA-activated nuclear receptor 65 and could potentially suppress the RXR-mediated RA signaling pathway 66,67 As a vitamin A metabolite, RA plays an important role in early heart development 49. Its function primarily depends on a tight control of RA distribution within the embryo through the spatiotemporal regulation of the RA synthesizing (RALDH1-3) and metabolizing enzymes (CYP26). Many insights have been gained from studying Raldh mutant embryos. Early studies in zebrafish embryos indicate that RA signaling is necessary to restrict the pool of cardiac progenitor cells and maintain a developmental balance between cardiac and noncardiac identities 72. Homozygous knockout of Raldh2 in mouse embryos leads to abnormal development of the SHF with an expansion of Isl1+ cardiac progenitor populations and compromised deployment of SHF cells within the heart tube 73. In addition, RA signaling specifies Tbx5+ progenitors of the FHF to a venous and atrial cell type, as blockade of RA synthesis results in an abnormal heart that lacks the atrial chamber. Further investigations have suggested that atrial-specific gene expression is modulated by local synthesis of RA, and RA exclusion is required for the correct specification of ventricles in the heart 49,74. In vitro studies imply that RA signal can modulate the differentiation of atrial and ventricular cardiomyocytes from mouse and human pluripotent stem cells. RA signaling promotes atrial-specific gene expression to generate atrial-like cardiomyocytes in differentiating PSCs 75-77. RA-induced atrial specification is mediated by the upregulation of the transcription factor COUP-TFII, a RA-activated receptor and key regulator that determines atrial identity 65,78. Cardiomyocyte-specific COUP-TFII ablation in mice results in ventricularized atria that display ventricle-like action potentials, increased cardiomyocyte size, and development of extensive T tubules. Nevertheless, the effect of RA on the development of atrial-like myocytes at the expense of ventricular lineage is restricted to a narrow developmental window corresponding to the cardiac mesoderm stage, when distinct mesodermal populations are committed to atrial and ventricular cardiomyocytes 18,19. The combination of RA, BMP, and WNT signaling directs human PSCs toward epicardial lineage, including cardiac fibroblasts and vascular smooth muscle cells 79,80. Though RA treatment does not influence the expression of cardiac conduction tissue marker Hcn4 during cardiac differentiation of PSCs 81, the combination of RA and BMP signaling promotes the differentiation of sinoatrial node-like pacemaker cells from human PSCs 82. GENERATION OF ATRIAL-, VENTRICULAR-, AND NODAL-LIKE CARDIOMYOCYTES FROM HUMAN PSCs AND IMPLICATIONS IN CARDIOVASCULAR DISEASE MODELING AND PRECISION MEDICINE With the discovery of human iPSCs, patient-specific cardiomyocytes have been employed to model cardiovascular disease, screen novel drugs, and perform cardiac toxicity testing 14,83. Cardiomyocyte differentiation protocols have been extensively developed in the past decade: from EB-based 3-D differentiation to small molecule-induced monolayer differentiation 22,23. Robust cardiomyocyte generation can now be achieved in chemically defined conditions by sequential modulation of WNT signaling 84,85. Despite an immature and fetal-like phenotype, iPSC-CMs display a mixture of atrial-, ventricular-, and nodal-like electrophysiological features 86. Subtype-specific cardiomyocytes have been generated by multiple differentiation protocols that employ a cocktail of chemicals and growth factors (Table 1). A number of subtype-specific and genetically engineered reporter PSC lines have been created to facilitate the purification and characterization of subtype-specific cardiomyocytes (Table S1). Together with tissue engineering technologies, atrial- and ventricular-specific cardiac tissue has been recently constructed, which is capable of recapitulating chamber-specific electrophysiological spectrum and drug responses 21. In the following section, we will review the strategies to generate subtype-specific cardiomyocytes from human PSCs (Figure 5) and how they impact current cardiac cell therapy and disease modeling. TABLE1 Subtype-specific cardiomyocyte differentiation by sequential manipulation of developmental signaling pathways during heart development Subtypes . Mesoderm induction . Cardiac progenitors . CM specification . References . Days 1-3 . Days 3-5 . Days 5-7 . Atrial CMs Low nodal BMP FGF WNT WNT inhibition RA Retinoic acid (RA) Zhang et al 75 Devalla et al 76 Lee et al 18 Cyganek et al 19 Ventricular CMs High nodal BMP FGF WNT WNT inhibition RA inhibition Noggin Zhang et al 75 Lian et al 84 Burridge et al 85 Karakikes et al 87 Pacemaker CMs Low nodal BMP FGF WNT BMP RA WNT inhibition FGF inhibition WNT Protze et al 82 Liang et al 88 Ren et al 89 Subtypes . Mesoderm induction . Cardiac progenitors . CM specification . References . Days 1-3 . Days 3-5 . Days 5-7 . Atrial CMs Low nodal BMP FGF WNT WNT inhibition RA Retinoic acid (RA) Zhang et al 75 Devalla et al 76 Lee et al 18 Cyganek et al 19 Ventricular CMs High nodal BMP FGF WNT WNT inhibition RA inhibition Noggin Zhang et al 75 Lian et al 84 Burridge et al 85 Karakikes et al 87 Pacemaker CMs Low nodal BMP FGF WNT BMP RA WNT inhibition FGF inhibition WNT Protze et al 82 Liang et al 88 Ren et al 89 Note: This summary is primarily based on the 2-D monolayer differentiation. RA can be added as early as day 3 for atrial CM differentiation in an EB-based differentiation protocol 18. Open in new tab TABLE1 Subtype-specific cardiomyocyte differentiation by sequential manipulation of developmental signaling pathways during heart development Subtypes . Mesoderm induction . Cardiac progenitors . CM specification . References . Days 1-3 . Days 3-5 . Days 5-7 . Atrial CMs Low nodal BMP FGF WNT WNT inhibition RA Retinoic acid (RA) Zhang et al 75 Devalla et al 76 Lee et al 18 Cyganek et al 19 Ventricular CMs High nodal BMP FGF WNT WNT inhibition RA inhibition Noggin Zhang et al 75 Lian et al 84 Burridge et al 85 Karakikes et al 87 Pacemaker CMs Low nodal BMP FGF WNT BMP RA WNT inhibition FGF inhibition WNT Protze et al 82 Liang et al 88 Ren et al 89 Subtypes . Mesoderm induction . Cardiac progenitors . CM specification . References . Days 1-3 . Days 3-5 . Days 5-7 . Atrial CMs Low nodal BMP FGF WNT WNT inhibition RA Retinoic acid (RA) Zhang et al 75 Devalla et al 76 Lee et al 18 Cyganek et al 19 Ventricular CMs High nodal BMP FGF WNT WNT inhibition RA inhibition Noggin Zhang et al 75 Lian et al 84 Burridge et al 85 Karakikes et al 87 Pacemaker CMs Low nodal BMP FGF WNT BMP RA WNT inhibition FGF inhibition WNT Protze et al 82 Liang et al 88 Ren et al 89 Note: This summary is primarily based on the 2-D monolayer differentiation. RA can be added as early as day 3 for atrial CM differentiation in an EB-based differentiation protocol 18. Open in new tab FIGURE 5 Open in new tabDownload slide Strategic protocols for generating subtype-specific cardiomyocytes and their implications in modeling cardiovascular disease and precision medicine. Pluripotent stem cells are induced to cardiac mesoderm by activation of WNT and BMP signaling. Cardiac progenitors are committed by the administration of WNT inhibitors such as IWR-1. Sequential manipulation of WNT signaling gives rise to robust cardiomyocyte differentiation in a monolayer culture system under chemically defined conditions. For cardiac progenitors, RA signaling directs toward atrial subtype commitment whereas inhibition of RA signaling promotes ventricular lineage differentiation. In addition, RA and BMP cooperate to instruct cardiac progenitors to SAN pacemaker cell fate. Canonical Wnt signaling also promotes pacemaker cell specification from cardiac mesoderm cells. Precision production of subtype-specific cardiomyocytes has the potential to elucidate cardiovascular disease mechanisms and facilitate the development of individual-based therapies. For example, atrial-like cardiomyocytes can be used to model atrial disease for drug discovery, large-scale production of ventricular-like cardiomyocytes may be utilized as a cell therapy for myocardial infarction, and patient-derived pacemaker cells are promising source for biological pacemakers FIGURE 5 Open in new tabDownload slide Strategic protocols for generating subtype-specific cardiomyocytes and their implications in modeling cardiovascular disease and precision medicine. Pluripotent stem cells are induced to cardiac mesoderm by activation of WNT and BMP signaling. Cardiac progenitors are committed by the administration of WNT inhibitors such as IWR-1. Sequential manipulation of WNT signaling gives rise to robust cardiomyocyte differentiation in a monolayer culture system under chemically defined conditions. For cardiac progenitors, RA signaling directs toward atrial subtype commitment whereas inhibition of RA signaling promotes ventricular lineage differentiation. In addition, RA and BMP cooperate to instruct cardiac progenitors to SAN pacemaker cell fate. Canonical Wnt signaling also promotes pacemaker cell specification from cardiac mesoderm cells. Precision production of subtype-specific cardiomyocytes has the potential to elucidate cardiovascular disease mechanisms and facilitate the development of individual-based therapies. For example, atrial-like cardiomyocytes can be used to model atrial disease for drug discovery, large-scale production of ventricular-like cardiomyocytes may be utilized as a cell therapy for myocardial infarction, and patient-derived pacemaker cells are promising source for biological pacemakers GENERATION OF ATRIAL-LIKE CARDIOMYOCYTES FROM HUMAN PSCs Inspired by the elucidation of molecular regulators of chamber formation in the developing heart, scientists have invested much effort on manipulating key signaling molecules to coax human PSCs to atrial-like cardiomyocytes in vitro. One of the crucial players is RA signaling (Figure 4). Using atrial CM-specific reporter cell lines, several groups have found that RA promotes cardiac progenitor cells toward an atrial-like subtype in both mouse and human PSCs 18,19,75-77. Regardless of monolayer or EB-mediated differentiation, RA should be administered in a narrow window to direct progenitor cells into an atrial-like lineage. Excessive RA signaling exposure may cause severe cardiac malformations such as enlarged atrial chambers and small ventricles in mouse and chicken embryos 74. This restrictive temporal window corresponds to mouse embryonic day E7.5 to E8.5 when cardiac mesoderm progenitors are migrating from the primitive streak. Therefore, RA is usually added for a short period of time (2-3 days) to stimulate atrial specification after the cardiac mesoderm is committed during human PSC differentiation 18,19. In contrast, RA inhibition leads to ventricular cardiomyocyte specification, which will be discussed in detail in the following section. Recent studies have demonstrated that atrial and ventricular subtypes are derived from distinct mesoderm progenitors that can be distinguished by different cell surface markers 18. Using different concentrations of BMP4 and Activin A, human PSCs can be induced to distinct mesoderm populations: CD235a+ CYP26A1+ and RALDH2+ ALDH+ mesoderm progenitors. In the absence of RA signaling, CD235a+ CYP26A1+ mesoderm gives rise to ventricular cardiomyocytes whereas RALDH2+ ALDH+ mesoderm tends to generate atrial subtype. However, in the presence of RA, RALDH2+ ALDH+ mesoderm efficiently gives rise to atrial-like cardiomyocytes whereas CD235a+ CYP26A1+ mesoderm inefficiently produces atrial-like cardiomyocytes 18. Therefore, the balance between RA synthesis and degradation appears to modulate the generation of atrial cardiomyocytes. An emerging pathway to promote the atrial-specific cell fate is NOTCH signaling. As discussed earlier, NOTCH signaling is required for ventricular chamber specification during heart development 45,48,58. NOTCH activation inhibits COUP-TFII activity that is essential for atrial chamber formation in the developing heart 78. Conversely, COUP-TFII suppresses NOTCH activity and may indirectly promote atrial cardiomyocyte specification 90-92. Loss-of-function of HEY2, a NOTCH pathway downstream transcription factor, dramatically boosts atrial specification by increasing the percentage of atrial-like cardiomyocytes without exogenous RA exposure 92. As NOTCH signaling also regulates ion channel activity and electrophysiological properties in the heart chamber 93,94, further investigation of its roles in the atrial and ventricular cardiomyocyte specification is warranted. GENERATION OF VENTRICULAR-LIKE CARDIOMYOCYTES FROM HUMAN PSCs AND USE IN CELL THERAPY AND DRUG DISCOVERY Human iPSC-derived cardiomyocytes are potential donor cells for regenerating the injured heart caused by ischemic myocardial infarction, as evidenced by functional restoration in left ventricular chamber in nonhuman primates after the injection of PSC-CMs 95. However, ventricular arrhythmias have been observed in the human PSC-CM-grafted primates, possibly due to the mixed atrial- and ventricular-like cardiomyocytes in the grafts 96,97. Therefore, enriching ventricular cardiomyocytes while eliminating other subtype cells is paramount for clinically implementing human PSC-CM mediated cardiac regeneration. Current cardiomyocyte differentiation protocols generate populations of cells in which more than half is ventricular-like cardiomyocytes, but this is mixed with small numbers of atrial- and pacemaker-like cells. Multiple strategies have been proposed to purify ventricular-like cardiomyocytes for cell therapy purpose (Figure 5). First, a number of ventricular-specific reporter lines have been created to enrich the ventricular cardiomyocyte subtype (Table S1) 98. In these reporter lines, a fluorescence protein is cloned into the endogenous MLC2v locus or driven by an MLC2v promoter for selection of ventricular-like cardiomyocytes 99,100. This reporter can also be combined with a second cardiac marker such as NKX2.5 for double selection 101. A dual reporter line NKX2.5EGFP/+ COUP-TFIImCherry/+ is generated to segregate atrial from ventricular cardiomyocytes based upon COUP-TFII expression 102. The EGFP+/mCherry− cells exhibit transcriptional and electrophysiological characteristics of ventricular subtype. Recently, NKX2-5TagRFP and TBX5Clover2 dual reporters have been engineered to extract FHF-like and SHF-like progenitor cells. TBX5+ NKX2-5+ FHF-like cells give rise to ventricular-like cardiomyocytes whereas TBX5− NKX2-5+ SHF-like progenitors are prone to generate atrial-like cardiomyocytes 40. In addition, cell surface markers have been sought for the purification of ventricular-like cardiomyocytes. Though SIPRA is a general surface marker for isolating TNNT2+ beating cardiomyocytes from human PSCs 103, a CD77+/CD200− cell-surface signature is recently identified for the enrichment of ventricular-like cardiomyocytes 104. Also, a combination of small molecules and growth factors is used to stimulate ventricular subtype specification during cardiac differentiation 87,105. Sequential administration of BMP4, Rho kinase inhibitor, Activin A, and IWR-1 in cardiogenic embryoid bodies generates over 92% of ventricular-like cardiomyocytes, which is confirmed via ventricular-specific action potential duration and ionic current. Lastly, inhibition of RA signaling indirectly promotes ventricular subtype specification 75. A pan-retinoic acid receptor antagonist BMS-189453 together with Noggin significantly directs the cardiac progenitors toward a ventricular-like subtype. Alternatively, ventricular-like cardiomyocytes can be derived from CD235a+ CYP26A1+ mesoderm progenitors in the absence of RA signaling 18. GENERATION OF NODAL-LIKE CARDIOMYOCYTES FROM HUMAN PSCs FOR DEVELOPMENT OF BIOLOGICAL PACEMAKER CELLS TO TREAT CARDIAC ARRHYTHMIAS The sinoatrial node (SAN) pacemaker cells possess pivotal roles in the cardiac conduction system and control heart rate throughout life. Dysfunction of SAN pacemaker cells leads to the reduction of heart rate and insufficient blood circulation, which currently can be managed by the implantation of an artificial (electronic) pacemaker. Generating biological SAN pacemakers in vitro may be an alternative cell therapy for the failing SAN (sinus arrhythmias) and may potentially replace an electronic pacemaker. In the developing heart, SAN pacemaker lineage specification is modulated by the coordinated interaction of multiple cardiogenic transcription factors that include TBX18, TBX3, SHOX2, NKX2.5, and ISL1 106-108. The SAN lineage originates from TBX18+ NKX2.5− mesoderm progenitors, and the lack of NKX2.5 expression distinguishes the SAN pacemaker cells from the NKX2.5+ atrial/ventricular cardiomyocytes and the atrioventricular node (AVN) pacemakers 109,110. In addition, hyperpolarization-activated cyclic nucleotide-gated potassium/sodium channel 4 (HCN4) is one of the ion channels that is specifically expressed in SAN pacemaker cells. HCN4 is initially expressed in the FHF, and gradually confined in the SAN during embryonic heart development 111. Generation of SAN-like pacemaker cells (SANLPCs) from human PSCs has been achieved by using transgene dependent and independent methods in the past decade (Figure 5). By mimicking the developmental scenario of SAN lineage specification, SANLPCs are generated from human PSCs through stage-specific activation of BMP and RA signaling pathways or from expandable cardiac progenitor cells induced by enforced expression of the c-MYC oncogene 112. The SIRPA+ CD90− SANLPCs are derived from NKX2.5− mesoderm progenitors by blocking FGF signaling 82. These SANLPCs show gene expression and electrophysiological characteristics of pacemaker cells, and successfully function as a biological pacemaker for the host rat ventricular cardiomyocytes upon transplantation. Recent studies have demonstrated that canonical WNT signaling promotes the differentiation of cardiac mesoderm toward pacemaker cardiomyocytes in human and mouse PSCs 88,89. Forced expression of pacemaker-specific transcription factors such as SHOX2 promotes differentiation of human PSC to pacemaker-like cells 113, and SHOX2 voltage-sensitive fluorescent protein (SHOX2-VSFP) positive cells display nodal-like action potential with high level of HCN4 expression 99. Forward overexpression of a nodal cell inducer TBX3 in human PSCs can facilitate the generation of functional nodal tissue 114. Similarly, overexpression of TGF-beta activated kinase (TAK1/MAP3K7) directs cardiac embryoid bodies toward the SAN lineage, suggesting a specific role of MAP3K7 in the differentiation of cardiac conduction system 115. Recently, Schweizer et al reported a direct pacemaker cell differentiation protocol by coculturing with the visceral endoderm-like cell line END-2 and subsequent exposure to FBS-enriched medium 116. A few SAN-specific markers have been identified to purify and enrich SAN cardiomyocytes from mouse and human PSCs 117. CD166+ cardiac precursors derived from PSCs are thought to develop into functional SAN pacemaker cells 118. In the developing heart, HCN4 marks the FHF at cardiac crescent stage and distinct cardiac conduction precursors at different developmental stages, then labels the entire conduction system by late fetal stages 33,119. In contrast, avian cardiac pacemaker cells are not derived from Hcn4+ cells in the FHF 34. HCN4 is dynamically expressed in PSC-derived pacemaker cells and may be insufficient to identify pacemaker-like cardiomyocytes 120. Additional chamber-specific structural and functional features should be carefully considered for the phenotypic characterization of differentiated human PSC-CMs 121. CONCLUSIONS AND PERSPECTIVES Precise generation of subtype-specific (atrial-, ventricular-, and nodal-like) cardiomyocytes will significantly improve the translational applications of patient-derived PSCs for disease modeling, cell therapy, and drug discovery. Atrial-like cardiomyocytes are particularly suitable for modeling atrial arrhythmias, such as atrial fibrillation. Large-scale production of pure ventricular-like cardiomyocytes has the potential to facilitate the restoration of cardiac function after myocardial infarction and abrogate possible ventricular arrhythmias in the graft after transplantation. Biological SAN pacemaker cells represent a promising alternative to artificial pacemakers that have serious drawbacks especially for newborns and children with heart block. Efficient methods of deriving atrial-, ventricular-, and nodal-like cardiomyocytes into homogenous populations will be a future challenge and may be circumvented by the identification of cardiac progenitors committed to a specific subtype lineage. Direct reprogramming of somatic cells 122 and forward programming of human PSCs by lineage-specific transcription factors 123 will advance our understanding on how diverse cardiac subtype identity is established and maintained during heart development. Recent emerging technologies, such as single-cell genomics 124, cardiac organoids 125, and CRISPR/Cas9-mediated genome editing 126 will propel the implementation of precision medicine in cardiovascular disease using more refined subtype-specific cardiomyocytes derived from individual patients. ACKNOWLEDGMENTS This study was supported by the American Heart Association (AHA) Career Development Awards 18CDA34110293 (M. -T. Z.) and 18CDA34110352 (N. S.), and National Institute of Health (NIH) grants R01 HL121797, R01 HL144009, and R01HL132801 (V. G.). Dr. M. -T. Z. was also supported by startup funds from the Abigail Wexner Research Institute at Nationwide Children's Hospital. CONFLICT OF INTEREST The authors declared no potential conflicts of interest. AUTHOR CONTRIBUTIONS M.-T.Z.: conception and design, manuscript writing, figure preparation, and final approval of manuscript; N.-Y.S., V.G.: manuscript writing and final approval of manuscript. DATA AVAILABILITY STATEMENT Data sharing is not applicable to this article as no new data were created or analyzed in this study REFERENCES 1 Thomson JA , Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts . Science . 1998 ; 282 ( 5391 ): 1145 - 1147 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Tachibana M , Amato P, Sparman M, et al. Human embryonic stem cells derived by somatic cell nuclear transfer . Cell . 2013 ; 153 ( 6 ): 1228 - 1238 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Takahashi K , Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors . Cell . 2007 ; 131 ( 5 ): 861 - 872 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Zhao MT , Chen H, Liu Q, et al. Molecular and functional resemblance of differentiated cells derived from isogenic human iPSCs and SCNT-derived ESCs . Proc Natl Acad Sci U S A . 2017 ; 114 ( 52 ): E11111 - E11120 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Itzhaki I , Maizels L, Huber I, et al. Modelling the long QT syndrome with induced pluripotent stem cells . Nature . 2011 ; 471 ( 7337 ): 225 - 229 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Yazawa M , Hsueh B, Jia X, et al. Using induced pluripotent stem cells to investigate cardiac phenotypes in Timothy syndrome . Nature . 2011 ; 471 ( 7337 ): 230 - 234 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Moretti A , Bellin M, Welling A, et al. Patient-specific induced pluripotent stem-cell models for long-QT syndrome . N Engl J Med . 2010 ; 363 ( 15 ): 1397 - 1409 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Liang P , Sallam K, Wu H, et al. Patient-specific and genome-edited induced pluripotent stem cell-derived cardiomyocytes elucidate single-cell phenotype of Brugada syndrome . J Am Coll Cardiol . 2016 ; 68 ( 19 ): 2086 - 2096 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Kim C , Wong J, Wen J, et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs . Nature . 2013 ; 494 ( 7435 ): 105 - 110 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Hinson JT , Chopra A, Nafissi N, et al. Titin mutations in iPS cells define sarcomere insufficiency as a cause of dilated cardiomyopathy . Science . 2015 ; 349 ( 6251 ): 982 - 986 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Sun N , Yazawa M, Liu J, et al. Patient-specific induced pluripotent stem cells as a model for familial dilated cardiomyopathy . Sci Transl Med . 2012 ; 4 ( 130 ):130ra47. Google Scholar OpenURL Placeholder Text WorldCat 12 Lan F , Lee AS, Liang P, et al. Abnormal calcium handling properties underlie familial hypertrophic cardiomyopathy pathology in patient-specific induced pluripotent stem cells . Cell Stem Cell . 2013 ; 12 ( 1 ): 101 - 113 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Liang P , Lan F, Lee AS, et al. Drug screening using a library of human induced pluripotent stem cell-derived cardiomyocytes reveals disease-specific patterns of cardiotoxicity . Circulation . 2013 ; 127 ( 16 ): 1677 - 1691 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Millard D , Dang Q, Shi H, et al. Cross-site reliability of human induced pluripotent stem cell-derived cardiomyocyte based safety assays using microelectrode arrays: results from a blinded CiPA pilot study . Toxicol Sci . 2018 ; 164 ( 2 ): 550 - 562 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Burridge PW , Li YF, Matsa E, et al. Human induced pluripotent stem cell-derived cardiomyocytes recapitulate the predilection of breast cancer patients to doxorubicin-induced cardiotoxicity . Nat Med . 2016 ; 22 ( 5 ): 547 - 556 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Sharma A , Burridge PW, McKeithan WL, et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells . Sci Transl Med . 2017 ; 9 ( 377 ):eaaf2584. Google Scholar OpenURL Placeholder Text WorldCat 17 Stack JP , Moslehi J, Sayed N, Wu JC. Cancer therapy-induced cardiomyopathy: can human induced pluripotent stem cell modelling help prevent it? Eur Heart J . 2019 ; 40 ( 22 ): 1764 - 1770 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Lee JH , Protze SI, Laksman Z, Backx PH, Keller GM. Human pluripotent stem cell-derived atrial and ventricular cardiomyocytes develop from distinct mesoderm populations . Cell Stem Cell 2017 ; 21 ( 2 ): 179 – 194 e174. Google Scholar Crossref Search ADS PubMed WorldCat 19 Cyganek L , Tiburcy M, Sekeres K, et al. Deep phenotyping of human induced pluripotent stem cell-derived atrial and ventricular cardiomyocytes . JCI Insight . 2018 ; 3 ( 12 ):e99941. Google Scholar OpenURL Placeholder Text WorldCat 20 Protze SI , Lee JH, Keller GM. Human pluripotent stem cell-derived cardiovascular cells: from developmental biology to therapeutic applications . Cell Stem Cell . 2019 ; 25 ( 3 ): 311 - 327 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Zhao Y , Rafatian N, Feric NT, et al. A platform for generation of chamber-specific cardiac tissues and disease modeling . Cell . 2019 ; 176 ( 4 ): 913 - 927 e918 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Burridge PW , Keller G, Gold JD, Wu JC. Production of de novo cardiomyocytes: human pluripotent stem cell differentiation and direct reprogramming . Cell Stem Cell . 2012 ; 10 ( 1 ): 16 - 28 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Mummery CL , Zhang J, Ng ES, Elliott DA, Elefanty AG, Kamp TJ. Differentiation of human embryonic stem cells and induced pluripotent stem cells to cardiomyocytes: a methods overview . Circ Res . 2012 ; 111 ( 3 ): 344 - 358 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Williams IM , Wu JC. Generation of endothelial cells from human pluripotent stem cells . Arterioscler Thromb Vasc Biol . 2019 ; 39 ( 7 ): 1317 - 1329 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Cui Y , Zheng Y, Liu X, et al. Single-cell transcriptome analysis maps the developmental track of the human heart . Cell Rep . 2019 ; 26 ( 7 ): 1934 - 1950 e1935 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Friedman CE , Nguyen Q, Lukowski SW, et al. Single-cell transcriptomic analysis of cardiac differentiation from human PSCs reveals HOPX-dependent cardiomyocyte maturation . Cell Stem Cell . 2018 ; 23 ( 4 ): 586 - 598 e588 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Buckingham M , Meilhac S, Zaffran S. Building the mammalian heart from two sources of myocardial cells . Nat Rev Genet . 2005 ; 6 ( 11 ): 826 - 835 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Spater D , Hansson EM, Zangi L, Chien KR. How to make a cardiomyocyte . Development . 2014 ; 141 ( 23 ): 4418 - 4431 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Paige SL , Plonowska K, Xu A, Wu SM. Molecular regulation of cardiomyocyte differentiation . Circ Res . 2015 ; 116 ( 2 ): 341 - 353 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Cai CL , Liang X, Shi Y, et al. Isl1 identifies a cardiac progenitor population that proliferates prior to differentiation and contributes a majority of cells to the heart . Dev Cell . 2003 ; 5 ( 6 ): 877 - 889 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Sturzu AC , Wu SM. Developmental and regenerative biology of multipotent cardiovascular progenitor cells . Circ Res . 2011 ; 108 ( 3 ): 353 - 364 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Sahara M , Santoro F, Chien KR. Programming and reprogramming a human heart cell . EMBO J . 2015 ; 34 ( 6 ): 710 - 738 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Spater D , Abramczuk MK, Buac K, et al. A HCN4+ cardiomyogenic progenitor derived from the first heart field and human pluripotent stem cells . Nat Cell Biol . 2013 ; 15 ( 9 ): 1098 - 1106 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Bressan M , Liu G, Mikawa T. Early mesodermal cues assign avian cardiac pacemaker fate potential in a tertiary heart field . Science . 2013 ; 340 ( 6133 ): 744 - 748 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Zaffran S , Frasch M. Early signals in cardiac development . Circ Res . 2002 ; 91 ( 6 ): 457 - 469 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Srivastava D , Olson EN. A genetic blueprint for cardiac development . Nature . 2000 ; 407 ( 6801 ): 221 - 226 . Google Scholar Crossref Search ADS PubMed WorldCat 37 Bondue A , Blanpain C. Mesp1: a key regulator of cardiovascular lineage commitment . Circ Res . 2010 ; 107 ( 12 ): 1414 - 1427 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Bondue A , Lapouge G, Paulissen C, et al. Mesp1 acts as a master regulator of multipotent cardiovascular progenitor specification . Cell Stem Cell . 2008 ; 3 ( 1 ): 69 - 84 . Google Scholar Crossref Search ADS PubMed WorldCat 39 Lescroart F , Chabab S, Lin X, et al. Early lineage restriction in temporally distinct populations of Mesp1 progenitors during mammalian heart development . Nat Cell Biol . 2014 ; 16 ( 9 ): 829 - 840 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Zhang JZ , Termglinchan V, Shao NY, et al. A human iPSC double-reporter system enables purification of cardiac lineage subpopulations with distinct function and drug response profiles . Cell Stem Cell . 2019 ; 24 ( 5 ): 802 - 811 e805 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Lescroart F , Wang X, Lin X, et al. Defining the earliest step of cardiovascular lineage segregation by single-cell RNA-seq . Science . 2018 ; 359 ( 6380 ): 1177 - 1181 . Google Scholar Crossref Search ADS PubMed WorldCat 42 Srivastava D . Making or breaking the heart: from lineage determination to morphogenesis . Cell . 2006 ; 126 ( 6 ): 1037 - 1048 . Google Scholar Crossref Search ADS PubMed WorldCat 43 Bruneau BG . The developmental genetics of congenital heart disease . Nature . 2008 ; 451 ( 7181 ): 943 - 948 . Google Scholar Crossref Search ADS PubMed WorldCat 44 David R , Brenner C, Stieber J, et al. MesP1 drives vertebrate cardiovascular differentiation through Dkk-1-mediated blockade of Wnt-signalling . Nat Cell Biol . 2008 ; 10 ( 3 ): 338 - 345 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Grego-Bessa J , Luna-Zurita L, del Monte G, et al. Notch signaling is essential for ventricular chamber development . Dev Cell . 2007 ; 12 ( 3 ): 415 - 429 . Google Scholar Crossref Search ADS PubMed WorldCat 46 Lavine KJ , Yu K, White AC, et al. Endocardial and epicardial derived FGF signals regulate myocardial proliferation and differentiation in vivo . Dev Cell . 2005 ; 8 ( 1 ): 85 - 95 . Google Scholar Crossref Search ADS PubMed WorldCat 47 Papoutsi T , Luna-Zurita L, Prados B, Zaffran S, de la Pompa JL. Bmp2 and Notch cooperate to pattern the embryonic endocardium . Development . 2018 ; 145 ( 13 ):dev163378. Google Scholar OpenURL Placeholder Text WorldCat 48 High FA , Epstein JA. The multifaceted role of Notch in cardiac development and disease . Nat Rev Genet . 2008 ; 9 ( 1 ): 49 - 61 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Stefanovic S , Zaffran S. Mechanisms of retinoic acid signaling during cardiogenesis . Mech Dev . 2017 ; 143 : 9 - 19 . Google Scholar Crossref Search ADS PubMed WorldCat 50 de la Pompa JL , Epstein JA. Coordinating tissue interactions: Notch signaling in cardiac development and disease . Dev Cell . 2012 ; 22 ( 2 ): 244 - 254 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 51 Siebel C , Lendahl U. Notch signaling in development, tissue homeostasis, and disease . Physiol Rev . 2017 ; 97 ( 4 ): 1235 - 1294 . Google Scholar Crossref Search ADS PubMed WorldCat 52 Bray SJ . Notch signalling in context . Nat Rev Mol Cell Biol . 2016 ; 17 ( 11 ): 722 - 735 . Google Scholar Crossref Search ADS PubMed WorldCat 53 Del Monte G , Grego-Bessa J, Gonzalez-Rajal A, et al. Monitoring Notch1 activity in development: evidence for a feedback regulatory loop . Dev Dyn . 2007 ; 236 ( 9 ): 2594 - 2614 . Google Scholar Crossref Search ADS PubMed WorldCat 54 del Monte G , Casanova JC, Guadix JA, et al. Differential Notch signaling in the epicardium is required for cardiac inflow development and coronary vessel morphogenesis . Circ Res . 2011 ; 108 ( 7 ): 824 - 836 . Google Scholar Crossref Search ADS PubMed WorldCat 55 Grieskamp T , Rudat C, Ludtke TH, et al. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells . Circ Res . 2011 ; 108 ( 7 ): 813 - 823 . Google Scholar Crossref Search ADS PubMed WorldCat 56 Han P , Bloomekatz J, Ren J, et al. Coordinating cardiomyocyte interactions to direct ventricular chamber morphogenesis . Nature . 2016 ; 534 ( 7609 ): 700 - 704 . Google Scholar Crossref Search ADS PubMed WorldCat 57 Kwon C , Qian L, Cheng P, Nigam V, Arnold J, Srivastava D. A regulatory pathway involving Notch1/beta-catenin/Isl1 determines cardiac progenitor cell fate . Nat Cell Biol . 2009 ; 11 ( 8 ): 951 - 957 . Google Scholar Crossref Search ADS PubMed WorldCat 58 D'Amato G , Luxan G, del Monte-Nieto G, et al. Sequential Notch activation regulates ventricular chamber development . Nat Cell Biol . 2016 ; 18 ( 1 ): 7 - 20 . Google Scholar Crossref Search ADS PubMed WorldCat 59 Luxan G , D'Amato G, MacGrogan D, et al. Endocardial Notch signaling in cardiac development and disease . Circ Res . 2016 ; 118 ( 1 ):e1-e18. Google Scholar OpenURL Placeholder Text WorldCat 60 Luxan G , Casanova JC, Martinez-Poveda B, et al. Mutations in the NOTCH pathway regulator MIB1 cause left ventricular noncompaction cardiomyopathy . Nat Med . 2013 ; 19 ( 2 ): 193 - 201 . Google Scholar Crossref Search ADS PubMed WorldCat 61 Pierpont ME , Brueckner M, Chung WK, et al. Genetic basis for congenital heart disease: revisited: a scientific statement from the American Heart Association . Circulation . 2018 ; 138 ( 21 ): e653 - e711 . Google Scholar Crossref Search ADS PubMed WorldCat 62 Garg V , Muth AN, Ransom JF, et al. Mutations in NOTCH1 cause aortic valve disease . Nature . 2005 ; 437 ( 7056 ): 270 - 274 . Google Scholar Crossref Search ADS PubMed WorldCat 63 Page DJ , Miossec MJ, Williams SG, et al. Whole exome sequencing reveals the major genetic contributors to nonsyndromic tetralogy of Fallot . Circ Res . 2019 ; 124 ( 4 ): 553 - 563 . Google Scholar Crossref Search ADS PubMed WorldCat 64 Thaller C , Eichele G. Identification and spatial distribution of retinoids in the developing chick limb bud . Nature . 1987 ; 327 ( 6123 ): 625 - 628 . Google Scholar Crossref Search ADS PubMed WorldCat 65 Kruse SW , Suino-Powell K, Zhou XE, et al. Identification of COUP-TFII orphan nuclear receptor as a retinoic acid-activated receptor . PLoS Biol . 2008 ; 6 ( 9 ): e227 . Google Scholar Crossref Search ADS PubMed WorldCat 66 Kliewer SA , Umesono K, Heyman RA, Mangelsdorf DJ, Dyck JA, Evans RM. Retinoid X receptor-COUP-TF interactions modulate retinoic acid signaling . Proc Natl Acad Sci U S A . 1992 ; 89 ( 4 ): 1448 - 1452 . Google Scholar Crossref Search ADS PubMed WorldCat 67 Tran P , Zhang XK, Salbert G, Hermann T, Lehmann JM, Pfahl M. COUP orphan receptors are negative regulators of retinoic acid response pathways . Mol Cell Biol . 1992 ; 12 ( 10 ): 4666 - 4676 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 68 Niederreither K , Dolle P. Retinoic acid in development: towards an integrated view . Nat Rev Genet . 2008 ; 9 ( 7 ): 541 - 553 . Google Scholar Crossref Search ADS PubMed WorldCat 69 Jepsen K , Hermanson O, Onami TM, et al. Combinatorial roles of the nuclear receptor corepressor in transcription and development . Cell . 2000 ; 102 ( 6 ): 753 - 763 . Google Scholar Crossref Search ADS PubMed WorldCat 70 Nagy L , Kao HY, Chakravarti D, et al. Nuclear receptor repression mediated by a complex containing SMRT, mSin3A, and histone deacetylase . Cell . 1997 ; 89 ( 3 ): 373 - 380 . Google Scholar Crossref Search ADS PubMed WorldCat 71 Cunningham TJ , Duester G. Mechanisms of retinoic acid signalling and its roles in organ and limb development . Nat Rev Mol Cell Biol . 2015 ; 16 ( 2 ): 110 - 123 . Google Scholar Crossref Search ADS PubMed WorldCat 72 Keegan BR , Feldman JL, Begemann G, Ingham PW, Yelon D. Retinoic acid signaling restricts the cardiac progenitor pool . Science . 2005 ; 307 ( 5707 ): 247 - 249 . Google Scholar Crossref Search ADS PubMed WorldCat 73 Ryckebusch L , Wang Z, Bertrand N, et al. Retinoic acid deficiency alters second heart field formation . Proc Natl Acad Sci U S A . 2008 ; 105 ( 8 ): 2913 - 2918 . Google Scholar Crossref Search ADS PubMed WorldCat 74 Xavier-Neto J , Neville CM, Shapiro MD, et al. A retinoic acid-inducible transgenic marker of sino-atrial development in the mouse heart . Development . 1999 ; 126 ( 12 ): 2677 - 2687 . Google Scholar Crossref Search ADS PubMed WorldCat 75 Zhang Q , Jiang J, Han P, et al. Direct differentiation of atrial and ventricular myocytes from human embryonic stem cells by alternating retinoid signals . Cell Res . 2011 ; 21 ( 4 ): 579 - 587 . Google Scholar Crossref Search ADS PubMed WorldCat 76 Devalla HD , Schwach V, Ford JW, et al. Atrial-like cardiomyocytes from human pluripotent stem cells are a robust preclinical model for assessing atrial-selective pharmacology . EMBO Mol Med . 2015 ; 7 ( 4 ): 394 - 410 . Google Scholar Crossref Search ADS PubMed WorldCat 77 Gassanov N , Er F, Zagidullin N, Jankowski M, Gutkowska J, Hoppe UC. Retinoid acid-induced effects on atrial and pacemaker cell differentiation and expression of cardiac ion channels . Differentiation . 2008 ; 76 ( 9 ): 971 - 980 . Google Scholar Crossref Search ADS PubMed WorldCat 78 Wu SP , Cheng CM, Lanz RB, et al. Atrial identity is determined by a COUP-TFII regulatory network . Dev Cell . 2013 ; 25 ( 4 ): 417 - 426 . Google Scholar Crossref Search ADS PubMed WorldCat 79 Iyer D , Gambardella L, Bernard WG, et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells . Development . 2015 ; 142 ( 8 ): 1528 - 1541 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 80 Witty AD , Mihic A, Tam RY, et al. Generation of the epicardial lineage from human pluripotent stem cells . Nat Biotechnol . 2014 ; 32 ( 10 ): 1026 - 1035 . Google Scholar Crossref Search ADS PubMed WorldCat 81 Wobus AM , Kaomei G, Shan J, et al. Retinoic acid accelerates embryonic stem cell-derived cardiac differentiation and enhances development of ventricular cardiomyocytes . J Mol Cell Cardiol . 1997 ; 29 ( 6 ): 1525 - 1539 . Google Scholar Crossref Search ADS PubMed WorldCat 82 Protze SI , Liu J, Nussinovitch U, et al. Sinoatrial node cardiomyocytes derived from human pluripotent cells function as a biological pacemaker . Nat Biotechnol . 2017 ; 35 ( 1 ): 56 - 68 . Google Scholar Crossref Search ADS PubMed WorldCat 83 Moretti A , Laugwitz KL, Dorn T, Sinnecker D, Mummery C. Pluripotent stem cell models of human heart disease . Cold Spring Harb Perspect Med . 2013 ; 3 ( 11 ):a014027. Google Scholar OpenURL Placeholder Text WorldCat 84 Lian X , Hsiao C, Wilson G, et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling . Proc Natl Acad Sci U S A . 2012 ; 109 ( 27 ): E1848 - E1857 . Google Scholar Crossref Search ADS PubMed WorldCat 85 Burridge PW , Matsa E, Shukla P, et al. Chemically defined generation of human cardiomyocytes . Nat Methods . 2014 ; 11 ( 8 ): 855 - 860 . Google Scholar Crossref Search ADS PubMed WorldCat 86 Yang X , Pabon L, Murry CE. Engineering adolescence: maturation of human pluripotent stem cell-derived cardiomyocytes . Circ Res . 2014 ; 114 ( 3 ): 511 - 523 . Google Scholar Crossref Search ADS PubMed WorldCat 87 Karakikes I , Senyei GD, Hansen J, et al. Small molecule-mediated directed differentiation of human embryonic stem cells toward ventricular cardiomyocytes . Stem Cells Transl Med . 2014 ; 3 ( 1 ): 18 - 31 . Google Scholar Crossref Search ADS PubMed WorldCat 88 Liang W , Han P, Kim EH, et al. Canonical Wnt signaling promotes pacemaker cell specification of cardiac mesodermal cells derived from mouse and human embryonic stem cells . Stem Cells . 2020 ; 38 ( 3 ): 352 - 368 . Google Scholar Crossref Search ADS PubMed WorldCat 89 Ren J , Han P, Ma X, et al. Canonical Wnt5b signaling directs outlying Nkx2.5+ mesoderm into pacemaker cardiomyocytes . Dev Cell . 2019 ; 50 ( 6 ): 729 - 743 e725 . Google Scholar Crossref Search ADS PubMed WorldCat 90 You LR , Lin FJ, Lee CT, DeMayo FJ, Tsai MJ, Tsai SY. Suppression of Notch signalling by the COUP-TFII transcription factor regulates vein identity . Nature . 2005 ; 435 ( 7038 ): 98 - 104 . Google Scholar Crossref Search ADS PubMed WorldCat 91 Chen X , Qin J, Cheng CM, Tsai MJ, Tsai SY. COUP-TFII is a major regulator of cell cycle and Notch signaling pathways . Mol Endocrinol . 2012 ; 26 ( 8 ): 1268 - 1277 . Google Scholar Crossref Search ADS PubMed WorldCat 92 Churko JM , Garg P, Treutlein B, et al. Defining human cardiac transcription factor hierarchies using integrated single-cell heterogeneity analysis . Nat Commun . 2018 ; 9 ( 1 ): 4906 . Google Scholar Crossref Search ADS PubMed WorldCat 93 Khandekar A , Springer S, Wang W, et al. Notch-mediated epigenetic regulation of voltage-gated potassium currents . Circ Res . 2016 ; 119 ( 12 ): 1324 - 1338 . Google Scholar Crossref Search ADS PubMed WorldCat 94 Qiao Y , Lipovsky C, Hicks S, et al. Transient Notch activation induces long-term gene expression changes leading to sick sinus syndrome in mice . Circ Res . 2017 ; 121 ( 5 ): 549 - 563 . Google Scholar Crossref Search ADS PubMed WorldCat 95 Liu YW , Chen B, Yang X, et al. Human embryonic stem cell-derived cardiomyocytes restore function in infarcted hearts of non-human primates . Nat Biotechnol . 2018 ; 36 ( 7 ): 597 - 605 . Google Scholar Crossref Search ADS PubMed WorldCat 96 Shiba Y , Gomibuchi T, Seto T, et al. Allogeneic transplantation of iPS cell-derived cardiomyocytes regenerates primate hearts . Nature . 2016 ; 538 ( 7625 ): 388 - 391 . Google Scholar Crossref Search ADS PubMed WorldCat 97 Chong JJ , Yang X, Don CW, et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts . Nature . 2014 ; 510 ( 7504 ): 273 - 277 . Google Scholar Crossref Search ADS PubMed WorldCat 98 Zhang JZ , Guo H, Wu JC. Applications of genetically engineered human pluripotent stem cell reporters in cardiac stem cell biology . Curr Opin Biotechnol . 2018 ; 52 : 66 - 73 . Google Scholar Crossref Search ADS PubMed WorldCat 99 Chen Z , Xian W, Bellin M, et al. Subtype-specific promoter-driven action potential imaging for precise disease modelling and drug testing in hiPSC-derived cardiomyocytes . Eur Heart J . 2017 ; 38 ( 4 ): 292 - 301 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 100 Li B , Yang H, Wang X, et al. Engineering human ventricular heart muscles based on a highly efficient system for purification of human pluripotent stem cell-derived ventricular cardiomyocytes . Stem Cell Res Ther . 2017 ; 8 ( 1 ): 202 . Google Scholar Crossref Search ADS PubMed WorldCat 101 Yamauchi K , Li J, Morikawa K, et al. Isolation and characterization of ventricular-like cells derived from NKX2-5(eGFP/w) and MLC2v(mCherry/w) double knock-in human pluripotent stem cells . Biochem Biophys Res Commun . 2018 ; 495 ( 1 ): 1278 - 1284 . Google Scholar Crossref Search ADS PubMed WorldCat 102 Schwach V , Verkerk AO, Mol M, et al. A COUP-TFII human embryonic stem cell reporter line to identify and select atrial cardiomyocytes . Stem Cell Rep . 2017 ; 9 ( 6 ): 1765 - 1779 . Google Scholar Crossref Search ADS WorldCat 103 Dubois NC , Craft AM, Sharma P, et al. SIRPA is a specific cell-surface marker for isolating cardiomyocytes derived from human pluripotent stem cells . Nat Biotechnol . 2011 ; 29 ( 11 ): 1011 - 1018 . Google Scholar Crossref Search ADS PubMed WorldCat 104 Veevers J , Farah EN, Corselli M, et al. Cell-surface marker signature for enrichment of ventricular cardiomyocytes derived from human embryonic stem cells . Stem Cell Rep . 2018 ; 11 ( 3 ): 828 - 841 . Google Scholar Crossref Search ADS WorldCat 105 Weng Z , Kong CW, Ren L, et al. A simple, cost-effective but highly efficient system for deriving ventricular cardiomyocytes from human pluripotent stem cells . Stem Cells Dev . 2014 ; 23 ( 14 ): 1704 - 1716 . Google Scholar Crossref Search ADS PubMed WorldCat 106 Christoffels VM , Smits GJ, Kispert A, Moorman AFM. Development of the pacemaker tissues of the heart . Circ Res . 2010 ; 106 ( 2 ): 240 - 254 . Google Scholar Crossref Search ADS PubMed WorldCat 107 Liang X , Evans SM, Sun Y. Development of the cardiac pacemaker . Cell Mol Life Sci . 2017 ; 74 ( 7 ): 1247 - 1259 . Google Scholar Crossref Search ADS PubMed WorldCat 108 Munshi NV . Gene regulatory networks in cardiac conduction system development . Circ Res . 2012 ; 110 ( 11 ): 1525 - 1537 . Google Scholar Crossref Search ADS PubMed WorldCat 109 Schott JJ , Benson DW, Basson CT, et al. Congenital heart disease caused by mutations in the transcription factor NKX2-5 . Science . 1998 ; 281 ( 5373 ): 108 - 111 . Google Scholar Crossref Search ADS PubMed WorldCat 110 Christoffels VM , Mommersteeg MT, Trowe MO, et al. Formation of the venous pole of the heart from an Nkx2-5-negative precursor population requires Tbx18 . Circ Res . 2006 ; 98 ( 12 ): 1555 - 1563 . Google Scholar Crossref Search ADS PubMed WorldCat 111 Stieber J , Herrmann S, Feil S, et al. The hyperpolarization-activated channel HCN4 is required for the generation of pacemaker action potentials in the embryonic heart . Proc Natl Acad Sci U S A . 2003 ; 100 ( 25 ): 15235 - 15240 . Google Scholar Crossref Search ADS PubMed WorldCat 112 Birket MJ , Ribeiro MC, Verkerk AO, et al. Expansion and patterning of cardiovascular progenitors derived from human pluripotent stem cells . Nat Biotechnol . 2015 ; 33 ( 9 ): 970 - 979 . Google Scholar Crossref Search ADS PubMed WorldCat 113 Ionta V , Liang W, Kim EH, et al. SHOX2 overexpression favors differentiation of embryonic stem cells into cardiac pacemaker cells improving biological pacing ability . Stem Cell Rep . 2015 ; 4 ( 1 ): 129 - 142 . Google Scholar Crossref Search ADS WorldCat 114 Jung JJ , Husse B, Rimmbach C, et al. Programming and isolation of highly pure physiologically and pharmacologically functional sinus-nodal bodies from pluripotent stem cells . Stem Cell Rep . 2014 ; 2 ( 5 ): 592 - 605 . Google Scholar Crossref Search ADS WorldCat 115 Brown K , Legros S, Ortega FA, et al. Overexpression of Map3k7 activates sinoatrial node-like differentiation in mouse ES-derived cardiomyocytes . PloS One . 2017 ; 12 ( 12 ):e0189818. Google Scholar OpenURL Placeholder Text WorldCat 116 Schweizer PA , Darche FF, Ullrich ND, et al. Subtype-specific differentiation of cardiac pacemaker cell clusters from human induced pluripotent stem cells . Stem Cell Res Ther . 2017 ; 8 ( 1 ): 229 . Google Scholar Crossref Search ADS PubMed WorldCat 117 Barbuti A , Robinson RB. Stem cell-derived nodal-like cardiomyocytes as a novel pharmacologic tool: insights from sinoatrial node development and function . Pharmacol Rev . 2015 ; 67 ( 2 ): 368 - 388 . Google Scholar Crossref Search ADS PubMed WorldCat 118 Scavone A , Capilupo D, Mazzocchi N, et al. Embryonic stem cell-derived CD166+ precursors develop into fully functional sinoatrial-like cells . Circ Res . 2013 ; 113 ( 4 ): 389 - 398 . Google Scholar Crossref Search ADS PubMed WorldCat 119 Liang X , Wang G, Lin L, et al. HCN4 dynamically marks the first heart field and conduction system precursors . Circ Res . 2013 ; 113 ( 4 ): 399 - 407 . Google Scholar Crossref Search ADS PubMed WorldCat 120 Yechikov S , Copaciu R, Gluck JM, et al. Same-single-cell analysis of pacemaker-specific markers in human induced pluripotent stem cell-derived cardiomyocyte subtypes classified by electrophysiology . Stem Cells . 2016 ; 34 ( 11 ): 2670 - 2680 . Google Scholar Crossref Search ADS PubMed WorldCat 121 Kane C , Terracciano CMN. Criteria for chamber-specific categorization of human cardiac myocytes derived from pluripotent stem cells . Stem Cells . 2017 ; 35 ( 8 ): 1881 - 1897 . Google Scholar Crossref Search ADS PubMed WorldCat 122 Sadahiro T , Yamanaka S, Ieda M. Direct cardiac reprogramming: progress and challenges in basic biology and clinical applications . Circ Res . 2015 ; 116 ( 8 ): 1378 - 1391 . Google Scholar Crossref Search ADS PubMed WorldCat 123 Pawlowski M , Ortmann D, Bertero A, et al. Inducible and deterministic forward programming of human pluripotent stem cells into neurons, skeletal myocytes, and oligodendrocytes . Stem Cell Rep . 2017 ; 8 ( 4 ): 803 - 812 . Google Scholar Crossref Search ADS WorldCat 124 Trapnell C . Defining cell types and states with single-cell genomics . Genome Res . 2015 ; 25 ( 10 ): 1491 - 1498 . Google Scholar Crossref Search ADS PubMed WorldCat 125 Mills RJ , Parker BL, Quaife-Ryan GA, et al. Drug screening in human PSC-cardiac organoids identifies pro-proliferative compounds acting via the mevalonate pathway . Cell Stem Cell . 2019 ; 24 ( 6 ): 895 - 907 e896 . Google Scholar Crossref Search ADS PubMed WorldCat 126 Knott GJ , Doudna JA. CRISPR-Cas guides the future of genetic engineering . Science . 2018 ; 361 ( 6405 ): 866 - 869 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Funding information American Heart Association, Grant/Award Numbers: 18CDA34110293, 18CDA34110352; NIH, Grant/Award Number: HL121797 © AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Jing, Ruiqi; Guo, Xudong; Yang, Yiwei; Chen, Wen; Kang, Jiuhong; Zhu, Songcheng

doi: 10.1002/stem.3180pmid: 32277787

Abstract Large intergenic noncoding RNAs (lincRNAs) in ESCs may play an important role in the maintenance of pluripotency. The identification of stem cell-specific lincRNAs and their interacting partners will deepen our understanding of the maintenance of stem cell pluripotency. We identified a lincRNA, LincQ, which is specifically expressed in ESCs and is regulated by core pluripotent transcription factors. It was rapidly downregulated during the differentiation process. Knockdown of LincQ in ESCs led to differentiation, downregulation of pluripotency-related genes, and upregulation of differentiation-related genes. We found that exon 1 of LincQ can specifically bind to Sox2. The Soxp region in Sox2, rather than the high mobility group domain, is responsible for LincQ binding. Importantly, the interaction between LincQ and Sox2 is required for the maintenance of pluripotency in ESCs and the transcription of pluripotency genes. Esrrb and Tfcp2l1 are key downstream targets of LincQ and Sox2, since overexpression of Esrrb and Tfcp2l1 can restore the loss of ESC pluripotency that is induced by LincQ depletion. In summary, we found that LincQ specifically interacts with Sox2 and contributes to the maintenance of pluripotency, highlighting the critical role of lincRNA in the pluripotency regulatory network. Significance statement This study shows that the long intergenic noncoding RNA LincQ is critical for ESC pluripotency maintenance. LincQ is highly expressed in ESCs and is downregulated during differentiation. Furthermore, its inhibition leads to ESC differentiation. LincQ binds to Sox2 to regulate the transcription of pluripotency genes. Esrrb and Tfcp2l1 are the main downstream targets of LincQ/Sox2 that are involved in ESC maintenance. Schematic diagram shows the involvement of LincQ in ESC maintenance. Pluripotency transcription factors (Oct4, Sox2, and Nanog) promote the expression of LincQ. LincQ associates with Sox2 and activates the expression of pluripotency genes, such as Esrrb and Tfcp2l1, which are crucial for ESC maintenance. Depletion of LincQ in ESC leads to the downregulation of pluripotency genes and differentiation. Open in new tabDownload slide Open in new tabDownload slide core pluripotent transcription factors, lincRNAs, maintenance of pluripotency, mouse ESCs, Sox2 INTRODUCTION ESCs are separated from the inner cell mass of early embryos, and they have the ability to differentiate into different kinds of cells and can be maintained indefinitely in culture.1,2 Therefore, ESCs provide important insights and methods that reveal the mechanisms of development. Maintenance of ESC pluripotency depends on a complex regulatory network that includes transcription factors, histone modifications, and signaling pathways.3-5 The transcription factors Oct4, Sox2, and Nanog and the complex they form are in the core of the network that maintains the pluripotency of stem cells.6 They are called core transcription factors. The three core factors have been used in the induction of pluripotency from both human and mouse somatic cells.7-9 The Oct4, Sox2, and Nanog complex regulates maintenance of pluripotency in ESCs, and it can promote the expression of pluripotency-related genes and repress the expression of differentiation- and development-related genes.10,11 Extensive data have indicated that Oct4, Sox2, and Nanog collaborate to form regulatory circuitry consisting of autoregulatory and feedforward loops to potentially reinforce their own expression.6 The core factors also cooperate with other factors, including chromatin remodeling factors, in ESC maintenance and developmental processes.12,13 However, the core factors with other partners, such as long noncoding RNAs (lncRNAs) and their precise mechanisms in ESC regulation, need more comprehensive study. lncRNAs are a class of RNA transcripts with a length of greater than 200 nucleotides. Generally, lncRNAs are not capable of encoding proteins or peptides.14,15 lncRNAs have been shown to exhibit a variety of subcellular localization patterns; while, the majority of lncRNAs are localized in the nucleus,16 some lncRNAs almost exclusively locate to and function in the cytoplasm.17 lncRNAs have secondary and tertiary structures that enable them to have both RNA- and protein-like functions.18 They can bind nucleic acids ranging from microRNAs to DNA elements in a base-pairing fashion. Some lncRNAs recognize proteins precisely to participate in RNA-protein complex formation where they regulate the function of the complex.19,20 lncRNAs exert diverse biological functions at transcriptional, translational, and posttranslational levels.21,22 It has been demonstrated that lncRNAs are widely involved in developmental processes, stem cell differentiation, and the pathogenesis of many diseases, including cancer, metabolic disorders, and cardiovascular diseases.15,23 Increasing evidence has demonstrated that lncRNAs are also involved in the maintenance of stem cell pluripotency.24-26 LncPress1, an lncRNA expressed specifically in ESCs, is essential for the maintenance of pluripotency because it disrupts Sirt6 activity and maintains high H3K56/K9ac levels at pluripotency genes.27 lncRNA GAS5 controls ESC pluripotency by protecting NODAL expression from miRNA-mediated degradation.28 Despite these findings of pluripotency-related lncRNAs, the understanding of the roles of lncRNAs in pluripotency regulation is still limited. Sox2 is a member of the Soxb1 subfamily, and Sox2 has 80% homology with group members Sox1 and Sox3. Sox2 has a highly conserved high mobility group (HMG) domain in its N-terminus that mediates DNA binding and it has a transcription activation domain in its C-terminus.29 Following the HMG domain is a region called as Soxp region, and its function remains unclear. Sox2 plays an indispensable role in the regulation of ESC pluripotency and neural differentiation.30 In ESCs, the cooperative interaction between Oct4 and Sox2 has previously been described to drive pluripotent-specific expression of a number of genes that have a role in maintaining stem cell pluripotency, including Nanog, Zfp206, and Fgf4.31-33 Specific knockdown of Sox2 by RNA interference leads to the reduction of both gene enhancer activities and endogenous expression levels in addition to resulting in ESC differentiation.34 In addition to cooperating with Oct4, Sox2 can also bind with other partners to control the expression of other kinds of downstream target genes.33,35 Sox2 cooperates with Chd7 to regulate the genes involved in neural stem cells.36 Sox2 also has the ability to bind lncRNAs. The sequence and structural diversity of the lncRNAs that Sox2 binds gives Sox2 the ability to specifically bind to downstream genes. For instance, the lncRNA rhabdomyosarcoma 2-associated transcript (RMST) cooperates with Sox2 to regulate neural-related gene activation.37 However, the identification of ESC-specific lncRNAs and the mechanism of lncRNA/Sox2 in the regulation of ESCs still need more investigation. We found that LincQ, a large intergenic noncoding RNA (lincRNA) specifically expressed in mouse ESCs, is a key factor regulating pluripotency. Its expression is promoted by the three core factors, and it is required for the maintenance of mouse ESC pluripotency. LincQ specifically binds to the core factor Sox2 to promote pluripotency gene activation, but it does not bind to Oct4 or Nanog. Furthermore, we also found that the Soxp domain of Sox2, the function of which has not yet been defined, mediates LincQ binding to Sox2. Therefore, our study shows that, through binding with Sox2, LincQ is involved in the transcriptional regulation of the network that maintains ESC pluripotency. MATERIALS AND METHODS Cell culture Mouse ESCs (E14Tg2A) were cultured on gelatin-coated plates in Dulbecco's modified Eagle medium (DMEM) supplemented with 15% fetal bovine serum (FBS) (Gibco, New York), 1× nonessential amino acids (Gibco), 1× GlutaMAX (Gibco), 1× sodium pyruvate (Gibco), 1000 units/mL of leukemia inhibitory factor (Lif) (Millipore, Massachusetts), and 55 μM β-mercaptoethanol (Gibco). Alkaline phosphatase staining ESCs were fixed with 4% paraformaldehyde and washed once in 1× phosphate-buffered saline (PBS). The 1× PBS was removed, and cells were stained with an alkaline phosphatase staining kit (Sigma) for 15 minutes at 37°C. Colony formation Colony formation was performed as previously described.38 ESCs were plated at 600 cells per six-well plate in ESC medium and were maintained for 6 days. The medium was changed every 2 days. Then, the cells were stained with an Alkaline Phosphatase Staining kit, and photos were captured. Western blot analysis Cells were harvested and resuspended in SDS lysis buffer supplemented with a 1× Protease Inhibitor Cocktail (Roche). Protein lysate was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membranes. Membranes were blocked in 5% milk-TBST for 1 hour and probed with primary antibodies overnight at 4°C. Membranes were washed and probed with secondary antibodies for 1 hour at room temperature. The primary antibodies used in Western blot experiments were as follows: anti-Dnmt3b (Abcam, ab122932), anti-Oct4 (Abcam, ab19857), anti-Sox2 (CST, 23064s), anti-Nanog (Abcam, ab80892), anti-Flag (CST, 14793s), anti-HA (Abcam, ab9110), and anti-GAPDH (Bioworld, AP0063). Biotinylated RNA pull-down Transcribed RNAs were obtained with an RNA labeling mix and T7/T3 RNA polymerase (Roche). Three micrograms of RNA were mixed in RNA structure buffer (10 mM Tris-HCl pH 7.0, 0.1 M KCl and 10 mM MgCl2) with RNase Out (Invitrogen) and were heated for 2 minutes at 90°C on ice for 2 minutes. Streptavidin beads were coated with biotin-labeled RNAs for at least 4 hours. Cells were harvested (5 × 106), were resuspended in RNA immunoprecipitation (RIP) lysis buffer (100 mM KCl, 5 mM MgCl2, 10 mM HEPES pH 7.0, 0.5% NP-40, and 1 mM DTT), and were placed on ice for 30 minutes. The cell lysate was incubated with the beads to coat them by rotation overnight at 4°C. Then, the beads were washed with RIP wash buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM MgCl2, and 0.05% NP-40) and were treated with SDS lysis buffer for Western blot analysis. RNA immunoprecipitation RIP was performed as previously described.39 Briefly, ESCs (5 × 106) were obtained, were resuspended in RIP lysis buffer, and were placed on ice for 30 minutes to lyse the cells. The antibodies for the RIP assay were incubated with protein A+G beads overnight at 4°C. Then, the beads were washed with RIP wash buffer and incubated with cell lysate. Total RNA was extracted for subsequent quantitative reverse transcription polymerase chain reaction (qRT-PCR) analysis. Immunostaining Cells were cultured on gelatin-coated coverslips and were washed in 1 × PBS and fixed with 4% paraformaldehyde at room temperature for 15 minutes. Then, the cells were washed in 1 × PBS and fixed with 0.1% Triton X-100 for 10 minutes at room temperature. The cells were washed in 1× PBS and blocked with 10% donkey serum for 1 hour at room temperature. Then, the cells were incubated with primary antibodies at 4°C overnight before being incubated with Alexa Fluor-488- or Alexa Fluor-594-conjugated secondary antibodies (Invitrogen) and Hoechst 33342. Images were obtained with a Nikon A1R confocal microscope. Fluorescent in situ hybridization The ESCs were grown on gelatin-coated coverslips, washed in 1× PBS and fixed with 4% paraformaldehyde at room temperature for 15 minutes. The cells were washed in 1× PBS and fixed with 0.5% Triton X-100 for 5 minutes at 4°C. Then, the cells were incubated with prehybridization buffer at 37°C for 30 minutes, and then they were hybridized with fluorescent in situ hybridization (FISH) probes in the dark overnight at 37°C. The cells then were washed with wash buffer and stained with Hoechst 33342. LincQ-cy3 FISH probes were designed and synthesized by RiboBio Co., Ltd. Mouse U6 FISH probes (LNC110103, RiboBio) were used as a nuclear control, and mouse 18S FISH probes (LNC110104, RiboBio) were used as a cytoplasmic control. The buffer was from a Ribo Fluorescent In Situ Hybridization kit (C10910, RiboBio). Images were obtained with a Nikon A1R confocal microscope. Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) was performed as previously described.40 The following antibodies were used in the ChIP assay: anti-Sox2 (CST, 23064s) and anti-RNA Polymerase II (Millipore, 05-623). The immunoprecipitated DNA and input DNA were extracted for qRT-PCR analysis. Published data analysis Related sequencing data for ChIP-seq analysis (GSM2066253, GSM288347, and GSM288345) were retrieved from the NCBI GEO database. RNA-seq and analysis Total RNA for RNA-seq was extracted from ESCs by RNAiso (Takara). Following the manufacturer's instructions, the libraries were sequenced using a BGISEQ-500. In brief, sequenced reads were mapped to the mm10 mouse genome from the UCSC Genome Browser database using Bowtie2 version 2.2.5 with default parameters. Evaluation of the expression level was performed by RSEM 1.2.12. Analysis of differential expression was calculated via edgeR statistics using a P value threshold of less than .05 and a fold change threshold of more than 1.5. A gene expression heat map was generated using the R program. Enriched gene ontology (GO) terms were identified using DAVID bioinformatics tools. Statistical analyses The data in this study were analyzed using t test. The data are presented as the means ± SD from three independent experiments. *P#, **/##, and ***/### represent P < .05, P < .01, and P < .001, respectively. RESULTS LincQ is a potential key pluripotency regulator of ESCs We were interested in lncRNAs that play important roles in maintenance of pluripotency and differentiation of ESCs. Therefore, we collected information on lncRNAs that have been reported previously to be expressed in ESCs41 and examined their expression in E14Tg2A cells by qRT-PCR (supplemental online Figure S1A). The lncRNAs with higher expression in ESCs were further examined in spontaneous EB differentiation. We found that LincQ was different from other LincRNAs in that its expression was rapidly downregulated during EB differentiation (supplemental online Figure S1B-F). Therefore, LincQ emerged as a promising candidate. LincQ (Gm33377) is located on mouse chromosome 10, and it contains four transcripts (supplemental online Figure S1G). We found c long transcript was highly expressed in mouse ESCs (supplemental online Figure S1H,I). We also detected the expression level of LincQ in mouse different tissues or cell types and found that LincQ is highly expressed in mouse embryo and ESCs (Figure 1A,B). We detected the expression level of LincQ in EB differentiation and retinoic acid-induced differentiation, and we found that the expression profile of LincQ was similar to that of the core transcription factors Oct4, Sox2, and Nanog, which are highly expressed in stem cells and rapidly downregulated following differentiation (Figure 1C,D). ChIP-seq data showed that the promoter region of LincQ is highly enriched with Oct4, Sox2, and Nanog (Figure 1E). To further validate the ChIP-seq data, our ChIP assay confirmed Oct4, Sox2 and Nanog occupancy of the LincQ promoter region (−1500 to 0 bp) (Figure 1F). Furthermore, we performed a reporter assay with a LincQ promoter-driven luciferase and found that the core transcription factors Oct4, Sox2, and Nanog promoted the activity of LincQ promoter by more than fivefold (Figure 1G). Additionally, Oct4, Sox2, or Nanog knockdown significantly reduced LincQ gene expression (Figure 1H). The knockdown efficiency of Oct4, Sox2, and Nanog was detected by Western blot (supplemental online Figure S1J). These data suggested that LincQ expression correlates positively with the pluripotency state and that it is a downstream target of Oct4, Sox2, and Nanog. The high expression of LincQ in ESCs might be related to pluripotency. FIGURE 1 Open in new tabDownload slide LincQ is a potential key pluripotency regulator of ESCs. A, Expression of LincQ in different mouse tissues was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). B, Expression of LincQ in different mouse cell types (E14Tg2A, MEF, and NIH3T3) was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). C,D, Expression of LincQ, Oct4, Sox2, and Nanog during EB differentiation, C, and RA-induced differentiation, D, was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to D0 ESCs. E, ChIP-seq binding profiles show the ESC transcription factors Oct4, Sox2, and Nanog at the LincQ locus in ESCs. F, ChIP-qPCR analysis of Oct4, Sox2, and Nanog binding at the promoter of LincQ. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to IgG. G, Luciferase activity reporter assay was performed for the LincQ promoter transfected with Oct4, Sox2, and Nanog in 293FT cells. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to control ESCs. H, Expression of LincQ upon Oct4, Sox2, or Nanog knockdown was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (**P < .01) was performed relative to control ESCs. ChIP, chromatin immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; RA, retinoic acid FIGURE 1 Open in new tabDownload slide LincQ is a potential key pluripotency regulator of ESCs. A, Expression of LincQ in different mouse tissues was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). B, Expression of LincQ in different mouse cell types (E14Tg2A, MEF, and NIH3T3) was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). C,D, Expression of LincQ, Oct4, Sox2, and Nanog during EB differentiation, C, and RA-induced differentiation, D, was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to D0 ESCs. E, ChIP-seq binding profiles show the ESC transcription factors Oct4, Sox2, and Nanog at the LincQ locus in ESCs. F, ChIP-qPCR analysis of Oct4, Sox2, and Nanog binding at the promoter of LincQ. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to IgG. G, Luciferase activity reporter assay was performed for the LincQ promoter transfected with Oct4, Sox2, and Nanog in 293FT cells. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to control ESCs. H, Expression of LincQ upon Oct4, Sox2, or Nanog knockdown was measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (**P < .01) was performed relative to control ESCs. ChIP, chromatin immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; RA, retinoic acid Depletion of LincQ affects ESC pluripotency To explore the function of LincQ in ESCs, we knocked down LincQ expression by treating cells with specific short hairpin RNAs (shRNAs). ESCs were infected with lentiviruses harboring an shRNA control (control) or two independent shRNAs targeting LincQ (shLincQ-1 or shLincQ-2). The knockdown efficiency detected by qRT-PCR was significant (Figure 2A). Compared with the control knockdown ESCs, LincQ knockdown ESCs were highly dispersed. The statistical results showed that LincQ knockdown ESCs involved a higher percentage of colonies poorly stained by alkaline phosphatase (AP) than were present in control ESCs (Figure 2B,C), which is another indication of differentiation. We prolonged ESCs culture to six passages and found that LincQ knockdown ESCs failed to maintain ESC morphology and differentiated (supplemental online Figure S2A). Furthermore, LincQ knockdown decreased the expression of pluripotency genes, while it increased the expression of differentiated genes (Figure 2D,E). Immunostaining analysis of pluripotency and differentiated proteins also showed that stem cells underwent differentiation upon knockdown of LincQ (Figure 2F). Moreover, colony formation analysis showed that LincQ knockdown decreased the efficiency of colony formation (supplemental online Figure S2B). To further measure the developmental potential of LincQ knockdown ESCs, we performed EB differentiation of both control ESCs and LincQ knockdown ESCs for 6 days. LincQ knockdown ESCs showed abnormal EB differentiation, characterized by the decreased expression levels of endoderm developmental markers (Gata4 and Gata6) and the increased expression levels of mesoderm developmental markers (T and Eomes) (supplemental online Figure S2C). We also designed guide RNAs (gRNAs) to knockout LincQ gene in ESCs using CRISPR/Cas9-based genome editing technology (supplemental online Figure S3A-C). We found that ESCs with LincQ−/− cannot maintain pluripotent morphology and exhibited spontaneous differentiation phenotype. Deletion of LincQ in ESCs led to the decrease of AP positive colonies (supplemental online Figure S3D) and declined the colony formation efficiency (supplemental online Figure S3E). Thus, these results show that depletion of LincQ affects the pluripotency of ESCs and are consistent with LincQ knockdown. FIGURE 2 Open in new tabDownload slide Depletion of LincQ affects ESC pluripotency. A, qRT-PCR analysis of LincQ knockdown by two distinct shRNAs (shLincQ-1 and shLincQ-2) in ESCs. Control indicates a scrambled shRNA with no specific target in the genome. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (**P < .01) was performed to analyze data relative to that of control ESCs. B, AP staining analysis was performed on control and shLincQ ESCs. Scale bar = 100 μm. C, Statistical analysis of the colony morphology was performed for control and shLincQ ESCs. The colonies were counted according to three types as indicated. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent experience. Two-tailed Student's t test (**P < .01) was performed relative to control undifferentiated cells. D, Western blot analysis of Nanog and Dnmt3b in control and shLincQ ESCs. GAPDH was used as a loading control. E, Expression of pluripotency genes (left panel) and differentiated genes (right panel) in control and shLincQ ESCs were measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs. F, Immunostaining of Nanog and Dnmt3b in control and shLincQ ESCs. The nuclei were stained with Hoechst 33342 (Ho.33342). Scale bars = 50 μm. AP, alkaline phosphatase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; shRNA, short hairpin RNA FIGURE 2 Open in new tabDownload slide Depletion of LincQ affects ESC pluripotency. A, qRT-PCR analysis of LincQ knockdown by two distinct shRNAs (shLincQ-1 and shLincQ-2) in ESCs. Control indicates a scrambled shRNA with no specific target in the genome. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (**P < .01) was performed to analyze data relative to that of control ESCs. B, AP staining analysis was performed on control and shLincQ ESCs. Scale bar = 100 μm. C, Statistical analysis of the colony morphology was performed for control and shLincQ ESCs. The colonies were counted according to three types as indicated. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent experience. Two-tailed Student's t test (**P < .01) was performed relative to control undifferentiated cells. D, Western blot analysis of Nanog and Dnmt3b in control and shLincQ ESCs. GAPDH was used as a loading control. E, Expression of pluripotency genes (left panel) and differentiated genes (right panel) in control and shLincQ ESCs were measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs. F, Immunostaining of Nanog and Dnmt3b in control and shLincQ ESCs. The nuclei were stained with Hoechst 33342 (Ho.33342). Scale bars = 50 μm. AP, alkaline phosphatase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; shRNA, short hairpin RNA Exon 1 of LincQ interacts with Sox2 to maintain the pluripotency of ESCs We further investigated the mechanism of LincQ in maintaining the pluripotency of ESCs. The location of lncRNAs in cells is closely related to their mechanism.22 Therefore, we designed an RNA probe based on the sequence of LincQ and used FISH to detect the distribution of LincQ in ESCs. U6 and 18S RNAs served as the controls. The results showed that LincQ was mainly located in the nuclei of ESCs (supplemental online Figure S4), suggesting its potential involvement in transcription regulation. Therefore, we investigated whether LincQ functionally interacted with core transcription factors in ESCs. RIP showed that LincQ could specifically bind to Sox2, but it did not bind to Oct4 and Nanog (Figure 3A). Moreover, an RNA pull-down assay with biotin-labeled LincQ confirmed that both endogenous Sox2 in ESCs (Figure 3B) and exogenous Sox2 in 293FT cells could bind to LincQ (Figure 3C). Since LincQ knockdown reduced the expression of Sox2 in ESCs, we wondered whether the changes in cell morphology upon LincQ knockdown were caused by the decrease in Sox2. We established Sox2-overexpressing ESCs with LincQ knocked down. The results showed that Sox2 overexpression did not rescue the change in cell morphology or the decrease in the proportion of AP staining caused by the LincQ knockdown (supplemental online Figure S5A,B), which was consistent with the expression of pluripotency genes and differentiated genes (supplemental online Figure S5C-E). Thus, these results indicated that the change in pluripotency in LincQ knockdown ESCs was due to disruption of the interaction with Sox2 rather than the reduction in Sox2 expression. FIGURE 3 Open in new tabDownload slide Exon 1 of LincQ interacts with Sox2 to maintain the pluripotency of ESCs. A, The interaction of LincQ with endogenous Sox2, Oct4, and Nanog was verified by RIP analysis in ESCs. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (**P < .01) was performed relative to IgG. B, Biotinylated RNA pull-down analysis was performed with ESCs using full-length LincQ transcript (LincQ-S), antisense (LincQ-AS), and beads only (no RNA), which were followed by immunoblotting. LincQ-AS and no RNA samples served as negative controls. C, Biotinylated RNA pull-down analysis was performed to assess the exogenous expression of Flag-tagged Sox2 with LincQ in 293FT cells. D, Schematic representation of LincQ truncations. The following are shown: LincQ (full-length), E1 (exon 1 of LincQ), E2 (exon 2 of LincQ), E3 (exon 3 of LincQ), E1+2 (exons 1+2 of LincQ), E2+3 (exons 2+3 of LincQ), and E1+3 (exons 1+3 of LincQ). E, Biotinylated RNA pull-down analysis was performed with ESCs using full-length LincQ transcript and LincQ truncation mutants, which were followed by immunoblotting. F, Statistical analysis of colony morphology following overexpression of LincQ and LincQ truncation mutants in LincQ knockdown ESCs. LincQ full-length transcript and the E1 and E2+3 truncations were designed to resist LincQ shRNAs. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent replicate. Two-tailed Student's t test (***P < .001) was performed relative to control undifferentiated cells, and (##P < .01) was performed relative to shLincQ-2 Luc undifferentiated cells. G, Western blot analysis of Nanog and Dnmt3b in control and shLincQ-2 ESCs with full-length or truncated LincQ expression. GAPDH was used as a loading control. H, Expression of pluripotency genes (left panel) and differentiated genes (right panel) in control and shLincQ-2 with full-length or truncated mutants LincQ ESCs, as measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs, and (#P < .05 and ##P < .01) was performed relative to shLincQ-2 Luc ESCs. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; RIP, RNA immunoprecipitation; shRNA, short hairpin RNA FIGURE 3 Open in new tabDownload slide Exon 1 of LincQ interacts with Sox2 to maintain the pluripotency of ESCs. A, The interaction of LincQ with endogenous Sox2, Oct4, and Nanog was verified by RIP analysis in ESCs. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (**P < .01) was performed relative to IgG. B, Biotinylated RNA pull-down analysis was performed with ESCs using full-length LincQ transcript (LincQ-S), antisense (LincQ-AS), and beads only (no RNA), which were followed by immunoblotting. LincQ-AS and no RNA samples served as negative controls. C, Biotinylated RNA pull-down analysis was performed to assess the exogenous expression of Flag-tagged Sox2 with LincQ in 293FT cells. D, Schematic representation of LincQ truncations. The following are shown: LincQ (full-length), E1 (exon 1 of LincQ), E2 (exon 2 of LincQ), E3 (exon 3 of LincQ), E1+2 (exons 1+2 of LincQ), E2+3 (exons 2+3 of LincQ), and E1+3 (exons 1+3 of LincQ). E, Biotinylated RNA pull-down analysis was performed with ESCs using full-length LincQ transcript and LincQ truncation mutants, which were followed by immunoblotting. F, Statistical analysis of colony morphology following overexpression of LincQ and LincQ truncation mutants in LincQ knockdown ESCs. LincQ full-length transcript and the E1 and E2+3 truncations were designed to resist LincQ shRNAs. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent replicate. Two-tailed Student's t test (***P < .001) was performed relative to control undifferentiated cells, and (##P < .01) was performed relative to shLincQ-2 Luc undifferentiated cells. G, Western blot analysis of Nanog and Dnmt3b in control and shLincQ-2 ESCs with full-length or truncated LincQ expression. GAPDH was used as a loading control. H, Expression of pluripotency genes (left panel) and differentiated genes (right panel) in control and shLincQ-2 with full-length or truncated mutants LincQ ESCs, as measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs, and (#P < .05 and ##P < .01) was performed relative to shLincQ-2 Luc ESCs. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; RIP, RNA immunoprecipitation; shRNA, short hairpin RNA The LincQ gene contains three exons. To further investigate the interaction between LincQ and Sox2, we constructed a series of LincQ truncations based on the exons (Figure 3D). A biotinylated RNA pull-down assay with LincQ truncations showed that Sox2 mainly bound to exon 1 of LincQ rather than bind to exon 2 and exon 3 (Figure 3E). We then expressed shRNA-resistant LincQ truncations of exon 1 and exons 2+3 in ESCs and examined the cell morphology upon LincQ knockdown. We found that exon 1, which truncated the segment that interacted with Sox2, rescued the cell morphology change and loss of AP activity induced by LincQ knockdown (Figure 3F). Consistent with these results, both decreased expression of pluripotency genes and increased expression of differentiated genes were rescued by overexpression of exon 1 but not exons 2+3 in LincQ knockdown ESCs (Figure 3G,H). Taken together, these data indicated that exon 1 of LincQ is required for Sox2 binding and maintenance of pluripotency. The Soxp domain of Sox2 is required for LincQ binding to Sox2 and for the maintenance of pluripotency As an important transcription factor, Sox2 forms a complex with different protein partners to regulate different gene sets in the maintenance of ESC pluripotency or in other developmental processes.42 However, information regarding the binding of Sox2 to lncRNAs remains elusive. Sox2 contains an HMG domain, which enables its binding to DNA, and it contains an Soxp domain and a C-terminal domain (CTD).29 The function of the Soxp region between the HMG and the CTD remains unclear. We generated Sox2 mutants containing deletions of the HMG (DelHMG), Soxp (DelSoxp), or the C-terminal domain (DelCTD), and we examined the interaction between the Sox2 truncation mutants expressed in 293FT cells and the biotinylated LincQ. When efficient expression of Sox2 truncations (Flag-tagged DelHMG, Flag-tagged DelSoxp, and Flag-tagged DelCTD) was observed, biotinylated RNA pull-down experiments showed that the Soxp domain of Sox2 was required for the binding of LincQ (Figure 4A). Furthermore, we knocked down Sox2 expression in ESCs by treatment with an shRNA that targeted its 3′-UTR, and we overexpressed WT Sox2 and the DelSoxp truncation. As expected, the AP activity of ESCs was restored by overexpression of WT Sox2 in Sox2 knockdown ESCs, while overexpression of the Soxp deletion truncation, which did not allow binding with LincQ, could not rescue AP activity (Figure 4B). Correspondingly, the changes in pluripotency genes and differentiated genes induced by Sox2 knockdown were rescued by the WT Sox2 but not the DelSoxp mutant in ESCs (Figure 4C-E). Therefore, our results showed that the Soxp domain of Sox2 was essential for binding with LincQ and for the maintenance of ESC pluripotency. FIGURE 4 Open in new tabDownload slide The Soxp domain of Sox2 is required for LincQ binding and for the maintenance of pluripotency. A, Schematic representation of the domains of Sox2 (top). Western blot analysis of flag-tagged full-length Sox2 and truncations were pulled down by LincQ full-length transcript in 293FT cells (bottom). B, Statistical analysis of the colony morphology following overexpression of Sox2 and the DelSoxp truncation in Sox2 knockdown ESCs. Sox2 was knocked down by treatment with an shRNA targeting its 3′-UTR. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent replicate. Two-tailed Student's t test (**P < .01) was performed relative to control undifferentiated cells, and (##P < .01) was performed relative to shSox2 Luc undifferentiated cells. C, Western blot analysis of Nanog and Dnmt3b in control and shSox2 UTR ESCs that expressed Sox2 or the DelSoxp truncation. GAPDH was used as a loading control. D, Expression of pluripotency genes (left panel) and differentiated genes (right panel) in control and shSox2 UTR ESCs with the expression of WT and DelSoxp Sox2 measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs and (#P < .05 and ##P < .01) was performed relative to shSox2 Luc ESCs. E, Immunostaining of Nanog and Dnmt3b in control and shSox2 UTR ESCs that express Sox2 and the DelSoxp truncation. The nuclei were stained with Hoechst 33342. Scale bars = 50 μm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; shRNA, short hairpin RNA; WT, wild type FIGURE 4 Open in new tabDownload slide The Soxp domain of Sox2 is required for LincQ binding and for the maintenance of pluripotency. A, Schematic representation of the domains of Sox2 (top). Western blot analysis of flag-tagged full-length Sox2 and truncations were pulled down by LincQ full-length transcript in 293FT cells (bottom). B, Statistical analysis of the colony morphology following overexpression of Sox2 and the DelSoxp truncation in Sox2 knockdown ESCs. Sox2 was knocked down by treatment with an shRNA targeting its 3′-UTR. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent replicate. Two-tailed Student's t test (**P < .01) was performed relative to control undifferentiated cells, and (##P < .01) was performed relative to shSox2 Luc undifferentiated cells. C, Western blot analysis of Nanog and Dnmt3b in control and shSox2 UTR ESCs that expressed Sox2 or the DelSoxp truncation. GAPDH was used as a loading control. D, Expression of pluripotency genes (left panel) and differentiated genes (right panel) in control and shSox2 UTR ESCs with the expression of WT and DelSoxp Sox2 measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs and (#P < .05 and ##P < .01) was performed relative to shSox2 Luc ESCs. E, Immunostaining of Nanog and Dnmt3b in control and shSox2 UTR ESCs that express Sox2 and the DelSoxp truncation. The nuclei were stained with Hoechst 33342. Scale bars = 50 μm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse transcription with quantitative polymerase chain reaction; shRNA, short hairpin RNA; WT, wild type LincQ/Sox2 regulate the transcription of pluripotency gene sets We next focused on the downstream genes regulated by both LincQ and Sox2. We performed RNA-seq analyses in control and LincQ knockdown ESCs. A total of 746 genes were downregulated, and 805 genes were upregulated in LincQ knockdown ESCs when compared to the control (Figure 5A). GO term analysis showed that the downregulated genes were associated with stem cell population maintenance or other biological processes, such as transport. The upregulated genes were associated with multicellular organism development and cell differentiation processes (Figure 5B,C). Furthermore, we evaluated the RNA-seq reliability. qRT-PCR showed that the expression of pluripotency genes (eg, Tfcp2l1, Tcl1, and Prdm14) was decreased, and the expression of differentiated genes (eg, Gata6, Sox17, and Zic2) was increased (supplemental online Figure S6A) in LincQ knockdown ESCs. Notably, gene set enrichment analysis showed that LincQ knockdown reduced the expression of ESC-enriched genes, indicating that LincQ is closely related to the maintenance of ESC pluripotency through regulating ESCs maintenance related genes (Figure 5D). Consistently, GO term analysis showed that the genes are bound by Sox2 and downregulated in LincQ knockdown ESCs were mainly associated with stem cell population maintenance and positive transcription processes (Figure 5E,F). The genes are bound by Sox2 and upregulated in LincQ knockdown ESCs were mainly associated with development process (supplemental online Figure S6B,C). We suspected the co-downregulated genes as potential targets of LincQ/Sox2 in ESCs. To further determine whether LincQ/Sox2 regulates these cotarget genes, ChIP assays for Sox2 and RNA polymerase II occupancy of these genes were performed in LincQ knockdown ESCs. Our results showed that Sox2 and RNA polymerase II enrichment were decreased at cotarget genes upon LincQ knockdown (Figure 5G,H). Furthermore, the enrichment of RNA polymerase II at these genes was decreased in Sox2 knockdown ESCs (Figure 5I). Collectively, these findings suggest that LincQ is involved in Sox2 function in transcription regulation of pluripotency genes. FIGURE 5 Open in new tabDownload slide LincQ/Sox2 regulate the transcription of pluripotency gene sets. A, Scatter plot of the RNA-seq expression data from control and LincQ knockdown ESCs. Genes significantly changed (>1.5-fold change) are colored in blue and red for downregulated genes and upregulated genes, respectively. B,C, GO term analysis of genes that were downregulated, B, or upregulated, C, from control and LincQ knockdown ESC RNA-seq expression data. D, Gene set enrichment analysis from the RNA-seq expression data with control and shLincQ ESCs. ESC-enriched gene sets have been reported by other studies.63 E, Venn diagram shows overlap of shLincQ RNA-seq downregulated genes with Sox2 ChIP-seq bound genes. F, GO term analysis of shLincQ RNA-seq downregulated and Sox2 ChIP-seq bound overlap genes. G,H, ChIP-qPCR analysis of Sox2 and RNA polymerase II binding at sites of pluripotency genes in control and LincQ knockdown ESCs are shown using the designed primers. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to control ESCs. I, ChIP-qPCR analysis of RNA polymerase II binding at sites of pluripotency genes in control and Sox2 knockdown ESCs are shown using the designed primers. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to control ESCs. ChIP, chromatin immunoprecipitation; GO, gene ontology FIGURE 5 Open in new tabDownload slide LincQ/Sox2 regulate the transcription of pluripotency gene sets. A, Scatter plot of the RNA-seq expression data from control and LincQ knockdown ESCs. Genes significantly changed (>1.5-fold change) are colored in blue and red for downregulated genes and upregulated genes, respectively. B,C, GO term analysis of genes that were downregulated, B, or upregulated, C, from control and LincQ knockdown ESC RNA-seq expression data. D, Gene set enrichment analysis from the RNA-seq expression data with control and shLincQ ESCs. ESC-enriched gene sets have been reported by other studies.63 E, Venn diagram shows overlap of shLincQ RNA-seq downregulated genes with Sox2 ChIP-seq bound genes. F, GO term analysis of shLincQ RNA-seq downregulated and Sox2 ChIP-seq bound overlap genes. G,H, ChIP-qPCR analysis of Sox2 and RNA polymerase II binding at sites of pluripotency genes in control and LincQ knockdown ESCs are shown using the designed primers. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to control ESCs. I, ChIP-qPCR analysis of RNA polymerase II binding at sites of pluripotency genes in control and Sox2 knockdown ESCs are shown using the designed primers. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05 and **P < .01) was performed relative to control ESCs. ChIP, chromatin immunoprecipitation; GO, gene ontology Esrrb and Tfcp2l1 are the main downstream targets of LincQ/Sox2 in maintaining pluripotency Two of the LincQ/Sox2 bound and regulated genes, Esrrb and Tfcp2l1, were of particular interest because they are key regulators of ESC pluripotency. They built a connection between extrinsic pluripotency-related signaling and intrinsic pluripotency factors in ESCs, and the reduction of their expression leads to impaired ESC pluripotency.5,43 Indeed, upon LincQ knockdown, we found an obvious decrease in Sox2 and RNA polymerase II enrichment at Esrrb and Tfcp2l1 sites, consistent with their markedly reduced expression. Therefore, we suspected that Esrrb and Tfcp2l1 were the main target genes for LincQ and Sox2 regulation. We then introduced exogenous HA-tagged Esrrb and Flag-tagged Tfcp2l1 into LincQ knockdown ESCs either individually or in combination. The results showed that introducing Esrrb or Tfcp2l1 individually partially rescued AP activity in LincQ knockdown ESCs, and fully rescue was achieved upon coexpression of Esrrb and Tfcp2l1 in LincQ knockdown ESCs (Figure 6A). Correspondingly, the pluripotency genes and differentiated genes were fully rescued by Esrrb and Tfcp2l1 coexpression in shLincQ ESCs (Figure 6B,C). Immunostaining analysis showed the same conclusion (Figure 6D). Taken together, we showed that restoring Esrrb and Tfcp2l1 levels was sufficient for maintaining pluripotency in LincQ knockdown ESCs. FIGURE 6 Open in new tabDownload slide Esrrb and Tfcp2l1 are the main downstream targets of LincQ/Sox2 in maintaining pluripotency. A, Statistical analysis of colony morphology following overexpression of Esrrb (HA-tagged Esrrb), Tfcp2l1 (Flag-tagged Tfcp2l1) or both in LincQ knockdown ESCs. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent replicate. Two-tailed Student's t test (**P < .01) was performed relative to control undifferentiated cells, and (#P < .05 and ##P < .01) was performed relative to shLincQ-2 Luc undifferentiated cells. B, Expression of pluripotency genes (top) and differentiated genes (bottom) in control and shLincQ ESCs with the expression of Esrrb, Tfcp2l1, or both were measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs, and (#P < .05, ##P < .01, and ###P < .001) was performed relative to shLincQ-2 Luc ESCs. C, Western blot analysis of Nanog, Dnmt3b, HA-tag, and Flag-tag in control and shLincQ ESCs with the expression of Esrrb, Tfcp2l1, or both. GAPDH was used as a loading control. D, Immunostaining of Nanog and Dnmt3b is shown in control and shLincQ ESCs that express Esrrb, Tfcp2l1, or both. The nuclei were stained with Hoechst 33342. Scale bars = 50 μm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse-transcription quantitative real-time polymerase chain reaction FIGURE 6 Open in new tabDownload slide Esrrb and Tfcp2l1 are the main downstream targets of LincQ/Sox2 in maintaining pluripotency. A, Statistical analysis of colony morphology following overexpression of Esrrb (HA-tagged Esrrb), Tfcp2l1 (Flag-tagged Tfcp2l1) or both in LincQ knockdown ESCs. The results are presented as the mean ± SD (n = 3), with >200 colonies counted in each independent replicate. Two-tailed Student's t test (**P < .01) was performed relative to control undifferentiated cells, and (#P < .05 and ##P < .01) was performed relative to shLincQ-2 Luc undifferentiated cells. B, Expression of pluripotency genes (top) and differentiated genes (bottom) in control and shLincQ ESCs with the expression of Esrrb, Tfcp2l1, or both were measured by qRT-PCR. Expression levels were normalized to GAPDH. The results are presented as the mean ± SD (n = 3). Two-tailed Student's t test (*P < .05, **P < .01, and ***P < .001) was performed relative to control ESCs, and (#P < .05, ##P < .01, and ###P < .001) was performed relative to shLincQ-2 Luc ESCs. C, Western blot analysis of Nanog, Dnmt3b, HA-tag, and Flag-tag in control and shLincQ ESCs with the expression of Esrrb, Tfcp2l1, or both. GAPDH was used as a loading control. D, Immunostaining of Nanog and Dnmt3b is shown in control and shLincQ ESCs that express Esrrb, Tfcp2l1, or both. The nuclei were stained with Hoechst 33342. Scale bars = 50 μm. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; qRT-PCR, reverse-transcription quantitative real-time polymerase chain reaction DISCUSSION The function and regulation of LincQ Although the functional roles of lncRNAs in pluripotency have been increasingly reported, most of them have been identified in the context of stemness of cancers44-46; few lncRNAs that control the pluripotency of ESCs are known. LncKdm2b is highly expressed in ESCs.47 It can activate Zbtb3 by promoting the assembly and ATPase activity of the Snf2-related CREBBP activator protein (SRCAP) complex and potentiates ESC self-renewal in a Nanog-dependent manner.47 Trincr1 and lincU function in the cytoplasm and subsequently regulate the ERK and ERK pathways and ESC self-renewal.48,49 lncRNAs may represent an additional layer of the regulation of ESC self-renewal. In our study, ESCs lost their pluripotent ability and differentiated upon LincQ knockdown. The expression of LincQ is intrinsically activated by core factors in ESCs. The three core factors, Oct4, Sox2, and Nanog all have binding sites in their promoters and have a positive effect on promoting their own expression. Cooperative regulation by three core factors is a typical feature of many pluripotency-related genes and antidifferentiation genes,6 and the expression and regulatory profile of LincQ is a strong indication of its function in stem cells. Therefore, our findings reveal that LincQ is a novel lincRNA that is regulated by core factors and maintains the pluripotent state of ESCs. LincQ is a core factor associated lincRNA that acts as an activator Among the core transcription factors, few lncRNAs have been identified that associate with Oct4 and Nanog. The well-known linc-RoR functions as a key competing endogenous RNA to link the network of miRNAs and core transcription factors (TFs), for example, Oct4, Sox2, and Nanog.50,51 Human endogenous retrovirus subfamily H (HERVH) is a nuclear lncRNA required for the maintenance of human ESC identity.52 HERVH is associated with Oct4, coactivators, and Mediator subunits. Nanog interacting lincRNA steroid receptor RNA activator can be recruited to DNA through interactions with proteins that bind either directly or indirectly to DNA.20 Several lincRNAs were identified to be Sox2-associated,37,53 indicating that Sox2 is subjected to more robust regulation by lincRNAs. We found that LincQ binds specifically with the Sox2 protein but not the other two core factors (Oct4 and Nanog). Exon 1, the largest exon among the three LincQ exons, is critical for its binding to Sox2, and the binding is critically required for pluripotency maintenance. LincQ functions as a partner for Sox2 in activation of transcription. LincQ is different from lincRNA1614, which we reported previously.53 LincRNA1614 associates with the Sox2 and the PRC2 complex in gene transcription suppression, and LincQ acts as an activator rather than a suppressor. The function of the Soxp domain in Sox2 Importantly, we revealed that LincQ binds to the Soxp domain but not the HMG domain. The functional role of HMG in Sox2 is evolutionarily conserved; it mediates Sox2 binding to DNA elements or protein-protein, such as the interaction between Sox2 and Oct4.54 Given the ability of the HMG to bind to DNA, it is rational that the lncRNA may also prefer this region for binding, and it may play a regulatory role in Sox2 function. To our surprise, we showed that LincQ does not bind to the HMG domain at all. In Sox2, multiple activation domains within its C-terminus transcription activation region have been identified55; however, its C-terminus is also not involved in lincRNA binding. The function of the Soxp domain following HMG domain has not yet been well defined.55 We found that this region is responsible for binding to lncRNA. In light of recent discoveries revealing the flexibility of lncRNAs and their abilities to act as modular scaffolds for protein-chromatin interactions and to form spatially compact arrays of complexes, the binding of LincQ to Sox2 may play a role in conformational stabilization or recruitment of other molecules for chromatin modification and transcription regulation. Global gene expression regulation by LincQ and Sox2 in ESCs As a critical transcriptional regulator in maintenance of ESC pluripotency, Sox2 regulates pluripotency through regulation of the specific downstream gene sets and key genes.13 Previous studies indicated that some lncRNAs also regulate pluripotency through regulation of specific downstream gene sets. For instance, TUNA cooperates with PTBP1 and HNRNPK to maintain ESC pluripotency by promoting the transcriptional activities of a series of pluripotent genes, such as Nanog and Fgf4.56 Lncenc1 promotes the expression of glycolysis genes to maintain glycolysis activity, which is necessary for naive ESC self-renewal.57 In this study, we demonstrate that LincQ regulates a variety of genes involved in maintenance of pluripotency through its specifically binding to Sox2. However, whether this regulation is through LincQ direct association with these genes needs further investigation. Among them, Esrrb and Tfcp2l1 are key downstream genes, since their expression can rescue the impairment induced by LincQ knockdown. Esrrb and Tfcp2l1 perform critical functions during early development, and the maintenance of ESC pluripotency.43,58 Esrrb is a transcription factor, and a decrease in Esrrb impairs ESC pluripotency.59,60 Similar to Esrrb, Tfcp2l1 also acts as a transcription factor that regulates pluripotency genes such as Klf4 and Nanog in ESCs.61 Esrrb and Tfcp2l1 can also reprogram epidermal stem cells (EpiSCs) to become naive ESCs, indicating their significant role in ESCs.62 Our results showed that the expression of Esrrb and Tfcp2l1 is regulated by a lncRNA through the canonic core transcription factor Sox2. Functionally, overexpression of Esrrb or Tfcp2l1 individually or in combination can partially or fully rescue the loss of ESC pluripotency induced by LincQ knockdown, indicating the coordinated role of Esrrb, Tfcp2l1, and lincRNAs in ESCs. CONCLUSION We characterized a novel lncRNA, LincQ, that is highly expressed in ESCs and is critical for maintenance of ESC pluripotency. We demonstrated that LincQ interacts with Sox2 through exon 1 and that the Soxp domain of Sox2 is responsible for binding with LincQ. The interaction between Sox2 and LincQ is essential for the maintenance of pluripotency. LincQ/Sox2 is involved in the complex regulatory network of ESCs, and Esrrb or Tfcp2l1 are the key mediators. These findings deepen our understanding of the maintenance of ESC pluripotency and provide new insights into the molecular mechanism of Sox2 with LincRNAs. ACKNOWLEDGMENT This work was supported by grants obtained from the National Natural Science Foundation of China (Grant numbers 31771506, 81530042, 31871298, 31721003, and 31671533) and the Ministry of Science and Technology (Grant number 2016YFA0101300). CONFLICT OF INTEREST The authors declared no potential conflicts of interest. AUTHOR CONTRIBUTIONS R.J.: conceived and designed the experiments, performed the experiments, collected and assembled the data, and wrote the paper; X.G., Y.Y., W.C.: analyzed some of the experimental results, and provided technical assistance; J.K.: contributed materials, reagents or analytical tools, provided technical assistance, and approved the final version of manuscript; S.Z.: conceived and designed the experiments, contributed materials, reagents or analytical tools, wrote the paper, and approved the final version of the manuscript. DATA AVAILABILITY STATEMENT The data that support the findings of this study are available on request from the corresponding author. REFERENCES 1 Evans MJ , Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos . Nature . 1981 ; 292 : 154 - 156 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Martello G , Smith A. The nature of embryonic stem cells . Annu Rev Cell Dev Biol . 2014 ; 30 : 647 - 675 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Lessard JA , Crabtree GR. Chromatin regulatory mechanisms in pluripotency . Annu Rev Cell Dev Biol . 2010 ; 26 : 503 - 532 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Huang GY , Ye SD, Zhou XL, Liu D, Ying QL. Molecular basis of embryonic stem cell self-renewal: from signaling pathways to pluripotency network . Cell Mol Life Sci . 2015 ; 72 : 1741 - 1757 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Hackett JA , Surani MA. Regulatory principles of pluripotency: from the ground state up . Cell Stem Cell . 2014 ; 15 : 416 - 430 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Boyer LA , Lee TI, Cole MF, et al. Core transcriptional regulatory circuitry in human embryonic stem cells . Cell . 2005 ; 122 : 947 - 956 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Takahashi K , Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors . Cell . 2006 ; 126 : 663 - 676 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Takahashi K , Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors . Cell . 2007 ; 131 : 861 - 872 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Okita K , Ichisaka T, Yamanaka S. Generation of germline-competent induced pluripotent stem cells . Nature . 2007 ; 448 : 313 - 317 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Boiani M , Scholer HR. Regulatory networks in embryo-derived pluripotent stem cells . Nat Rev Mol Cell Biol . 2005 ; 6 : 872 - 884 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Rao S , Orkin SH. Unraveling the transcriptional network controlling ES cell pluripotency . Genome Biol . 2006 ; 7 : 230 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Jerabek S , Merino F, Scholer HR, et al. OCT4: dynamic DNA binding pioneers stem cell pluripotency . Biochim Biophys Acta . 1839 ; 2014 : 138 - 154 . Google Scholar OpenURL Placeholder Text WorldCat 13 Sarkar A , Hochedlinger K. The Sox family of transcription factors: versatile regulators of stem and progenitor cell fate . Cell Stem Cell . 2013 ; 12 : 15 - 30 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Chi Y , Wang D, Wang J, et al. Long non-coding RNA in the pathogenesis of cancers . Cell . 2019 ; 8 :1015. Google Scholar OpenURL Placeholder Text WorldCat 15 Batista PJ , Chang HY. Long noncoding RNAs: cellular address codes in development and disease . Cell . 2013 ; 152 : 1298 - 1307 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Derrien T , Johnson R, Bussotti G, et al. The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression . Genome Res . 2012 ; 22 : 1775 - 1789 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Cabili MN , Dunagin MC, McClanahan PD, et al. Localization and abundance analysis of human lncRNAs at single-cell and single-molecule resolution . Genome Biol . 2015 ; 16 : 20 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Novikova IV , Hennelly SP, Sanbonmatsu KY. Tackling structures of long noncoding RNAs . Int J Mol Sci . 2013 ; 14 : 23672 - 23684 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Guo X , Xu Y, Wang Z, et al. A Linc1405/Eomes complex promotes cardiac mesoderm specification and cardiogenesis . Cell Stem Cell . 2018 ; 22 : 893 - 908 . e896. Google Scholar Crossref Search ADS PubMed WorldCat 20 Wongtrakoongate P , Riddick G, Fucharoen S, Felsenfeld G. Association of the long non-coding RNA steroid receptor RNA activator (SRA) with TrxG and PRC2 complexes . PLoS Genet . 2015 ; 11 :e1005615. Google Scholar OpenURL Placeholder Text WorldCat 21 Ulitsky I , Bartel DP. lincRNAs: genomics, evolution, and mechanisms . Cell . 2013 ; 154 : 26 - 46 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Quinn JJ , Chang HY. Unique features of long non-coding RNA biogenesis and function . Nat Rev Genet . 2016 ; 17 : 47 - 62 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Huarte M . The emerging role of IncRNAs in cancer . Nat Med . 2015 ; 21 : 1253 - 1261 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Yang L , Lin C, Rosenfeld MG. A lincRNA switch for embryonic stem cell fate . Cell Res . 2011 ; 21 : 1646 - 1648 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Chen L , Zhang S. Long noncoding RNAs in cell differentiation and pluripotency . Cell Tissue Res . 2016 ; 366 : 509 - 521 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Rosa A , Ballarino A. Long noncoding RNA regulation of pluripotency . Stem Cells Int . 2016 ; 2016 :1797692. Google Scholar OpenURL Placeholder Text WorldCat 27 Jain AK , Xi YX, McCarthy R, et al. LncPRESS1 is a p53-regulated LncRNA that safeguards pluripotency by disrupting SIRT6-mediated de-acetylation of histone H3K56 . Mol Cell . 2016 ; 64 : 967 - 981 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Xu C , Zhang Y, Wang QL, et al. Long non-coding RNA GAS5 controls human embryonic stem cell self-renewal by maintaining NODAL signalling . Nat Commun . 2016 ; 7 :13287. Google Scholar OpenURL Placeholder Text WorldCat 29 Kamachi Y , Kondoh H. Sox proteins: regulators of cell fate specification and differentiation . Development . 2013 ; 140 : 4129 - 4144 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Zhang S , Cui W. Sox2, a key factor in the regulation of pluripotency and neural differentiation . World J Stem Cells . 2014 ; 6 : 305 - 311 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Rodda DJ , Chew JL, Lim LH, et al. Transcriptional regulation of nanog by OCT4 and SOX2 . J Biol Chem . 2005 ; 280 : 24731 - 24737 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Wang ZX , Teh CH, Kueh JL, et al. Oct4 and Sox2 directly regulate expression of another pluripotency transcription factor, Zfp206, in embryonic stem cells . J Biol Chem . 2007 ; 282 : 12822 - 12830 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Kondoh H , Kamachi Y. SOX-partner code for cell specification: regulatory target selection and underlying molecular mechanisms . Int J Biochem Cell Biol . 2010 ; 42 : 391 - 399 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Chew JL , Loh YH, Zhang W, et al. Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells . Mol Cell Biol . 2005 ; 25 : 6031 - 6046 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Kamachi Y , Uchikawa M, Tanouchi A, Sekido R, Kondoh H. Pax6 and SOX2 form a co-DNA-binding partner complex that regulates initiation of lens development . Genes Dev . 2001 ; 15 : 1272 - 1286 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Engelen E , Akinci U, Bryne JC, et al. Sox2 cooperates with Chd7 to regulate genes that are mutated in human syndromes . Nat Genet . 2011 ; 43 : 607 - 611 . Google Scholar Crossref Search ADS PubMed WorldCat 37 Ng SY , Bogu GK, Soh BS, Stanton LW. The long noncoding RNA RMST interacts with SOX2 to regulate neurogenesis . Mol Cell . 2013 ; 51 : 349 - 359 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Karwacki-Neisius V , Goke J, Osorno R, et al. Reduced Oct4 expression directs a robust pluripotent state with distinct signaling activity and increased enhancer occupancy by Oct4 and Nanog . Cell Stem Cell . 2013 ; 12 : 531 - 545 . Google Scholar Crossref Search ADS PubMed WorldCat 39 Ng SY , Johnson R, Stanton LW. Human long non-coding RNAs promote pluripotency and neuronal differentiation by association with chromatin modifiers and transcription factors . EMBO J . 2012 ; 31 : 522 - 533 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Lee TI , Johnstone SE, Young RA. Chromatin immunoprecipitation and microarray-based analysis of protein location . Nat Protoc . 2006 ; 1 : 729 - 748 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Guttman M , Donaghey J, Carey BW, et al. lincRNAs act in the circuitry controlling pluripotency and differentiation . Nature . 2011 ; 477 : 295 - 300 . Google Scholar Crossref Search ADS PubMed WorldCat 42 Adachi K , Suemori H, Yasuda S, et al. Role of SOX2 in maintaining pluripotency of human embryonic stem cells . Genes Cells . 2010 ; 15 : 455 - 469 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 43 Ye SD , Li P, Tong C, Ying QL. Embryonic stem cell self-renewal pathways converge on the transcription factor Tfcp2l1 . EMBO J . 2013 ; 32 : 2548 - 2560 . Google Scholar Crossref Search ADS PubMed WorldCat 44 Wang Y , He L, Du Y, et al. The long noncoding RNA lncTCF7 promotes self-renewal of human liver cancer stem cells through activation of Wnt signaling . Cell Stem Cell . 2015 ; 16 : 413 - 425 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Zhu PP , Wu JY, Wang YY, et al. LncGata6 maintains stemness of intestinal stem cells and promotes intestinal tumorigenesis . Nat Cell Biol . 2018 ; 20 : 1134 - 1144 . Google Scholar Crossref Search ADS PubMed WorldCat 46 Huarte M . The emerging role of lncRNAs in cancer . Nat Med . 2015 ; 21 : 1253 - 1261 . Google Scholar Crossref Search ADS PubMed WorldCat 47 Ye B , Liu B, Yang L, et al. LncKdm2b controls self-renewal of embryonic stem cells via activating expression of transcription factor Zbtb3 . EMBO J . 2018 ; 37 :e97174. Google Scholar OpenURL Placeholder Text WorldCat 48 Li YP , Duan FF, Zhao YT, et al. A TRIM71 binding long noncoding RNA Trincr1 represses FGF/ERK signaling in embryonic stem cells . Nat Commun . 2019 ; 10 : 1368 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Jiapaer Z , Li G, Ye D, et al. LincU preserves naive pluripotency by restricting ERK activity in embryonic stem cells . Stem Cell Reports . 2018 ; 11 : 395 - 409 . Google Scholar Crossref Search ADS PubMed WorldCat 50 Wang Y , Xu Z, Jiang J, et al. Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal . Dev Cell . 2013 ; 25 : 69 - 80 . Google Scholar Crossref Search ADS PubMed WorldCat 51 Cheng EC , Lin H. Repressing the repressor: a lincRNA as a MicroRNA sponge in embryonic stem cell self-renewal . Dev Cell . 2013 ; 25 : 1 - 2 . Google Scholar Crossref Search ADS PubMed WorldCat 52 Lu X , Sachs F, Ramsay L, et al. The retrovirus HERVH is a long noncoding RNA required for human embryonic stem cell identity . Nat Struct Mol Biol . 2014 ; 21 : 423 - 425 . Google Scholar Crossref Search ADS PubMed WorldCat 53 Guo X , Wang Z, Lu C, et al. LincRNA-1614 coordinates Sox2/PRC2-mediated repression of developmental genes in pluripotency maintenance . J Mol Cell Biol . 2018 ; 10 : 118 - 129 . Google Scholar Crossref Search ADS PubMed WorldCat 54 Ambrosetti DC , Basilico C, Dailey L. Synergistic activation of the fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends on protein-protein interactions facilitated by a specific spatial arrangement of factor binding sites . Mol Cell Biol . 1997 ; 17 : 6321 - 6329 . Google Scholar Crossref Search ADS PubMed WorldCat 55 Cox JL , Mallanna SK, Luo X, Rizzino A. Sox2 uses multiple domains to associate with proteins present in Sox2-protein complexes . PLoS One . 2010 ; 5 :e15486. Google Scholar OpenURL Placeholder Text WorldCat 56 Lin NW , Chang KY, Li ZH, et al. An evolutionarily conserved long noncoding RNA TUNA controls pluripotency and neural lineage commitment . Mol Cell . 2014 ; 53 : 1067 - 1067 . Google Scholar Crossref Search ADS WorldCat 57 Sun ZH , Zhu MZ, Lv P, et al. The long noncoding RNA Lncenc1 maintains naive states of mouse ESCs by promoting the glycolysis pathway . Stem Cell Reports . 2018 ; 11 : 741 - 755 . Google Scholar Crossref Search ADS PubMed WorldCat 58 Festuccia N , Owens N, Navarro P. Esrrb, an estrogen-related receptor involved in early development, pluripotency, and reprogramming . FEBS Lett . 2018 ; 592 : 852 - 877 . Google Scholar Crossref Search ADS PubMed WorldCat 59 van den Berg DLC , Zhang WS, Yates A, et al. Estrogen-related receptor beta interacts with Oct4 to positively regulate Nanog gene expression . Mol Cell Biol . 2008 ; 28 : 5986 - 5995 . Google Scholar Crossref Search ADS PubMed WorldCat 60 Percharde M , Lavial F, Ng JH, et al. Ncoa3 functions as an essential Esrrb coactivator to sustain embryonic stem cell self-renewal and reprogramming . Genes Dev . 2012 ; 26 : 2286 - 2298 . Google Scholar Crossref Search ADS PubMed WorldCat 61 Chen X , Xu H, Yuan P, et al. Integration of external signaling pathways with the core transcriptional network in embryonic stem cells . Cell . 2008 ; 133 : 1106 - 1117 . Google Scholar Crossref Search ADS PubMed WorldCat 62 Qiu DB , Ye SD, Ruiz B, et al. Klf2 and Tfcp2l1, two Wnt/beta-catenin targets, act synergistically to induce and maintain naive pluripotency . Stem Cell Reports . 2015 ; 5 : 314 - 322 . Google Scholar Crossref Search ADS PubMed WorldCat 63 Ben-Porath I , Thomson MW, Carey VJ, et al. An embryonic stem cell-like gene expression signature in poorly differentiated aggressive human tumors . Nat Genet . 2008 ; 40 : 499 - 507 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Funding information Ministry of Science and Technology of the People's Republic of China, Grant/Award Number: 2016YFA0101300; National Natural Science Foundation of China, Grant/Award Numbers: 31671533, 31721003, 31771506, 31871298, 81530042 ©AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Singh, Pratibha; Mohammad, Khalid S.; Pelus, Louis M.

doi: 10.1002/stem.3174pmid: 32159901

Abstract The bone marrow (BM) microenvironment/niche plays a key role in regulating hematopoietic stem and progenitor cell (HSPC) activities; however, mechanisms regulating niche cell function are not well understood. In this study, we show that niche intrinsic expression of the CXCR4 chemokine receptor critically regulates HSPC maintenance during steady state, and promotes early hematopoietic regeneration after myeloablative irradiation. At steady state, chimeric mice with wild-type (WT) HSPC and marrow stroma that lack CXCR4 show decreased HSPC quiescence, and their repopulation capacity was markedly reduced. Mesenchymal stromal cells (MSC) were significantly reduced in the BM of CXCR4 deficient mice, which was accompanied by decreased levels of the HSPC supporting factors stromal cell-derived factor-1 (SDF-1) and stem cell factor (SCF). CXCR4 also plays a crucial role in survival and restoration of BM stromal cells after myeloablative irradiation, where the loss of BM stromal cells was more severe in CXCR4-deficient mice compared to WT mice. In addition, transplantation of WT donor HSPC into CXCR4-deficient recipient mice demonstrated reduced HSPC homing and early hematopoietic reconstitution. We found that CXCR4 signaling attenuates irradiation-induced BM stromal cell loss by upregulating the expression of the antiapoptotic protein Survivin via the PI3K pathway. Our study suggests that SDF-1-CXCR4 signaling in the stromal microenvironment cells plays a crucial role in maintenance of HSPCs during homeostasis, and promotes niche regeneration and early hematopoietic reconstitution after transplantation. Modulation of CXCR4 signaling in the HSPC microenvironment could be a means to enhance hematopoietic recovery after clinical hematopoietic cell transplantation. Significance statement This study identified how the bone marrow (BM) niche intrinsic CXCR4-SDF-1 axis supports hematopoietic stem and progenitor cell maintenance and retention under steady state and promotes early hematopoietic recovery after myeloablation. The findings suggest that targeted modulation of CXCR4 signaling in BM niche may provide a novel approach to alleviate the irradiation/chemotherapy-induced BM stroma damage, to enhance blood cell production in patients undergoing stem cell transplantation for several hematological complications, including leukemia, lymphoma and aplastic anemia, as well as metabolic disorders such as diabetes. Bone marrow (BM) niche expressed CXCR4 critically regulates the hematopoietic stem and progenitor cell (HSPC) function. CXCR4 gene deletion exclusively in BM niche impairs wild-type HSPC quiescence, retention in BM, and their repopulation ability. These defects in HSPC function are associated with a reduction in HSPC supporting factors in BM due to loss of mesenchymal stem and progenitor cells. Open in new tabDownload slide Open in new tabDownload slide INTRODUCTION The proliferation and differentiation of hematopoietic stem and progenitor cells (HSPC) provides life-long production of blood and immune cells in adults. HSPC reside in a complex bone marrow (BM) microenvironment/niche formed by blood vessels, perivascular mesenchymal stromal cells (MSC), macrophages and sympathetic nerve fibers.1-5 Niche MSC and endothelial cells (EC) provide pivotal factors required for maintenance of HSPC under steady state, and hematopoietic regeneration after stress.3,, 4 Conditional deletion of the cytokines stromal cell-derived factor-1 (SDF-1) or stem cell factor (SCF) in EC and MSC results in a marked reduction in HSPC number and an increase in their trafficking to extramedullary organs.6,, 7 Blocking EC angiogenic activity by neutralizing vascular endothelial-cadherin (VE-cadherin) or vascular endothelial growth factor receptor-2 (VEGFR2) impairs hematopoietic stem cell (HSC) self-renewal and long-term repopulation ability.1 SDF-1 is an essential factor supporting HSC quiescence and their retention in the BM,8-10 and is primarily produced by perivascular MSC that colocalize with HSC.4 The biological activities of SDF-1 are mediated through binding to its cognate G-protein coupled receptor CXCR4.11-14 While it has been shown that SDF-1 signaling through CXCR4 expressed on HSC can regulate their quiescence, maintenance, and retention, the role of the SDF-1-CXCR4 signaling pathway in the marrow stromal cells that extrinsically support HSC function remains unclear. In this study we show that BM stromal cells express CXCR4 and that SDF-1-CXCR4 signaling in stromal cells extrinsically regulates HSC maintenance, self-renewal, and hematopoietic reconstitution after BM myeloablation. This identifies a critical unrecognized new level of extrinsic regulation of HSC maintenance and response to stress. MATERIALS AND METHODS Mice C57BL/6 and B6.Cg-Tg(CAG-cre/Esr1)5Amc (tamoxifen-inducible Cre) mice were purchased from Jackson Laboratories (Bar Harbor, Maine). B6.SJL-Ptprca/Pepcb (BoyJ) mice were bred and maintained in the IUSM LARC facility. CXCR4 floxed mice (CXCR4fl/fl) were originally obtained from Dr. Yong-Rui Zou (Feinstein Institute for Medical Research, Manhasset, New York) and maintained in our animal facility. CXCR4 conditional KO mice were generated by crossing CXCR4fl/fl to tamoxifen-inducible Cre transgenic mice. B6.Cg-Tg(CAG-cre/Esr1)5Amc and CXCR4fl/fl mice were on the C57BL/6 background. CXCR4 gene deletion in adult mice (9-12-weeks old) was induced by tamoxifen injections (2 mg/mouse, i.p.) for five consecutive days. Hereafter, we refer to CXCR4fl/fl mice as WT, and after tamoxifen treatment Cre+ CXCR4fl/fl mice as CXCR4 −/− or CXCR4 KO mice. All animal experiments were approved by the IUSM IACUC. Reagents Antibodies against c-kit (clone: 2B8), Sca-1 (clone: D7), lineage (clone: 17A2/RB6-8C5/RA3-6B2/Ter-119/M1/70), CD48 (clone: HM48-1), CD45 (clone: 30-F11), anti-Ter119 (clone: ter-119), PDGFR (clone: APB5), CD51 (clone: RMV-7), and CD31 (clone: MEC13.3) were from Biolegend (San Diego, California). Antibodies against CD150 (clone: mShad150), and VE-cadherin (clone: eBioBV13) were from BD Biosciences (San Diego, California). Anti-Nestin (clone: 307501) antibody was from R&D Systems (Minneapolis, Minnesota) and anti-Survivin (clone: 71G4B7E), and Phospho-Akt (Ser473) antibodies were from Cell Signaling Technology (Danvers, Massachusetts). Antibody against Kap-1 (phospho S824) was purchased from Abcam (Cambridge, Massachusetts). YM155 was purchased from Cayman Chemical (Ann Arbor, Michigan) and LY294002 was from Millipore Sigma (St. Louis, Missouri). Flow cytometry analysis Whole BM and spleen cells were treated with FcR blocker (BD Biosciences), and then stained with antilineage, anti-Sca-1, anti-c-kit, anti-CD150, and anti-CD48 antibodies to measure the phenotypically defined HSPC populations. After staining, cells were fixed with 1% paraformaldehyde and analyzed by flow cytometry. For stromal cell analysis, BM cells were first stained with anti-CD45, anti-ter119, anti-CD51, anti-PDGFRa, anti-CD31, and anti-VE-cadherin antibodies followed by fixation and permeabilization, and then stained with anti-Nestin and anti-phospho Kap-1 antibodies. Active caspase 3 and 7 were detected using CellEvent Caspase-3/7 (Invitrogen), and dead cells were excluded using LIVE/DEAD Fixable Stain (Invitrogen). Total cell count in the BM, spleen, and blood was quantitated using a Heska Element HT5 analyzer. Quantitative RT-PCR RNA from stromal cells (CD45-Ter119-CD31−) were isolated using QIAGEN RNeasy micro or mini kits. cDNAs were reverse-transcribed from total RNA using SuperScript VILO (Life Technologies, Invitrogen), according to the manufacturers’ protocols and subjected to real-time PCR using SYBR Green Supermix (Life Technologies) and a QuantStudio 6 Real time PCR System (ABI, Foster City, California). All of the samples were run in triplicate. Amplification of GAPDH was used for sample normalization. qRT-PCR primers were as follows: Survivin F: ATCGCCACCTTCAAGAACTG; Survivin R: AATCAGGCTCGTTCTCGGTA. CXCR4 F: GGCTGTAGAGCGAGTGTTGC; CXCR4 R AGATGGTGGGCAGGAAGATCC. Chimeric mouse generation Chimeric mice were generated by transplanting 1 × 106 whole BM cells from WT mice into lethally irradiated (1150 cGy split dose) congenic WT or tamoxifen-inducible Cre + CXCR4fl/fl recipients. Two months post-transplant, chimeric mice were treated with tamoxifen for five consecutive days and HSPC and total hematopoietic content determined by FACS immunophenotype and CFC assay. To evaluate the HSC self-renewal capacity, BM cells (200 000) from chimeric mice (CD45.1+) plus 200 000 competitive whole BM cells from untreated CD45.2+ mice were transplanted into lethally irradiated CD45.2+ recipients. Peripheral blood chimerism and multilineage reconstitution were assessed monthly for 20 weeks post-transplant. HSPC homing and hematopoietic stem cell engraftment Whole BM cells (2 × 107) from WT mice (CD45.1+) mice were labeled with 5-(and -6)-carboxyfluorescein diacetate succinimidyl ester (CFSE) (Molecular Probes, Thermo Fisher Scientific), washed, and transplanted into lethally irradiated WT and CXCR4 KO mice (CD45.2+). At 24-hour post-transplantation, BM cells were harvested, lineage positive cells depleted using MACS microbeads, and lineage negative cells were stained for LSK. The total number of CD45.1+ CFSE+ LSK cells were determined by flow cytometry. To measure the role of stromal CXCR4 in hematopoietic regeneration, we transplanted 1 × 106 WT donor cells into lethally irradiated WT or CXCR4−/− mice, and total CD45.1+ cells, LSK and SLAM LSK cells were measured at 15 days and 6 months post-transplantation. Ex vivo culture and treatment Freshly harvested mouse BM cells were enriched for the CD45-negative fraction using anti-CD45 magnetic beads (Miltenyi Biotech), and 1 × 106 CD45-negative cells were cultured in six-well adherent tissue culture plates using MesenCult media (Stem Cell Technologies, Vancouver, British Columbia, Canada) with 10% FBS. One half of the media was replaced after 7 days and on day 14 cells were stained with Giemsa staining solution (EMD Chemicals, Billerica, Massachusetts) and colonies enumerated. For in vitro BM stromal cell culture, CD45-negative BM cells were irradiated at 500 cGy, cultured in mouse MesenCult medium with or without SDF-1 (10 ng/mL) for 3 days, and treated with YM155 (10 ng/mL) or LY294002 (10 nM). To measure phospho AKT, CD45-negative BM cells were cultured overnight in MesenCult medium, followed by 30-minute treatment with SDF-1, and intracellular phospho AKT was measured by flow cytometry. For in vivo experiments, mice were irradiated at 650 cGy, and treated with SDF-1 (100 μg/kg/d) alone or in combination with YM155 (10 mg/kg/d) for 3 days. ELISA BM extracellular fluid (BMEF) was obtained by flushing one femur with 1 mL ice-cold PBS followed by centrifugation at 400g for 3 minutes. Cell-free supernatants were used to measure SDF-1 and SCF by ELISA (R&D Systems). All samples were run in duplicate. Migration assay BM CD45-negative cells were placed in upper chambers of transwell inserts (5 μm) (Corning, Lowell, Massachusetts) and their migration to rm/rhSDF-1 (100 ng/mL; R&D system) was quantitated by flow cytometry after 4 hours. Percentage migration was calculated by dividing total cells migrated to the lower well by the cell input multiplied by 100. MSC cell migration was determined by comparison of the proportion of MSCs in input and migrated populations. Statistical analysis All WT and KO mice were age and sex matched, and cages were randomly assigned to treatment groups. The number of animals used in the experiments was estimated to give sufficient power (>90%) based on the effect sizes observed in our preliminary data. Grubbs method was used to identify the outliers and no animals were excluded from the analysis. in vivo and ex vitro processing steps were not blinded. All the statistical analyses were performed using Excel (Microsoft Corp, Redmond, Washington) or Prism-GraphPad software (GraphPad, San Diego, California). Statistical significance for binary comparisons was assessed by two-tailed Student's t test; data were normally distributed with sufficiently equivalent variances. For comparison of more than two groups, ANOVA with post-hoc test was used. All data are reported as Mean ± SEM. RESULTS Loss of CXCR4 in marrow stromal cells impairs HSPC quiescence and maintenance HSPC quiescence and marrow retention has been linked to the interaction between SDF-1 produced extrinsically by perivascular stromal cells and CXCR4 expressed on HSC.4, 8, 9, 15 However, the role of intrinsic SDF-1-CXCR4 signaling in niche stromal cells and its subsequent effects on supporting HSC function is not clear. To evaluate if a niche cell SDF-1-CXCR4 axis contributes to HSPC regulation we first measured CXCR4 expression on different subpopulations of marrow stromal cells. Flow cytometry analysis showed that approximately 25% of total stromal cells (CD45−Ter119−), 23% of MSC (CD45−Ter119−CD31− PDGFR+CD51+), and 21% of EC (CD45−Ter119−CD31+VE-cadherin+) express CXCR4 (Figure 1A,B). To evaluate the physiological implication of intrinsic stromal cell CXCR4 signaling in regulation of HSPC function, we created chimeric mice by transplanting WT donor cells (Boy J; CD45.1) into WT (CXCR4fl/fl) or tamoxifen-inducible CXCR4 conditional knockout (Cre+ CXCR4fl/fl) recipient mice (C57BL6; CD45.2) (Figure 1C). At 8 weeks post-transplantation, all recipient mice were ≥95% CD45.1+, confirming full donor chimerism. At this time point, both sets of chimeric mice received tamoxifen administration and 12 weeks later marrow and peripheral blood (PB) HSPC were quantitated. CXCR4 transcript expression was essentially eliminated in stromal cells of chimeric mice with WT HSPC and CXCR4 knockout (KO) stroma (WT: CXCR4−/− mice) (Figure 1D). Consistent with absence of CXCR4 transcript, expression of cell surface CXCR4 was reduced on total stromal cells (>87%), MSC (>90%), and EC (>92%) after tamoxifen treatment (Figure 1E). Interestingly, WT: CXCR4−/− chimeric mice revealed significantly increased total BM LSK and SLAM LSK cells (Figure 1F,G) and significantly higher number of SLAM-LSK cells in active cell cycle (S + G2/M) (Figure 1H) compared with chimeric mice with WT HSPC and WT stroma (WT: CXCR4+/+ mice). In addition, peripheral blood colony-forming cells (CFU-C) were increased in WT: CXCR4−/− mice (Figure 1I). Total leukocytes in BM and PB were similar in both groups (Figure S1A,B). In addition, BM histology in chimeric mice with wild-type or CXCR4 KO stroma was similar to wild-type mice (Figure S1C). To measure the long-term repopulating potential of HSC in these chimeric mice, competitive transplantation was performed using BM cells from either WT: CXCR4+/+ or WT: CXCR4−/− chimeric mice as donors and lethally irradiated WT congenic mice as recipients. BM cells from chimeric mice with CXCR4-deficient stromal cells (WT: CXCR4−/−) displayed markedly reduced hematopoietic repopulating capacity compared to BM cells from chimeric mice with wild-type stroma (WT: CXCR4+/+) (Figure 1J, left) measured by blood chimerism. Trilineage distribution (myeloid, B cells and T cells) was similar in both types of chimeric mice (Figure 1J, right). WT: CXCR4−/− chimeric mice donor cells also showed reduced hematopoietic engraftment in the BM of recipient mice at 20 weeks post-transplantation (Figure S1D). These results strongly suggest that BM microenvironment CXCR4 signaling plays a crucial role in HSPC quiescence, maintenance, and function during steady state. Figure 1 Open in new tabDownload slide Loss of CXCR4 in BM stromal cells reduces HSPC retention and function. A, Top: Representative flow cytometry plots of freshly isolated mouse BM stromal cells (CD45−Ter119−), MSC (CD45−Ter119−CD31−CD51+PDGFRα+), and EC (CD45−Ter119−CD31+VE-cadherin+). Bottom: Representative flow plots showing CXCR4 expression on total stromal cells, MSC, and EC. B, Cell surface CXCR4 expression on mouse BM stromal cells, MSC, and EC (X ± SEM; N = 5 mice, each assayed individually). C, Schematic of chimeric mice generation, CXCR4 deletion, and functional analysis. D, E, CXCR4 transcript expression in CD45-Ter119- stromal cells of chimeric mice with WT stroma or CXCR4 KO stroma (X ± SEM; N = 3 mice, each assayed individually) and cell surface CXCR4 expression on BM total stromal cells, MSC and EC of chimeric mice with WT stroma or CXCR4 KO stroma (X ± SEM; N = 5 mice, each assayed individually). F, G, LSK and SLAM-LSK frequency in the BM of chimeric mice with WT donor:CXCR4 KO stroma or WT donor:WT stroma at 12 weeks post-tamoxifen treatment (X ± SEM; N = 5 mice per group, assayed individually; *P < .05). H, Cell-cycle status of BM SLAM-LSK from chimeric mice with WT or KO stroma (X ± SEM; N = 4 mice per group, assayed individually; *P < .05). I, Peripheral blood total CFU-C (CFU-GM, BFU-E, CFU-GEMM) in both group of mice at 12-week tamoxifen treatment (X ± SEM; N = 4 mice per group assayed individually; *P < .05). J, Long-term repopulating ability of HSPC from chimeric mice with WT donor:CXCR4 KO stroma or WT donor:WT stroma. BM cells from chimeric mice (CD45.1+) plus 200 000 competitive whole BM cells from untreated CD45.2+ mice were transplanted into lethally irradiated CD45.2+ recipients. Peripheral blood chimerism and multilineage reconstitution was assessed 20 weeks post-transplant (X ± SEM; N = 4 mice per group, each assayed individually; *P < .05) Figure 1 Open in new tabDownload slide Loss of CXCR4 in BM stromal cells reduces HSPC retention and function. A, Top: Representative flow cytometry plots of freshly isolated mouse BM stromal cells (CD45−Ter119−), MSC (CD45−Ter119−CD31−CD51+PDGFRα+), and EC (CD45−Ter119−CD31+VE-cadherin+). Bottom: Representative flow plots showing CXCR4 expression on total stromal cells, MSC, and EC. B, Cell surface CXCR4 expression on mouse BM stromal cells, MSC, and EC (X ± SEM; N = 5 mice, each assayed individually). C, Schematic of chimeric mice generation, CXCR4 deletion, and functional analysis. D, E, CXCR4 transcript expression in CD45-Ter119- stromal cells of chimeric mice with WT stroma or CXCR4 KO stroma (X ± SEM; N = 3 mice, each assayed individually) and cell surface CXCR4 expression on BM total stromal cells, MSC and EC of chimeric mice with WT stroma or CXCR4 KO stroma (X ± SEM; N = 5 mice, each assayed individually). F, G, LSK and SLAM-LSK frequency in the BM of chimeric mice with WT donor:CXCR4 KO stroma or WT donor:WT stroma at 12 weeks post-tamoxifen treatment (X ± SEM; N = 5 mice per group, assayed individually; *P < .05). H, Cell-cycle status of BM SLAM-LSK from chimeric mice with WT or KO stroma (X ± SEM; N = 4 mice per group, assayed individually; *P < .05). I, Peripheral blood total CFU-C (CFU-GM, BFU-E, CFU-GEMM) in both group of mice at 12-week tamoxifen treatment (X ± SEM; N = 4 mice per group assayed individually; *P < .05). J, Long-term repopulating ability of HSPC from chimeric mice with WT donor:CXCR4 KO stroma or WT donor:WT stroma. BM cells from chimeric mice (CD45.1+) plus 200 000 competitive whole BM cells from untreated CD45.2+ mice were transplanted into lethally irradiated CD45.2+ recipients. Peripheral blood chimerism and multilineage reconstitution was assessed 20 weeks post-transplant (X ± SEM; N = 4 mice per group, each assayed individually; *P < .05) Enhanced MSC egress and reduced levels of marrow stem cell supporting factors in the absence of CXCR4 Because CXCR4 deficiency in the BM microenvironment impairs HSPC function, we tested whether CXCR4 signals directly regulate the activity of BM niche cells. At 12 weeks post-CXCR4 gene deletion, a substantial decrease in MSC (CD45−Ter119−CD31−PDGFR+CD51+), nestin+CD45−Ter119−CD31− cells and mesenchymal progenitor cells (MPC) (CD45−Ter119−CD31−Sca-1+Alcam−) was observed in the BM of CXCR4 KO mice as compared to WT mice (Figure 2A,C). Of note, BM MSC counts were equivalent in Cre-CXCR4fl/fl and Cre-CXCR4wt/fl control groups (Figure S2A). Total marrow EC and α-SMA+ macrophage numbers were similar in WT and CXCR4 KO mice (Figure 2D,E). The HSPC supporting factors SDF-1 and SCF were significantly reduced in the BM of CXCR4 KO mice (Figure 2F,G). To further define the effect of CXCR4 signaling on MSC function, we measured MSC proliferation, survival and migration in WT and CXCR4 KO mice. CXCR4-deficient BM stromal cells generated fewer CFU-F colonies compared to WT stromal cells (Figure 2H). However, MSC survival, determined by caspase 3 expression, was similar in both group of mice (Figure 2I). MSC from CXCR4 KO mice demonstrated reduce migration to SDF-1 compared to WT mice MSC (Figure 2J). Moreover, CXCR4 KO mice consistently demonstrated an increase in trafficking of MSC to the peripheral circulation compared to WT mice (Figure 2K). Total BM cellularity was similar in WT and CXCR4 KO mice (Figure S2B). These data suggest that CXCR4 signaling regulates MSC retention in the BM, which provides optimal levels of hematopoietic factors for HSC maintenance. Figure 2 Open in new tabDownload slide CXCR4 deficiency enhances MSC egress and reduces stem cell supporting factors in the BM. A-E, Total BM MSC, Nestin+ cells, MPC, EC, and αSMA+ MO in WT and CXCR4 conditional KO mice (X ± SEM; N = 4-8 mice per group assayed individually; *P < .05). F, G, SDF-1 and SCF in the BMEF of WT and CXCR4 conditional KO mice at 12 weeks post-tamoxifen treatment (X ± SEM; N = 4 mice per group assayed individually in duplicate; *P < .05). H, CFU-F generation from WT and CXCR4 conditional KO mice derived MSC. CD45-negative BM cells from WT and CXCR4 KO mice were cultured for 15 days, and CFU-F were quantitated after Giemsa staining (X ± SEM; N = 4 mice per group assayed individually; *P < .05). I, Caspase-3 expression in BM MSC of WT and CXCR4 conditional KO mice at 12 weeks post-tamoxifen treatment. Caspase-3 expression in MSC gated population was determined by flow cytometry (X ± SEM; N = 4 mice per group assayed individually; *P < .05). J, Migration of MSC from WT and CXCR4 conditional KO mice to SDF-1 (100 ng/mL) in vitro in transwell cultures (X ± SEM; N = 4 mice per group assayed individually; *P < .05). K, MSC in PB of WT and CXCR4 conditional KO mice (X ± SEM; N = 4 mice per group assayed individually; *P < .05) Figure 2 Open in new tabDownload slide CXCR4 deficiency enhances MSC egress and reduces stem cell supporting factors in the BM. A-E, Total BM MSC, Nestin+ cells, MPC, EC, and αSMA+ MO in WT and CXCR4 conditional KO mice (X ± SEM; N = 4-8 mice per group assayed individually; *P < .05). F, G, SDF-1 and SCF in the BMEF of WT and CXCR4 conditional KO mice at 12 weeks post-tamoxifen treatment (X ± SEM; N = 4 mice per group assayed individually in duplicate; *P < .05). H, CFU-F generation from WT and CXCR4 conditional KO mice derived MSC. CD45-negative BM cells from WT and CXCR4 KO mice were cultured for 15 days, and CFU-F were quantitated after Giemsa staining (X ± SEM; N = 4 mice per group assayed individually; *P < .05). I, Caspase-3 expression in BM MSC of WT and CXCR4 conditional KO mice at 12 weeks post-tamoxifen treatment. Caspase-3 expression in MSC gated population was determined by flow cytometry (X ± SEM; N = 4 mice per group assayed individually; *P < .05). J, Migration of MSC from WT and CXCR4 conditional KO mice to SDF-1 (100 ng/mL) in vitro in transwell cultures (X ± SEM; N = 4 mice per group assayed individually; *P < .05). K, MSC in PB of WT and CXCR4 conditional KO mice (X ± SEM; N = 4 mice per group assayed individually; *P < .05) CXCR4 is required for protection of stromal niche cells and hematopoietic regeneration after myeloablative irradiation Because myeloablative irradiation severely damages the BM microenvironment16,, 17 and hematopoietic regeneration is critically regulated by microenvironment/niche cells, we evaluated whether stromal cell CXCR4 expression contributes to niche protection/restoration and hematopoietic regeneration after lethal irradiation using a transplantation model. Wild-type and CXCR4 conditional KO mice (treated 15 days earlier with tamoxifen) were lethally irradiated, and at 24 hours post-irradiation transplanted with WT whole BM cells (Figure 3A). At 48 hours post-irradiation, BM niche stromal cell populations were evaluated by flow cytometry. Total BM stromal cell, MSC, and EC counts were substantially lower in irradiated CXCR4 KO mice compared to WT mice (Figures 3B-D and S2C). Expression of the DNA damage marker phosphorylated-Kap-1 was significantly higher in MSC and EC of CXCR4 KO mice compared to WT irradiated mice (Figure 3E,F). To further determine whether ablation of CXCR4 signaling in the BM niche cells influences their ability to support hematopoietic reconstitution after irradiation, we measured donor HSPC homing and engraftment in lethally irradiated WT or CXCR4 KO recipient mice. Homing of donor LSK cells was substantially lower in CXCR4 KO recipient mice compared to WT recipient mice at 24 hours post-transplantation (Figure 3G). At 15 days post-transplantation, donor-derived LSK, SLAM LSK, and lineage-positive cells (Figure 3H) were significantly lower in the BM of CXCR4 KO recipient mice compared to WT recipients. While donor LSK and SLAM LSK number were significantly higher in the BM of CXCR4 KO recipient mice at 6-months post-transplantation compared to WT recipient mice (Figure 3I), overall BM cellularity was similar. Furthermore, spleen LSK, SLAM LSK, and total nucleated cells were significantly lower in CXCR4 KO recipient mice compared to WT recipient mice (Figure 3J). In contrast, spleen LSK cell count was higher in CXCR4 KO mice compared to WT mice under normal physiological condition (Figure S3A). These findings demonstrate that BM niche cell CXCR4 is essential for stem cell niche protection, early hematopoietic regeneration, and HSPC maintenance after radiation-induced myelosuppression. Figure 3 Open in new tabDownload slide CXCR4 is required for the niche protection and hematopoietic regeneration after myeloablative irradiation. A, Schematic of WT HSPC transplantation into WT and CXCR4 KO recipient mice. CXCR4 gene deletion was induced by tamoxifen administration. At 15 days post-tamoxifen treatment, WT and CXCR4 KO mice were lethally irradiated and transplanted with WT donor cells 24 hours later. Bone marrow niche composition and donor HSPC homing was measured 24 hours post-transplantation. B-D, CD45neg total stromal cell, MSC and EC in the BM (two femurs) of WT and CXCR4 KO recipient mice transplanted with WT donor cells (X ± SEM; N = 5-6 mice per group assayed individually; *P < .05). Expression of phosphorylated Kap-1 in gated BM MSC, E, and EC, F, of lethally irradiated WT and CXCR4 KO mice. (X ± SEM; N = 4 mice per group assayed individually; *P < .05). G, Homing Wild-type donor HSPC either in WT or CXCR4 KO recipient mice (X ± SEM; N = 4 mice per group assayed individually; *P < .05). H, WT donor LSK (left), SLAM-LSK (center), and total nucleated cells (right) in the BM of lethally irradiated WT or CXCR4 KO mice recipient mice 15 days post-transplant (X ± SEM; N = 6-7 mice per group assayed individually; *P < .05). I, WT donor LSK (left), SLAM-LSK (center), and total nucleated cells (right) in the BM of lethally irradiated WT or CXCR4 KO mice recipient at 6 months post-transplant (X ± SEM; N = 4-6 mice per group assayed individually; *P < .05). J, Spleen LSK (left), SLAM LSK (center), and total nucleated cellularity (right) at 6 months post-transplant (X ± SEM; N = 4-6 mice per group assayed individually; *P < .05) Figure 3 Open in new tabDownload slide CXCR4 is required for the niche protection and hematopoietic regeneration after myeloablative irradiation. A, Schematic of WT HSPC transplantation into WT and CXCR4 KO recipient mice. CXCR4 gene deletion was induced by tamoxifen administration. At 15 days post-tamoxifen treatment, WT and CXCR4 KO mice were lethally irradiated and transplanted with WT donor cells 24 hours later. Bone marrow niche composition and donor HSPC homing was measured 24 hours post-transplantation. B-D, CD45neg total stromal cell, MSC and EC in the BM (two femurs) of WT and CXCR4 KO recipient mice transplanted with WT donor cells (X ± SEM; N = 5-6 mice per group assayed individually; *P < .05). Expression of phosphorylated Kap-1 in gated BM MSC, E, and EC, F, of lethally irradiated WT and CXCR4 KO mice. (X ± SEM; N = 4 mice per group assayed individually; *P < .05). G, Homing Wild-type donor HSPC either in WT or CXCR4 KO recipient mice (X ± SEM; N = 4 mice per group assayed individually; *P < .05). H, WT donor LSK (left), SLAM-LSK (center), and total nucleated cells (right) in the BM of lethally irradiated WT or CXCR4 KO mice recipient mice 15 days post-transplant (X ± SEM; N = 6-7 mice per group assayed individually; *P < .05). I, WT donor LSK (left), SLAM-LSK (center), and total nucleated cells (right) in the BM of lethally irradiated WT or CXCR4 KO mice recipient at 6 months post-transplant (X ± SEM; N = 4-6 mice per group assayed individually; *P < .05). J, Spleen LSK (left), SLAM LSK (center), and total nucleated cellularity (right) at 6 months post-transplant (X ± SEM; N = 4-6 mice per group assayed individually; *P < .05) CXCR4 attenuates irradiation-induced BM stromal cells loss by regulating Survivin expression We have previously reported that the antiapoptotic protein Survivin plays a crucial role in niche MSC survival after irradiation exposure.18 To investigate whether CXCR4 signaling supports HSC niche cell survival after irradiation exposure by regulating Survivin expression, we first measured whether the SDF-1-CXCR4 axis regulates Survivin expression in BM niche stromal cells. Flow cytometry data revealed that ex vivo SDF-1 treatment substantially increased intracellular Survivin protein expression in CD45−Ter119− marrow stromal cells of WT mice, but failed to increase Survivin in CXCR4 KO stromal cells (Figure 4A). Interestingly, the basal stromal cell Survivin level was significantly higher in WT mice compared to CXCR4 KO mice, further linking CXCR4 signaling in stromal cells to Survivin expression. In addition, ex vivo treatment of BM stromal cells with SDF-1 increased Survivin transcript expression (Figure S3B). Figure 4 Open in new tabDownload slide CXCR4 attenuates irradiation-induced BM stromal cell loss by upregulating intracellular Survivin. A, Survivin expression in BM stromal cells (CD45−Ter119−) cells from WT and CXCR4 KO mice after treatment in vitro with SDF-1 for 24 hours. Data are X ± SEM; N = 4 mice per group, assayed individually; *P < .05. B, C, Effects of in vitro and in vivo treatment with SDF-1 and Survivin inhibitor (YM155) on WT and CXCR4 KO BM stromal cell recovery after irradiation exposure. Data are X ± SEM; N = 4 mice per group, assayed individually; *P < .05. D, Phospho-AKT in BM stromal cells of WT and CXCR4 KO mice after in vitro treatment with or without SDF-1. Data are X ± SEM; N = 4 experiments; *P < .05. E, Intracellular Survivin expression in irradiated BM stromal cells treated with SDF-1 or SDF-1plus LY294002; data are X ± SEM; N = 4 experiments; *P < .05. F, Effect of in vitro SDF-1 or SDF-1 plus LY294002 treatment on irradiated BM stromal cell recovery; data are X ± SEM; N = 4 experiments; *P < .05 Figure 4 Open in new tabDownload slide CXCR4 attenuates irradiation-induced BM stromal cell loss by upregulating intracellular Survivin. A, Survivin expression in BM stromal cells (CD45−Ter119−) cells from WT and CXCR4 KO mice after treatment in vitro with SDF-1 for 24 hours. Data are X ± SEM; N = 4 mice per group, assayed individually; *P < .05. B, C, Effects of in vitro and in vivo treatment with SDF-1 and Survivin inhibitor (YM155) on WT and CXCR4 KO BM stromal cell recovery after irradiation exposure. Data are X ± SEM; N = 4 mice per group, assayed individually; *P < .05. D, Phospho-AKT in BM stromal cells of WT and CXCR4 KO mice after in vitro treatment with or without SDF-1. Data are X ± SEM; N = 4 experiments; *P < .05. E, Intracellular Survivin expression in irradiated BM stromal cells treated with SDF-1 or SDF-1plus LY294002; data are X ± SEM; N = 4 experiments; *P < .05. F, Effect of in vitro SDF-1 or SDF-1 plus LY294002 treatment on irradiated BM stromal cell recovery; data are X ± SEM; N = 4 experiments; *P < .05 To determine the significance of Survivin in CXCR4 signaling mediated niche protection after irradiation, WT and CXCR4 KO mouse BM stromal cells were cultured ex vivo with SDF-1, with or without YM155, a selective Survivin synthesis inhibitor,18 followed by irradiation at 500 cGy. At 72 hours post-irradiation, survival of WT and CXCR4−/− BM stromal cells was significantly reduced compared to nonirradiated controls (Figure 4B). Irradiation-mediated loss of WT BM stromal cells was significantly attenuated in the presence of SDF-1; however, SDF-1 was unable to rescue CXCR4 KO BM stromal cells (Figure 4B). The radioprotective effect of SDF-1 on WT stromal cell number was abrogated by YM155 treatment. In vivo, irradiation-induced stromal cell loss was more severe in CXCR4 KO mice compared to wild-type mice, and SDF-1 treatment substantially prevented stromal cell loss in WT mice but failed to rescue stromal cell loss in CXCR4 KO mice (Figure 4C). Attenuation of stromal cell loss observed in SDF-1 supplemented WT mice was abrogated by YM155 treatment (Figure 4C). The SDF-1-CXCR4 axis has been implicated in the activation of the P13K/AKT pathway in many neoplastic hematopoietic and solid cancer cells. To determine whether CXCR4 signaling enhances Survivin expression in stromal cells by regulating PI3K/AKT activation, we first measured AKT phosphorylation in SDF-1 treated BM stromal cells from WT and CXCR4 KO mice. SDF-1 treatment substantially increased AKT phosphorylation in WT stromal cells, but not in CXCR4 KO mice (Figure 4D). Interestingly, in vitro treatment of WT BM stromal cells with SDF-1 enhanced Survivin expression, whereas blockade of PI3K activation with LY294002 suppressed the SDF-1-induced increase in Survivin expression (Figure 4E). In addition, SDF-1 prevented irradiation-induced BM stromal loss; however, the protective effect of SDF-1 was abrogated by LY294002 (Figure 4F). These data suggest that SDF-1-CXCR4 axis-mediated Survivin expression via PI3K/AKT in BM niche stromal cells is important for their survival after irradiation exposure. DISCUSSION Although prior studies have described roles for intrinsic CXCR4 signaling in the regulation of HSPC quiescence and maintenance,8-10 survival/apoptosis,19,, 20 and BM retention,21 whether and how CXCR4 signaling within the stromal cell populations that extrinsically influence HSPC function is not known. In this study, we demonstrate for the first time that an SDF-1-CXCR4 axis in the stromal cell populations that comprise the HSPC niche directly regulates niche cell homeostasis and indirectly regulates/influences HSPC activity. The SDF-1 receptor CXCR4 is expressed on BM stroma cells including MSC and EC. Chimeric mice with CXCR4-deficient stroma and WT hematopoietic cells demonstrated defective HSPC quiescence, BM retention, and long-term repopulating ability. In addition, HSPC homing and early hematopoietic regeneration is markedly reduced when WT donor cells are transplanted into mice in which CXCR4 was deleted in the marrow stromal cells. Hematopoietic stem cell functional activities have been linked to intrinsic CXCR4 signaling.8 Our findings challenge that HSPC intrinsic signaling alone maintains their quiescence, marrow retention, and self-renewal, as selective ablation of CXCR4 in the BM stem cell microenvironment results in HSPC hyper-proliferation, lower self-renewal, and reduced BM retention. MSC are required for HSPC maintenance, and depletion of these cells enhances HSPC migration to extra extramedullary sites.4 Under steady state, we now find that CXCR4 signaling in stromal cells serves to regulate MSC retention in the BM, as ablation of CXCR4 on MSC enhanced their egress to the peripheral circulation and reduced their migration to SDF-1 in vitro. Thus, niche CXCR4 signaling likely influences HSPC maintenance by regulating MSC retention in the BM. It is well known that BM microenvironment cells support hematopoiesis through the production of factors that regulate HSPC function. Previous studies have shown that within the BM microenvironment, SDF-1 and SCF are primarily produced by MSC and EC.3,, 4 Reduced levels of HSPC supportive factors SDF-1 and SCF in the BM of CXCR4 KO mice strongly suggest that niche intrinsic CXCR4 signaling regulates HSPC function by influencing the production of HSPC supportive factors. High-dose irradiation commonly used as a preparative regimen for stem cell transplantation severely damages the BM niche and impairs hematopoietic reconstitution.01,, 16 Our study shows that the niche intrinsic CXCR4-SDF-1 axis protects them from irradiation-induced damage and promotes hematopoietic recovery. It suggests a new approach to alleviate the potentially life-threatening complications of radiotherapy and myeloablative transplantation. CXCR4 signaling promotes BM stromal cell survival by upregulating the expression of Survivin, an antiapoptotic protein. In this context using pharmacologic and genetic manipulation, we recently showed that Survivin critically promotes BM MSC survival after irradiation exposure.18 CXCR4 signaling mediated upregulation of Survivin has been shown to mitigate radiotherapy induced cancer cell apoptosis.22 PI3K/AKT and ERK are critical downstream pathways of SDF-1-CXCR4 axis,23 and a number of studies have shown that Survivin expression is upregulated by the PI3K/AKT/p70S6k1 pathway in many neoplastic hematopoietic and solid cancer cells24-27 and notably in normal EC as well.28 Since irradiation causes DNA damage29 and Survivin is shown to enhance DNA break repair,30 it is possible that CXCR4 signaling promotes BM stromal cell survival through Survivin-mediated enhancement of DNA damage repair. In this context, we found increased expression of phosphorylated Kap-1 and reduced levels of Survivin in CXCR4 KO stromal cells compared to WT stromal cells. In hematopoietic progenitor cells, we have previously reported that the antiapoptotic effects of Survivin require the cyclin-dependent kinase inhibitor p21WAF1/Cip1.31 Moreover we have shown that Survivin reduces p53 protein and enhances p53 degradation post-transcriptionally through blocking caspase-mediated Mdm2 cleavage.32 In normal HSC33 and in leukemic stem cells,34 differential mRNA microarray analysis indicates that Survivin impacts DNA-dependent transcription and affects multiple signaling pathways, notably, Src, PI3K, MAPK, and EGRF affecting transcription of genes involved in protein localization and translation, cytokine production and DNA damage repair. Thus, there are many potential pathways whereby CXCR4-mediated upregulation of Survivin expression can affect stromal cell survival and proliferation and further study is needed to explore the mechanistic links. CONCLUSION Our study suggests that SDF-1-CXCR4 signaling in hematopoietic niche cells plays a crucial role in maintenance of HSPC function during homeostasis, and promotes niche regeneration and recovery of hematopoiesis after transplantation. ACKNOWLEDGMENTS This work was supported by US Public Health Service grants HL096305, CA182947, AG046246, and AI128894 (to LMP) from the National Institutes of Health. Flow cytometry was performed in the Flow Cytometry Resource Facility of the IU Simon Cancer Center (NCI P30 CA082709). CONFLICT OF INTEREST The authors declared no potential conflicts of interest. AUTHOR CONTRIBUTIONS P.S.: study design, data interpretation, experiments, data analysis, manuscript writing; L.M.P.: study design, data interpretation and manuscript writing; K.S.M.: experiments, data analysis. DATA AVAILABILITY STATEMENT The data that support the findings of this study are available from the corresponding author upon reasonable request REFERENCES 1 Butler JM , Nolan DJ, Vertes EL, et al. Endothelial cells are essential for the self-renewal and repopulation of Notch-dependent hematopoietic stem cells . Cell Stem Cell . 2010 ; 6 : 251 - 264 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Chow A , Lucas D, Hidalgo A, et al. Bone marrow CD169+ macrophages promote the retention of hematopoietic stem and progenitor cells in the mesenchymal stem cell niche . J Exp Med . 2011 ; 208 : 261 - 271 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Ding L , Saunders TL, Enikolopov G, Morrison SJ. Endothelial and perivascular cells maintain haematopoietic stem cells . Nature . 2012 ; 481 : 457 - 462 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Mendez-Ferrer S , Michurina TV, Ferraro F, et al. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche . Nature . 2010 ; 466 : 829 - 834 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Zhao M , Tao F, Venkatraman A, et al. N-cadherin-expressing bone and marrow stromal progenitor cells maintain reserve hematopoietic stem cells . Cell Rep . 2019 ; 26 : 652 - 669 . e656. Google Scholar Crossref Search ADS PubMed WorldCat 6 Asada N , Kunisaki Y, Pierce H, et al. Differential cytokine contributions of perivascular haematopoietic stem cell niches . Nat Cell Biol . 2017 ; 19 : 214 - 223 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Ding L , Morrison SJ. Haematopoietic stem cells and early lymphoid progenitors occupy distinct bone marrow niches . Nature . 2013 ; 495 : 231 - 235 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Nie Y , Han YC, Zou YR. CXCR4 is required for the quiescence of primitive hematopoietic cells . J Exp Med . 2008 ; 205 : 777 - 783 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Sugiyama T , Kohara H, Noda M, Nagasawa T. Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches . Immunity . 2006 ; 25 : 977 - 988 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Zhang Y , Depond M, He L, et al. CXCR4/CXCL12 axis counteracts hematopoietic stem cell exhaustion through selective protection against oxidative stress . Sci Rep . 2016 ; 6 :37827. Google Scholar OpenURL Placeholder Text WorldCat 11 Foudi A , Jarrier P, Zhang Y, et al. Reduced retention of radioprotective hematopoietic cells within the bone marrow microenvironment in CXCR4−/− chimeric mice . Blood . 2006 ; 107 : 2243 - 2251 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Ma Q , Jones D, Borghesani PR, et al. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice . Proc Natl Acad Sci U S A . 1998 ; 95 : 9448 - 9453 . Google Scholar Crossref Search ADS PubMed WorldCat 13 Nagasawa T . CXC chemokine ligand 12 (CXCL12) and its receptor CXCR4 . J Mol Med (Berl) . 2014 ; 92 : 433 - 439 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Peled A , Grabovsky V, Habler L, et al. The chemokine SDF-1 stimulates integrin-mediated arrest of CD34(+) cells on vascular endothelium under shear flow . J Clin Invest . 1999 ; 104 : 1199 - 1211 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Greenbaum A , Hsu YM, Day RB, et al. CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance . Nature . 2013 ; 495 : 227 - 230 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Abbuehl JP , Tatarova Z, Held W, Huelsken J. Long-term engraftment of primary bone marrow stromal cells repairs niche damage and improves hematopoietic stem cell transplantation . Cell Stem Cell . 2017 ; 21 : 241 - 255 . e246. Google Scholar Crossref Search ADS PubMed WorldCat 17 Hooper AT , Butler JM, Nolan DJ, et al. Engraftment and reconstitution of hematopoiesis is dependent on VEGFR2-mediated regeneration of sinusoidal endothelial cells . Cell Stem Cell . 2009 ; 4 : 263 - 274 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Singh P , Fukuda S, Liu L, Chitteti BR, Pelus LM. Survivin is required for mouse and human bone marrow mesenchymal stromal cell function . Stem Cells . 2018 ; 36 : 123 - 129 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Broxmeyer HE , Cooper S, Kohli L, et al. Transgenic expression of stromal cell-derived factor-1/CXC chemokine ligand 12 enhances myeloid progenitor cell survival/antiapoptosis in vitro in response to growth factor withdrawal and enhances myelopoiesis in vivo . J Immunol . 2003 ; 170 : 421 - 429 . Google Scholar Crossref Search ADS PubMed WorldCat 20 Broxmeyer HE , Kohli L, Kim CH, et al. Stromal cell-derived factor-1/CXCL12 directly enhances survival/antiapoptosis of myeloid progenitor cells through CXCR4 and G(alpha)i proteins and enhances engraftment of competitive, repopulating stem cells . J Leukoc Biol . 2003 ; 73 : 630 - 638 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Broxmeyer HE , Orschell CM, Clapp DW, et al. Rapid mobilization of murine and human hematopoietic stem and progenitor cells with AMD3100, a CXCR4 antagonist . J Exp Med . 2005 ; 201 : 1307 - 1318 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Wang D , Jiao C, Zhu Y, et al. Activation of CXCL12/CXCR4 renders colorectal cancer cells less sensitive to radiotherapy via up-regulating the expression of survivin . Exp Biol Med (Maywood) . 2017 ; 242 : 429 - 435 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Yang P , Wang G, Huo H, Li Q, Zhao Y, Liu Y. SDF-1/CXCR4 signaling up-regulates survivin to regulate human sacral chondrosarcoma cell cycle and epithelial-mesenchymal transition via ERK and PI3K/AKT pathway . Med Oncol . 2015 ; 32 : 377 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Asanuma H , Torigoe T, Kamiguchi K, et al. Survivin expression is regulated by coexpression of human epidermal growth factor receptor 2 and epidermal growth factor receptor via phosphatidylinositol 3-kinase/AKT signaling pathway in breast cancer cells . Cancer Res . 2005 ; 65 : 11018 - 11025 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Carter BZ , Milella M, Altieri DC, Andreeff M. Cytokine-regulated expression of survivin in myeloid leukemia . Blood . 2001 ; 97 : 2784 - 2790 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Dasgupta P , Kinkade R, Joshi B, DeCook C, Haura E, Chellappan S. Nicotine inhibits apoptosis induced by chemotherapeutic drugs by up-regulating XIAP and survivin . Proc Natl Acad Sci U S A . 2006 ; 103 : 6332 - 6337 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Zhao P , Meng Q, Liu LZ, You YP, Liu N, Jiang BH. Regulation of survivin by PI3K/Akt/p70S6K1 pathway . Biochem Biophys Res Commun . 2010 ; 395 : 219 - 224 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Papapetropoulos A , Fulton D, Mahboubi K, et al. Angiopoietin-1 inhibits endothelial cell apoptosis via the Akt/survivin pathway . J Biol Chem . 2000 ; 275 : 9102 - 9105 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Lomax ME , Folkes LK, O'Neill P. Biological consequences of radiation-induced DNA damage: relevance to radiotherapy . Clin Oncol (R Coll Radiol) . 2013 ; 25 : 578 - 585 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Jiang G , Ren B, Xu L, Song S, Zhu C, Ye F. Survivin may enhance DNA double-strand break repair capability by up-regulating Ku70 in human KB cells . Anticancer Res . 2009 ; 29 : 223 - 228 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 31 Fukuda S , Mantel CR, Pelus LM. Survivin regulates hematopoietic progenitor cell proliferation through p21WAF1/Cip1-dependent and -independent pathways . Blood . 2004 ; 103 : 120 - 127 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Wang Z , Fukuda S, Pelus LM. Survivin regulates the p53 tumor suppressor gene family . Oncogene . 2004 ; 23 : 8146 - 8153 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Fukuda S , Hoggatt J, Singh P, et al. Survivin modulates genes with divergent molecular functions and regulates proliferation of hematopoietic stem cells through Evi-1 . Leukemia . 2015 ; 29 : 433 - 440 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Fukuda S , Abe M, Onishi C, et al. Survivin selectively modulates genes deregulated in human leukemia stem cells . J Oncol . 2011 ; 2011 :946936. Google Scholar OpenURL Placeholder Text WorldCat Author notes Funding information IU Simon Cancer Center, Grant/Award Number: NCI P30 CA082709; National Institutes of Health, Grant/Award Numbers: AI128894, AG046246, CA182947, HL096305 © AlphaMed Press 2020 This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Xia, Mingyu; Chen, Yan; He, Yingzi; Li, Huawei; Li, Wenyan

doi: 10.1002/stem.3175pmid: 32159914

Abstract Cellular mechanotransduction plays an essential role in the development and differentiation of many cell types, but if and how mechanical cues from the extracellular matrix (ECM) influence the fate determination of inner ear progenitor cells (IEPCs) remains largely unknown. In the current study, we compared the biological behavior of IEPCs in Matrigel-based suspension and encapsulated culture systems, and we found that the mechanical cues from the ECM promote the survival and expansion of IEPCs. Furthermore, we found that the mechanical cues from the ECM induced the accumulation of Ras homolog family member A (RhoA) and caused the polymerization of actin cytoskeleton in IEPCs. These changes in turn resulted in increased Yes-associated protein (YAP) nuclear localization and enhanced expansion of IEPCs, at least partially through upregulating the canonical Wnt signaling pathway. We therefore provide the first demonstration that the RhoA-YAP-β-catenin signaling axis senses and transduces mechanical cues from the ECM and plays crucial roles in promoting the expansion of IEPCs. Significance statement The impact of extracellular matrix (ECM) mechanical cues and mechanotransduction signaling upon inner ear progenitor cells (IEPCs) fate has not been described. The authors provide the first demonstration that RHOA-mediated actin cytoskeletal contractility plays a critical role in regulating the response of IEPCs to their microenvironment mechanical cues, using suspension and encapsulated culture systems. More specifically, the authors first characterized the action of YAP as mediators of mechanotransduction signaling to promote the expansion of IEPCs, partly through regulating ß-catenin activity. This study reveals the role and mechanism of YAP dependent mechanotransduction signaling in IEPCs proliferation. The study demonstrates that the essential role of RhoA–YAP–β-catenin signaling axis on inner ear progenitor cells expansion. The response of inner ear progenitor cells to mechanical cues from their microenvironment via RhoA-mediated actin cytoskeleton contraction, which lead to nuclear Yes-associated protein (YAP) accumulation. YAP as a mediator of mechanotransduction signaling to promote the expansion of inner ear progenitor cells through regulating β-catenin activity. Open in new tabDownload slide Open in new tabDownload slide INTRODUCTION The organ of Corti is the sensory receptor for hearing in mammals, and it is composed of mechanosensory hair cells and surrounding supporting cells. Different from other vertebrates, hair cells in mammals do not automatically regenerate after injury to the cochlea, and this results in permanent hearing loss,1-4 especially after the neonatal period. Because supporting cells share the same precursor cells with hair cells in the prosensory domain during inner ear development, supporting cells are regarded as the ideal source for hair cell regeneration. It has been reported that a subtype of supporting cells can reenter the cell cycle and transdifferentiate into hair cells under certain conditions, and these progenitor cells of the inner ear are marked by the expression of Lgr5, one of the Wnt-responsive molecules.5-7 However, the numbers of these progenitors as well as their regenerative capacity decreases significantly along with aging, and nearly no hair cell regeneration has been identified in the organ of Corti in adult mammals.8-10 Thus, investigations into the regulation of the proliferation, differentiation, and survival of progenitor cells in the inner ear will be beneficial for developing strategies for hair cell regeneration and the restoration of hearing. Isolated Lgr5+ cells can proliferate to form spheroids and differentiate into multiple cell types of the inner ear in intro, and these cells provide an ideal research model for studying development in the inner ear.11 In early studies, inner ear progenitor cells (IEPCs) were suspended in the culture medium on low-adherence plates for proliferating and for forming spheres.9 However, because cells reside in vivo surrounded by the extracellular matrix (ECM), which serves as a natural scaffold providing both structural integrity and biological cues, such suspension culture systems could not completely mimic the in vivo physiological environment. Recently, three-dimensional (3D) cell cultures with animal-derived and synthetic ECM have been used to optimize in vitro systems for culturing stem cells,12 and such systems provide more cues from the natural microenvironment that play important roles in the survival, proliferation, differentiation, and migration of the stem cells.13,, 14 It has been shown that cells cultured in 3D systems sense and adapt to external forces as well as to the mechanical constraints of the ECM through mechanotransduction signaling, especially through integrin-based adhesion and its connections with the intracellular actin cytoskeleton.15,, 16 Ras homolog family member A (RhoA) acts as a mechanotransducer of mechanical cues by promoting actin polymerization,17 and RhoA-mediated cytoskeletal contractility has been shown to play important roles in stem cell maintenance and differentiation.18-20 In addition, the transcriptional effector of the Hippo pathway—the Yes-associated protein (YAP)/transcriptional coactivator with PDZ-binding motif (TAZ)—has been found to serve as another sensor and mediator of mechanical signals in response to ECM cues.21,, 22 The Hippo pathway comprises two core kinases (MST1/2 and LATS1/2), YAP/TAZ, and other adaptor ligands, and activation by upstream signals causes MST1/2 to phosphorylate and activate LATS1/2, which in turn directly phosphorylates and inhibits YAP activity.23,, 24 Nuclear YAP protein is enriched in multiple mouse stem and progenitor cells,25 and the overexpression of YAP maintains the pluripotency of human embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs).26 Activation of YAP has also been shown to induce primary dedifferentiated cells to convert into a tissue-specific progenitor and stem cell state,27 and thus activation of YAP serves as a major regulator of stem/progenitor cell proliferation and plays crucial roles in organ development and regeneration.28-30 However, the roles of RhoA and YAP, the two signaling pathways most closely associated with the mediation of mechanical signals in response to the ECM, on the biological characteristics of IEPCs remain to be investigated. Such research will provide a better understanding of the mechanisms involved in the regulation of IEPCs and a better understanding of the interactions between these two important pathways, and this will ultimately lead to new methods for rebuilding the integrity of the hearing sensory epithelium by activating the remaining IEPCs. In the current study, we first compared the biological behaviors of IEPCs in a traditional suspension culture system and in a Matrigel-encapsulated 3D culture system to explore the effects of the external forces as well as the mechanical constraints induced by the ECM on the IEPCs in vitro. We then supplied the culture medium with multiple small molecules for interfering with the RhoA and YAP signals, and this allowed us to identify the downstream targets of the mechanical force induced by the ECM as well as the mechanism behind the proliferation and differentiation of IEPCs in the 3D culture system. We conclude that the mechanical cues from the ECM that are transduced via RhoA signaling and the actin cytoskeleton are essential for the survival and expansion of IEPCs and that YAP serves as a downstream nuclear mediator and effector of actin cytoskeletal contraction through β-catenin in order to promote IEPC expansion. MATERIALS AND METHODS Animal model Lgr5-EGFP-IRES-creERT2 mice were purchased from the Jackson Laboratory (Stock #008875). β-cateninflox(exon3) mice were generously provided by Mark Taketo (Kyoto University). All animal experiments were approved by the Institutional Animal Care and Use Committee of Fudan University. Culture of the IEPCs from the organ of Corti The cochleae from postnatal day (P) 0–2 mice were dissected in phosphate buffered saline (Hyclone) on ice, and the sensory epithelium was separated along with the modiolus and the stria vascularis. For the preparation of single cell suspensions, the isolated cochlear sensory epithelium was treated with 0.125% trypsin (Thermo Fisher Scientific) for 12 to 15 minutes at 37°C, followed by an equal volume of trypsin neutralizer solution (Thermo Fisher Scientific) to stop the enzymatic reaction. The samples were triturated with a plastic pipette, and dissociated cells were passed through a cell strainer with a pore size of 40 μm. For traditional culture, the single cell suspension was maintained with the culture medium in low-attachment 24-well plates (Corning), and a droplet of 40 μL Matrigel (Corning) was placed at the bottom of each plate in order to account for any possible influence of water-soluble factors in the Matrigel. For the encapsulated culture, the single cell suspension was embedded in 40 μL Matrigel and dropped to the bottom of each plate at room temperature to solidify the Matrigel, and then supplied with culture medium. The culture medium was composed of the basic culture medium (advanced Dulbecco's modified Eagle's medium/F12 supplemented with penicillin/streptomycin, N2, and B27), EGF (20 ng/mL), bFGF (10 ng/mL), and IGF (50 ng/mL), all from Thermo Fisher Scientific. In general, the culture medium was changed every 2 days. As indicated, the following small molecules and proteins were supplied to the culture media at the specified concentrations: Y-27632 (25 μM, Selleck), ML-7 (10 μM, Selleck), Blebbistatin (10 μM, Sigma), Cytochalasin D (10 μM, Sigma), Oleoyl-L-α-lysophosphatidic acid sodium salt (LPA) (2.5 μM, Sigma), Verteporfin (0.5 μM and 1 μM, Sigma), CHIR99021 (3 μM, Sigma), IWP-2 (2 μM, Sigma), CT04 (0.2 μg/mL and 0.5 μg/mL, Cytoskeleton), and CN03 (0.1 μg/mL and 0.2 μg/mL, Cytoskeleton). For the cell proliferation assay, EdU was supplied at a concentration of 5 μM for 4 hours prefixation. (Additional materials and methods are described in the Supplementary Materials and Methods.) RESULTS The viability of IEPCs is enhanced in the encapsulated 3D culture We compared the viability of IEPCs in the suspension culture system and in the Matrigel-encapsulated 3D culture system (Figure 1A). After being cultured for 3 days, IEPCs formed spheroids (Figure 1B) in both culture systems. As time progressed, however, more dead cells were seen in the spheroids cultured in suspension. At day 7, there were more dead cells in the suspension culture group than in the 3D-encapsulated culture group (Figure 1B-D), and the differences were even more pronounced at day 12. Furthermore, we performed a 3D Cell Titre Glo assay to detect the viability of cultured IEPCs, and after 5 days of culture, the viability of IEPCs was significantly lower in the suspension culture system than in the encapsulated cultured system. As time progressed, greater viability of IEPCs was detected in the spheroids cultured in the encapsulated system, and the differences were even more pronounced at day 12. These results indicate that the viability of IEPCs was well preserved in the 3D-encapsulated culture system. Figure 1 Open in new tabDownload slide IEPCs grown in encapsulated culture retain high viability. A, Schematic showing that IEPCs from Lgr5-EGFP mice grow into spheroids in suspension and 3D-encapsulated culture systems. B, Transmitted light and fluorescence microscopy images of spheroids from suspension culture stained for dead cells after 3, 5, 7, and 12 days. Scale bar = 100 μm. C, Transmitted light and fluorescence microscopy images of spheroids from the 3D-encapsulated culture system stained for dead cells after 3, 5, 7, and 12 days. Scale bar = 100 μm. D, The number of dead cells per spheroid. The data are presented as mean ± SEM (n = 30 spheroids for each group), *P < .05; **P < .01 vs suspension culture on the same day (two-way ANOVA followed by Sidak's multiple comparisons test). E, Luminescent cell viability assay comparing two independent culture system-generated spheroids at 3, 5, 7, and 12 days. The data are presented as mean ± SEM (n = 6), **P < .01 vs suspension culture on the same day (two-way ANOVA followed by Sidak's multiple comparisons test) Figure 1 Open in new tabDownload slide IEPCs grown in encapsulated culture retain high viability. A, Schematic showing that IEPCs from Lgr5-EGFP mice grow into spheroids in suspension and 3D-encapsulated culture systems. B, Transmitted light and fluorescence microscopy images of spheroids from suspension culture stained for dead cells after 3, 5, 7, and 12 days. Scale bar = 100 μm. C, Transmitted light and fluorescence microscopy images of spheroids from the 3D-encapsulated culture system stained for dead cells after 3, 5, 7, and 12 days. Scale bar = 100 μm. D, The number of dead cells per spheroid. The data are presented as mean ± SEM (n = 30 spheroids for each group), *P < .05; **P < .01 vs suspension culture on the same day (two-way ANOVA followed by Sidak's multiple comparisons test). E, Luminescent cell viability assay comparing two independent culture system-generated spheroids at 3, 5, 7, and 12 days. The data are presented as mean ± SEM (n = 6), **P < .01 vs suspension culture on the same day (two-way ANOVA followed by Sidak's multiple comparisons test) Encapsulated 3D culture promotes the expansion of IEPCs In order to compare the proliferative capacity of IEPCs in the two culture systems, we evaluated their proliferative ability by counting the number of EdU+ cells in cultured spheroids and by labeling them with the proliferative marker Ki67. After culture for 7 days, the percentage of EdU+ cells in the individual spheroids was higher in the 3D-encapsulated culture system compared with the suspension culture system (40.76 ± 1.26% vs 20.37 ± 0.87%, P < .01) (Figure 2A). In accordance with the results of EdU labeling, the percentage of Ki67+ cells in individual spheroids was also higher in the 3D-encapsulated culture system than in the suspension culture system (37.75 ± 1.25% vs 16.98 ± 1.43%, P < .01). The spheroids were also larger in the 3D-encapsulated system than in the suspension culture system (diameter: 80.58 ± 5.40 μm vs 41.28 ± 3.17 μm) (Figure 2B). Figure 2 Open in new tabDownload slide Encapsulated culture promotes IEPC expansion. A, Confocal images of suspended and encapsulated spheroids showing EdU and Ki67 staining. Proliferating cells were quantified as the percentage of EdU+ or Ki67+ cells. Scale bar = 15 μm. n = 11 suspended spheroids, and n = 10 encapsulated spheroids. B, Bright-field and fluorescence microscopy images of spheroids formed from suspended and encapsulated cells and expressing Lgr5-EGFP. Scale bar = 500 μm. Quantification of the diameter of spheroids from (B); n = 22 suspended spheroids, and n = 18 encapsulated spheroids. Quantification of the percentage of Lgr5-EGFP positive spheroids from (B) (n = 3); C, qRT-PCR analysis showing the relative expression of cell cycle genes and markers of IEPCs, supporting cells, and hair cells. Results were normalized to GAPDH in the same sample and then normalized to the suspension group (n = 3). D, Confocal images showing Myosin7a and Sox2 immunofluorescent staining. Scale bar = 15 μm. Quantification of the percentage of Myosin7a/Sox2 double-positive spheroids from (D) (n = 6), and quantification of the percentage of Myosin7a/Sox2 double-positive cells per spheroid from (D) (n = 10 spheroids for each group). The data are presented as mean ± SEM; *P < .05; **P < .01 (unpaired two-tailed Student's t test) Figure 2 Open in new tabDownload slide Encapsulated culture promotes IEPC expansion. A, Confocal images of suspended and encapsulated spheroids showing EdU and Ki67 staining. Proliferating cells were quantified as the percentage of EdU+ or Ki67+ cells. Scale bar = 15 μm. n = 11 suspended spheroids, and n = 10 encapsulated spheroids. B, Bright-field and fluorescence microscopy images of spheroids formed from suspended and encapsulated cells and expressing Lgr5-EGFP. Scale bar = 500 μm. Quantification of the diameter of spheroids from (B); n = 22 suspended spheroids, and n = 18 encapsulated spheroids. Quantification of the percentage of Lgr5-EGFP positive spheroids from (B) (n = 3); C, qRT-PCR analysis showing the relative expression of cell cycle genes and markers of IEPCs, supporting cells, and hair cells. Results were normalized to GAPDH in the same sample and then normalized to the suspension group (n = 3). D, Confocal images showing Myosin7a and Sox2 immunofluorescent staining. Scale bar = 15 μm. Quantification of the percentage of Myosin7a/Sox2 double-positive spheroids from (D) (n = 6), and quantification of the percentage of Myosin7a/Sox2 double-positive cells per spheroid from (D) (n = 10 spheroids for each group). The data are presented as mean ± SEM; *P < .05; **P < .01 (unpaired two-tailed Student's t test) Lgr5+ is a marker of progenitor cells in the inner ear, and after 7 days of culture the percentage of Lgr5+ cells in the suspended spheroids decreased significantly compared to the 3D-encapsulated spheroids (9.35 ± 1.44% vs 45.19 ± 3.85%, respectively, P < .01), and this provided further evidence for the sustained proliferative ability of IEPCs in the 3D-encapsulated culture system (Figure 2B). Furthermore, we compared the gene expression profiles of spheroids cultured in the suspension system and the Matrigel-encapsulated system, and we identified increased expression of Lgr5 and reduced expression of P27Kip1, an indicator of cell cycle exit, in the encapsulated culture system (Figure 2C). In order to further identify the possible differentiation process during the expansion of IEPCs in vitro, we investigated the expression of the genes involved in differentiation in the inner ear, and we found that there was no significant difference on the expression of supporting cell markers, including Sox2 and Jagged1, although the expression of Prox1 was much higher in the suspended spheroids. Meanwhile, the expression of hair cell markers, including Atoh1, Pou4f3, Prestin, and Vglut3, was also higher in the suspended spheroids (Figure 2C). We further labeled the spheroids with Myosin7a and Sox2 after 10 days in culture, and we identified several Myosin7a+ cells in the spheroids from the suspension culture system, but not in the spheroids from the 3D-encapsulated culture system (Figure 2D), and these Myosin7a+ cells were also labeled with Sox2 indicating that they were newly generated hair cells. These results suggested that the proliferative capacity of IEPCs decreased during their expansion in the suspension culture system, and this was subsequently accompanied by the unavoidable differentiation process, while, in the 3D-encapsulated culture system, the expansion capacity of IEPCs were significantly enhanced along with the reduced cell differentiation. Mechanotransduction signaling modulates the expansion of IEPCs in the 3D culture system In order to further dissect the mechanism behind the enhanced survival and proliferative capacity of the IEPCs in the 3D-encapsulated culture system, we investigated the possible roles of mechanotransduction signaling on the Matrigel-encapsulated spheroids. It has been reported that the intracellular actin cytoskeleton senses and transmits mechanical changes in the microenvironment and that this activity is regulated by RhoA.31 The accumulation of RhoA was observed in the encapsulated spheroids compared to the suspension spheroids (Figure 3A,C), especially at the edges of the spheroids. Similar to the distribution of RhoA, intensive F-actin cytoskeleton polymerization was observed close to the cell-ECM interface of the encapsulated spheroids, while only a scattered and loosely formed F-actin cytoskeleton was identified in the suspended spheroids, which suggested that cell-ECM interactions might contribute to the cytoskeletal organization. Figure 3 Open in new tabDownload slide Upregulated RhoA enhances cytoskeleton polymerization and activates YAP in encapsulated culture. A, Confocal images of suspended and encapsulated spheroids showing RhoA and F-actin staining. Scale bar = 15 μm. B, Gene expression of RhoA, CTGF, and CYR61 by qRT-PCR analysis. Results were normalized to GAPDH in the same sample and then normalized to the suspended group (n = 3). C, Western blot analysis is shown for the indicated proteins in spheroids from two independent culture systems. GAPDH was used as the loading control. D, Immunofluorescent staining of p-YAP (s127) in IEPC spheroids. Scale bar = 15 μm. Quantification of the mean fluorescence intensity of antibody labeling for p-YAP (s-127) from (D) (n = 8 spheroids for each group). E, Immunofluorescent staining of YAP in IEPC spheroids and the percentage of YAP located in the nucleus. Scale bar, 15 μm. n = 10 spheroids for each group. The data are presented as mean ± SEM; *P < .05; **P < 0.01 (unpaired two-tailed Student's t test) Figure 3 Open in new tabDownload slide Upregulated RhoA enhances cytoskeleton polymerization and activates YAP in encapsulated culture. A, Confocal images of suspended and encapsulated spheroids showing RhoA and F-actin staining. Scale bar = 15 μm. B, Gene expression of RhoA, CTGF, and CYR61 by qRT-PCR analysis. Results were normalized to GAPDH in the same sample and then normalized to the suspended group (n = 3). C, Western blot analysis is shown for the indicated proteins in spheroids from two independent culture systems. GAPDH was used as the loading control. D, Immunofluorescent staining of p-YAP (s127) in IEPC spheroids. Scale bar = 15 μm. Quantification of the mean fluorescence intensity of antibody labeling for p-YAP (s-127) from (D) (n = 8 spheroids for each group). E, Immunofluorescent staining of YAP in IEPC spheroids and the percentage of YAP located in the nucleus. Scale bar, 15 μm. n = 10 spheroids for each group. The data are presented as mean ± SEM; *P < .05; **P < 0.01 (unpaired two-tailed Student's t test) In order to investigate the signal transduction from the external ECM mechanical cues to gene transcription in the Matrigel-encapsulated IEPCs, we used qPCR to measure the expression of RhoA and the downstream targets of YAP/TAZ—CTGF and CYR6. The expression of RhoA, CTGF, and CYR61 was significantly upregulated in the encapsulated spheroids compared to the suspended spheroids (Figure 3B). In addition, by Western blotting we found repressed LATS1 and enhanced YAP activity in IEPCs in the encapsulated culture system, as shown by lower phosphorylation levels of LATS1 and YAP at Ser127 in the encapsulated spheroids compared to the suspended spheroids (Figure 3C). The encapsulated IEPCs also had elevated levels of TAZ and CTGF. We also confirmed that the expression of p-YAP (s127) protein was downregulated in the encapsulated spheroids compared to the suspended spheroids (intensity: 21.61 ± 1.70 vs 37.94 ± 2.12, P < .01) (Figure 3D) and that the nuclear distribution of YAP, which is the functional form of the YAP protein, was much higher in the encapsulated spheroids compared to the suspended spheroids (54.93 ± 2.50% vs 21.82 ± 1.79%, P < .01) (Figure 3E). Our results showed that YAP signaling was strongly activated during the culture of IEPCs in the Matrigel-encapsulated 3D culture system. To further explore the role of RhoA on the expansion of IEPCs, we treated IEPCs with the Rho GTPase inhibitor CT04 in the encapsulated culture for 3 days, and this led to decreased cell viability in a dose-dependent manner (Figure S1A). Treatment with CT04 also caused a decreased number of spheroids in both the suspension and encapsulated culture systems (Figure S1B). Moreover, we observed weak F-actin cytoskeleton polymerization and reduced distribution of YAP in the nucleus of encapsulated spheroids after treatment with CT04 (42.45 ± 2.20% and 14.37 ± 1.01% in the control and the CT04-treated group, respectively, P < .01) (Figure S1C). Furthermore, we treated IEPCs with the Rho GTPase activator CN03 for 7 days, and supplementation with CN03 improved the viability of IEPCs in suspension culture (Figure S2A). We also found an increased spheroid number in the presence of CN03 in both culture systems (Figure S2B). In addition, an increased percentage of nuclear localization of YAP was found in the presence of CN03 in the two culture systems (suspension: 18.50 ± 1.95% and 36.97 ± 2.72% in the control and CN03-treated groups, respectively, P < .01; encapsulated: 42.27 ± 1.98% and 63.87 ± 2.30% in the control and CN03-treated groups, respectively, P < .01) (Figure S2C). Actin cytoskeletal integrity has been reported to sustain YAP nuclear localization.32-34 To get a deeper insight into the role of RhoA/ROCK and the structure of the actin cytoskeleton on the expansion of IEPCs, we inhibited ROCK by supplying Y-27632, and we blocked the polymerization of the cytoskeleton by supplying the myosin light chain kinase (MLCK) inhibitor ML-7, the myosin II inhibitor Blebbistatin, or the F-actin polymerization inhibitor Cytochalasin D in the Matrigel-encapsulated 3D culture system. The accumulation of F-actin was reduced by all four inhibitors, especially at the edges of the spheroids, which resulted in the scattered distribution of the cytoskeleton (Figure 4A). We also found that inhibition of ROCK as well as blocking cytoskeleton polymerization led to a decreased number of spheroids and to smaller spheroids in the single-cell suspension (Figure 4B). According to the cell proliferation assay, the percentages of EdU+ cells in each cultured spheroid were also decreased by the RhoA and cytoskeleton polymerization inhibitors compared to dimethyl sulfoxide (DMSO) treatment (Figure 4D), and this was accompanied by the downregulation of Lgr5 mRNA expression (Figure 4C). Figure 4 Open in new tabDownload slide Inhibition of Rho kinases and F-actin cytoskeleton polymerization leads to reduced expansion capacity and reduced YAP nuclear localization in IEPCs. A, Confocal images showing F-actin staining in spheroids treated with DMSO or different inhibitors. B, Spheroid formation in 3D-encapsulated culture treated with DMSO or different inhibitors by transmitted light microscopy. The scale bar on the left is 500 μm and the scale bar on the right is 50 μm. Quantification of the number of spheroids from (B); n = 3. C, RT-PCR analysis showing the mRNA expression of Lgr5 in IEPCs treated with DMSO or different inhibitors. Results were normalized to GAPDH in the same sample and then normalized to the Control group (n = 3). D, Confocal images showing EdU and YAP staining in IEPCs treated with DMSO or different inhibitors. Scale bar = 15 μm. n = 8 spheroids for each group. The data are presented as mean ± SEM; *P < .05; **P < .01 vs DMSO control (one-way ANOVA followed by Dunnett's multiple comparison test) Figure 4 Open in new tabDownload slide Inhibition of Rho kinases and F-actin cytoskeleton polymerization leads to reduced expansion capacity and reduced YAP nuclear localization in IEPCs. A, Confocal images showing F-actin staining in spheroids treated with DMSO or different inhibitors. B, Spheroid formation in 3D-encapsulated culture treated with DMSO or different inhibitors by transmitted light microscopy. The scale bar on the left is 500 μm and the scale bar on the right is 50 μm. Quantification of the number of spheroids from (B); n = 3. C, RT-PCR analysis showing the mRNA expression of Lgr5 in IEPCs treated with DMSO or different inhibitors. Results were normalized to GAPDH in the same sample and then normalized to the Control group (n = 3). D, Confocal images showing EdU and YAP staining in IEPCs treated with DMSO or different inhibitors. Scale bar = 15 μm. n = 8 spheroids for each group. The data are presented as mean ± SEM; *P < .05; **P < .01 vs DMSO control (one-way ANOVA followed by Dunnett's multiple comparison test) Furthermore, we observed reduced distribution of YAP in the nucleus after treatment with the ROCK and cytoskeleton polymerization inhibitors mentioned above compared to DMSO-treated controls (Figure 4D). In the current study, we found a correlation between the polymerization of the actin cytoskeleton induced by the cell-ECM interaction and the activation of YAP, which showed that RhoA/ROCK and the actin cytoskeleton regulate the behavior of the cultured IEPCs and are required to maintain YAP activity in IEPCs. YAP maintains the proliferative capacity of the encapsulated IEPCs Because the activation of YAP mediated by the mechanical cues from the cell-ECM interaction was observed in the Matrigel-encapsulated 3D culture system, we performed further experiments to dissect the role of YAP, one of the effectors of Hippo signaling, on the expansion of IEPCs. LPA acts as a Hippo signaling agonist by inhibiting LAST1/2 and by increasing the nuclear localization of YAP,35 and we found that the expression of YAP-targeted genes, including CTGF and CYR61, was significantly upregulated in the encapsulated spheroids after LPA treatment (Figure 5A). LPA-induced dephosphorylation of LATS1 and YAP at Ser127, and LPA also caused increased TAZ expression. The LPA-induced activation of the Hippo pathway was blocked by the RhoA inhibitor CT04 (Figure 5B), which indicated that RhoA might mediate the activation of YAP by LPA. Supplementation with LPA also increased the number of spheroids that formed from the single cell suspension (Figure 5D) and upregulated the expression of Lgr5 (Figure 5A), a marker of IEPCs. Moreover, the addition of LPA to the 3D-encapsulated culture system led to an increase in the nuclear localization of YAP protein, as indicated by Western blot (Figure 5C) and by immunostaining (55.83% ± 2.18% and 77.19% ± 2.29% of nuclear YAP+ cells in the DMSO and LPA-treated groups, respectively, P < .05) (Figure 5E,F), and this was associated with an increased percentage of EdU+ cells in each spheroid (43.00% ± 1.32% and 56.51% ± 1.726% EdU+ cells in the DMSO- and LPA-treated groups). Figure 5 Open in new tabDownload slide Activation of YAP enhances the expansion of IEPCs. A, RT-PCR analysis showing mRNA expression of YAP target genes and Lgr5 in spheroids from controls or spheroids treated with LPA. Results were normalized to GAPDH in the same sample and then normalized to the control group (n = 3). B, Western blot analysis for the indicated proteins in spheroids from different treated groups. GAPDH was used as the loading control. C, Western blot analysis of nuclear YAP protein from IEPC spheroids in 3D-encapsulated culture. Lamin B1 was used as the nuclear loading control. D, Transmitted light microscopy images of spheroid formation after treatment with vehicle or LPA. Scale bar = 500 μm. Quantification of the number of spheroids from (D) (n = 3). E, Confocal images showing YAP and EdU staining in control IEPCs and IEPCs treated with LPA in 3D-encapsulated culture at day 7. Scale bar = 15 μm. F, Quantification of the percentage of nuclear YAP or EdU positive cells per sphere from (E); n = 15 spheroids (Control), n = 12 spheroids (LPA). G, Confocal images showing YAP and EdU staining in IEPCs cultured in the presence or absence of growth factors (EGF, bFGF, and IGF) at day 14. Cultured IEPCs in 3D-encapsulated culture in the presence of growth factors for 7 days (Control) are compared to those in which the growth factors were withdrawn (Withdrawn GFs). Scale bar = 15 μm. H, Quantification of the percentage of nuclear YAP+ or EdU+ cells per sphere from (E). n = 12 spheroids for each group. The data are presented as mean ± SEM; *P < .05; **P < .01 (unpaired two-tailed Student's t test) Figure 5 Open in new tabDownload slide Activation of YAP enhances the expansion of IEPCs. A, RT-PCR analysis showing mRNA expression of YAP target genes and Lgr5 in spheroids from controls or spheroids treated with LPA. Results were normalized to GAPDH in the same sample and then normalized to the control group (n = 3). B, Western blot analysis for the indicated proteins in spheroids from different treated groups. GAPDH was used as the loading control. C, Western blot analysis of nuclear YAP protein from IEPC spheroids in 3D-encapsulated culture. Lamin B1 was used as the nuclear loading control. D, Transmitted light microscopy images of spheroid formation after treatment with vehicle or LPA. Scale bar = 500 μm. Quantification of the number of spheroids from (D) (n = 3). E, Confocal images showing YAP and EdU staining in control IEPCs and IEPCs treated with LPA in 3D-encapsulated culture at day 7. Scale bar = 15 μm. F, Quantification of the percentage of nuclear YAP or EdU positive cells per sphere from (E); n = 15 spheroids (Control), n = 12 spheroids (LPA). G, Confocal images showing YAP and EdU staining in IEPCs cultured in the presence or absence of growth factors (EGF, bFGF, and IGF) at day 14. Cultured IEPCs in 3D-encapsulated culture in the presence of growth factors for 7 days (Control) are compared to those in which the growth factors were withdrawn (Withdrawn GFs). Scale bar = 15 μm. H, Quantification of the percentage of nuclear YAP+ or EdU+ cells per sphere from (E). n = 12 spheroids for each group. The data are presented as mean ± SEM; *P < .05; **P < .01 (unpaired two-tailed Student's t test) We next sought to further verify the roles of YAP on the expansion of IEPCs. After growing IEPCs in the 3D-encapsulated culture system in the classical expansion culture medium containing growth factors (EGF, bFGF, and IGF) for 7 days, the cells were divided into two groups—those cultured in the continued presence of growth factors (controls) and those in which the growth factors were withdrawn. Compared with the spheroids cultured in growth factor medium for another 7 days, the spheroids in the growth factor withdrawal group showed a concomitant decrease in the percentage of nuclear localization of YAP (35.73% ± 3.54% vs 14.15% ± 1.99%, P < .01) and in the percentage of EdU+ cells (17.89% ± 1.67% vs 0.67% ± 0.28%, P < .01) in each cultured spheroid in the 3D-encapsulated system (Figure 5G,H). These results further confirm that YAP activity is closely related to the proliferative capacity of IEPCs. To investigate whether disruption of YAP alters IEPC growth, we used lentiviral delivery of short hairpin RNA (shRNA) to deplete YAP. Depletion of YAP lead to decreased CTGF and CYR61 mRNA and decreased Lgr5 expression (Figure 6A,B). Compared to shControl, shYAP significantly decreased the number of spheroids in the encapsulated culture (Figure 6C). It has been reported that Verteporfin (VP) is a potent inhibitor of YAP, and we observed attenuated proliferation of IEPCs in a dose-dependent manner after exposure to VP (Figure 6D). The expression of the target genes of YAP, including CTGF and CYR61, was also downregulated and served as further evidence for the inactivation of YAP induced by VP (Figure 6E). As expected, compared with DMSO-treated controls, we found a decreased percentage of nuclear localization of YAP, a reduced percentage of EdU+ cells in each spheroid (Figure 6F), mitigated expression of Lgr5 expression (Figure 6E), and reduced capacity of the IEPCs to form spheroids after treatment with VP in the 3D-encapsulated culture system (Figure 6G). Combined with previous findings, our results highlight the crucial role of YAP in promoting the expansion of IEPCs. Figure 6 Open in new tabDownload slide Inhibition of YAP attenuates the expansion of IEPCs. A, Western blot analysis of YAP protein in shControl or shYAP IEPCs in 3D-encapsulated culture. B, RT-PCR analysis showing mRNA expression of YAP target genes and Lgr5 in shControl and shYAP IEPCs in 3D-encapsulated culture. Results were normalized to GAPDH in the same sample and then normalized to the shControl group (n = 3). C, Transmitted light and fluorescence microscopy images of spheroids from 3D-encapsulated cultured shControl or shYAP IEPCs. Scale bar = 200 μm. Quantification of the number of spheroids from C (n = 5). The data are presented as mean ± SEM; **P < .01 vs shControl (one-way ANOVA followed by Dunnett's multiple comparison test). D, The impact of Verteporfin (VP) on IEPC growth in 3D-encapsulated culture was assessed with the CCK8 assay (n = 3). E, RT-PCR analysis showing mRNA expression of YAP target genes and Lgr5 in spheroids treated with DMSO or VP. Results were normalized to GAPDH in the same sample and then normalized to the Control group (n = 3). F, Confocal images showing YAP and EdU staining in IEPCs treated with DMSO or VP. Scale bar = 15 μm. Quantification of the percentage of nuclear YAP+ or EdU+ cells per sphere from (E) (n = 8 spheroids for each group). G, Transmitted light microscopy images of spheroids treated with DMSO or VP. Scale bar = 500 μm. Quantification of the number of spheroids from (G) (n = 3). The data are presented as mean ± SEM; *P < .05; **P < .01 vs Control (one-way ANOVA followed by Dunnett's multiple comparison test) Figure 6 Open in new tabDownload slide Inhibition of YAP attenuates the expansion of IEPCs. A, Western blot analysis of YAP protein in shControl or shYAP IEPCs in 3D-encapsulated culture. B, RT-PCR analysis showing mRNA expression of YAP target genes and Lgr5 in shControl and shYAP IEPCs in 3D-encapsulated culture. Results were normalized to GAPDH in the same sample and then normalized to the shControl group (n = 3). C, Transmitted light and fluorescence microscopy images of spheroids from 3D-encapsulated cultured shControl or shYAP IEPCs. Scale bar = 200 μm. Quantification of the number of spheroids from C (n = 5). The data are presented as mean ± SEM; **P < .01 vs shControl (one-way ANOVA followed by Dunnett's multiple comparison test). D, The impact of Verteporfin (VP) on IEPC growth in 3D-encapsulated culture was assessed with the CCK8 assay (n = 3). E, RT-PCR analysis showing mRNA expression of YAP target genes and Lgr5 in spheroids treated with DMSO or VP. Results were normalized to GAPDH in the same sample and then normalized to the Control group (n = 3). F, Confocal images showing YAP and EdU staining in IEPCs treated with DMSO or VP. Scale bar = 15 μm. Quantification of the percentage of nuclear YAP+ or EdU+ cells per sphere from (E) (n = 8 spheroids for each group). G, Transmitted light microscopy images of spheroids treated with DMSO or VP. Scale bar = 500 μm. Quantification of the number of spheroids from (G) (n = 3). The data are presented as mean ± SEM; *P < .05; **P < .01 vs Control (one-way ANOVA followed by Dunnett's multiple comparison test) YAP enhances the expansion of IEPCs through activation of Wnt signaling It has been established that activation of the canonical Wnt signaling pathway by overexpressing β-catenin in the inner ear forces progenitors to reenter the cell cycle and thus facilitates progenitor cell proliferation and subsequent differentiation into hair cells.36,, 37 Considering the important roles of β-catenin on cell proliferation in the inner ear, we hypothesized that β-catenin might be a critical downstream target of YAP for promoting the expansion capacity of IEPCs. We crossed β-cateninflox(exon3) mice with Lgr5-EGFP-IRES-creERT2 mice to induce the overexpression of β-catenin (β-catenin-OE) in the Lgr5+ cells. Tamoxifen induction was performed at P0 and P1, and we harvested the organ of Corti at P7. We found that overexpression of β-catenin caused elevated Lgr5 expression in vivo (Figure S3A). Moreover, β-catenin-OE led to an increase in the capacity of IEPCs to form spheroids (Figure S3B). To further investigate the effects of β-catenin on the proliferation of IEPCs in the Matrigel-encapsulated 3D system, we added CHIR99021 (CHIR) to the culture medium to activate Wnt signaling. We observed more EdU+ and Ki67+ cells in the spheroids after treatment with CHIR, and these effects could be attenuated by IWP-2, an inhibitor of Wnt signaling (Figure 7A), which further verified the role of Wnt signaling on the proliferation of IEPCs in the Matrigel-encapsulated 3D culture system. Figure 7 Open in new tabDownload slide YAP enhances the expansion of IEPCs through β-catenin. A, Confocal images showing β-catenin, EdU, and Ki67 staining in spheroids treated with CHIR, IWP-2, or CHIR+IWP2. Scale bar = 15 μm. Quantification of the percentage of nuclear β-catenin+, EdU+, and Ki67+ cells per sphere from A (n = 8 spheroids for each group). B, Confocal images showing β-catenin and EdU staining in spheroids treated with DMSO, LPA, LPA+IWP-2, VP, or VP+CHIR. Scale bar = 15 μm. Quantification of the percentage of nuclear β-catenin+ or EdU+ cells per sphere from B (n = 8 spheroids for each group). C, Transmitted light microscopy images of spheroid formation from cells treated with DMSO, LPA, LPA+IWP-2, VP, or VP+CHIR. Scale bar = 500 μm. Quantification of the number of spheroids from C (n = 4). D, RT-PCR analysis showing mRNA expression of β-catenin target genes Cyclin D1 and Axin2 and Lgr5 in IEPC spheroids treated with DMSO, LPA, LPA+VP, or LPA+shYAP. Results were normalized to GAPDH in the same sample and then normalized to the Control group (n = 3). E, Western blot analysis of nuclear YAP and β-catenin protein from IEPC spheroids in 3D-encapsulated culture treated with DMSO, LPA, LPA+VP, or LPA+shYAP. Lamin B1 was used as the nuclear loading control. The data are presented as mean ± SEM; *P < .05; **P < .01 (one-way ANOVA followed by Tukey's multiple comparisons test) Figure 7 Open in new tabDownload slide YAP enhances the expansion of IEPCs through β-catenin. A, Confocal images showing β-catenin, EdU, and Ki67 staining in spheroids treated with CHIR, IWP-2, or CHIR+IWP2. Scale bar = 15 μm. Quantification of the percentage of nuclear β-catenin+, EdU+, and Ki67+ cells per sphere from A (n = 8 spheroids for each group). B, Confocal images showing β-catenin and EdU staining in spheroids treated with DMSO, LPA, LPA+IWP-2, VP, or VP+CHIR. Scale bar = 15 μm. Quantification of the percentage of nuclear β-catenin+ or EdU+ cells per sphere from B (n = 8 spheroids for each group). C, Transmitted light microscopy images of spheroid formation from cells treated with DMSO, LPA, LPA+IWP-2, VP, or VP+CHIR. Scale bar = 500 μm. Quantification of the number of spheroids from C (n = 4). D, RT-PCR analysis showing mRNA expression of β-catenin target genes Cyclin D1 and Axin2 and Lgr5 in IEPC spheroids treated with DMSO, LPA, LPA+VP, or LPA+shYAP. Results were normalized to GAPDH in the same sample and then normalized to the Control group (n = 3). E, Western blot analysis of nuclear YAP and β-catenin protein from IEPC spheroids in 3D-encapsulated culture treated with DMSO, LPA, LPA+VP, or LPA+shYAP. Lamin B1 was used as the nuclear loading control. The data are presented as mean ± SEM; *P < .05; **P < .01 (one-way ANOVA followed by Tukey's multiple comparisons test) We further dissected the interaction between Hippo and Wnt signaling on the expansion of IEPCs in our system. We observed increased nuclear localization of β-catenin and more EdU+ progenitors in the cultured spheroids after treatment with LPA, and these effects could be attenuated by IWP-2 (Figure 7B). We observed fewer EdU+ progenitors in the cultured spheroids after treatment with VP, and this could be rescued by the addition of CHIR. LPA treatment promoted the ability of single cells to form spheroids, and this effect could be attenuated by IWP-2, whereas the sphere-forming ability was inhibited by VP treatment and could be rescued by CHIR in the Matrigel-encapsulated 3D culture system (Figure 7C). In addition, the expression of Lgr5 and the target genes of Wnt signaling, including Cyclin D1 and Axin2, was also upregulated at the mRNA level after treatment with LPA, while the LPA-induced Wnt downstream gene expression was abated by inhibition of YAP using VP or shYAP (Figure 7D). Moreover, LPA-induced nuclear-localized β-catenin was clearly reversed by VP and by shYAP (Figure 7E). Taken together, these results indicate that the enhanced expansion of IEPCs in the 3D system was modulated by sensing the mechanical cues from the ECM and that β-catenin served as the downstream nuclear effector for promoting the expansion of IEPCs. Spheroids from encapsulated IEPCs partially resemble transcriptome signatures of cochlear epithelium in vivo We observed the expression of Sox2 and E-caderin in the spheroids from encapsulated IEPCs by immunostaining, which confirmed that the expanded IEPCs preserved the characteristics of epithelial tissue in vitro (Figure S4A). In order to further investigate the transcriptomics of spheroids from encapsulated IEPCs, we performed RNA-seq to compare the transcriptional profiles between the IEPCs formed spheroids in 3D-encapsulted culture in vitro and the fresh dissected cochlear epithelium, the source of IEPCs in vivo. Our results show that there are 1432 differentially expressed genes (P-adj < .05, |log2Foldchange| > 1) between the IEPCs formed spheroids in vitro and the fresh dissected cochlear epithelium (Figure S4B). Compared to the fresh dissected cochlear epithelium, the genes related to terminal differentiation were significant lower in the IEPCs formed spheroids in vitro, such as Myo7a, Pou4f3, Espn, Tmc1, and Gfi1 (Figure S4C). While there is no difference on the genes involved in the mechanotransduction signaling between those two groups, such as Itgb4, Itgb8, Fbln2, Rhoa, and Rock1 (Figure S4d). In addition, the comparable expression profiles were identified in the genes involved in apoptosis (such as Bad, Bax, Casp3, Casp7, Casp9, and Fasn), genes related to cell cycle (such as Cdkn1a, Cdk2, Cdk4, and Mik67) and canonical Wnt signaling targets (such as Ctnnb1, Dkk1, Fzd2, Lrp5, and Tcf3) (Figure S4E-G) between the IEPCs formed spheroids in vitro and the fresh dissected cochlear epithelium. Most importantly, there is no prominent difference in the IEPCs marker genes between the spheroids cultured in vitro and fresh dissected sensory epithelium, such as, Sox9 and Epcam (Figure S4H). These results suggested that IEPCs cultured in 3D-encapsulated system partially resemble transcriptome signatures of the source of IEPCs in vivo. DISCUSSION In an earlier work, IEPCs were maintained in a suspension culture system without ECM,9, 38, 39 but recent evidence suggests that mechanical cues from the ECM have significant impacts on cell fate decisions comparable to the biochemical cues induced by growth factors.40,, 41 The mechanical properties of the ECM have been shown to have a great influence on cells’ biological functions, and during mechanotransduction ECM mechanical stimuli such as stretching, elasticity, and matrix rigidity are converted into chemical signals that control cell fate.12,, 42 The mechanical constraints from the ECM have also been shown to regulate the growth of murine inner ear cells during the developmental process,43 and thus we used a Matrigel-encapsulated 3D culture system to induce similar mechanical cues in the IEPC culture system that might better mimic the in vivo microenvironment. In the current study, we found that mechanical cell-matrix interactions increased the viability and expansion of IEPCs in the Matrigel-encapsulated IEPC culture system, which has been widely used in organoid cultures.44,, 45 It has been reported that cell-ECM interactions regulate the fate of many different kinds of cells in 3D culture, including embryonic stem cells, mesenchymal stem cells, and so on.42, 46, 47 Cells change their fate in response to integrin-dependent RhoA signaling and actin cytoskeleton dynamics induced by ECM mechanical stimulation.15 Decreased RhoA activity and disruptions to the actin cytoskeleton can be observed in vivo during hair cell loss induced by aminoglycoside antibiotics in the inner ear.48 The results from our experiments demonstrated that actin cytoskeleton polymerization regulated by RhoA could affect the proliferative capacity of IEPCs by transducing the mechanical cues from the external microenvironment, which is in agreement with studies in other systems.49,, 50 Furthermore, we found that activation of RhoA and enhanced actin cytoskeleton polymerization were primarily located on the surface of spheroids formed from single IEPCs in the Matrigel-encapsulated 3D culture system, and this was similar to what has been observed for colonies formed from human ESCs that displayed strong cell-ECM interactions at the colony edge.51 Enhanced RhoA activity and actin cytoskeleton polymerization were also found in spheroid cells that were not in contact with the ECM, and this suggests that mechanical signals from the ECM might be transmitted among the cells within the IEPC spheroid and thus affect the expansion of the IEPCs in a similar manner to how cell-cell contacts can remodel the actin cytoskeleton by regulating RhoA signaling to maintain cardiomyocyte identity.52 YAP has also been shown to be a sensor and mediator for mechanical signals in response to ECM cues, and the ECM mechanical cues that activate YAP require a mechanically stressed cytoskeleton.35,, 53 Pharmacological inhibition of actin cytoskeleton polymerization reduced the nuclear localization of YAP, providing further evidence that the actin cytoskeleton is required for maintaining the activity of YAP in IEPCs. We found that attenuated LATS1 phosphorylation was accompanied by YAP activation in 3D-encapsulated culture. We activated YAP signaling by using LPA, which binds to a family of G protein-coupled receptors and regulates YAP activity via Ga12/13-coupled receptors,35 and we found that LPA increased the proliferative potential of IEPCs. In addition, LPA simultaneously increased YAP activity and decreased LATS1 phosphorylation. These effects were all blocked by inhibition of RhoA. These results indicated that mechanotransduction signaling might promote IEPC expansion in a LATS-dependent manner in the encapsulated culture. In contrast to our results, a previous study showed that mechanical signals regulate YAP through a LATS-independent manner in soft ECM hydrogels,54 while another study supports our results by showing that extracellular mechanical signals modulate YAP through LATS in low-stiffness ECM.55 This contradiction might be due to the different cell culture modes and different cell-cell interactions. LPA-induced IEPC expansion was in accordance with the observation that LPA plays a positive role in maintaining the pluripotency of human ESCs and iPSCs by upregulating YAP activity.26 We also found that the combination of EGF, bFGF, and IGF could sustain the accumulation of YAP in the nucleus, which suggests that there might be cross-talk between YAP signaling and other signaling pathways, such as the FGFs, and it has been reported that bFGF-induced YAP nuclear translocation plays a crucial role in promoting the proliferation of lens epithelial cells.56 We inhibited YAP signaling using VP, and this significantly decreased the nuclear expression and downstream genes of YAP and inhibited the expansion of IEPCs. However, other studies have shown that the antiproliferative effects of VP are not dependent on YAP in endometrial cancer and colorectal cancer cells.57,, 58 Interestingly, VP attenuated the interaction between YAP and TEAD and suppressed YAP-dependent liver cancer.59 Moreover, VP has been shown to inhibit YAP nuclear translocation by increasing its phosphorylation at Ser7 and to activate MST1 to suppress the growth of C4-2 cells.60 These results suggest that VP is not specific for its target, and it might have tissue differences as an inhibitor of YAP. To account for this, we used shRNA to knock down YAP and got the same results as VP, which further shows the importance of YAP for promoting the expansion of IEPCs. In other tissues, it has been reported that the activation of YAP signaling reprograms intestinal stem cells and induces the regeneration of the intestinal epithelium after exposure to ionizing radiation28 and that constitutively active YAP signaling upregulates embryonic and proliferation-related genes and stimulates cardiac regeneration in the adult heart.61 Our results further demonstrate that YAP signaling plays a crucial role in promoting the expansion of IEPCs. Because Wnt/β-catenin signaling is another well-established essential signaling pathway for the proliferation of Lgr5+ progenitor cells in the inner ear, and because the stabilization of β-catenin results in cell-cycle reentry followed by differentiation of IEPCs into hair cells,36,, 62 we further investigated the interaction between canonical Wnt and YAP signaling during the expansion of IEPCs in our culture systems. The increased β-catenin nuclear translocation and subsequent enhancement of IEPC proliferation induced by the YAP activator LPA could be prevented by adding a Wnt signaling inhibitor, while the reduced β-catenin nuclear translocation and subsequent decrease in IEPC proliferation caused by the YAP inhibitor VP could be rescued by adding a Wnt signaling activator. Although the specific targets through which YAP regulates Wnt signaling during the expansion of IEPCs were not explored in our current study, our data still provide the first evidence that β-catenin might act as a downstream effector of YAP during the proliferation of IEPCs. Indeed, the interaction between Wnt and YAP signaling has been verified in other cellular and biological contexts, and it has been reported that the activation of YAP enhances cardiomyocyte proliferation and promotes cardiac regeneration by activating β-catenin,61,, 63 while another study showed that activation of YAP reprograms intestinal stem cells and induces intestinal regeneration by transiently suppressing Wnt signaling.28 According to the comparison and analysis of whole gene sequencing between the IEPCs formed spheroids in 3D-encapsulted culture in vitro and the fresh dissected cochlear epithelium, the source of IEPCs in vivo. We further confirmed that the ECM encapsulated IEPCs in 3D culture system could mimic the mechanotransduction signaling surrounded the IPECs in vivo, and the spheroids from encapsulated IEPCs partially resemble transcriptome signatures of cochlear epithelium in vivo. It has been reported that the biophysical simulation of nature environment in the cultured progenitors might be not sufficient to achieve the gene signatures of related tissue in vivo.41,, 64 Multiple combinations of growth factors and compounds will be tested in our Matrigel encapsulated 3D culture system for achieving the self-renewal of IEPCs as well as the controllable differentiation process65,, 66 In this study, we provide the first demonstration that external mechanical signals from the ECM can be transduced into IEPCs through the RhoA-YAP-β-catenin signaling axis and that this regulates the survival, proliferation, and differentiation of IEPCs. Thus, such interactions serve as an important modulating factor for the biological activities of IEPCs and provide potential therapeutic targets for activating the progenitor cells and for promoting hair cell regeneration in the inner ear by pharmacologically or genetically regulating the function of the RhoA-YAP-β-catenin signaling axis in vitro or in vivo. In addition, the interacting targets among the whole RhoA-YAP-β-catenin signaling axis should be further investigated for promoting hair cell regeneration and for restoring homeostasis in the cochlear epithelium. CONCLUSION In conclusion, we provide the first piece of evidence that RhoA-mediated actin cytoskeletal contractility plays a critical role in regulating the response of IEPCs to mechanical cues in their microenvironment by comparing the survival, proliferation, and differentiation of IEPCs cultured in suspended or in Matrigel-encapsulated 3D systems. We further identified YAP as a mediator of mechanotransduction signaling for promoting the expansion of IEPCs, partly through the regulation of β-catenin activity. Thus, the RhoA-YAP-β-catenin signaling axis senses and transmits mechanical cues from the ECM and plays crucial roles in promoting the expansion of IEPCs. ACKNOWLEDGMENTS This work was supported by the National Key R&D Program of China (No. 2017YFA0103900), the National Science Foundation for outstanding young people (81922018), the National Natural Science Foundation of China (No. 81771011), the Development Fund for Shanghai Talents (grant number 2017046), and the Excellent Personnel Training Plan for the Shanghai Health System (grant number 2017Q003). CONFLICT OF INTERESTS The authors declare no potential conflict of interest. AUTHOR CONTRIBUTIONS M.X., W.L., H.L.: design; M.X., W.L., H.L.: manuscript writing; M.X., Y.C., Y.H.: experiments; M.X., W.L.: analysis; M.X., W.L., H.L., Y.C., Y.H.: manuscript commenting. DATA AVAILABILITY STATEMENT The data that support the findings of this study are accessible through accession number PRJNA608092 (NCBI SRA). REFERENCES 1 Corwin JT , Cotanche DA. Regeneration of sensory hair cells after acoustic trauma . Science . 1988 ; 240 : 1772 - 1774 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Oshima K , Grimm CM, Corrales CE, et al. Differential distribution of stem cells in the auditory and vestibular organs of the inner ear . J Assoc Res Otolaryngol . 2007 ; 8 : 18 - 31 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Ryals BM , Rubel EW. Hair cell regeneration after acoustic trauma in adult Coturnix quail . Science . 1988 ; 240 : 1774 - 1776 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Warchol ME . Sensory regeneration in the vertebrate inner ear: differences at the levels of cells and species . Hearing Res . 2011 ; 273 : 72 - 79 . Google Scholar Crossref Search ADS WorldCat 5 Chai R , Kuo B, Wang T, et al. Wnt signaling induces proliferation of sensory precursors in the postnatal mouse cochlea . Proc Natl Acad Sci U S A . 2012 ; 109 : 8167 - 8172 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Huch M , Dorrell C, Boj SF, et al. In vitro expansion of single Lgr5+ liver stem cells induced by Wnt-driven regeneration . Nature . 2013 ; 494 : 247 - 250 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Li W , Wu J, Yang J, et al. Notch inhibition induces mitotically generated hair cells in mammalian cochleae via activating the Wnt pathway . Proc Natl Acad Sci U S A . 2015 ; 112 : 166 - 171 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Cox BC , Chai R, Lenoir A, et al. Spontaneous hair cell regeneration in the neonatal mouse cochlea in vivo . Development . 2014 ; 141 : 816 - 829 . Google Scholar Crossref Search ADS PubMed WorldCat 9 Lu X , Sun S, Qi J, et al. Bmi1 regulates the proliferation of cochlear supporting cells via the canonical Wnt signaling pathway . Mol Neurobiol . 2017 ; 54 : 1326 - 1339 . Google Scholar Crossref Search ADS PubMed WorldCat 10 Bramhall NF , Shi F, Arnold K, et al. Lgr5-positive supporting cells generate new hair cells in the postnatal cochlea . Stem Cell Rep . 2014 ; 2 : 311 - 322 . Google Scholar Crossref Search ADS WorldCat 11 McLean WJ , Yin X, Lu L, et al. Clonal expansion of Lgr5-positive cells from mammalian cochlea and high-purity generation of sensory hair cells . Cell Rep . 2017 ; 18 : 1917 - 1929 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Bao M , Xie J, Huck WTS. Recent advances in engineering the stem cell microniche in 3D . Adv Sci . 2018 ; 5 :1800448. Google Scholar OpenURL Placeholder Text WorldCat 13 Jarvelainen H , Sainio A, Koulu M, et al. Extracellular matrix molecules: potential targets in pharmacotherapy . Pharmacol Rev . 2009 ; 61 : 198 - 223 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Guilak F , Cohen DM, Estes BT, et al. Control of stem cell fate by physical interactions with the extracellular matrix . Cell Stem Cell . 2009 ; 5 : 17 - 26 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Sun Z , Guo SS, Fassler R. Integrin-mediated mechanotransduction . J Cell Biol . 2016 ; 215 : 445 - 456 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Case LB , Waterman CM. Integration of actin dynamics and cell adhesion by a three-dimensional, mechanosensitive molecular clutch . Nat Cell Biol . 2015 ; 17 : 955 - 963 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Vogel V , Sheetz M. Local force and geometry sensing regulate cell functions . Nat Rev Mol Cell Biol . 2006 ; 7 : 265 - 275 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Frith JE , Kusuma GD, Carthew J, et al. Mechanically-sensitive miRNAs bias human mesenchymal stem cell fate via mTOR signalling . Nat Commun. 2018 ; 9 : 257 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Liu M , Zhang Z, Sampson L, et al. RHOA GTPase controls YAP-mediated EREG signaling in small intestinal stem cell maintenance . Stem Cell Rep . 2017 ; 9 : 1961 - 1975 . Google Scholar Crossref Search ADS WorldCat 20 Keung AJ , de Juan-Pardo EM, Schaffer DV, et al. Rho GTPases mediate the mechanosensitive lineage commitment of neural stem cells . Stem Cells . 2011 ; 29 : 1886 - 1897 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Ma S , Meng Z, Chen R, et al. The Hippo pathway: biology and pathophysiology . Annu Rev Biochem . 2019 ; 88 : 577 - 604 . Google Scholar Crossref Search ADS PubMed WorldCat 22 Totaro A , Panciera T, Piccolo S. YAP/TAZ upstream signals and downstream responses . Nat Cell Biol . 2018 ; 20 : 888 - 899 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Mo JS , Park HW, Guan KL. The Hippo signaling pathway in stem cell biology and cancer . EMBO Rep . 2014 ; 15 : 642 - 656 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Yu F-X , Zhao B, Guan K-L. Hippo pathway in organ size control, tissue homeostasis, and cancer . Cell . 2015 ; 163 : 811 - 828 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Piccolo S , Dupont S, Cordenonsi M. The biology of YAP/TAZ: hippo signaling and beyond . Physiol Rev . 2014 ; 94 : 1287 - 1312 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Qin H , Hejna M, Liu Y, et al. YAP induces human naive pluripotency . Cell Rep . 2016 ; 14 : 2301 - 2312 . Google Scholar Crossref Search ADS PubMed WorldCat 27 Panciera T , Azzolin L, Fujimura A, et al. Induction of expandable tissue-specific stem/progenitor cells through transient expression of YAP/TAZ . Cell Stem Cell . 2016 ; 19 : 725 - 737 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Gregorieff A , Liu Y, Inanlou MR, et al. Yap-dependent reprogramming of Lgr5(+) stem cells drives intestinal regeneration and cancer . Nature . 2015 ; 526 : 715 - 718 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Yui S , Azzolin L, Maimets M, et al. YAP/TAZ-dependent reprogramming of colonic epithelium links ECM remodeling to tissue regeneration . Cell Stem Cell . 2018 ; 22 : 35 - 49 . e37. Google Scholar Crossref Search ADS PubMed WorldCat 30 Yosefzon Y , Soteriou D, Feldman A, et al. Caspase-3 regulates YAP-dependent cell proliferation and organ size . Mol Cell . 2018 ; 70 : 573 - 587 . e574. Google Scholar Crossref Search ADS PubMed WorldCat 31 Schiller HB , Fässler R. Mechanosensitivity and compositional dynamics of cell–matrix adhesions . EMBO Rep . 2013 ; 14 : 509 - 519 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Das A , Fischer RS, Pan D, et al. YAP nuclear localization in the absence of cell-cell contact is mediated by a filamentous actin-dependent, Myosin II- and Phospho-YAP-independent pathway during extracellular matrix mechanosensing . J Biol Chem . 2016 ; 291 : 6096 - 6110 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Kim M , Kim M, Lee S, et al. cAMP/PKA signalling reinforces the LATS-YAP pathway to fully suppress YAP in response to actin cytoskeletal changes . EMBO J . 2013 ; 32 : 1543 - 1555 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Wada K , Itoga K, Okano T, et al. Hippo pathway regulation by cell morphology and stress fibers . Development . 2011 ; 138 : 3907 - 3914 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Yu FX , Zhao B, Panupinthu N, et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling . Cell . 2012 ; 150 : 780 - 791 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Ni W , Lin C, Guo L, et al. Extensive supporting cell proliferation and mitotic hair cell generation by in vivo genetic reprogramming in the neonatal mouse cochlea . J Neurosci . 2016 ; 36 : 8734 - 8745 . Google Scholar Crossref Search ADS PubMed WorldCat 37 Yeh WH , Chiang H, Rees HA, et al. In vivo base editing of post-mitotic sensory cells . Nat Commun. 2018 ; 9 : 2184 . Google Scholar Crossref Search ADS PubMed WorldCat 38 McLean WJ , McLean DT, Eatock RA, et al. Distinct capacity for differentiation to inner ear cell types by progenitor cells of the cochlea and vestibular organs . Development . 2016 ; 143 : 4381 - 4393 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 39 Wang Z , Jiang H, Yan Y, et al. Characterization of proliferating cells from newborn mouse cochleae . Neuroreport . 2006 ; 17 : 767 - 771 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Sun Y , Chen C, Fu J. Forcing stem cells to behave: a biophysical perspective of the cellular microenvironment . Annu Rev Biophys . 2012 ; 41 : 519 - 542 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Cruz-Acuna R , Quiros M, Farkas AE, et al. Synthetic hydrogels for human intestinal organoid generation and colonic wound repair . Nat Cell Biol . 2017 ; 19 : 1326 - 1335 . Google Scholar Crossref Search ADS PubMed WorldCat 42 Goetzke R , Sechi A, De Laporte L, et al. Why the impact of mechanical stimuli on stem cells remains a challenge . Cell Mol Life Sci . 2018 ; 75 : 3297 - 3312 . Google Scholar Crossref Search ADS PubMed WorldCat 43 Gnedeva K , Jacobo A, Salvi JD, et al. Elastic force restricts growth of the murine utricle . Elife . 2017 ; 6 . https://doi.org/10.7554/eLife.25681. Google Scholar OpenURL Placeholder Text WorldCat 44 Koehler KR , Nie J, Longworth-Mills E, et al. Generation of inner ear organoids containing functional hair cells from human pluripotent stem cells . Nat Biotechnol . 2017 ; 35 : 583 - 589 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Alves-Lopes JP , Soder O, Stukenborg JB. Testicular organoid generation by a novel in vitro three-layer gradient system . Biomaterials . 2017 ; 130 : 76 - 89 . Google Scholar Crossref Search ADS PubMed WorldCat 46 Chen SS , Fitzgerald W, Zimmerberg J, et al. Cell-cell and cell-extracellular matrix interactions regulate embryonic stem cell differentiation . Stem Cells . 2007 ; 25 : 553 - 561 . Google Scholar Crossref Search ADS PubMed WorldCat 47 Gill BJ , West JL. Modeling the tumor extracellular matrix: tissue engineering tools repurposed towards new frontiers in cancer biology . J Biomech . 2014 ; 47 : 1969 - 1978 . Google Scholar Crossref Search ADS PubMed WorldCat 48 Jiang H , Sha SH, Schacht J. Rac/Rho pathway regulates actin depolymerization induced by aminoglycoside antibiotics . J Neurosci Res . 2006 ; 83 : 1544 - 1551 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Chen G , Hou Z, Gulbranson DR, et al. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells . Cell Stem Cell . 2010 ; 7 : 240 - 248 . Google Scholar Crossref Search ADS PubMed WorldCat 50 Etienne-Manneville S , Hall A. Rho GTPases in cell biology . Nature . 2002 ; 420 : 629 - 635 . Google Scholar Crossref Search ADS PubMed WorldCat 51 Rosowski KA , Mertz AF, Norcross S, et al. Edges of human embryonic stem cell colonies display distinct mechanical properties and differentiation potential . Sci Rep. 2015 ; 5 :14218. Google Scholar OpenURL Placeholder Text WorldCat 52 Dorn T , Kornherr J, Parrotta EI, et al. Interplay of cell-cell contacts and RhoA/MRTF-A signaling regulates cardiomyocyte identity . EMBO J . 2018 ; 37 . https://doi.org/10.15252/embj.201798133. Google Scholar OpenURL Placeholder Text WorldCat 53 Chakraborty S , Njah K, Pobbati AV, et al. Agrin as a mechanotransduction signal regulating YAP through the Hippo pathway . Cell Rep . 2017 ; 18 : 2464 - 2479 . Google Scholar Crossref Search ADS PubMed WorldCat 54 Dupont S , Morsut L, Aragona M, et al. Role of YAP/TAZ in mechanotransduction . Nature . 2011 ; 474 : 179 - 183 . Google Scholar Crossref Search ADS PubMed WorldCat 55 Meng Z , Qiu Y, Lin KC, et al. RAP2 mediates mechanoresponses of the Hippo pathway . Nature . 2018 ; 560 : 655 - 660 . Google Scholar Crossref Search ADS PubMed WorldCat 56 Dawes LJ , Shelley EJ, McAvoy JW, et al. A role for Hippo/YAP-signaling in FGF-induced lens epithelial cell proliferation and fibre differentiation . Exp Eye Res . 2018 ; 169 : 122 - 133 . Google Scholar Crossref Search ADS PubMed WorldCat 57 Dasari VR , Mazack V, Feng W, et al. Verteporfin exhibits YAP-independent anti-proliferative and cytotoxic effects in endometrial cancer cells . Oncotarget . 2017 ; 8 : 28628 - 28640 . Google Scholar Crossref Search ADS PubMed WorldCat 58 Zhang H , Ramakrishnan SK, Triner D, et al. Tumor-selective proteotoxicity of verteporfin inhibits colon cancer progression independently of YAP1 . Sci Signal . 2015 ; 8 :ra98. Google Scholar OpenURL Placeholder Text WorldCat 59 Liu-Chittenden Y , Huang B, Shim JS, et al. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP . Genes Dev . 2012 ; 26 : 1300 - 1305 . Google Scholar Crossref Search ADS PubMed WorldCat 60 Kuser-Abali G , Alptekin A, Lewis M, et al. YAP1 and AR interactions contribute to the switch from androgen-dependent to castration-resistant growth in prostate cancer . Nat Commun . 2015 ; 6 : 8126 . Google Scholar Crossref Search ADS PubMed WorldCat 61 Xin M , Kim Y, Sutherland LB, et al. Hippo pathway effector Yap promotes cardiac regeneration . Proc Natl Acad Sci U S A . 2013 ; 110 : 13839 - 13844 . Google Scholar Crossref Search ADS PubMed WorldCat 62 Kuo BR , Baldwin EM, Layman WS, et al. In vivo cochlear hair cell generation and survival by coactivation of β-Catenin and Atoh1 . J Neurosci . 2015 ; 35 : 10786 - 10798 . Google Scholar Crossref Search ADS PubMed WorldCat 63 Heallen T , Zhang M, Wang J, et al. Hippo pathway inhibits Wnt signaling to restrain cardiomyocyte proliferation and heart size . Science . 2011 ; 332 : 458 - 461 . Google Scholar Crossref Search ADS PubMed WorldCat 64 Gjorevski N , Sachs N, Manfrin A, et al. Designer matrices for intestinal stem cell and organoid culture . Nature . 2016 ; 539 : 560 - 564 . Google Scholar Crossref Search ADS PubMed WorldCat 65 Nichane M , Javed A, Sivakamasundari V, et al. Isolation and 3D expansion of multipotent Sox9(+) mouse lung progenitors . Nat Methods . 2017 ; 14 : 1205 - 1212 . Google Scholar Crossref Search ADS PubMed WorldCat 66 Turco MY , Gardner L, Hughes J, et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium . Nat Cell Biol . 2017 ; 19 : 568 - 577 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Funding information the Development Fund for Shanghai Talents, Grant/Award Number: 2017046; the Excellent Personnel Training Plan for the Shanghai Health System, Grant/Award Number: 2017Q003; the National Key R&D Program of China, Grant/Award Numbers: 2017YFA0103900, 2016YFC0905200; the National Natural Science Foundation of China, Grant/Award Number: 81771011; the National Science Fund for Excellent Young Scholars, Grant/Award Number: 81922018 ©2020 The Authors. Stem Cells published by Wiley Periodicals, Inc. on behalf of AlphaMed Press 2020 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial reuse, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected]

Zhang, Gaoqun; Ferg, Marco; Lübke, Luisa; Takamiya, Masanari; Beil, Tanja; Gourain, Victor; Diotel, Nicolas; Strähle, Uwe; Rastegar, Sepand

doi: 10.1002/stem.3182pmid: 32246536

Abstract In the telencephalon of adult zebrafish, the inhibitor of DNA binding 1 (id1) gene is expressed in radial glial cells (RGCs), behaving as neural stem cells (NSCs), during constitutive and regenerative neurogenesis. Id1 controls the balance between resting and proliferating states of RGCs by promoting quiescence. Here, we identified a phylogenetically conserved cis-regulatory module (CRM) mediating the specific expression of id1 in RGCs. Systematic deletion mapping and mutation of conserved transcription factor binding sites in stable transgenic zebrafish lines reveal that this CRM operates via conserved smad1/5 and 4 binding motifs under both homeostatic and regenerative conditions. Transcriptome analysis of injured and uninjured telencephala as well as pharmacological inhibition experiments identify a crucial role of bone morphogenetic protein (BMP) signaling for the function of the CRM. Our data highlight that BMP signals control id1 expression and thus NSC proliferation during constitutive and induced neurogenesis. Significance statement In the adult brain, to maintain a continuous supply of new neurons and to avoid the exhaustion of the neural stem cells (NSCs) pool, a tight control between quiescence and proliferation is crucial. The inhibitor of DNA binding 1 (id1) gene controls the balance between dividing and resting neural stem cells by promoting quiescence. A regulatory sequence of id1 was identified, which mediates the input from the bone morphogenetic protein signaling into the adult NSCs. This regulatory sequence has a high potential to serve as an interface, which will permit to alter the balance between proliferation and maintenance of stem cells in experimental, as well as medical, applications. The bone morphogenetic protein (BMP) pathway controls inhibitor of DNA binding 1 (id1) expression in the radial glial cells (RGCs) during both constitutive and regenerative neurogenesis. An evolutionary conserved cis-regulatory module (CRM) of id1 is necessary for its RGC-specific expression. The id1 CRM contains a BMP responsive element, which is necessary but not sufficient for the expression of id1 in the ventricular zone of the zebrafish adult telencephalon. The human CRM2 works in zebrafish. Thus its function was conserved during evolution. Open in new tabDownload slide Open in new tabDownload slide adult neurogenesis, BMP, cis-regulatory modules, id1, neural stem cell, radial glial cell, regeneration, telencephalon, transcription, zebrafish INTRODUCTION In contrast to the mammalian adult brain, which contains only two main neurogenic regions that are both located in the forebrain and have rather limited ability to generate new neurons or to repair an injury, the brain of adult zebrafish contains numerous proliferative regions.1-3 These are distributed throughout different subdivisions of the brain and show high reactivation and repair capability upon lesion during adulthood.4-7 The ventricular zone of the adult zebrafish telencephalon is the most extensively studied neurogenic region in this context. This region produces new neurons, which integrate into existing neural networks throughout the lifetime of the animal.1,2,8,9 It is densely populated by the cell bodies of radial glia cells (RGCs), which are the neural stem cells (NSCs) of the adult telencephalon.9,10 The cell bodies of the RGCs extend two processes: a short one to the ventricular surface and a long one that crosses the brain parenchyma to reach the pial surface.9,11 Under homeostatic conditions, the majority of RGCs are quiescent (type 1)9,12,13 and express typical neural stem cell markers such as glial acidic fibrillary protein (Gfap), brain lipid binding protein (Blbp), and the calcium-binding protein ß (S100ß).9,10,14 Only a very low percentage of RGCs proliferate (type 2) and express the proliferative cell nuclear antigen (PCNA). This latter population can give rise to new neuroblasts (type 3 cells), either through asymmetric division or through direct conversion.15 A stab wound injury inflicted upon the telencephalon of adult zebrafish leads to an increase in NSC proliferation from 48 hours to 13 days postinjury16 and a concomitant sustained production of new neurons that migrate from the ventricular layer to the injury site to replace the damaged/lost neurons.17-20 Remarkably, 3 weeks after the brain injury, the fish feed and breed normally, barely exhibiting histological traces of the traumatic damage.17-21 To quickly and efficiently replace dying/dead neurons, the number of RGCs entering the cell cycle and starting proliferation is greatly increased during regenerative neurogenesis.15,17,19,20 Inflammatory signaling molecules cause expression of Gata3, a zinc finger transcription factor necessary for proliferation of RGCs, neurogenesis and migration of newborn neuroblasts.5,22 In order to maintain a continuous supply of new neurons and to simultaneously prevent the exhaustion of the adult NSC pool, a tight control between quiescence, proliferation, differentiation, and self-renewal of the RGCs is crucial. In a screen for transcriptional regulators expressed in the telencephalon of adult zebrafish, we previously identified the helix-loop-helix factor id1 (inhibitor of DNA binding 1) as a key player of both homeostatic and regenerative neurogenesis.23-25 Id1 is mostly expressed in quiescent RGCs, and its expression is upregulated in the ventricular zone upon telencephalic injury. Forced expression of id1 causes quiescence of NSCs, while id1 knockdown increases the number of proliferating RGCs.25 Id1 reduces cycling NSCs both during constitutive neurogenesis and after the initial wave of induction of proliferation in reactive neurogenesis.25 Our data argue for a role of id1 in maintaining the balance between dividing and resting NSCs by promoting RGC quiescence. We speculated that this might prevent depletion of the NSC pool. Neither Notch signaling nor inflammatory signals appear to be involved in regulating id1 expression in the adult telencephalon.25 These data raised the central question of how and by which specific signals id1 expression is restricted to adult neural stem cells and is upregulated after brain injury. To address these questions, we decided to investigate the mechanisms of transcriptional regulation of this gene during constitutive and regenerative neurogenesis. We identified a phylogenetically conserved id1 cis-regulatory module (CRM) that drives GFP expression in RGCs of the adult brain of transgenic zebrafish. This RGC-specific CRM harbors transcription factor (TF) binding sites conserved between human, mouse, and zebrafish id1 homologues. Deletion mapping, mutations of the binding sites, as well as pharmacological inhibition and transcriptome analysis suggest a role for the BMP pathway in controlling id1 expression in RGCs both during constitutive and regenerative neurogenesis. MATERIALS AND METHODS Zebrafish strains and maintenance All experiments were performed on 6- to 12-month-old AB wild-type (wt) fish or on the transgenic reporter line described in this article. Zebrafish housing and husbandry were performed as recommended by Reference 26. Animal experimentations were carried out in accordance with the German animal protection standards and were approved by the Government of Baden-Württemberg, Regierungspräsidium Karlsruhe, Germany (Aktenzeichen 35-9185.81/G-272/12 and 35-9185.81/G-288/18 “Adulte Neurogenese”). Identification and cloning of putative CRMs Identification of CRMs driving id1 expression in zebrafish was based on their conservation in comparison to other fish species. We utilized Ancora (http://ancora.genereg.net) to select sequences for functional analysis. Ancora represents a database of highly conserved noncoding elements (HCNEs) that are identified by scanning pairwise BLASTZ net whole-genome alignments with different similarity parameters.27 Criteria to be selected for functional testing were 80% sequence identity in a 50 bp window in all of the species Oryzias latipes, Gasterosteus aculeatus, and Tetraodon nigroviridis within a 100 kb window around the id1 locus. Genomic coordinates in putative CRMs chosen to test for regulatory potential were polymerase chain reaction (PCR)-amplified from genomic DNA. Amplicons were subcloned into pCR8/GW/TOPO (Invitrogen) to create entry vectors for subsequent cloning into the Tol2-GFP-destination vector pT2KHGpzGATA2C1 as described by.28 These constructs were used to generate stable zebrafish transgenic lines. The sequences of all CRMs are provided in Appendix S1. Mutation and deletion of different binding sites in the id1 core sequence Individual TF binding sites were mutated by converting the core sequence of the binding site as defined by MatInspector to a stretch of thymidines. The approach was PCR-based by employing primers designed to include the desired change. Deletions were created using a similar methodology, a PCR-based approach using tailed primers designed to overlap with and anneal to the opposite strand of the adjoining region. The sequences of all primers used in this study can be found in Appendix S2. Injection of plasmids For the generation of transgenic fish via a Tol2-based approach,29 50 ng/μL plasmid DNA was injected. The injection solution was prepared by adding 1% of phenol red and 30 ng/μL Tol2 mRNA. After injection the embryos were incubated at 28°C until they reached the desired stage. Embryos expressing GFP at 24 hpf were selected and the expression patterns documented. Identified F0 were out-crossed with wt fish to obtain stable progenies that express the transgene in the F1 generation. Each reporter construct was tested in at least three independent transgenic lines. Stab wound and chemical treatment of adult zebrafish The stab wound injury was always inflicted in the left telencephalic hemisphere while the contralateral right hemisphere was kept intact and served as a control. Three to seven animals per transgenic line were tested for GFP induction upon telencephalon injury. The stab wound procedure was performed as described.21 For the treatment, 9-month-old Tg(id1-CRM2:GFP) fish were bathed in 300 mL fresh fish water containing 600 μL of a 10 mM DMH1 (Tocris, Wiesbaden-Nordenstadt, Germany) stock solution (final concentration 20 μM) for 7 days. As a control, 600 μL of DMSO were added to 300 mL of fresh fish water. Every morning the fish were fed with regular adult fish food and the DMH1 or DMSO solution was changed every 2 days. Stab wounds were inflicted as described on the second day of treatment and the fish sacrificed for analysis 5 days after the injury. All experiments were carried out independently at least three times. Preparation of adult zebrafish brains, in situ hybridization, immunohistochemistry, imaging, and quantification Brain dissection, in situ hybridization, and immunohistochemistry were performed as described in References 1 and 21. Primary antibodies used in this study include chicken anti-GFP (1:1000, Aves labs, Davis, California), mouse anti- PCNA (1:500, Dako, Agilent, Santa Clara, California) and rabbit anti-S100 (1:400, Dako). Secondary antibodies were conjugated with Alexa fluor dyes (Alexa series) and include anti-GFP Alexa 488, antimouse Alexa 546 and antirabbit Alexa 633 (1:1000, Invitrogen, Waltham, Massachusetts). Pictures of in situ hybridized sections were acquired with a Leica compound microscope (DM5000B). For imaging and quantification immunohistochemistry brain slices mounted in Aqua-Poly/Mount (Cat No. 18606-20, Polysciences, Inc) with #1.5 thickness coverslips were imaged with a laser scanning confocal microscope Leica TCS SP5. To obtain single-cell resolution images, an HCX PL APO CS x63/1.2NA objective was used with the pinhole size set to 1-airy unit. Fluorescent images for GFP, PCNA, and S100β were acquired sequentially in 16-bit color depth with excitation/emission wavelength combinations of 488 nm/492 to 550 nm, 561 nm/565 to 605 nm, and 633 nm/650 to 740 nm, respectively. Pixel resolution for XY and Z planes are 0.24 and 0.50 μm, respectively. For individual brain samples, at least three transverse sections cut with a vibratome (VT1000S, Leica) at different anterior-posterior levels representing anterior, posterior an intermediate telencephalic regions were imaged. In order to quantify the changes in bambia, id3, and smad5 mRNAs following brain injury at 5 days postlesion, up to 11 telencephalic pictures at the injury site were taken for each of the genes. Then, using imageJ, the pictures were processed setting up a threshold for the staining intensity and quantification of the upregulated area was performed along the control and stab-wounded ventricular zone from the dorsomedial to the dorsolateral part of the telencephalon. The fold induction between the injured vs control ventricular zone was subsequently calculated. Image analysis Confocal brain images were opened with Fiji/ImageJ software30 as composite hyperstacks to manually evaluate colocalization of GFP, PCNA, and S100β proteins. Colocalization of fluorescent signals was assessed by at least two experimenters. For quantifications, three sections per brain were analyzed. Cells were counted in the dorsomedial and the dorsolateral ventricular zone. Statistical analysis For quantifications of id1-CRM2:GFP and derivative constructs, the number of cells was determined by counting the cells in Z-stacks of 50 μm thickness in 1 μm steps (×40 objective lens). Comparisons between two data sets and between more than two data sets were performed using Welch two sample t-test and one-way ANOVA followed by Tukey's multiple pairwise-comparison test, respectively. Statistical significance was assessed by using R. Cells were always counted at the dorsomedial and dorsolateral regions of the adult zebrafish telencephalon ventricular zone. Quantitative real-time PCR Total RNA was isolated from adult telencephala using Trizol (Life Technology). First-strand cDNA was synthesized from 1 μg of total RNA with the Maxima First-strand cDNA synthesis kit (Thermo Scientific) according to the manufacturer's protocol. A StepOnePlus Real-Time qRT-PCR system (Applied Biosystems) and SYBR Green I fluorescent dye (Promega) were used. Expression levels were normalized using β-actin (Figure 7). The relative levels of mRNA were calculated using the 2−ΔΔCT method. The primer sequences are listed in Table S2. RNA sequencing and library preparation For RNA sequencing, total RNA was isolated from three injured hemispheres (5 days postinjury) and three uninjured contralateral telencephalic hemispheres each to create injured and uninjured RNAseq libraries, respectively. Our data were generated from three biological repeats (as described in Reference 25). Two milligrams of total RNA was used to prepare each of the six mRNAseq libraries. RNA sequencing data were retrieved from a previous data set.25 The data analysis was carried out as described31 using the latest version of the zebrafish reference genome, assembly GRCz11 (https://www.ncbi.nlm.nih.gov/assembly/GCA_000002035.4/). RESULTS Identification of a CRM mediating expression of id1 in adult NSCs To elucidate the mechanisms underlying id1 expression in adult NSCs and its injury-induced upregulation, we performed a systematic search for CRMs controlling expression of id1 in the ventricular zone of the adult telencephalon. Via phylogenetic sequence comparison of the id1 locus, we identified five conserved putative cis-regulatory modules (CRM1-5) upstream and downstream of the id1 coding sequence (Figure 1A). The identified conserved noncoding sequences were inserted in front of a gata2 minimal promoter,32 coupled to a GFP reporter cassette28 and introduced into the germ line of zebrafish to generate stable transgenic lines, Tg(id1-CRMX:GFP), where X represents one of the five CRMs (Figure 1B-F, H-L, and H′-L′). All five CRMs mediated expression in 24-hour postfertilization (hpf) zebrafish embryos in somewhat overlapping but distinct and specific patterns (Figure 1B-F). In the adult telencephalon (Figure 1H-L and H′-L′), only id1-CRM2 mediated specific GFP expression in the ventricular zone (white arrows, Figure 1K and Movie S1) in a pattern identical to the previously described GFP-tagged id1 BAC (bacterial artificial chromosome) transgenic line, TgBAC(id1:GFP)25 (Figure 1M and M′), while CRM5 (Figure 1H), CRM4 (Figure 1I), CRM3 (Figure 1J), and CRM1 (Figure 1L) drove ectopic GFP expression presumably at the tela choridea and blood vessels (white rectangle, Figure 1H, magnification in 1H′), in neurons (white rectangle, Figure 1I, L and respective magnification in Figure 1I′ and 1L′) and in blood vessels and presumptive oligodendrocytes/neurons (white rectangle, Figure 1J and magnification in 1J′). The ventricular GFP-positive cells resembled RGCs in morphology and coexpressed the RGC marker S100ß (96.9% ±2.3%), (Figure 1K, K', N, Q, and R) which were shown to be the NSCs in the adult zebrafish telencephalon.9,10 GFP was predominantly expressed in S100ß+/PCNA− type 1 cells (82.5 ± 8.4%, n = 3 telencephala; Figure 1N-Q and R-U), while only a small number of GFP+/S100ß+ cells represented type 2 cells coexpressing PCNA (17.5 ± 8.4%, n = 3), a marker for cell proliferation. GFP expression was also excluded from the rostral migratory stream (RMS), a highly proliferative domain in the telencephalon composed of type 3 progenitors (Figure 1K, white arrowhead). These data show that GFP+ cells correspond in majority to quiescent type 1 RGCs. Furthermore, both GFP expression and intensity were increased in the left telencephalic hemisphere upon stab injury compared to right noninjured control hemispheres (Figure 1R, U, V-W, and Y-Z). After stab wounding the proportion of GFP+/S100ß+/PCNA− type 1 and GFP+/S100ß+/PCNA+ type 2 stem cells was not altered in the injured left hemisphere relative to the right uninjured side, which is similar to the endogenous id1 gene and the id1 BAC transgenic line.25 Additionally, GFP was predominately found in quiescent cells (Figure 1W,X). Thus, the id1-CRM2 drives expression of GFP in the RGCs in a pattern identical to the endogenous id1 gene, and this expression is inducible by injury. FIGURE 1 Open in new tabDownload slide The id1 cis-regulatory module 2 (CRM2) drives ventricular expression and responds with increased expression to stab injury of the adult zebrafish telencephalon. A, Homology-based search for cis-regulatory modules (CRMs). Schematic representation of the id1 locus with putative CRMs 1 to 5 highlighted by yellow rectangles. B-M′, Stable GFP reporter expression of id1-CRM5 (B and H-H′), id1-CRM4 (C and I-I′), id1-CRM3 (D and J-J′), id1-CRM2 (E and K–K′), id1-CRM1 (F and L-L′) are shown in comparison with the control TgBAC(id1:GFP) (G and M-M′) for 24 hpf embryos (B-G) and adult telencephala (H-M′). H-M, GFP reporter expression analyzed in transverse sections from the middle part of the adult telencephalon (location of section schematically indicated in the upper-hand right corner). The Tg(id1-CRM2:GFP) transgenic line (K) recapitulates GFP expression of the TgBAC(id1:GFP) line (M) with strong expression in the ventricular zone (white arrows) and absence of expression in the rostral migratory stream (RMS, white arrowheads). The yellow arrowheads indicate ectopic GFP expression in the tela choroidea (H-H′), cells with appearances of neurons (I-I′ and L-L′) and oligodendrocytes (J-J′). Rectangles (H-M) represent the region magnified in H′-M′, respectively. Dashed lines indicate the boundary of the telencephalon. N-Q, Magnified views of RGCs highlighting type 1 and type 2 RGCs identified by expression of id1-CRM2:GFP (N), S100ß (O) and PCNA (P; all merged in Q). R-U, Transverse view of a 5 days postinjury telencephalon showing the expression of id1-CRM2:GFP (R), S100ß (S) and PCNA (T; all merged in U). The lesion site (left hemisphere) is marked by an asterisk. V-W, Summary of colocalization analysis of GFP and S100ß expression for BAC and CRM2- id1 constructs. W, Relative population sizes of type 1 and type 2 RGCs for BAC and id1-CRM2 constructs. X, Y, Relative population sizes of type 1 and type 2 RGCs (X) and the number of GFP+ cells (Y) for id1-CRM2 constructs, comparing lesioned and unlesioned control hemispheres. Z, id1-CRM2:GFP intensity ratio between left and right hemispheres comparing undamaged telencephalon (control) and damaged telencephalon (lesion). Significance is indicated by asterisks: *.01 ≤ P < .05; ***P < .001. n.s. = not significant. Scale bars = 200 μm (H-M), 20 μm (B-G; H′-M′), 2 μm (N-Q), and 25 μm (R-U) FIGURE 1 Open in new tabDownload slide The id1 cis-regulatory module 2 (CRM2) drives ventricular expression and responds with increased expression to stab injury of the adult zebrafish telencephalon. A, Homology-based search for cis-regulatory modules (CRMs). Schematic representation of the id1 locus with putative CRMs 1 to 5 highlighted by yellow rectangles. B-M′, Stable GFP reporter expression of id1-CRM5 (B and H-H′), id1-CRM4 (C and I-I′), id1-CRM3 (D and J-J′), id1-CRM2 (E and K–K′), id1-CRM1 (F and L-L′) are shown in comparison with the control TgBAC(id1:GFP) (G and M-M′) for 24 hpf embryos (B-G) and adult telencephala (H-M′). H-M, GFP reporter expression analyzed in transverse sections from the middle part of the adult telencephalon (location of section schematically indicated in the upper-hand right corner). The Tg(id1-CRM2:GFP) transgenic line (K) recapitulates GFP expression of the TgBAC(id1:GFP) line (M) with strong expression in the ventricular zone (white arrows) and absence of expression in the rostral migratory stream (RMS, white arrowheads). The yellow arrowheads indicate ectopic GFP expression in the tela choroidea (H-H′), cells with appearances of neurons (I-I′ and L-L′) and oligodendrocytes (J-J′). Rectangles (H-M) represent the region magnified in H′-M′, respectively. Dashed lines indicate the boundary of the telencephalon. N-Q, Magnified views of RGCs highlighting type 1 and type 2 RGCs identified by expression of id1-CRM2:GFP (N), S100ß (O) and PCNA (P; all merged in Q). R-U, Transverse view of a 5 days postinjury telencephalon showing the expression of id1-CRM2:GFP (R), S100ß (S) and PCNA (T; all merged in U). The lesion site (left hemisphere) is marked by an asterisk. V-W, Summary of colocalization analysis of GFP and S100ß expression for BAC and CRM2- id1 constructs. W, Relative population sizes of type 1 and type 2 RGCs for BAC and id1-CRM2 constructs. X, Y, Relative population sizes of type 1 and type 2 RGCs (X) and the number of GFP+ cells (Y) for id1-CRM2 constructs, comparing lesioned and unlesioned control hemispheres. Z, id1-CRM2:GFP intensity ratio between left and right hemispheres comparing undamaged telencephalon (control) and damaged telencephalon (lesion). Significance is indicated by asterisks: *.01 ≤ P < .05; ***P < .001. n.s. = not significant. Scale bars = 200 μm (H-M), 20 μm (B-G; H′-M′), 2 μm (N-Q), and 25 μm (R-U) Fine-mapping of the regulatory sequences mediating expression in RGCs In order to map the core regulatory region of the id1-CRM2 responsible for its specific activity in the RGCs of the telencephalic ventricular zone, a series of 5′and 3′ overlapping deletion variants of the reporter construct were generated and analyzed in stable transgenic lines (Figure 2A and data not shown). The transcriptional activities of these mutant versions were first investigated by monitoring GFP expression in 24 hpf zebrafish embryos. We observed at least three independent transgenic lines per construct and only constructs driving strong GFP expression resembling id1 embryonic expression were selected for further analysis in the adult brain (Figure 2A and data not shown). FIGURE 2 Open in new tabDownload slide Deletion mapping of id1-CRM2 identified a 157 bp core region, which confers RGC-specific expression in the adult telencephalon. A, 5′and 3′ deletions of id1-CRM2 analyzed for expression in zebrafish embryos and adult brains. Results are summarized on the right; + indicates specific GFP expression; ± and − represent weak and absence of expression, respectively. B-I, Immunohistochemistry of telencephalic transverse sections with antibodies against GFP (B, F), S100ß (C, G), and PCNA (D, H) (merged panels: E, I). Section levels and areas of magnification are indicated in the upper right-hand corner of each image. B-E, White arrows show two RGCs. E, The upper cell is GFP+/S100β+/PCNA− (type 1 RGC), whereas the lower cell is GFP+/S100+/PCNA+ (type 2 RGC). F-I, Upon stab wound injury the reporter construct expression is upregulated. The left injured side is labeled with a white asterisk. B-I, Section levels and areas of magnification are indicated in the upper right-hand corner each image. J, Quantification of PCNA and S100ß expression in id1-CRM2:GFP-positive cells. K, Relative population size of type 1 and type 2 RGCs in the control and lesioned hemisphere. L, M, Quantification of GFP-positive cells and GFP intensity upon injury. Graphs showing the number of GFP-expressing cells (L) and the intensity ratio between left uninjured (control) and right injured hemispheres respectively (M). Bars: mean ± SD. Significance is indicated by asterisks: *P < .05; **P < .01; ***P < .001. Boxed image in lower left-hand corner of (F-I) represents entire brain sections. n = 3 animals (B-L), n = 15 sections (M). Scale bar = 20 μm (B-I); 200 μm for Boxed image in lower left-hand corner of (F-I) FIGURE 2 Open in new tabDownload slide Deletion mapping of id1-CRM2 identified a 157 bp core region, which confers RGC-specific expression in the adult telencephalon. A, 5′and 3′ deletions of id1-CRM2 analyzed for expression in zebrafish embryos and adult brains. Results are summarized on the right; + indicates specific GFP expression; ± and − represent weak and absence of expression, respectively. B-I, Immunohistochemistry of telencephalic transverse sections with antibodies against GFP (B, F), S100ß (C, G), and PCNA (D, H) (merged panels: E, I). Section levels and areas of magnification are indicated in the upper right-hand corner of each image. B-E, White arrows show two RGCs. E, The upper cell is GFP+/S100β+/PCNA− (type 1 RGC), whereas the lower cell is GFP+/S100+/PCNA+ (type 2 RGC). F-I, Upon stab wound injury the reporter construct expression is upregulated. The left injured side is labeled with a white asterisk. B-I, Section levels and areas of magnification are indicated in the upper right-hand corner each image. J, Quantification of PCNA and S100ß expression in id1-CRM2:GFP-positive cells. K, Relative population size of type 1 and type 2 RGCs in the control and lesioned hemisphere. L, M, Quantification of GFP-positive cells and GFP intensity upon injury. Graphs showing the number of GFP-expressing cells (L) and the intensity ratio between left uninjured (control) and right injured hemispheres respectively (M). Bars: mean ± SD. Significance is indicated by asterisks: *P < .05; **P < .01; ***P < .001. Boxed image in lower left-hand corner of (F-I) represents entire brain sections. n = 3 animals (B-L), n = 15 sections (M). Scale bar = 20 μm (B-I); 200 μm for Boxed image in lower left-hand corner of (F-I) The deletion construct designed as id1-CRM2-core which contains a 157 bp long stretch of the CRM2 sequence (Figure 2A, chr11:18,706,838-18,706,994) drove expression in the ventricular zone of the adult telencephalon (Figure 2B). Double labeling experiments of the transgenic line Tg(id1-CRM2-core:GFP) revealed that this shorter version of the CRM2 drives mainly expression in PCNA-, S100β+ RGCs (Figure 2B-E and J), as observed for the endogenous id1,25 id1-BAC:GFP and id1-CRM2 (Figure 1R,U,V). Moreover, this short sequence responded to injury by increased expression and intensity of GFP (Figure 2F-I,L,M; n = 3 telencephala). Thus, our deletion approach led to the identification of a 157 bp sequence that appears to harbor all relevant sequences to drive expression in NSCs and to respond to injury. Remarkably, this sequence also proved sufficient to drive GFP expression in the brain, eye, somites, midline and urogenital opening in 24 hpf embryos (Figure S1) indicating that both embryonic and adult regulatory signals act through this CRM. Id1-CRM2-core is structurally and functionally conserved between fish and human Sequence analysis of zebrafish id1-CRM2-core with the MatInspector software33 showed that this regulatory module harbors TF binding sites for Forkhead box protein A2 (FoxA2), cyclic AMP response element binding protein (CREB), Homeobox domain transcription factor (Pknox), and Early growth response gene 1 (Egr1), as well as two smad binding motifs (SBMs) (Figure 3A). The entire core sequence displays a high degree of conservation between zebrafish, mouse, and human homologues. We thus tested whether the sequence is also functionally conserved by constructing a transgene harboring the human version of the zebrafish CRM2-core referred to as Hsid1-CRM2-core. After stably introducing this transgene into the germ line of zebrafish, we analyzed expression in the adult telencephalon (Figure 3B-E). The human sequence also mediated expression in the ventricular zone, in type 1 progenitors corresponding to quiescent RGCs (PCNA−, S100ß+), similar to the zebrafish sequence (Figures 3J and 2J, respectively). Moreover, when a brain injury was inflicted in one hemisphere of the telencephalon the Hsid1-CRM2-core carrying transgene also responded to the stab wound by increased expression at 5 days postlesion (dpl) (Figure 3F-I,L,M; n = 3 telencephala). Taken together, these results show that the mechanism of id1 regulation appears to be conserved from fish to human, suggesting that the mechanisms underlying the control of neurogenesis are very similar despite the remarkably different abilities to repair lesions in the adult brain among these phylogenetically distant vertebrate species. FIGURE 3 Open in new tabDownload slide Conservation of the zebrafish id1-CRM2 core sequences and its function across evolution. A, Sequence comparison of zebrafish id1-CRM2-core (Danio) with human (Homo) and mouse (Mus) orthologous sequences. Conserved nucleotides are indicated with an asterisk. Conserved motifs are outlined by yellow boxes comprising putative DNA recognition sequences for the transcription factors FoxA2, Smad (SBM1 and 2), CRE binding protein (CREB), Pknox, and EGR1. Nucleotide sequences in green, red, or blue correspond to previously identified sequences in the mouse id1 orthologue: Smad binding element (SBE), a Smad 1/5 binding site and a binding site for an unknown binding protein, respectively. B-I, Immunohistochemistry of telencephalic transverse sections with antibodies against GFP (B, F), S100ß (C, G), and PCNA (D, H) (merged panels: E, I). B, Expression of GFP in RGCs at the telencephalic ventricular zone driven by the human id1 regulatory sequences in the zebrafish adult telencephalon. F, Expression of the human Tg(Hsid1-CRM2) driven reporter construct is upregulated upon stab wound injury. The injured telencephalic hemisphere is labeled with a white asterisk. J, Quantification of PCNA and S100ß expression in GFP+ cells in the Tg(Hsid1-CRM2) line. K, Relative population size of type 1 and type 2 RGCs in the control and lesioned hemispheres. The proportion of GFP+/S100β+/PCNA− type 1 and GFP+/S100+/PCNA+ type 2 stem cells is not altered in the injured hemisphere relative to the control hemisphere of the telencephalon. L, M, Quantification of GFP+ cells upon injury. The number of GFP-expressing cells (L) and the intensity ratio between left and right hemispheres comparing undamaged hemisphere (control) and damaged telencephalic hemisphere (M) are both increased following injury. Bars: mean ± SD. Significance is indicated by asterisks: *.01 ≤ P < .05; ***P < .001. n.s. = not significant. Boxed in image in lower left-hand corner of (F-I) represents entire brain sections. n = 3 animals (B-L), n = 15 sections (M). Scale bar = 20 μm (B-I); 200 μm for boxed image in lower left-hand corner of F-I FIGURE 3 Open in new tabDownload slide Conservation of the zebrafish id1-CRM2 core sequences and its function across evolution. A, Sequence comparison of zebrafish id1-CRM2-core (Danio) with human (Homo) and mouse (Mus) orthologous sequences. Conserved nucleotides are indicated with an asterisk. Conserved motifs are outlined by yellow boxes comprising putative DNA recognition sequences for the transcription factors FoxA2, Smad (SBM1 and 2), CRE binding protein (CREB), Pknox, and EGR1. Nucleotide sequences in green, red, or blue correspond to previously identified sequences in the mouse id1 orthologue: Smad binding element (SBE), a Smad 1/5 binding site and a binding site for an unknown binding protein, respectively. B-I, Immunohistochemistry of telencephalic transverse sections with antibodies against GFP (B, F), S100ß (C, G), and PCNA (D, H) (merged panels: E, I). B, Expression of GFP in RGCs at the telencephalic ventricular zone driven by the human id1 regulatory sequences in the zebrafish adult telencephalon. F, Expression of the human Tg(Hsid1-CRM2) driven reporter construct is upregulated upon stab wound injury. The injured telencephalic hemisphere is labeled with a white asterisk. J, Quantification of PCNA and S100ß expression in GFP+ cells in the Tg(Hsid1-CRM2) line. K, Relative population size of type 1 and type 2 RGCs in the control and lesioned hemispheres. The proportion of GFP+/S100β+/PCNA− type 1 and GFP+/S100+/PCNA+ type 2 stem cells is not altered in the injured hemisphere relative to the control hemisphere of the telencephalon. L, M, Quantification of GFP+ cells upon injury. The number of GFP-expressing cells (L) and the intensity ratio between left and right hemispheres comparing undamaged hemisphere (control) and damaged telencephalic hemisphere (M) are both increased following injury. Bars: mean ± SD. Significance is indicated by asterisks: *.01 ≤ P < .05; ***P < .001. n.s. = not significant. Boxed in image in lower left-hand corner of (F-I) represents entire brain sections. n = 3 animals (B-L), n = 15 sections (M). Scale bar = 20 μm (B-I); 200 μm for boxed image in lower left-hand corner of F-I BMP response elements are required for id1-CRM2 activity in the zebrafish adult telencephalon The central region (chr11:18,706,875-18,706,953) of the id1-CRM2-core, situated between the foxA2 and egr1 binding sites and containing two SBMs (Figures 3A and 4A), is similar to a previously identified BMP response element (BRE) of the mouse and human id1 gene34,35.36 Because id1 is a direct target of the BMP signaling pathway37 and smads transduce the BMP signal from the cytoplasm to the nucleus38 (Figure 6A), we tested whether this BRE is necessary for the function of id1-CRM2 in the zebrafish adult telencephalon. To this aim we generated two id1-CRM2 mutant variants, in which either the conserved 74 bp sequence covering the BRE was deleted (id1-CRM2-Δ74) (Figure 4B) or both SBM1 and SBM2 sequences were mutated (id1-CRM2-mut-SBMs) (Figure 4C). GFP expression in the ventricular zone and in RGCs was abolished in transgenic lines carrying the mutant constructs (Figure 4D-H (id1-CRM2-Δ74; no GFP, expression in S100ß+ cells n = 5)) and (Figure 4I-M [id1-CRM2-mut-SBMs, no GFP expression in S100ß+ n = 6]) and no induction of GFP expression upon injury could be detected for both constructs (Figure S3). These results show that the BRE located in the id1-CRM2 is critical for the expression of id1 in RGCs. Moreover, they suggest that BMP signaling may play a role in controlling id1 expression in the telencephalon of the adult zebrafish. FIGURE 4 Open in new tabDownload slide The conserved BMP response element in the id1-CRM2 is crucial for correct expression of the GFP reporter in the ventricular zone and RGCs. A-C, Scheme showing mutated id1-CRM2 reporter constructs: A, id1-CRM2 wt construct with putative TF binding sites indicated in gray. B, id1-CRM2-Δ74 construct which contains a deletion of a 74 bp stretch of the most conserved sequence in id1-CRM2. C, id1-CRM2-mut-SBMs construct with mutations in the 2 SBMs (1 and 2) of id1-CRM2. D, Deletion of the 74 bp stretch in the id1-CRM2 abolished GFP expression in the ventricular zone. E-H, Enlarged micrographs of D. E-H, Immunohistochemistry with GFP (E), S100ß (F), and PCNA (G) antibodies on telencephalic cross sections of the id1-CRM2-Δ74 transgenic line shows no GFP reporter expression in S100ß+ RGCs (H, merged view). I-M, Mutations in Smad binding motifs (SBM1 and 2) abolished GFP expression in the ventricular zone. J-M, Magnification of white-boxed region in I. J-M, Immunohistochemistry with GFP (J), S100ß (K), and PCNA (L) antibodies on telencephalic cross sections of the id1-CRM2-mut-SBMs transgenic line show no colocalization between the RGC marker, S100ß, and GFP (M, merged view). N, GFP expression driven by id1-CRM2:GFP reporter construct in the ventricular zone (control). O, P, Q Immunohistochemistry of telencephalic cross sections with GFP (O, Q) and PCNA (P). O, Q, The BRE does not drive GFP expression in the RGCs (O) and is not inducible by telencephalic injury (Q). The left injured side is labeled with a white asterisk. Anteroposterior positions of transverse sections are indicated in the upper right-hand corner of each image. Scale bar = 20 μm (E, F, G, H, J, K, L, M); 200 μm (D, I, N, O, P, Q) FIGURE 4 Open in new tabDownload slide The conserved BMP response element in the id1-CRM2 is crucial for correct expression of the GFP reporter in the ventricular zone and RGCs. A-C, Scheme showing mutated id1-CRM2 reporter constructs: A, id1-CRM2 wt construct with putative TF binding sites indicated in gray. B, id1-CRM2-Δ74 construct which contains a deletion of a 74 bp stretch of the most conserved sequence in id1-CRM2. C, id1-CRM2-mut-SBMs construct with mutations in the 2 SBMs (1 and 2) of id1-CRM2. D, Deletion of the 74 bp stretch in the id1-CRM2 abolished GFP expression in the ventricular zone. E-H, Enlarged micrographs of D. E-H, Immunohistochemistry with GFP (E), S100ß (F), and PCNA (G) antibodies on telencephalic cross sections of the id1-CRM2-Δ74 transgenic line shows no GFP reporter expression in S100ß+ RGCs (H, merged view). I-M, Mutations in Smad binding motifs (SBM1 and 2) abolished GFP expression in the ventricular zone. J-M, Magnification of white-boxed region in I. J-M, Immunohistochemistry with GFP (J), S100ß (K), and PCNA (L) antibodies on telencephalic cross sections of the id1-CRM2-mut-SBMs transgenic line show no colocalization between the RGC marker, S100ß, and GFP (M, merged view). N, GFP expression driven by id1-CRM2:GFP reporter construct in the ventricular zone (control). O, P, Q Immunohistochemistry of telencephalic cross sections with GFP (O, Q) and PCNA (P). O, Q, The BRE does not drive GFP expression in the RGCs (O) and is not inducible by telencephalic injury (Q). The left injured side is labeled with a white asterisk. Anteroposterior positions of transverse sections are indicated in the upper right-hand corner of each image. Scale bar = 20 μm (E, F, G, H, J, K, L, M); 200 μm (D, I, N, O, P, Q) We next tested whether the well-characterized mouse id1 BRE34,35 that contains multiple SBMs would control expression in the telencephalon. A construct containing two tandem copies of the mouse BRE was shown to mediate GFP expression in all BMP signaling target tissues of zebrafish embryos.39,40 Surprisingly, however, it did not show any activity in the RGCs of the ventricular zone of the adult telencephalon (Figure 4O), and was unaffected by brain injury (Figure 4P,Q). In the transgenic line Tg(BRE:GFP), GFP expression is restricted to blood vessels of the adult brain (Figure 4O, n = 7), in contrast to the expressions driven by id1-CRM2 (Figure 4N) and id1-CRM2-core (Figure 2B), which are RGC-specific (compare Figure 4N with Figure 4O). This blood vessel expression was observed with two independent lines of the BRE:GFP described in References 39 and 41 These findings suggest that in the adult zebrafish brain, the BMP pathway alone is critical but not sufficient to drive id1 expression in the ventricular RGCs. BRE and additional transcription factors are necessary for full activity of id1-CRM2 in NSCs The observation that the two tandem copies of the mouse BRE34 are not sufficient to drive reporter gene expression in RGCs (Figure 4O) suggests that further sequences are required in addition to SBMs for activity of id1-CRM2-core in RGCs. Indeed, the id1-CRM2-core contains several other well-conserved binding sites for transcription factors surrounding the SBMs (Figure 3). To test whether these neighboring sequences are necessary in addition to the BRE, each of these sites was individually mutated, and stable transgenic lines were generated with the resulting mutant constructs (Figure 5A-E). While mutation in the foxA2 and egr1 binding sites had no effect on the expression pattern of GFP in the RGCs of the adult brain (Figure 5B,E,P,Q), we observed a reduction in GFP expression for constructs with mutated pknox or cre binding sites (Figure 5C,D,P,Q). Notably, we still observed a strong and specific response to stab injury of the telencephalon in these two mutant lines (Figure 5F-J,P,Q and Figure 5K-O,P,Q). This finding indicates that these sites together with SBMs are necessary for RGC-specific expression. However, since mutations of the individual cre (Figure 5F-J,P,Q) and pknox (Figure 5 K-O,P,Q) sites did not affect the capacity to respond to injury, these sites appear not to be required for injury-induced expression via the BMP pathway. FIGURE 5 Open in new tabDownload slide Cre and pknox binding sites in close vicinity to SBM1 and − 2 are necessary for the full activity of id1-CRM2. A-E, Immunohistochemistry with a GFP antibody on telencephalic cross sections of the id1-CRM2 transgenic lines containing a mutation in the foxA2 (B), cre (C), pknox (D), and egr1 (E) binding sites, respectively. Mutation in cre (C) and pknox (D) binding sites leads to a reduction of GFP+ cells in the ventricular zone. F, G, J, Expression of the id1-CRM2-mut-cre construct is inducible by brain injury (white asterisk, left injured hemisphere). G-J, Magnification boxed area in F. K, L, O, Expression of the id1-CRM2-mut-pknox construct is induced upon brain injury (white asterisk, left injured hemisphere). L-O, Magnification of boxed area in K. Anterioposterior positions of transverse sections are indicated in the upper right-hand corner of each image. P, Q, Percentage of GFP+/S100β+ RGCs over the total number of S100+ RGCs for id1-CRM2 mutant constructs under homeostatic condition (P) and at 5 days postinjury, comparing the injured hemisphere (green columns) and the contralateral uninjured hemisphere (white columns; Q) at the dorsomedial to the dorsolateral region of the telencephalon. Scale bar = 200 μm (A-F and K); 25 μm (G-J and L-O) FIGURE 5 Open in new tabDownload slide Cre and pknox binding sites in close vicinity to SBM1 and − 2 are necessary for the full activity of id1-CRM2. A-E, Immunohistochemistry with a GFP antibody on telencephalic cross sections of the id1-CRM2 transgenic lines containing a mutation in the foxA2 (B), cre (C), pknox (D), and egr1 (E) binding sites, respectively. Mutation in cre (C) and pknox (D) binding sites leads to a reduction of GFP+ cells in the ventricular zone. F, G, J, Expression of the id1-CRM2-mut-cre construct is inducible by brain injury (white asterisk, left injured hemisphere). G-J, Magnification boxed area in F. K, L, O, Expression of the id1-CRM2-mut-pknox construct is induced upon brain injury (white asterisk, left injured hemisphere). L-O, Magnification of boxed area in K. Anterioposterior positions of transverse sections are indicated in the upper right-hand corner of each image. P, Q, Percentage of GFP+/S100β+ RGCs over the total number of S100+ RGCs for id1-CRM2 mutant constructs under homeostatic condition (P) and at 5 days postinjury, comparing the injured hemisphere (green columns) and the contralateral uninjured hemisphere (white columns; Q) at the dorsomedial to the dorsolateral region of the telencephalon. Scale bar = 200 μm (A-F and K); 25 μm (G-J and L-O) Id1-CRM2 expression is induced by the BMP pathway in response to injury A crucial question is whether the increase in id1-CRM2 mediated transcription at the ventricular zone upon injury involves BMP signaling, as suggested by the requirement of the BRE for CRM2 activity. To address this question, in a first step we analyzed deep sequencing data sets of the transcriptomes generated from 5 days postlesion (dpl) hemispheres vs contralateral noninjured adult zebrafish telencephala.25 We discovered an increase in the transcription levels of several key genes involved in canonical BMP signaling (Figure 6A,B) when compared to the control, uninjured side. Among those, we identified the BMP receptor1aa (bmp1aa), the BMP receptor specific signal transducers smad1 and smad5 as well as several direct target genes of BMP signaling, including id1, id3, izts2a and bambia (Figure 6B). For genes that are significantly upregulated (Figure 6B) and that display a restricted pattern of expression in the telencephalon under homeostatic conditions (bambia, smad5 and id3), the results were further verified by in situ hybridization (ISH) on telencephalic cross sections at 5 dpl (Figure 6C-E). A distinct upregulation of bambia, smad5, and id3 at 5 dpl in the injured left telencephalic hemisphere was detected on the sections when compared to the right uninjured hemisphere, where expression did not change (Figure 6C-E; n = 4 telencephala per gene). The RNA sequencing and ISH data were confirmed by quantifying the staining intensity of bambia, smad5 and id3 following brain injury at 5 days postlesion at the injury site in comparison to the same region in the intact contralateral control hemisphere (Figure 6C′-E′). FIGURE 6 Open in new tabDownload slide Genes involved in canonical BMP signaling are induced in response to telencephalic injury. A, Scheme of the BMP signaling pathway. B, RNAseq analysis of injured telencephala hemispheres in comparison to uninjured hemispheres reveals an upregulation in mRNA expression of BMP signal transducers (smad5), regulators (bambia) or downstream target genes (id3, id1). C-E, In situ hybridization on sections of the adult zebrafish telencephalon 5 days postlesion. C, bambia, D, smad5, E, id3. Arrowheads indicate upregulation of gene expression in the left telencephalic hemisphere upon stab injury. C′-E′, Quantification of C´bambia, D′, smad5, and E′, id3 expression upregulation 5 days postlesion. Only upregulated areas were quantified along the control and injured ventricular zone from the dorsomedial to the dorsolateral region of the telencephalon (scheme in the upper right- hand corner of (C′) shows the quantified area in blue). Significance is indicated by asterisks: ***P < .001. P-values: bambia: 0.00008917 (C′), smad5: 0.003684 (D′), id3: 7.455 x 10−7 (E′). Scale bar = 200 μm (C, D, E) FIGURE 6 Open in new tabDownload slide Genes involved in canonical BMP signaling are induced in response to telencephalic injury. A, Scheme of the BMP signaling pathway. B, RNAseq analysis of injured telencephala hemispheres in comparison to uninjured hemispheres reveals an upregulation in mRNA expression of BMP signal transducers (smad5), regulators (bambia) or downstream target genes (id3, id1). C-E, In situ hybridization on sections of the adult zebrafish telencephalon 5 days postlesion. C, bambia, D, smad5, E, id3. Arrowheads indicate upregulation of gene expression in the left telencephalic hemisphere upon stab injury. C′-E′, Quantification of C´bambia, D′, smad5, and E′, id3 expression upregulation 5 days postlesion. Only upregulated areas were quantified along the control and injured ventricular zone from the dorsomedial to the dorsolateral region of the telencephalon (scheme in the upper right- hand corner of (C′) shows the quantified area in blue). Significance is indicated by asterisks: ***P < .001. P-values: bambia: 0.00008917 (C′), smad5: 0.003684 (D′), id3: 7.455 x 10−7 (E′). Scale bar = 200 μm (C, D, E) To functionally manipulate BMP signaling during the response to injury, telencephala of adult fish were injured on the second day of treatment with 20 μM of the BMP signaling pathway inhibitor DMH1 (dorsomorphin homologue 142,43). The fish were analyzed at 5 dpl. As visualized by in situ hybridization (Figure 7A,B,D,E) and by qPCR analysis (Figure 7C,F), suppression of BMP signaling by exposure to DMH1 led to a significant loss of induction of the endogenous id1 gene (Figure 7B) and id1-CRM2:GFP reporter gene (Figure 7E) upon injury of the telencephalon. We also observed a strong reduction in the basal expression of the gfp transgene and id1 endogenous gene in the uninjured telencephalic hemispheres upon DMH1 treatment (Figure 7C,F). FIGURE 7 Open in new tabDownload slide Inhibition of BMP signaling with DMH1 reduces injury-induced id1 and id1-CRM2:GFP transgene expression. ISH against id1 (A, B) and gfp mRNA (D, E) showed reduction in induction of id1 (B) and gfp (E) transgenes upon BMP signaling inhibition by DMH1 treatment (B and E) in comparison to DMSO-treated corresponding controls (A and D). Arrowheads indicate upregulation of gene expression the left telencephalic hemisphere upon stab injury. C, F, RT-qPCR quantification confirmed reduction in id1 and gfp expression in DMH1 treated fish. The data represent the mean ± SD of three independent experiments. Significance is indicated by asterisks:**.001 ≤ P < .01; ***P < .001. Scale bar = 200 μm (A, B, D, and E). n = 3 animals for C, F FIGURE 7 Open in new tabDownload slide Inhibition of BMP signaling with DMH1 reduces injury-induced id1 and id1-CRM2:GFP transgene expression. ISH against id1 (A, B) and gfp mRNA (D, E) showed reduction in induction of id1 (B) and gfp (E) transgenes upon BMP signaling inhibition by DMH1 treatment (B and E) in comparison to DMSO-treated corresponding controls (A and D). Arrowheads indicate upregulation of gene expression the left telencephalic hemisphere upon stab injury. C, F, RT-qPCR quantification confirmed reduction in id1 and gfp expression in DMH1 treated fish. The data represent the mean ± SD of three independent experiments. Significance is indicated by asterisks:**.001 ≤ P < .01; ***P < .001. Scale bar = 200 μm (A, B, D, and E). n = 3 animals for C, F In summary, our investigation of the transcriptional regulation mediated by id1-CRM2 suggests that BMP signaling positively regulates the expression of id1 in the adult zebrafish brain during constitutive and regenerative neurogenesis. DISCUSSION Here, we identified the DNA module id1-CRM2 as a key regulator of id1 expression in the ventricular zone of the adult zebrafish telencephalon. Moreover, we show that a BRE is crucial for the activity of this CRM and that inhibition of BMP signaling reduces expression of the CRM driven reporter, both during constitutive and reactive neurogenesis. This requirement of BMP signaling is correlated with an increase in mRNAs encoding BMP pathway components and BMP-controlled genes in the transcriptome of injured telencephala. BMP as a regulator of id1 expression during constitutive and regenerative neurogenesis A key question is which cues control id1 expression in RGCs during constitutive and regenerative neurogenesis. Inflammatory signals were previously implicated in the induction of regenerative neurogenesis in the zebrafish telencephalon.44 However, id1 expression was not affected by inflammation.25 Additionally, Notch signaling, previously shown to be involved in the control of neurogenesis in the zebrafish,45,46 did not affect id1 expression, either.25 Our systematic deletion and mutation analysis of the CRM2 module, as well as pharmacological inhibition of the BMP/Smad signaling pathway strongly suggest that BMP signals are crucial for id1 expression in the adult zebrafish telencephalon during both constitutive and regenerative neurogenesis. The observation that BMP signaling components (bmp1aa, smad1, smad5), as well as known BMP-controlled genes such as bambia, id3, and lzts2a are induced upon brain lesion in addition to the id1 gene suggests that injury increases the basal level of BMP signaling in the telencephalon. Remarkably, injury-induced proliferation of NSCs and upregulation of BMP target genes are always restricted to the injured side of the telencephalon (eg, 20,25 and this study). Given the close juxtaposition of left and right hemispheres in the medial parts of the telencephalon, this restriction of induction in gene expression and proliferation to the injured half is rather remarkable and implies a highly limited diffusion of the BMP signals toward the uninjured hemisphere. Rather than diffusing freely within the injured side, BMP signals may be sensed and relayed down to the cell bodies at the ventricular zone by the long processes of the RGCs. Bmp2, bmp4, and bmp7 mRNAs are expressed in the telencephalon (unpublished data), but the type of BMP signals involved in injury response as well as their origin are unclear. Although, we detected mRNA expression of these bmps in our transcriptome data, the change in response to injury was not significant. We did also not observe a reduction in the expression of BMP signaling inhibitors, such as smad6, smad7, noggin, and follistatin genes (data not shown). Therefore, it is tempting to speculate that the lesion triggers either release of BMPs or their maturation. BMPs as regulators of quiescence and proliferation of NSCs in reactive neurogenesis In agreement with our data, previous work in mouse associated BMP signaling and id genes with maintenance of the adult NSCs of the hippocampus and lateral ventricle during constitutive neurogenesis.47-49 However, in mice the situation is more complicated as several id genes act redundantly.49 A single id gene appears to provide this function in the zebrafish.25 Here, we provide evidence that the mechanism of neural stem cell maintenance by id1 is conserved not only in constitutive adult neurogenesis, as observed in mouse, but also in the teleost-specific reactive neurogenesis, which is involved in injury repair. BMP signals appear to play a crucial role in elevating id1 expression in response to injury and in this way to eventually downregulate proliferation of RGCs, securing a pool of resting stem cells for future activation. In this context, it is important to stress that id1 expression reacts in a delayed fashion relative to the induction of proliferation.25 Another signaling system maintaining adult neural stem cell quiescence is the Notch pathway in both zebrafish and mice.45,50 It remains to be assessed whether the BMP/Id1 and Notch/Her4.1 pathways are redundant or parallel pathways with distinct functions in stem cell maintenance during constitutive and reactive neurogenesis. In mouse it was recently suggested that both Notch/Hes and Bmp/Id pathways interact to enhance quiescence of NSCs.51,52 Id1-CRM2 is structurally and functionally highly conserved Id1-CRM2 is a highly conserved CRM with homologous sequences in all-vertebrate species examined so far (this report,53). The 74 bp central region of id1-CRM2-core situated between the foxA2 and egr1 binding sites is very similar to a previously identified BRE of the mouse and human id1 regulatory sequence.34,35 The two zebrafish SBM1 and SBM2 located in the central region perfectly match the smad binding site consensus GGCGCC 54,55 and that of the smad binding element (SBE), AGAC 56,57. These elements are critical for BMP-induced id1 expression in the mouse C2C12 myoblast cell line 34. Transgenes harboring tandem copies of this central BRE served as reliable reporters of canonical BMP signaling activity in mice and zebrafish embryos.39,40,58,59 However, this region was found to be necessary but not sufficient in id1-CRM2 to drive expression of id1 in RGCs of the adult zebrafish telencephalon. Moreover, the tandem copy of the BRE did not mediate expression in RGCs of the telencephalon. Conserved cre and a pknox site were found to be necessary in addition to the BRE core of id1-CRM2 for basal expression in the RGCs. The combination of smad binding sites with cre is a conserved feature of the id1-CRM2, which is shared with many other BMP target modules in the mammalian genome.60 In mouse osteoblasts, a cAMP response element was shown to enhance the response of id1 to BMP signals,61 showing that this interaction is not only restricted to NSCs in the zebrafish but is also employed during bone formation in mammals. The pknox binding site in the id1-CRM2 partially overlaps with the BRE sequences (CGCC, CAGC) identified in mouse id1 to be necessary for strong responsiveness to BMP signaling.34 Therefore, it may be possible that these mutations impair the BRE. However, the mutations of the pknox and cre sites did not impair the BMP mediated response to injury. Our data suggest that their function is dispensable for BMP mediated induction of id1 reporter expression in response to injury, suggesting that basal and induced expression may involve different cofactors. Taken together this regulatory region of the id1 gene appears to be structurally highly conserved between fish and mammals and serves as a regulatory interface that integrates multiple inputs. The high structural conservation is reflected by the fact that the human sequence can drive expression in RGCs of the adult zebrafish telencephalon. Remarkably, this conservation of function is not restricted to constitutive neurogenesis, but the human sequence also faithfully reproduces the response to injury. Thus, despite the vast difference in regenerative capacity, the underlying basic mechanism of reactive neurogenesis appears to be conserved between fish and mammals. This underscores the value of studies in the zebrafish as a model to develop therapies for injuries of the human brain. Clearly, id1-CRM2 is a highly versatile CRM that drives expression in the zebrafish embryo in various tissues including the notochord 53. It is thus expected to contain other elements, some of which may not reveal themselves by conserved sequence homology.53 CONCLUSION Here, we have identified an RGC CRM of id1, which mediates the input from the BMP signaling pathway into the adult NSCs during constitutive and regenerative neurogenesis in the zebrafish telencephalon. This CRM has a high potential to serve as an interface, which will permit to alter the balance between proliferation and maintenance of stem cells in experimental, as well as medical applications. ACKNOWLEDGMENTS We thank Nadine Borel and the fish facility staff for fish care, Sabrina Weber for technical support, Maryam Rastegar for her support with the microscopes, and Thomas Dickmeis for proofreading of the manuscript, Salim Seyfried, Elise Cau, Natascia Tiso, and Matthias Hammerschmidt for sharing zebrafish transgenic lines. We are grateful for support by the EU IP ZF-Health (Grant number: FP7-242048), the Deutsche Forschungsgemeinschaft (GRK2039), the program BioInterfaces in Technology and Medicine of the Helmholtz foundation and the European Union's Horizon 3952020 research and innovation program under the Marie Sklodowska-Curie grant agreement No. 643062 (ZENCODE-ITN). CONFLICT OF INTEREST The authors declared no potential conflicts of interest. AUTHOR CONTRIBUTIONS S.R.: designed the experiments and supervised the work, analyzed the data, and wrote the manuscript; U.S.: analyzed the data, and wrote the manuscript; G.Z., M.F.: conducted the experiments and analyzed the data; L.L., T.B.: conducted the experiments; V.G.: performed the RNA sequencing data analysis; M.T., N.D.: analyzed and quantified the data. DATA AVAILABILITY STATEMENT The data that support the findings of this study are available on request from the corresponding author. REFERENCES 1 Adolf B , Chapouton P, Lam CS, et al. Conserved and acquired features of adult neurogenesis in the zebrafish telencephalon . Dev Biol . 2006 ; 295 : 278 - 293 . Google Scholar Crossref Search ADS PubMed WorldCat 2 Grandel H , Kaslin J, Ganz J, Wenzel I, Brand M. Neural stem cells and neurogenesis in the adult zebrafish brain: origin, proliferation dynamics, migration and cell fate . Dev Biol . 2006 ; 295 : 263 - 277 . Google Scholar Crossref Search ADS PubMed WorldCat 3 Zupanc GK , Hinsch K, Gage FH. Proliferation, migration, neuronal differentiation, and long-term survival of new cells in the adult zebrafish brain . J Comp Neurol . 2005 ; 488 : 290 - 319 . Google Scholar Crossref Search ADS PubMed WorldCat 4 Alunni A , Bally-Cuif L. A comparative view of regenerative neurogenesis in vertebrates . Development . 2016 ; 143 : 741 - 753 . Google Scholar Crossref Search ADS PubMed WorldCat 5 Kizil C , Kaslin J, Kroehne V, Brand M. Adult neurogenesis and brain regeneration in zebrafish . Dev Neurobiol . 2012 ; 72 : 429 - 461 . Google Scholar Crossref Search ADS PubMed WorldCat 6 Lindsey BW , Hall ZJ, Heuze A, et al. The role of neuro-epithelial-like and radial-glial stem and progenitor cells in development, plasticity, and repair . Prog Neurobiol . 2018 ; 170 : 99 - 114 . Google Scholar Crossref Search ADS PubMed WorldCat 7 Schmidt R , Strähle U, Scholpp S. Neurogenesis in zebrafish - from embryo to adult . Neural Dev . 2013 ; 8 : 3 . Google Scholar Crossref Search ADS PubMed WorldCat 8 Ganz J , Kaslin J, Hochmann S, Freudenreich D, Brand M. Heterogeneity and Fgf dependence of adult neural progenitors in the zebrafish telencephalon . Glia . 2010 ; 58 : 1345 - 1363 . Google Scholar Crossref Search ADS PubMed WorldCat 9 März M , Chapouton P, Diotel N, et al. Heterogeneity in progenitor cell subtypes in the ventricular zone of the zebrafish adult telencephalon . Glia . 2010 ; 58 : 870 - 888 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 10 Lam CS , März M, Strähle U. Gfap and nestin reporter lines reveal characteristics of neural progenitors in the adult zebrafish brain . Dev Dyn . 2009 ; 238 : 475 - 486 . Google Scholar Crossref Search ADS PubMed WorldCat 11 Pellegrini E , Menuet A, Lethimonier C, et al. Relationships between aromatase and estrogen receptors in the brain of teleost fish . Gen Comp Endocrinol . 2005 ; 142 : 60 - 66 . Google Scholar Crossref Search ADS PubMed WorldCat 12 Dray N , Bedu S, Vuillemin N, et al. Large-scale live imaging of adult neural stem cells in their endogenous niche . Development . 2015 ; 142 : 3592 - 3600 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 13 Rothenaigner I , Krecsmarik M, Hayes JA, et al. Clonal analysis by distinct viral vectors identifies bona fide neural stem cells in the adult zebrafish telencephalon and characterizes their division properties and fate . Development . 2011 ; 138 : 1459 - 1469 . Google Scholar Crossref Search ADS PubMed WorldCat 14 Diotel N , Vaillant C, Kah O, Pellegrini E. Mapping of brain lipid binding protein (Blbp) in the brain of adult zebrafish, co-expression with aromatase B and links with proliferation . Gene Expr Patterns . 2016 ; 20 : 42 - 54 . Google Scholar Crossref Search ADS PubMed WorldCat 15 Barbosa JS , Sanchez-Gonzalez R, Di Giaimo R, et al. Neurodevelopment. Live imaging of adult neural stem cell behavior in the intact and injured zebrafish brain . Science . 2015 ; 348 : 789 - 793 . Google Scholar Crossref Search ADS PubMed WorldCat 16 Diotel N , Vaillant C, Gabbero C, et al. Effects of estradiol in adult neurogenesis and brain repair in zebrafish . Horm Behav . 2013 ; 63 : 193 - 207 . Google Scholar Crossref Search ADS PubMed WorldCat 17 Baumgart EV , Barbosa JS, Bally-Cuif L, et al. Stab wound injury of the zebrafish telencephalon: a model for comparative analysis of reactive gliosis . Glia . 2012 ; 60 : 343 - 357 . Google Scholar Crossref Search ADS PubMed WorldCat 18 Kishimoto N , Shimizu K, Sawamoto K. Neuronal regeneration in a zebrafish model of adult brain injury . Dis Model Mech . 2012 ; 5 : 200 - 209 . Google Scholar Crossref Search ADS PubMed WorldCat 19 Kroehne V , Freudenreich D, Hans S, Kaslin J, Brand M. Regeneration of the adult zebrafish brain from neurogenic radial glia-type progenitors . Development . 2011 ; 138 : 4831 - 4841 . Google Scholar Crossref Search ADS PubMed WorldCat 20 März M , Schmidt R, Rastegar S, Strähle U. Regenerative response following stab injury in the adult zebrafish telencephalon . Dev Dyn . 2011 ; 240 : 2221 - 2231 . Google Scholar Crossref Search ADS PubMed WorldCat 21 Schmidt R , Beil T, Strähle U, et al. Stab wound injury of the zebrafish adult telencephalon: a method to investigate vertebrate brain neurogenesis and regeneration . J Vis Exp . 2014 ; 90 :e51753. Google Scholar OpenURL Placeholder Text WorldCat 22 Kyritsis N , Kizil C, Zocher S, et al. Acute inflammation initiates the regenerative response in the adult zebrafish brain . Science . 2012 ; 338 : 1353 - 1356 . Google Scholar Crossref Search ADS PubMed WorldCat 23 Diotel N , Beil T, Strähle U, Rastegar S. Differential expression of id genes and their potential regulator znf238 in zebrafish adult neural progenitor cells and neurons suggests distinct functions in adult neurogenesis . Gene Expr Patterns . 2015 ; 19 : 1 - 13 . Google Scholar Crossref Search ADS PubMed WorldCat 24 Diotel N , Rodriguez Viales R, Armant O, et al. Comprehensive expression map of transcription regulators in the adult zebrafish telencephalon reveals distinct neurogenic niches . J Comp Neurol . 2015 ; 523 : 1202 - 1221 . Google Scholar Crossref Search ADS PubMed WorldCat 25 Rodriguez Viales R , Diotel N, Ferg M, et al. The helix-loop-helix protein id1 controls stem cell proliferation during regenerative neurogenesis in the adult zebrafish telencephalon . Stem Cells . 2015 ; 33 : 892 - 903 . Google Scholar Crossref Search ADS PubMed WorldCat 26 Aleström P , D'Angelo L, Midtlyng PJ, et al. Zebrafish: housing and husbandry recommendations . Lab Anim . 2019 ; 23677219869037 . https://doi.org/10.1177/0023677219869037. Google Scholar OpenURL Placeholder Text WorldCat 27 Engstrom PG , Fredman D, Lenhard B. Ancora: a web resource for exploring highly conserved noncoding elements and their association with developmental regulatory genes . Genome Biol . 2008 ; 9 : R34 . Google Scholar Crossref Search ADS PubMed WorldCat 28 Navratilova P , Fredman D, Hawkins TA, Turner K, Lenhard B, Becker TS. Systematic human/zebrafish comparative identification of cis-regulatory activity around vertebrate developmental transcription factor genes . Dev Biol . 2009 ; 327 : 526 - 540 . Google Scholar Crossref Search ADS PubMed WorldCat 29 Ishibashi M , Mechaly AS, Becker TS, Rinkwitz S. Using zebrafish transgenesis to test human genomic sequences for specific enhancer activity . Methods . 2013 ; 62 : 216 - 225 . Google Scholar Crossref Search ADS PubMed WorldCat 30 Schindelin J , Arganda-Carreras I, Frise E, et al. Fiji: an open-source platform for biological-image analysis . Nat Methods . 2012 ; 9 : 676 - 682 . Google Scholar Crossref Search ADS PubMed WorldCat 31 Armant O , März M, Schmidt R, et al. Genome-wide, whole mount in situ analysis of transcriptional regulators in zebrafish embryos . Dev Biol . 2013 ; 380 : 351 - 362 . Google Scholar Crossref Search ADS PubMed WorldCat 32 Meng A , Tang H, Ong BA, Farrell MJ, Lin S. Promoter analysis in living zebrafish embryos identifies a cis-acting motif required for neuronal expression of GATA-2 . Proc Natl Acad Sci U S A . 1997 ; 94 : 6267 - 6272 . Google Scholar Crossref Search ADS PubMed WorldCat 33 Cartharius K , Frech K, Grote K, et al. MatInspector and beyond: promoter analysis based on transcription factor binding sites . Bioinformatics . 2005 ; 21 : 2933 - 2942 . Google Scholar Crossref Search ADS PubMed WorldCat 34 Korchynskyi O , ten Dijke P. Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter . J Biol Chem . 2002 ; 277 : 4883 - 4891 . Google Scholar Crossref Search ADS PubMed WorldCat 35 Lopez-Rovira T , Chalaux E, Massague J, et al. Direct binding of Smad1 and Smad4 to two distinct motifs mediates bone morphogenetic protein-specific transcriptional activation of Id1 gene . J Biol Chem . 2002 ; 277 : 3176 - 3185 . Google Scholar Crossref Search ADS PubMed WorldCat 36 Lewis TC , Prywes R. Serum regulation of Id1 expression by a BMP pathway and BMP responsive element . Biochim Biophys Acta . 1829 ; 2013 : 1147 - 1159 . Google Scholar OpenURL Placeholder Text WorldCat 37 Hollnagel A , Oehlmann V, Heymer J, Rüther U, Nordheim A. Id genes are direct targets of bone morphogenetic protein induction in embryonic stem cells . J Biol Chem . 1999 ; 274 : 19838 - 19845 . Google Scholar Crossref Search ADS PubMed WorldCat 38 Henningfeld KA , Rastegar S, Adler G, Knöchel W. Smad1 and Smad4 are components of the bone morphogenetic protein-4 (BMP-4)-induced transcription complex of the Xvent-2B promoter . J Biol Chem . 2000 ; 275 : 21827 - 21835 . Google Scholar Crossref Search ADS PubMed WorldCat 39 Collery RF , Link BA. Dynamic smad-mediated BMP signaling revealed through transgenic zebrafish . Dev Dyn . 2011 ; 240 : 712 - 722 . Google Scholar Crossref Search ADS PubMed WorldCat 40 Laux DW , Febbo JA, Roman BL. Dynamic analysis of BMP-responsive smad activity in live zebrafish embryos . Dev Dyn . 2011 ; 240 : 682 - 694 . Google Scholar Crossref Search ADS PubMed WorldCat 41 Schiavone M , Rampazzo E, Casari A, et al. Zebrafish reporter lines reveal in vivo signaling pathway activities involved in pancreatic cancer . Dis Model Mech . 2014 ; 7 : 883 - 894 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 42 Hao J , Ho JN, Lewis JA, et al. In vivo structure-activity relationship study of dorsomorphin analogues identifies selective VEGF and BMP inhibitors . ACS Chem Biol . 2010 ; 5 : 245 - 253 . Google Scholar Crossref Search ADS PubMed WorldCat 43 Hao J , Lee R, Chang A, et al. DMH1, a small molecule inhibitor of BMP type i receptors, suppresses growth and invasion of lung cancer . PLoS One . 2014 ; 9 :e90748. Google Scholar OpenURL Placeholder Text WorldCat 44 Kizil C , Kyritsis N, Brand M. Effects of inflammation on stem cells: together they strive? EMBO Rep . 2015 ; 16 : 416 - 426 . Google Scholar Crossref Search ADS PubMed WorldCat 45 Alunni A , Krecsmarik M, Bosco A, et al. Notch3 signaling gates cell cycle entry and limits neural stem cell amplification in the adult pallium . Development . 2013 ; 140 : 3335 - 3347 . Google Scholar Crossref Search ADS PubMed WorldCat 46 Than-Trong E , Ortica-Gatti S, Mella S, Nepal C, Alunni A, Bally-Cuif L. Neural stem cell quiescence and stemness are molecularly distinct outputs of the Notch3 signalling cascade in the vertebrate adult brain . Development . 2018 ; 145 :dev161034. Google Scholar OpenURL Placeholder Text WorldCat 47 Bond AM , Peng CY, Meyers EA, McGuire T, Ewaleifoh O, Kessler JA. BMP signaling regulates the tempo of adult hippocampal progenitor maturation at multiple stages of the lineage . Stem Cells . 2014 ; 32 : 2201 - 2214 . Google Scholar Crossref Search ADS PubMed WorldCat 48 Mira H , Andreu Z, Suh H, et al. Signaling through BMPR-IA regulates quiescence and long-term activity of neural stem cells in the adult hippocampus . Cell Stem Cell . 2010 ; 7 : 78 - 89 . Google Scholar Crossref Search ADS PubMed WorldCat 49 Nam HS , Benezra R. High levels of Id1 expression define B1 type adult neural stem cells . Cell Stem Cell . 2009 ; 5 : 515 - 526 . Google Scholar Crossref Search ADS PubMed WorldCat 50 Imayoshi I , Sakamoto M, Yamaguchi M, Mori K, Kageyama R. Essential roles of notch signaling in maintenance of neural stem cells in developing and adult brains . J Neurosci . 2010 ; 30 : 3489 - 3498 . Google Scholar Crossref Search ADS PubMed WorldCat 51 Blomfield I , Rocamonde B, Masdeu M, et al. Id4 eliminates the pro-activation factor Ascl1 to maintain quiescence of adult hippocampal stem cells. bioRxiv. 2018 . 52 Boareto M , Iber D, Taylor V. Differential interactions between notch and ID factors control neurogenesis by modulating Hes factor autoregulation . Development . 2017 ; 144 : 3465 - 3474 . Google Scholar Crossref Search ADS PubMed WorldCat 53 Rastegar S , Hess I, Dickmeis T, et al. The words of the regulatory code are arranged in a variable manner in highly conserved enhancers . Dev Biol . 2008 ; 318 : 366 - 377 . Google Scholar Crossref Search ADS PubMed WorldCat 54 Kusanagi K , Inoue H, Ishidou Y, Mishima HK, Kawabata M, Miyazono K. Characterization of a bone morphogenetic protein-responsive Smad-binding element . Mol Biol Cell . 2000 ; 11 : 555 - 565 . Google Scholar Crossref Search ADS PubMed WorldCat 55 Yoshida Y , Tanaka S, Umemori H, et al. Negative regulation of BMP/Smad signaling by Tob in osteoblasts . Cell . 2000 ; 103 : 1085 - 1097 . Google Scholar Crossref Search ADS PubMed WorldCat 56 Dennler S , Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene . EMBO J . 1998 ; 17 : 3091 - 3100 . Google Scholar Crossref Search ADS PubMed WorldCat 57 Zawel L , Dai JL, Buckhaults P, et al. Human Smad3 and Smad4 are sequence-specific transcription activators . Mol Cell . 1998 ; 1 : 611 - 617 . Google Scholar Crossref Search ADS PubMed WorldCat 58 Monteiro RM , de Sousa Lopes SM, Bialecka M, et al. Real time monitoring of BMP Smads transcriptional activity during mouse development . Genesis . 2008 ; 46 : 335 - 346 . Google Scholar Crossref Search ADS PubMed WorldCat 59 Ramel MC , Hill CS. The ventral to dorsal BMP activity gradient in the early zebrafish embryo is determined by graded expression of BMP ligands . Dev Biol . 2013 ; 378 : 170 - 182 . Google Scholar Crossref Search ADS PubMed WorldCat 60 Ionescu AM , Drissi H, Schwarz EM, et al. CREB cooperates with BMP-stimulated Smad signaling to enhance transcription of the Smad6 promoter . J Cell Physiol . 2004 ; 198 : 428 - 440 . Google Scholar Crossref Search ADS PubMed WorldCat 61 Ohta Y , Nakagawa K, Imai Y, Katagiri T, Koike T, Takaoka K. Cyclic AMP enhances Smad-mediated BMP signaling through PKA-CREB pathway . J Bone Miner Metab . 2008 ; 26 : 478 - 484 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes Gaoqun Zhang and Marco Ferg contributed equally to this study. Funding information FP7 Health, Grant/Award Number: FP7-242048; the European Union's Horizon 3952020 research and innovation programme under the Marie Sklodowska-Curie grant agreement, Grant/Award Number: ZENCODE-ITN 643062; European Union ©2020 The Authors. Stem Cells published by Wiley Periodicals, Inc. on behalf of AlphaMed Press 2020 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc-nd/4.0/), which permits non-commercial reuse, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected]