Japanese Journal of Clinical Oncology

Kunitoh,, Hideo

doi: 10.1093/jjco/hyaa205pmid: 33367846

The year 2020 will be remembered as a nightmare year for oncology in Japan. In 2020, the Covid-19 pandemic has completely changed the face of the Earth. It has affected our daily care of cancer patients (1,2), clinical oncology research (3,4) and even ethics in cancer patient management (5). This plague is expected to stay with us for several years to come; we have to adjust, however reluctantly, our practice, research and ethics to this most unwelcome ‘new normal’. Also catastrophic, although to a lesser extent, is the Clinical Trials Act, which came into force in 2018, and which has imposed overly strict regulations, effectively prohibiting investigator-lead clinical research (6,7). Nakamura et al. (6) have described the situation in their excellent review, demonstrating how the act will reduce all clinical research activity in Japan except for pharmaceutical company-sponsored trials. We pushed hard for an amendment to the law, but the Covid pandemic stood in the way. We recently saw evidence of how industry-sponsored research has started to dominate Japanese clinical oncology when we made the final selection for the JJCO ‘Paper of the Year Award 2020’; 8 (8–15) out of the top 10 shortlisted papers were on industry-sponsored trials. Three of these papers were subset analyses of global studies (9,11,15). Of course, we do accept and welcome such papers as a journal of Japanese clinical oncology, but I would hate to see clinical research colleagues mainly working as subcontractors for ‘mega-pharma’ in the future. Amongst so many industry-sponsored papers, I am happy to announce that we gave the ‘Paper of the Year Award 2020 to Dr Takeshi Nawa and his co-authors for ‘A population-based cohort study to evaluate the effectiveness of lung cancer screening using low-dose CT in Hitachi city, Japan’ (16). They conducted a retrospective cohort study of computed tomography (CT) screening for participants amongst Hitachi residents and concluded that low-dose CT screening for a population including non-smokers and light smokers may be effective. The study was funded by public grants including one from the Agency for Medical Research and Development (AMED), and I do hope many investigations will follow this study with generous public support. Although I have repeatedly emphasized in my New Year Editorials that the most important factor for the success of a scientific journal is good-quality original articles, JJCO is also putting high priority on publishing relevant Review articles. In 2019 and 2020, we published reviews on new (8th edition) staging classifications on various tumours (17–26). These reviews will help readers to understand and implement the recently updated TNM classifications of malignant tumours, which are getting increasingly complicated and sometimes difficult to follow. In 2020, we started a review series on adjuvant/neoadjuvant therapies (27–35). For disease ‘cure’, monotherapy (surgery alone, radiotherapy alone, chemotherapy alone or immunotherapy alone) is seldom enough. Our new reviews series will provide insight into present and future patient care, which takes a multidisciplinary approach. In addition, we are soon to start yet another series on the rapidly changing field of immunotherapy. Please stay tuned for the JJCO review series, and more. I would also like to take this opportunity to thank our distinguished reviewers for the time they have donated to improving each manuscript and the journal as a whole. In 2018 we began a ‘Reviewer Award’ to express our gratitude to our reviewers’ contributions. In 2020, the prize went to Prof. Eiji Kikuchi, St Marianna Medical College, and to Ms. Maiko Fujimori, National Cancer Center. With the global trend for more open access articles/journals, JJCO is also encouraging the authors to make use of the Oxford Open service to make their paper freely available upon publication online. In 2020, 23 papers were published under the Oxford Open scheme, up from 16 in 2019. I would like to take this opportunity to call for greater use of this open access option. JJCO’s 2019 impact factor was 1.914, down from the 2018 impact factor of 2.183 and 2017 impact factor of 2.370. However, at the time of writing this, we are expecting to receive over 1000 manuscript submissions by the end of 2020. We believe JJCO is widely accepted as one of the leading oncology journals, not only in Japan, but also in the whole Asia-Pacific region. Our review time has shortened significantly during the last decade, with the average periods from submission to first and final decisions of 21 and 33 days, respectively, in 2019. Even for accepted manuscripts, which usually undergo one or more revisions, the average period from submission to acceptance was 89 days. With this prompt but careful peer review, I would like to invite all fellow researchers from anywhere in the world to contribute their high-quality academic and/or clinical research. We will continue to do our best so that you, the readers, will find articles in JJCO intriguing, informative, relevant and helpful. As I embark on my fourth year as Editor-in-Chief, I would like to express my appreciation your continuing interest and support. Conflict of interest statement None declared. References 1. Mulvey TM , Jacobson JO. COVID-19 and cancer care: ensuring safety while transforming care delivery . J Clin Oncol 2020 (in press) . doi: 10.1200/JCO.20.01474 . Google Scholar OpenURL Placeholder Text WorldCat Crossref 2. Segelov E , Underhill C, Prenen H et al. Practical considerations for treating patients with cancer in the COVID-19 pandemic . JCO Oncol Practice 2020 ; 16 : 467 – 82 . Google Scholar Crossref Search ADS WorldCat 3. Harris AL . COVID-19 and cancer research . Br J Cancer 2020 ; 123 : 689 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Moskowitz CS , Panageas KS. Implications for design and analyses of oncology clinical trials during the COVID-19 pandemic . JAMA Oncol 2020 ; 6 : 1326 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Marron JM , Joffe S, Jagsi R, Spence RA, Hlubocky FJ. Ethics and resource scarcity: ASCO recommendations for the oncology community during the COVID-19 pandemic . J Clin Oncol 2020 ; 38 : 2201 – 5 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Nakamura K , Shibata T. Regulatory changes after the enforcement of the new Clinical Trials Act in Japan . Jpn J Clin Oncol 2020 ; 50 : 399 – 404 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Kunitoh H . A catastrophe caused by good intentions? Jpn J Clin Oncol 2020 ; 50 : 347 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Usui K , Yokoyama T, Naka G et al. Plasma ctDNA monitoring during epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitor treatment in patients with EGFR-mutant non-small cell lung cancer (JP-CLEAR trial) . Jpn J Clin Oncol 2019 ; 49 : 554 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Ohe Y , Imamura F, Nogami N et al. Osimertinib versus standard-of-care EGFR-TKI as first-line treatment for EGFRm advanced NSCLC: FLAURA Japanese subset . Jpn J Clin Oncol 2019 ; 49 : 29 – 36 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Kosaka T, Uemura H, Sumitomo M et al. Impact of pegfilgrastim as primary prophylaxis for metastatic castration-resistant prostate cancer patients undergoing cabazitaxel treatment: an open-label study in Japan. Jpn J Clin Oncol 2019 ; 49 :766–71. 11. Iwata H , Inoue K, Kaneko K et al. Subgroup analysis of Japanese patients in a phase 3 study of atezolizumab in advanced triple-negative breast cancer (IMpassion130) . Jpn J Clin Oncol 2019 ; 49 : 1083 – 91 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Muro K , Itabashi M, Hashida H et al. Observational study of first-line chemotherapy including cetuximab in patients with metastatic colorectal cancer: CORAL trial . Jpn J Clin Oncol 2019 ; 49 : 339 – 46 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Suzuki K, Matsubara N, Kazama H, Seto T, Tsukube S, Matsuyama H. Safety and efficacy of cabazitaxel in 660 patients with metastatic castration-resistant prostate cancer in real-world settings: results of a Japanese post-marketing surveillance study . Jpn J Clin Oncol 2019 ; 49 : 1157 – 63 . Crossref Search ADS PubMed WorldCat 14. Rohde C , Yamaguchi R, Mukhina S, Sahin U, Itoh K, Türeci Ö. Comparison of Claudin 18.2 expression in primary tumors and lymph node metastases in Japanese patients with gastric adenocarcinoma . Jpn J Clin Oncol 2019 ; 49 : 870 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Tomita Y, Fukasawa S, Shinohara Net al. Nivolumab versus everolimus in advanced renal cell carcinoma: Japanese subgroup 3-year follow-up analysis from the phase III CheckMate 025 study . Jpn J Clin Oncol 2019 ; 49 : 506 – 14 . Crossref Search ADS PubMed WorldCat 16. Nawa T , Fukui K, Nakayama T et al. A population-based cohort study to evaluate the effectiveness of lung cancer screening using low-dose CT in Hitachi city, Japan . Jpn J Clin Oncol 2019 ; 49 : 130 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Daiko H , Kato K. Updates in the 8th edition of the TNM staging system for esophagus and esophagogastric junction cancer . Jpn J Clin Oncol 2020 ; 50 : 847 – 85 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Ueno M , Morizane C, Ikeda M, Okusaka T, Ishii H, Furuse J. A review of changes to and clinical implications of the eighth TNM classification of hepatobiliary and pancreatic cancers . Jpn J Clin Oncol 2019 ; 49 : 1073 – 82 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Munakata W , Terauchi T, Maruyama D, Nagai H. Revised staging system for malignant lymphoma based on the Lugano classification . Jpn J Clin Oncol 2019 ; 49 : 895 – 900 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Head and Neck Cancer Study Group (HNCSG) , Monden N, Asakage T et al. A review of head and neck cancer staging system in the TNM classification of malignant tumors (eighth edition) . Jpn J Clin Oncol 2019 ; 49 : 589 – 95 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Kandori S , Kojima T, Nishiyama H. The updated points of TNM classification of urological cancers in the 8th edition of AJCC and UICC . Jpn J Clin Oncol 2019 ; 49 : 421 – 5 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Tokunaga H , Shimada M, Ishikawa M, Yaegashi N. TNM classification of gynaecological malignant tumours, eighth edition: changes between the seventh and eighth editions . Jpn J Clin Oncol 2019 ; 49 : 311 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Shida D , Kanemitsu Y, Hamaguchi T, Shimada Y. Introducing the eighth edition of the tumor-node-metastasis classification as relevant to colorectal cancer, anal cancer and appendiceal cancer: a comparison study with the seventh edition of the tumor-node-metastasis and the Japanese classification of colorectal, Appendiceal, and anal carcinoma . Jpn J Clin Oncol 2019 ; 49 : 321 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Sawaki M , Shien T, Iwata H. TNM classification of malignant tumors (breast cancer study group) . Jpn J Clin Oncol 2019 ; 49 : 228 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Tanaka K , Ozaki T. New TNM classification (AJCC eighth edition) of bone and soft tissue sarcomas: JCOG Bone and Soft Tissue Tumor Study Group . Jpn J Clin Oncol 2019 ; 49 : 103 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Hattori A , Takamochi K, Oh S, Suzuki K. New revisions and current issues in the eighth edition of the TNM classification for non-small cell lung cancer . Jpn J Clin Oncol 2019 ; 49 : 3 – 11 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Shimada M , Tokunaga H, Kobayashi H, Ishikawa M, Yaegashi N. Perioperative treatments for stage IB–IIB uterine cervical cancer . Jpn J Clin Oncol 2020 ; 50 : 99 – 103 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Shien T , Iwata H. Adjuvant and neoadjuvant therapy for breast cancer . Jpn J Clin Oncol 2020 ; 50 : 225 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Inokuchi J , Yokomizo A, Nishiyama N et al. Perioperative therapies for urological cancers . Jpn J Clin Oncol 2020 ; 50 : 357 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Ouchi A , Shida D, Hamaguchi T et al. Challenges of improving treatment outcomes for colorectal and anal cancers in Japan: the Colorectal Cancer Study Group (CCSG) of the Japan Clinical Oncology Group (JCOG) . Jpn J Clin Oncol 2020 ; 50 : 368 – 78 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Nishio S , Ushijima K. Clinical significance of primary debulking surgery and neoadjuvant chemotherapy-interval debulking surgery in advanced ovarian cancer . Jpn J Clin Oncol 2020 ; 50 : 379 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Terashima M , Yoshikawa T, Boku N et al. Current status of perioperative chemotherapy for locally advanced gastric cancer and JCOG perspectives . Jpn J Clin Oncol 2020 ; 50 : 528 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Motoi F , Unno M. Adjuvant and neoadjuvant treatment for pancreatic adenocarcinoma . Jpn J Clin Oncol 2020 ; 50 : 483 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 34. Aoki Y , Kanao H, Wang X et al. Adjuvant treatment of endometrial cancer today . Jpn J Clin Oncol 2020 ; 50 : 753 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Nara S , Esaki M, Ban D et al. Adjuvant and neoadjuvant therapy for biliary tract cancer: a review of clinical trials . Jpn J Clin Oncol 2020 ; https://doi.org/10.1093/jjco/hyaa170. Google Scholar OpenURL Placeholder Text WorldCat Author notes Editor-in-Chief, Japanese Journal of Clinical Oncology © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Kato,, Junji;Uhara,, Hisashi

doi: 10.1093/jjco/hyaa188pmid: 33140101

Abstract Treatment with immune checkpoint inhibitors provides long-term survival for patients with advanced melanoma. Improvements in the overall survival of advanced melanoma patients have been achieved with anti-PD-1 monotherapy and anti-PD-1+ CTLA4 combination therapy, but there are still many issues to resolve. Acral, mucosal and uveal melanoma have been less responsive to immune checkpoint inhibitors than cutaneous melanoma. For patients who have achieved a good response, it is still not known how long the anti-PD-1 therapy should be administered. Moreover, there is limited treatment for patients who relapse during or after adjuvant anti-PD-1 therapy. Here, we review the current evidence regarding the clinical effects of immunotherapy for advanced melanoma. Moreover, we review previous studies of acral, mucosal and uveal melanoma, and we discuss the recent findings regarding durable response after the cessation of anti-PD-1 therapy, and treatment options for recurrence after adjuvant therapy. melanoma, immunotherapy, immune checkpoint inhibitor, acral melanoma, mucosal melanoma, uveal melanoma, durable response Introduction Over the years, dacarbazine (DTIC) has been a key drug for treating advanced melanoma. However, the overall response rate (ORR) and overall survival (OS) have been poor. The ORR and 5-year OS of DTIC are about 10% and less than 10%, respectively. In the last few years, anti-programmed cell death 1 (PD-1) antibodies, anti-cytotoxic T-lymphocyte-associated protein 4 (CTLA-4) antibody, BRAF inhibitors and MEK inhibitors have dramatically improved the ORR and elongated the OS of patients with advanced melanoma. The current first-line therapy for advanced melanoma without BRAF V600 mutation is immunotherapy with anti-PD-1 antibodies alone or in combination with anti-CTLA-4 antibody (1–4). To date, several trials and studies have evaluated immune checkpoint inhibitors (ICIs) for advanced melanoma. However, many issues remain to be resolved regarding immunotherapy for melanoma. Acral, mucosal and uveal melanoma have been less responsive to ICIs than cutaneous melanoma. How long should we continue to treat patients who have achieved a good response with ICIs? Additionally, how should we treat patients who recur after having received adjuvant PD1 therapy? Here, we review novel results of recent studies of acral, mucosal and uveal melanoma, and we discuss the recent findings regarding a durable response after the cessation of anti-PD-1 therapy, and treatment options for recurrence after adjuvant anti-PD-1 therapy. ICIs for advanced or metastatic melanoma Anti CTLA-4 antibody (ipilimumab) The anti-CTLA-4 antibody (ipilimumab) was approved for melanoma as monotherapy by the U.S. Food and Drug Administration (FDA) in 2011 and in Japan in 2015. In a phase III randomized trial of the combination of ipilimumab+dacarbazine versus dacarbazine alone, the median OS was longer in the combo group (5). A pooled analysis of the patients treated with ipilimumab showed that the median OS was 11.4 months, and the 3-year survival rate was 22% (6). A phase II study of ipilimumab in 20 Japanese patients showed that the median OS was 8.71 months and the ORR was 10% (7). Additionally, a real-world study of ipilimumab in 547 Japanese patients reported a median OS of 7.52 months (8). Recent investigations indicated that anti-PD-1 therapy showed significantly superior efficacy compared with ipilimumab therapy (9–11). Thus, ipilimumab monotherapy is used, mainly as a second- or later-line treatment. However, the ORR of ipilimumab treatment after a failed response to anti-PD-1 treatment was low (3.6–16%) (12–16). Anti PD-1 antibodies (nivolumab, pembrolizumab) PD-1 is an inhibitory receptor expressed by activated T cells, which down-modulates effector functions. In 2014, nivolumab was approved in Japan for advanced melanoma as the first anti-PD1 therapy, and this was followed by the approval of pembrolizumab in 2016. A phase II trial of nivolumab in Japanese patients as a second-line therapy achieved a 28.6% ORR, and the 1- and 2-year OS rates were 54.3 and 42.9%, respectively (17). Moreover, in a phase II trial of nivolumab as first-line therapy, the ORR was 34.8% and the median OS was 32.9 months (18). A real-world study of nivolumab in 610 Japanese patients indicated that the estimated median OS was 12 months (19). The long-term efficacy of anti-PD-1 therapies has been assessed in several trials and studies. The CheckMate 067 study showed that the 5-year landmark OS rate was 44% with a median OS of 36.9 months in patients treated with nivolumab as first-line therapy (20). The KEYNOTE-001 study showed that the 5-year OS rate treated with pembrolizumab was 34% in all patients and 41% in treatment-naive patients (21). Moreover, in the KEYNOTE-006 study that targeted BRAF V600-mutated melanoma patients treated with pembrolizumab, the median OS was 32.7 months (11). Combination treatment with nivolumab and ipilimumab The usefulness of the combination therapy of nivolumab plus ipilimumab was examined in the CheckMate 067 study. The ORR was 58% in the combination group (ipilimumab+nivolumab), 44% for nivolumab monotherapy and 19% in the ipilimumab monotherapy group. The complete response (CR) rates for these treatment groups were 22, 19 and 6%, respectively. The 5-year OS was 51% in the combination group, 44% in the nivolumab monotherapy group and 26% in the ipilimumab monotherapy group; the corresponding 5-year PFS rates were 36, 29 and 8%, respectively. Moreover, subgroup analyses showed that the OS was improved by the combination therapy in the subset of patients with PD-1 ligand 1 (PD-L1)-negative tumors. However, among the patients with a tumor PD-L1 expression level ≥ 1%, the OS was similar between the combination therapy group and the nivolumab monotherapy group (20,22). Additionally, in a Japanese study of combination therapy as first-line treatment, the ORR was 43.3% (13/30) (23). The percentages of patients in the CheckMate 067 study who exhibited grade 3 or 4 immune-related adverse events (irAEs) were 59% (ipilimumab+nivolumab), 23% (nivolumab) and 28% (ipilimumab) (20). The incidence of AEs was higher in the patients treated with the combination therapy than in those treated with either monotherapy. The pros and cons of the combination therapy should thus be carefully discussed with patients before beginning treatment. Due to the high incidence of irAEs in the combination regimen, a lower dose of the ipilimumab regimen was examined for safety and efficacy (24,25). In the CheckMate 511 study, 360 advanced melanoma patients were treated with either a nivolumab 1 mg/kg and ipilimumab 3 mg/kg (NIVO 1 + IPI 3) combo or a nivolumab 3 mg/kg and ipilimumab 1 mg/kg (NIVO 3 + IPI 1) combo. The incidence of grade 3–5 AEs was significantly lower in the (NIVO 3 + IPI 1) group than in the (NIVO 1 + IPI 3) group. However, the treatment efficacy was largely comparable between these groups. The ORRs were 45.6% (NIVO 3 + IPI 1) and 50.6% (NIVO 1 + IPI 3), with CRs in 15.0% (NIVO 3 + IPI 1) and 13.5% (NIVO 1 + IPI 3) of the patients (24). In the KEYNOTE-029 study, patients received standard-dose pembrolizumab (2 mg/kg) and low-dose ipilimumab (1 mg/kg) every 3 weeks for four doses, followed by pembrolizumab every 3 weeks for up to 2 years or disease progression or intolerable toxicity. Ninety-three (61%) patients had an objective response, and grade 3–4 AEs occurred in 42 (27%) patients (25). Immunotherapy for acral and mucosal melanoma The efficacy of the ICIs differs depending on the subtype of melanoma. The most frequent type of malignant melanoma affecting the Japanese population is different from that affecting Caucasians. Japanese melanoma patients more frequently have acral or mucosal melanoma compared with Caucasian patients. In a recent study of 4594 Japanese patients, the most common clinical type of melanoma was acral (40.4%), followed by superficial spreading (20.5%), nodular (10.0%), mucosal (9.5%) and lentigo maligna (8.1%) melanoma (26). Several studies have reported that acral and mucosal melanoma were less responsive to anti-PD-1 therapy than cutaneous melanoma. The ORR of anti-PD-1 therapy for mucosal melanoma was 9.5–35%, and the ORR for acral melanoma was 15.8–32% (27–41) (Tables 1 and 2). Table 1 Anti-PD-1 monotherapy for mucosal melanoma in previous studies Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 35 1st + ≥2nd 23 NR 3.9 2016 Takahashi et al. (30) 27 1st 33.3 7.4 NR 2017 D’Angelo et al. (31) 86 1st + ≥2nd 23.3 5.8 3.0 2018 Hamid et al. (32) 84 1st + ≥2nd 19 NR 2.8 2018 Mignard et al. (33) 75 1st + ≥2nd 20 NR NR 2019 Moya-Plana et al. (34) 20 1st 35 20 5 2019 Si et al. (35) 15 2nd 13.3 6.7 NR 2019 Maeda et al. (36) 24 NR 21 NR 7.5 2019 Kondo et al. (38) 22 1st + ≥2nd 9.5 NR NR 2020 Otsuka et al. (39) 27 NR 30 11 NR 2020 Nomura et al. (40) 17 1st + ≥2nd 23.5 5.9 1.4 Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 35 1st + ≥2nd 23 NR 3.9 2016 Takahashi et al. (30) 27 1st 33.3 7.4 NR 2017 D’Angelo et al. (31) 86 1st + ≥2nd 23.3 5.8 3.0 2018 Hamid et al. (32) 84 1st + ≥2nd 19 NR 2.8 2018 Mignard et al. (33) 75 1st + ≥2nd 20 NR NR 2019 Moya-Plana et al. (34) 20 1st 35 20 5 2019 Si et al. (35) 15 2nd 13.3 6.7 NR 2019 Maeda et al. (36) 24 NR 21 NR 7.5 2019 Kondo et al. (38) 22 1st + ≥2nd 9.5 NR NR 2020 Otsuka et al. (39) 27 NR 30 11 NR 2020 Nomura et al. (40) 17 1st + ≥2nd 23.5 5.9 1.4 CRR, complete response rate; NR, not reported; ORR, objective response rate; PFS, progression-free survival. Open in new tab Table 1 Anti-PD-1 monotherapy for mucosal melanoma in previous studies Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 35 1st + ≥2nd 23 NR 3.9 2016 Takahashi et al. (30) 27 1st 33.3 7.4 NR 2017 D’Angelo et al. (31) 86 1st + ≥2nd 23.3 5.8 3.0 2018 Hamid et al. (32) 84 1st + ≥2nd 19 NR 2.8 2018 Mignard et al. (33) 75 1st + ≥2nd 20 NR NR 2019 Moya-Plana et al. (34) 20 1st 35 20 5 2019 Si et al. (35) 15 2nd 13.3 6.7 NR 2019 Maeda et al. (36) 24 NR 21 NR 7.5 2019 Kondo et al. (38) 22 1st + ≥2nd 9.5 NR NR 2020 Otsuka et al. (39) 27 NR 30 11 NR 2020 Nomura et al. (40) 17 1st + ≥2nd 23.5 5.9 1.4 Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 35 1st + ≥2nd 23 NR 3.9 2016 Takahashi et al. (30) 27 1st 33.3 7.4 NR 2017 D’Angelo et al. (31) 86 1st + ≥2nd 23.3 5.8 3.0 2018 Hamid et al. (32) 84 1st + ≥2nd 19 NR 2.8 2018 Mignard et al. (33) 75 1st + ≥2nd 20 NR NR 2019 Moya-Plana et al. (34) 20 1st 35 20 5 2019 Si et al. (35) 15 2nd 13.3 6.7 NR 2019 Maeda et al. (36) 24 NR 21 NR 7.5 2019 Kondo et al. (38) 22 1st + ≥2nd 9.5 NR NR 2020 Otsuka et al. (39) 27 NR 30 11 NR 2020 Nomura et al. (40) 17 1st + ≥2nd 23.5 5.9 1.4 CRR, complete response rate; NR, not reported; ORR, objective response rate; PFS, progression-free survival. Open in new tab Table 2 Anti-PD-1 therapy for acral melanoma in previous studies Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 25 1st + ≥2nd 32 NR 4.1 2019 Si et al. (35) 39 2nd 15.8 0 NR 2019 Maeda et al. (36) 16 NR 19 NR 7.5 2020 Shoushtari et al (37). 50 ≥2nd 14 NR NR 2020 Nakamura et al. (41) 193 1st + ≥2nd 16.6 3.1 NR Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 25 1st + ≥2nd 32 NR 4.1 2019 Si et al. (35) 39 2nd 15.8 0 NR 2019 Maeda et al. (36) 16 NR 19 NR 7.5 2020 Shoushtari et al (37). 50 ≥2nd 14 NR NR 2020 Nakamura et al. (41) 193 1st + ≥2nd 16.6 3.1 NR Open in new tab Table 2 Anti-PD-1 therapy for acral melanoma in previous studies Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 25 1st + ≥2nd 32 NR 4.1 2019 Si et al. (35) 39 2nd 15.8 0 NR 2019 Maeda et al. (36) 16 NR 19 NR 7.5 2020 Shoushtari et al (37). 50 ≥2nd 14 NR NR 2020 Nakamura et al. (41) 193 1st + ≥2nd 16.6 3.1 NR Year . Source . n . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2016 Shoushtari et al. (29) 25 1st + ≥2nd 32 NR 4.1 2019 Si et al. (35) 39 2nd 15.8 0 NR 2019 Maeda et al. (36) 16 NR 19 NR 7.5 2020 Shoushtari et al (37). 50 ≥2nd 14 NR NR 2020 Nakamura et al. (41) 193 1st + ≥2nd 16.6 3.1 NR Open in new tab The combination of nivolumab and ipilimumab against mucosal melanoma has been reported to be efficacious compared with anti-PD-1 monotherapy. In a study of a nivolumab+ipilimumab combination, the ORR was 37.1% in 35 mucosal melanoma patients (31). The ORR in another study was 33.3% in 12 mucosal melanoma patients treated with a nivolumab+ipilimumab combination (23). For advanced mucosal melanoma, combination therapy could thus be a promising option. However, there are few reports on the effects of combination therapy for acral melanoma (Table 3). Table 3 Anti-PD-1+ anti-CTLA-4 combination therapy for acral or mucosal melanoma in previous studies Year . Source . n . Type . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2017 D’Angelo et al. (31) 35 Mucosal 1st 37.1 2.9 5.9 2018 Namikawa et al. (23) 12 Mucosal 1st 33.3 NR NR 2018 Namikawa et al. (23) 7 Acral 1st 42.9 NR NR Year . Source . n . Type . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2017 D’Angelo et al. (31) 35 Mucosal 1st 37.1 2.9 5.9 2018 Namikawa et al. (23) 12 Mucosal 1st 33.3 NR NR 2018 Namikawa et al. (23) 7 Acral 1st 42.9 NR NR Open in new tab Table 3 Anti-PD-1+ anti-CTLA-4 combination therapy for acral or mucosal melanoma in previous studies Year . Source . n . Type . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2017 D’Angelo et al. (31) 35 Mucosal 1st 37.1 2.9 5.9 2018 Namikawa et al. (23) 12 Mucosal 1st 33.3 NR NR 2018 Namikawa et al. (23) 7 Acral 1st 42.9 NR NR Year . Source . n . Type . Treatment line . ORR (%) . CRR (%) . Median PFS (months) . 2017 D’Angelo et al. (31) 35 Mucosal 1st 37.1 2.9 5.9 2018 Namikawa et al. (23) 12 Mucosal 1st 33.3 NR NR 2018 Namikawa et al. (23) 7 Acral 1st 42.9 NR NR Open in new tab The clinical response to ICIs can be associated with the tumor mutational burden, the PD-L1 expression, the presence of CD8+ tumor-infiltrating lymphocytes and the microsatellite instability status (42–47). ICIs are known to be more effective against tumors with a higher mutation burden. A study involving whole-genome sequencing showed that acral melanoma and mucosal melanoma had a far lower mutation burden than cutaneous melanoma (48). In another recent study, acral and mucosal melanomas had lower PD-L1 expressions than cutaneous melanoma (49). Moreover, lower rates of tumor-infiltrating lymphocytes were identified in acral melanoma and mucosal melanoma compared with cutaneous melanoma (50,51). ICIs are thus expected to be less effective against acral and mucosal melanomas compared with cutaneous melanoma. ICIs for uveal melanoma Uveal melanoma is a rare tumor with mutations in the BAP1, GNAQ and GNA11 genes (52). No standard treatment exists for metastasized uveal melanoma, and in contrast to cutaneous melanoma, ICIs have not yet been shown to be effective against metastatic uveal melanoma (53–57). In a phase II trial reported by Zimmer et al., the ORR was 0% in 53 patients with metastatic uveal melanoma treated with ipilimumab, although 16 patients had stable disease (47%) (58). In a study by Algazi et al., the ORR was 3.6% in 56 uveal melanoma patients treated with anti-PD-1 or anti-PD-L1 monotherapies (59). An investigation by Heppt et al. revealed that the ORR for patients treated with a PD-1 inhibitor was 4.7% (4/86), whereas the ORR for patients treated with a combination of ipilimumab+anti-PD-1 therapy was 16.7% (2/12) (60). A retrospective, multi-center study also conducted by Heppt et al. demonstrated that of 64 patients with metastatic or unresectable uveal melanoma treated with a combination of ipilimumab+anti-PD-1 therapy, the ORR was 15.6% and the CR rate was 3.1% (61). A recent phase II trial (NCT02626962) of 50 patients treated with an ipilimumab+nivolumab combination described an ORR of 12% (6/50) (62). Another recent prospective phase II trial (NCT01585194) of 30 patients treated with ipilimumab+nivolumab had an ORR of 17% (5/30) (63). A more recent retrospective study of 89 patients treated with ipilimumab+nivolumab reported an ORR of 11% (10/89) (64). Based on these reports, combination therapy for uveal melanoma was more effective than anti-PD-1 monotherapy. However, even with combination therapy, the ORR is ~15%, and thus, new treatments and approaches are needed for metastatic uveal melanoma. ICIs against brain metastasis Brain metastasis as the worst-prognosis factor is reflected in the newest American Joint Committee on Cancer staging manual (8th edition), and a new category (M1d: brain metastasis) was added to the M classification (65). However, the number of studies of ICIs against brain metastasis is limited. In a phase II study, the ORR was 26% (6 of 23 patients) against brain metastasis treated with anti-PD-1 monotherapy (66,67). An earlier study reported that the efficacy of ipilimumab+nivolumab combination therapy was better than that of anti-PD-1 monotherapy (68). There are also two recent trials that examine the effect of combination therapy for brain metastasis (68,69). Long et al. described their phase II trial comparing nivolumab monotherapy with an ipilimumab+nivolumab combination in asymptomatic patients with metastatic brain melanoma who had not undergone any local therapy. The intracranial ORRs for these patients were 46% (16/35) in the ipilimumab+nivolumab combination group and 20% (5/25) in the nivolumab monotherapy group (68). Similarly, in another phase II study (Checkmate 204 study), the intracranial ORR of the ipilimumab+nivolumab combination treatment group was 55% (52/94). Although the follow-up was short (median follow-up, 14.0 months), the 6-month PFS rate was 64.2%, and the estimated 12-month survival rate was 81.5% (69). These results demonstrated that the combination of nivolumab and ipilimumab for asymptomatic melanoma patients with brain metastases could provide support toward controlling both extracranial and brain metastases (Table 4). Table 4 Anti-PD-1 monotherapy or anti-PD-1+ anti-CTLA-4 combination therapy against brain metastasis Year . Source . n . Therapy . Intracranial ORR (%) . Extracranial ORR (%) . Median PFS (months) . 2018 Long et al. (68) 25 Nivolumab 20 29 2.5 2019 Kluger et al. (67) 23 Pembrolizumab 26 30 2 2018 Long et al. (68) 35 Ipilimumab+nivolumab 46 57 13.8 2018 Tawbi et al. (69) 94 Ipilimumab+nivolumab 55 50 NR Year . Source . n . Therapy . Intracranial ORR (%) . Extracranial ORR (%) . Median PFS (months) . 2018 Long et al. (68) 25 Nivolumab 20 29 2.5 2019 Kluger et al. (67) 23 Pembrolizumab 26 30 2 2018 Long et al. (68) 35 Ipilimumab+nivolumab 46 57 13.8 2018 Tawbi et al. (69) 94 Ipilimumab+nivolumab 55 50 NR Open in new tab Table 4 Anti-PD-1 monotherapy or anti-PD-1+ anti-CTLA-4 combination therapy against brain metastasis Year . Source . n . Therapy . Intracranial ORR (%) . Extracranial ORR (%) . Median PFS (months) . 2018 Long et al. (68) 25 Nivolumab 20 29 2.5 2019 Kluger et al. (67) 23 Pembrolizumab 26 30 2 2018 Long et al. (68) 35 Ipilimumab+nivolumab 46 57 13.8 2018 Tawbi et al. (69) 94 Ipilimumab+nivolumab 55 50 NR Year . Source . n . Therapy . Intracranial ORR (%) . Extracranial ORR (%) . Median PFS (months) . 2018 Long et al. (68) 25 Nivolumab 20 29 2.5 2019 Kluger et al. (67) 23 Pembrolizumab 26 30 2 2018 Long et al. (68) 35 Ipilimumab+nivolumab 46 57 13.8 2018 Tawbi et al. (69) 94 Ipilimumab+nivolumab 55 50 NR Open in new tab Several studies have shown that the combination of radiotherapy and immunotherapies improves the response of patients with brain metastasis of melanoma (70–74). A recent retrospective study of 50 patients with brain metastases treated with stereotactic radiosurgery combined with anti-PD-1therapy reported that the median PFS duration was 13.2 months (74). This result was much better than the result of anti-PD-1 monotherapy (2.0–2.5 months) (67,68). Clinical trials evaluating anti-PD-1 therapy and radiotherapy (NCT02858869, NCT02978404) and a combination of nivolumab+ ipilimumab therapy and radiotherapy (NCT03340129) are ongoing. Treatment options for recurrence after adjuvant anti-PD-1 therapy According to results from several reports, adjuvant anti-PD-1 therapy was observed to be more effective than adjuvant ipilimumab, and adjuvant ipilimumab was also associated with the highest rate of treatment-related AEs (75–80). Thus, anti-PD-1 therapy is the preferred adjuvant treatment for patients with resected stage III melanoma that is BRAF wild-type. However, the treatment options for BRAF wild-type patients who relapse during or after adjuvant anti-PD-1 therapy are limited. Owen et al. reported that patients who were treated with adjuvant anti-PD-1 therapy had tumor recurrence during or after the treatment (81). Among the patients with recurrence during adjuvant therapy in the study, there were no responders to a rechallenge of anti-PD-1 therapy, and 24% (8/33) responded to ipilimumab alone or in combination with PD-1. In contrast, among the five patients with recurrence after the completion of adjuvant treatment, two (40%) responded to a rechallenge of anti-PD-1 therapy, and two (40%) responded to ipilimumab alone or in combination with PD-1 (81). These results suggested that the efficacy of anti-PD1 as the next therapy could be dependent on the timing of recurrence in the patients who received the adjuvant PD-1 therapy. Moreover, a recent study presented at the 2020 American Society of Clinical Oncology (ASCO) virtual meeting (Abstract #1005) demonstrated that ipilimumab+nivolumab combination provided a higher ORR and longer survival than ipilimumab alone in patients who were resistant to anti-PD-1 therapy including in an adjuvant setting. Therefore, for the BRAF wild-type patients with recurrence during adjuvant anti-PD-1therapy, the ipilimumab+nivolumab combination should be considered. For those with recurrence after the completion of adjuvant anti-PD-1therapy, a rechallenge of anti-PD-1 therapy or ipilimumab+nivolumab combination should be considered. The prognosis after the discontinuation of anti-PD-1 therapy It is still uncertain how long anti-PD-1 therapy should continue to be administered to melanoma patients after they have achieved a good response. To resolve this issue, it is necessary to know how long a durable response will continue after the discontinuation of anti-PD-1 therapy. Few studies have focused on this topic (11,82–85). In the 67 patients who achieved a CR and discontinued pembrolizumab (KEYNOTE-001 study), the 2-year disease-free survival rate from CR was 89.9% (82). In the KEYNOTE-006 study, 21 melanoma patients with a CR had discontinued pembrolizumab after 24 months, and another group of 23 patients had discontinued pembrolizumab after receiving pembrolizumab for ≥6 to <24 months. The 2-year PFS rate for the first group was 85.4%, and that for the second group was 86.4% (11). In a real-world cohort study by Jansen et al., 117 melanoma patients achieved a CR and discontinued anti-PD-1 therapy in the absence of tumor progression or toxicity. Sixteen patients (14%) had recurrent disease after a median follow-up of 18 months. The risk of recurrence was significantly higher in the patients who were treated for <6 months (84). These studies indicated that majority of patients who had achieved a CR had good outcomes even if the treatment had been discontinued. Moreover, results from the studies suggested that a patient must be treated for at least 6 months before stopping treatment. However, further clinical studies with longer observation times are needed to test this hypothesis. Additionally, Jansen et al. also reported that for patients who relapsed after stopping treatment following a CR, ORR of re-challenge with anti–PD-1 therapy was 44% (4/9) (84). At the time of progression, rechallenge with an anti-PD-1 should be considered. Talimogene laherparepvec (T-VEC) Talimogene laherparepvec (T-VEC) is an oncolytic viral therapy based on the herpes simplex type 1 virus. It was approved by the FDA in 2015 as an intralesional therapy for advanced melanoma. It has not been approved for use in Japan. In a phase III randomized trial comparing the efficacy of T-VEC with that of granulocyte-macrophage colony-stimulating factor (GM-CSF) in 436 patients with unresectable stage IIIB, IIIC or IVM1a melanoma, the treatment with T-VEC significantly improved and extended the treatment responses compared with GM-CSF (86,87). More recently, final analyses of that study showed that the ORRs for the T-VEC and GM-CSF groups were 31.5 and 6.4%, respectively. A CR was achieved by 16.9% of the patients treated with T-VEC and 0.7% of those treated with GM-CSF. The disease control rates were 76.3% in the T-VEC group and 56.7% in the GM-CSF group. The median OS was 23.3 months for the T-VEC-treated patients and 18.9 months for the GM-CSF-treated patients. In subgroup analyses, patients with early-stage IIIB and IIIC melanomas were more likely to respond to T-VEC compared with the stage IVM1a patients, and treatment-related grade 3/4 AEs occurred in 11.3% of the T-VEC-treated patients and 4.7% of the GM-CSF-treated patients (87). Additionally, in a real-world retrospective study of 80 stage IIIB-D and IV melanoma patients treated with T-VEC monotherapy for ≥3 months, Louie et al. examined the efficacy of the therapy. The median follow-up for the patients was 9 months. A CR was observed in 39% (31/80) and a partial response was observed in 18% (14/80) of the patients (88). Conclusions Immunotherapy for advanced cutaneous melanoma has greatly improved, but the same cannot be said for acral, mucosal and uveal melanomas. Particularly in Japan, there are many treatment opportunities for these subtypes, yet we need to find new therapeutic approaches. Many issues remain to be resolved regarding immunotherapy for melanoma. For the patients who have achieved a good response, it is still not known how long anti-PD-1 therapy should be administered. Further investigations with longer observations are needed to explore this and other issues. Conflict of interest statement Junji Kato has no conflicts of interest. Hisashi Uhara received honoraria from Bristol-Myers Squibb Japan, Novartis and Ono Pharmaceutical. References 1. https://www.nccn.org/professionals/physician_gls/pdf/cutaneous_melanoma.pdf ( 16 June 2020, date last accessed ). 2. Seth R , Messersmith H, Kaur V et al. Systemic therapy for melanoma: ASCO guideline . J Clin Oncol 2020 ; Jco2000198 . doi: 10.1200/JCO.20.00198 . Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat Crossref 3. Michielin O , van Akkooi ACJ, Ascierto PA, Dummer R, Keilholz U. Cutaneous melanoma: ESMO clinical practice guidelines for diagnosis, treatment and follow-updagger . Ann Oncol 2019 ; 30 : 1884 – 901 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Nakamura Y , Asai J, Igaki H et al. Japanese dermatological association guidelines: outlines of guidelines for cutaneous melanoma 2019 . J Dermatol 2020 ; 47 : 89 – 103 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Robert C , Thomas L, Bondarenko I et al. Ipilimumab plus dacarbazine for previously untreated metastatic melanoma . N Engl J Med 2011 ; 364 : 2517 – 26 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Schadendorf D , Hodi FS, Robert C et al. Pooled analysis of long-term survival data from phase II and phase III trials of ipilimumab in unresectable or metastatic melanoma . J Clin Oncol 2015 ; 33 : 1889 – 94 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Yamazaki N , Kiyohara Y, Uhara H et al. Phase II study of ipilimumab monotherapy in Japanese patients with advanced melanoma . Cancer Chemother Pharmacol 2015 ; 76 : 997 – 1004 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Yamazaki N , Kiyohara Y, Uhara H et al. Real-world safety and efficacy data of ipilimumab in Japanese radically unresectable malignant melanoma patients: a postmarketing surveillance . J Dermatol 2020 . https://doi.org/10.1111/1346-8138.15388. Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat 9. Larkin J , Hodi FS, Wolchok JD. Combined nivolumab and ipilimumab or monotherapy in untreated melanoma . N Engl J Med 2015 ; 373 : 1270 – 1 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Schachter J , Ribas A, Long GV et al. Pembrolizumab versus ipilimumab for advanced melanoma: final overall survival results of a multicentre, randomised, open-label phase 3 study (KEYNOTE-006) . Lancet 2017 ; 390 : 1853 – 62 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Robert C , Ribas A, Schachter J et al. Pembrolizumab versus ipilimumab in advanced melanoma (KEYNOTE-006): post-hoc 5-year results from an open-label, multicentre, randomised, controlled, phase 3 study . Lancet Oncol 2019 ; 20 : 1239 – 51 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Bowyer S , Prithviraj P, Lorigan P et al. Efficacy and toxicity of treatment with the anti-CTLA-4 antibody ipilimumab in patients with metastatic melanoma after prior anti-PD-1 therapy . Br J Cancer 2016 ; 114 : 1084 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Zimmer L , Apuri S, Eroglu Z et al. Ipilimumab alone or in combination with nivolumab after progression on anti-PD-1 therapy in advanced melanoma . Eur J Cancer 2017 ; 75 : 47 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Fujisawa Y , Yoshino K, Otsuka A et al. Retrospective study of advanced melanoma patients treated with ipilimumab after nivolumab: analysis of 60 Japanese patients . J Dermatol Sci 2018 ; 89 : 60 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Tsutsumida A , Fukushima S, Yokota K et al. Japanese real-world study of sequential nivolumab and ipilimumab treament in melanoma . J Dermatol 2019 ; 46 : 947 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Cybulska-Stopa B , Rogala P, Czarnecka AM et al. Efficacy of ipilimumab after anti-PD-1 therapy in sequential treatment of metastatic melanoma patients - real world evidence . Adv Med Sci 2020 ; 65 : 316 – 23 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Yamazaki N , Kiyohara Y, Uhara H et al. Cytokine biomarkers to predict antitumor responses to nivolumab suggested in a phase 2 study for advanced melanoma . Cancer Sci 2017 ; 108 : 1022 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Yamazaki N , Kiyohara Y, Uhara H et al. Long-term follow up of nivolumab in previously untreated Japanese patients with advanced or recurrent malignant melanoma . Cancer Sci 2019 ; 110 : 1995 – 2003 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Kiyohara Y , Uhara H, Ito Y, Matsumoto N, Tsuchida T, Yamazaki N. Safety and efficacy of nivolumab in Japanese patients with malignant melanoma: an interim analysis of a postmarketing surveillance . J Dermatol 2018 ; 45 : 408 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Larkin J , Chiarion-Sileni V, Gonzalez R et al. Five-year survival with combined nivolumab and ipilimumab in advanced melanoma . N Engl J Med 2019 ; 381 : 1535 – 46 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Hamid O , Robert C, Daud A et al. Five-year survival outcomes for patients with advanced melanoma treated with pembrolizumab in KEYNOTE-001 . Ann Oncol 2019 ; 30 : 582 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Wolchok JD , Chiarion-Sileni V, Gonzalez R et al. Overall survival with combined nivolumab and ipilimumab in advanced melanoma . N Engl J Med 2017 ; 377 : 1345 – 56 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Namikawa K , Kiyohara Y, Takenouchi T et al. Efficacy and safety of nivolumab in combination with ipilimumab in Japanese patients with advanced melanoma: an open-label, single-arm, multicentre phase II study . Eur J Cancer 2018 ; 105 : 114 – 26 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Lebbé C , Meyer N, Mortier L et al. Evaluation of two dosing regimens for nivolumab in combination with ipilimumab in patients with advanced melanoma: results from the phase IIIb/IV CheckMate 511 trial . J Clin Oncol 2019 ; 37 : 867 – 75 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Long GV , Atkinson V, Cebon JS et al. Standard-dose pembrolizumab in combination with reduced-dose ipilimumab for patients with advanced melanoma (KEYNOTE-029): an open-label, phase 1b trial . Lancet Oncol 2017 ; 18 : 1202 – 10 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Fujisawa Y , Yoshikawa S, Minagawa A et al. Clinical and histopathological characteristics and survival analysis of 4594 Japanese patients with melanoma . Cancer Med 2019 ; 8 : 2146 – 56 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Postow MA , Luke JJ, Bluth MJ et al. Ipilimumab for patients with advanced mucosal melanoma . Oncologist 2013 ; 18 : 726 – 32 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Nathan P , Ascierto PA, Haanen J et al. Safety and efficacy of nivolumab in patients with rare melanoma subtypes who progressed on or after ipilimumab treatment: a single-arm, open-label, phase II study (CheckMate 172) . Eur J Cancer 2019 ; 119 : 168 – 78 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Shoushtari AN , Munhoz RR, Kuk D et al. The efficacy of anti-PD-1 agents in acral and mucosal melanoma . Cancer 2016 ; 122 : 3354 – 62 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Takahashi A , Tsutsumida A, Namikawa K, Nakamura Y, Muto I, Yamazaki N. The efficacy of nivolumab for unresectable metastatic mucosal melanoma . Ann Oncol 2016 ; 27 : vi383 . Google Scholar Crossref Search ADS WorldCat 31. D'Angelo SP , Larkin J, Sosman JA et al. Efficacy and safety of nivolumab alone or in combination with ipilimumab in patients with mucosal melanoma: a pooled analysis . J Clin Oncol 2017 ; 35 : 226 – 35 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Hamid O , Robert C, Ribas A et al. Antitumour activity of pembrolizumab in advanced mucosal melanoma: a post-hoc analysis of KEYNOTE-001, 002, 006 . Br J Cancer 2018 ; 119 : 670 – 4 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Mignard C , Deschamps Huvier A, Gillibert A et al. Efficacy of immunotherapy in patients with metastatic mucosal or uveal melanoma . J Oncol 2018 ; 2018 :1908065. Google Scholar OpenURL Placeholder Text WorldCat 34. Moya-Plana A , Herrera Gómez RG, Rossoni C et al. Evaluation of the efficacy of immunotherapy for non-resectable mucosal melanoma . Cancer Immunol Immunother 2019 ; 68 : 1171 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Si L , Zhang X, Shu Y et al. A phase Ib study of pembrolizumab as second-line therapy for Chinese patients with advanced or metastatic melanoma (KEYNOTE-151) . Transl Oncol 2019 ; 12 : 828 – 35 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Maeda T , Yoshino K, Nagai K et al. Efficacy of nivolumab monotherapy against acral lentiginous melanoma and mucosal melanoma in Asian patients . Br J Dermatol 2019 ; 180 : 1230 – 1 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Shoushtari AN , Bao R, Luke JJ. PD-1 blockade in Chinese versus western patients with melanoma . Clin Cancer Res 2020 . doi: 10.1158/1078-0432.CCR-20-1558 . Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat Crossref 38. Kondo T , Nomura M, Otsuka A et al. Predicting marker for early progression in unresectable melanoma treated with nivolumab . Int J Clin Oncol 2019 ; 24 : 323 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Otsuka M , Sugihara S, Mori S et al. Immune-related adverse events correlate with improved survival in patients with advanced mucosal melanoma treated with nivolumab: a single-center retrospective study in Japan . J Dermatol 2020 ; 47 : 356 – 62 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Nomura M , Oze I, Masuishi T et al. Multicenter prospective phase II trial of nivolumab in patients with unresectable or metastatic mucosal melanoma . Int J Clin Oncol 2020 ; 25 : 972 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Nakamura Y , Namikawa K, Yoshino K et al. Anti-PD1 checkpoint inhibitor therapy in acral melanoma: a multicentre study of 193 Japanese patients . Ann Oncol 2020 . https://doi.org/10.1016/j.annonc.2020.05.031. Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat 42. Snyder A , Makarov V, Merghoub T et al. Genetic basis for clinical response to CTLA-4 blockade in melanoma . N Engl J Med 2014 ; 371 : 2189 – 99 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Tumeh PC , Harview CL, Yearley JH et al. PD-1 blockade induces responses by inhibiting adaptive immune resistance . Nature 2014 ; 515 : 568 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Carlino MS , Long GV, Schadendorf D et al. Outcomes by line of therapy and programmed death ligand 1 expression in patients with advanced melanoma treated with pembrolizumab or ipilimumab in KEYNOTE-006: a randomised clinical trial . Eur J Cancer 2018 ; 101 : 236 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Rizvi NA , Hellmann MD, Snyder A et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer . Science 2015 ; 348 : 124 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Le DT , Durham JN, Smith KN et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade . Science 2017 ; 357 : 409 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Le DT , Uram JN, Wang H et al. PD-1 blockade in tumors with mismatch-repair deficiency . N Engl J Med 2015 ; 372 : 2509 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat 48. Hayward NK , Wilmott JS, Waddell N et al. Whole-genome landscapes of major melanoma subtypes . Nature 2017 ; 545 : 175 – 80 . Google Scholar Crossref Search ADS PubMed WorldCat 49. Nakamura Y , Ishitsuka Y, Tanaka R et al. Acral lentiginous melanoma and mucosal melanoma expressed less programmed-death 1 ligand than cutaneous melanoma: a retrospective study of 73 Japanese melanoma patients . J Eur Acad Dermatol Venereol 2019 ; 33 : e424 – e6 . Google Scholar Crossref Search ADS PubMed WorldCat 50. Castaneda CA , Torres-Cabala C, Castillo M et al. Tumor infiltrating lymphocytes in acral lentiginous melanoma: a study of a large cohort of cases from Latin America . Clin Transl Oncol 2017 ; 19 : 1478 – 88 . Google Scholar Crossref Search ADS PubMed WorldCat 51. Ascierto PA , Accorona R, Botti G et al. Mucosal melanoma of the head and neck . Crit Rev Oncol Hematol 2017 ; 112 : 136 – 52 . Google Scholar Crossref Search ADS PubMed WorldCat 52. Royer-Bertrand B , Torsello M, Rimoldi D et al. Comprehensive genetic landscape of uveal melanoma by whole-genome sequencing . Am J Hum Genet 2016 ; 99 : 1190 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 53. Klemen ND , Wang M, Rubinstein JC et al. Survival after checkpoint inhibitors for metastatic acral, mucosal and uveal melanoma . J Immunother Cancer 2020 ; 8 . doi: 10.1136/jitc-2019-000341 . Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat Crossref 54. van der Kooij MK , Joosse A, Speetjens FM et al. Anti-PD1 treatment in metastatic uveal melanoma in the Netherlands . Acta Oncol 2017 ; 56 : 101 – 3 . Google Scholar Crossref Search ADS PubMed WorldCat 55. Karydis I , Chan PY, Wheater M, Arriola E, Szlosarek PW, Ottensmeier CH. Clinical activity and safety of Pembrolizumab in Ipilimumab pre-treated patients with uveal melanoma . Onco Targets Ther 2016 ; 5 :e1143997. Google Scholar OpenURL Placeholder Text WorldCat 56. Rossi E , Pagliara MM, Orteschi D et al. Pembrolizumab as first-line treatment for metastatic uveal melanoma . Cancer Immunol Immunother 2019 ; 68 : 1179 – 85 . Google Scholar Crossref Search ADS PubMed WorldCat 57. Namikawa K , Takahashi A, Mori T et al. Nivolumab for patients with metastatic uveal melanoma previously untreated with ipilimumab: a single-institution retrospective study . Melanoma Res 2020 ; 30 : 76 – 84 . Google Scholar Crossref Search ADS PubMed WorldCat 58. Zimmer L , Vaubel J, Mohr P et al. Phase II DeCOG-study of ipilimumab in pretreated and treatment-naïve patients with metastatic uveal melanoma . PLoS One 2015 ; 10 :e0118564. Google Scholar OpenURL Placeholder Text WorldCat 59. Algazi AP , Tsai KK, Shoushtari AN et al. Clinical outcomes in metastatic uveal melanoma treated with PD-1 and PD-L1 antibodies . Cancer 2016 ; 122 : 3344 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat 60. Heppt MV , Heinzerling L, Kähler KC et al. Prognostic factors and outcomes in metastatic uveal melanoma treated with programmed cell death-1 or combined PD-1/cytotoxic T-lymphocyte antigen-4 inhibition . Eur J Cancer 2017 ; 82 : 56 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 61. Heppt MV , Amaral T, Kähler KC et al. Combined immune checkpoint blockade for metastatic uveal melanoma: a retrospective, multi-center study . J Immunother Cancer 2019 ; 7 :299. Google Scholar OpenURL Placeholder Text WorldCat 62. Piulats Rodriguez JM , De La Cruz Merino L, Espinosa E et al. Phase II multicenter, single arm, open label study of nivolumab in combination with ipilimumab in untreated patients with metastatic uveal melanoma (GEM1402.NCT02626962) . Ann Oncol 2018 ; 29 : vi443 . Google Scholar Crossref Search ADS WorldCat 63. Pelster M , Gruschkus SK, Bassett R et al. Phase II study of ipilimumab and nivolumab (ipi/nivo) in metastatic uveal melanoma (UM) . J Clin Oncol 2019 ; 37 : 9522 . Google Scholar Crossref Search ADS WorldCat 64. Najjar YG , Navrazhina K, Ding F et al. Ipilimumab plus nivolumab for patients with metastatic uveal melanoma: a multicenter, retrospective study . J Immunother Cancer 2020 ; 8 . doi: 10.1136/jitc-2019-000331 . Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat Crossref 65. Gershenwald JE , Scolyer RA, Hess KR et al. Melanoma staging: evidence-based changes in the American joint committee on cancer eighth edition cancer staging manual . CA Cancer J Clin 2017 ; 67 : 472 – 92 . Google Scholar Crossref Search ADS PubMed WorldCat 66. Goldberg SB , Gettinger SN, Mahajan A et al. Pembrolizumab for patients with melanoma or non-small-cell lung cancer and untreated brain metastases: early analysis of a non-randomised, open-label, phase 2 trial . Lancet Oncol 2016 ; 17 : 976 – 83 . Google Scholar Crossref Search ADS PubMed WorldCat 67. Kluger HM , Chiang V, Mahajan A et al. Long-term survival of patients with melanoma with active brain metastases treated with pembrolizumab on a phase II trial . J Clin Oncol 2019 ; 37 : 52 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat 68. Long GV , Atkinson V, Lo S et al. Combination nivolumab and ipilimumab or nivolumab alone in melanoma brain metastases: a multicentre randomised phase 2 study . Lancet Oncol 2018 ; 19 : 672 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat 69. Tawbi HA , Forsyth PA, Algazi A et al. Combined nivolumab and ipilimumab in melanoma metastatic to the brain . N Engl J Med 2018 ; 379 : 722 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 70. Kiess AP , Wolchok JD, Barker CA et al. Stereotactic radiosurgery for melanoma brain metastases in patients receiving ipilimumab: safety profile and efficacy of combined treatment . Int J Radiat Oncol Biol Phys 2015 ; 92 : 368 – 75 . Google Scholar Crossref Search ADS PubMed WorldCat 71. Qian JM , Yu JB, Kluger HM, Chiang VL. Timing and type of immune checkpoint therapy affect the early radiographic response of melanoma brain metastases to stereotactic radiosurgery . Cancer 2016 ; 122 : 3051 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 72. Tétu P , Allayous C, Oriano B et al. Impact of radiotherapy administered simultaneously with systemic treatment in patients with melanoma brain metastases within MelBase, a French multicentric prospective cohort . Eur J Cancer 2019 ; 112 : 38 – 46 . Google Scholar Crossref Search ADS PubMed WorldCat 73. Amaral T , Kiecker F, Schaefer S et al. Combined immunotherapy with nivolumab and ipilimumab with and without local therapy in patients with melanoma brain metastasis: a DeCOG* study in 380 patients . J Immunother Cancer 2020 ; 8 . Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat 74. Carron R , Gaudy-Marqueste C, Amatore F et al. Stereotactic radiosurgery combined with anti-PD1 for the management of melanoma brain metastases: a retrospective study of safety and efficacy . Eur J Cancer 2020 ; 135 : 52 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 75. Eggermont AMM , Chiarion-Sileni V, Grob JJ et al. Adjuvant ipilimumab versus placebo after complete resection of stage III melanoma: Long-term follow-up results of the European Organisation for Research and Treatment of Cancer 18071 double-blind phase 3 randomised trial . Eur J Cancer 2019 ; 119 : 1 – 10 . Google Scholar Crossref Search ADS PubMed WorldCat 76. Weber JS , Del Vecchio M, Mandala M et al. Adjuvant nivolumab (NIVO) versus ipilimumab (IPI) in resected stage III/IV melanoma: 3-year efficacy and biomarker results from the phase III CheckMate 238 trial . Ann Oncol 2019 ; 30 : v533 – 63 . Google Scholar Crossref Search ADS WorldCat 77. Eggermont AMM , Blank CU, Mandala M et al. Adjuvant pembrolizumab versus placebo in resected stage III melanoma . N Engl J Med 2018 ; 378 : 1789 – 801 . Google Scholar Crossref Search ADS PubMed WorldCat 78. Eggermont AM , Chiarion-Sileni V, Grob JJ et al. Prolonged survival in stage III melanoma with ipilimumab adjuvant therapy . N Engl J Med 2016 ; 375 : 1845 – 55 . Google Scholar Crossref Search ADS PubMed WorldCat 79. Yokota K , Uchi H, Uhara H et al. Adjuvant therapy with nivolumab versus ipilimumab after complete resection of stage III/IV melanoma: Japanese subgroup analysis from the phase 3 CheckMate 238 study . J Dermatol 2019 ; 46 : 1197 – 201 . Google Scholar Crossref Search ADS PubMed WorldCat 80. Eggermont AM , Blank CU, Mandalà M et al. Pembrolizumab versus placebo after complete resection of high-risk stage III melanoma: new recurrence-free survival results from the EORTC 1325-MG/Keynote 054 double-blinded phase III trial at three-year median follow-up . J Clin Oncol 2020 ; 38 :10000. Google Scholar OpenURL Placeholder Text WorldCat 81. Owen CN , Shoushtari AN, Chauhan D et al. Management of early melanoma recurrence despite adjuvant anti-PD-1 antibody therapy . Ann Oncol 2020 . https://doi.org/10.1016/j.annonc.2020.04.471. Online ahead of print. Google Scholar OpenURL Placeholder Text WorldCat 82. Robert C , Ribas A, Hamid O et al. Durable complete response after discontinuation of pembrolizumab in patients with metastatic melanoma . J Clin Oncol 2018 ; 36 : 1668 – 74 . Google Scholar Crossref Search ADS PubMed WorldCat 83. Ladwa R , Atkinson V. The cessation of anti-PD-1 antibodies of complete responders in metastatic melanoma . Melanoma Res 2017 ; 27 : 168 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat 84. Jansen YJL , Rozeman EA, Mason R et al. Discontinuation of anti-PD-1 antibody therapy in the absence of disease progression or treatment limiting toxicity: clinical outcomes in advanced melanoma . Ann Oncol 2019 ; 30 : 1154 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 85. Handa T , Kato J, Sumikawa Y et al. Durable response after cessation of anti-programmed death 1 therapy in four melanoma patients . J Dermatol 2019 ; 46 : e461 – e2 . Google Scholar Crossref Search ADS PubMed WorldCat 86. Andtbacka RH , Kaufman HL, Collichio F et al. Talimogene laherparepvec improves durable response rate in patients with advanced melanoma . J Clin Oncol 2015 ; 33 : 2780 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 87. Andtbacka RHI , Collichio F, Harrington KJ et al. Final analyses of OPTiM: a randomized phase III trial of talimogene laherparepvec versus granulocyte-macrophage colony-stimulating factor in unresectable stage III-IV melanoma . J Immunother Cancer 2019 ; 7 :145. Google Scholar OpenURL Placeholder Text WorldCat 88. Louie RJ , Perez MC, Jajja MR et al. Real-world outcomes of talimogene laherparepvec therapy: a multi-institutional experience . J Am Coll Surg 2019 ; 228 : 644 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Hirano,, Hidekazu;Takashima,, Atsuo;Hamaguchi,, Tetsuya;Shida,, Dai;Kanemitsu,, Yukihide;the Colorectal Cancer Study Group (CCSG) of the Japan Clinical Oncology Group, (JCOG)

doi: 10.1093/jjco/hyaa200pmid: 33205813

Abstract Immunotherapy, especially immune checkpoint inhibitors, has revolutionized the standard-of-care of multiple types of tumors. For colorectal cancer, the clinical development of immune checkpoint inhibitors is mainly separated according to the status of microsatellite instability or mismatch repair in a tumor. High-level microsatellite instability/deficient mismatch repair metastatic colorectal cancer generally has a tumor microenvironment with infiltration of T cells, associated with a favorable response to immune checkpoint inhibitors. Immune checkpoint inhibitors, including pembrolizumab (anti-PD-1 inhibitor) and nivolumab (anti-PD-1 inhibitor) with or without ipilimumab (anti-CTLA-4 inhibitor), have been integrated into the standard-of-care for high-level microsatellite instability/deficient mismatch repair metastatic colorectal cancer. Conversely, limited T-cell infiltration in the tumor microenvironment of microsatellite stable/proficient mismatch repair metastatic colorectal cancer, which constitutes the majority of metastatic colorectal cancer, is assumed to be a major resistant mechanism to immune checkpoint inhibitors. Currently, clinical trials to improve the clinical activity of immune checkpoint inhibitors by immunomodulation are ongoing for metastatic colorectal cancer. Furthermore, immune checkpoint inhibitors are under development in neoadjuvant and/or adjuvant setting. Here, we review the existing clinical data with ongoing trials and discuss the future perspectives with a focus on the immunotherapy of colorectal cancer. immunotherapy, colorectal cancer, microsatellite instability, mismatch repair, molecular targeting agent, radiotherapy Introduction Colorectal cancer (CRC) is ranked as the third most common cancer and is the second leading cause of cancer-related mortality worldwide (1). Despite recent advances in therapeutic agents including molecular targeting agents [e.g. bevacizumab for vascular endothelial growth factor-A (VEGF-A), cetuximab for epidermal growth factor receptor (EGFR), encorafenib for v-raf murine sarcoma viral oncogene homolog B1 (BRAF)], the prognosis of patients with metastatic CRC (mCRC) remains poor. Therefore, new effective therapies are warranted for this malignancy. In recent years, there has been significant progress in the development of immune checkpoint inhibitors (ICIs) that promote the anti-tumor activity of T cells by inhibiting immune checkpoints such as programmed death 1 (PD-1) and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4). ICIs targeting PD-1 and CTLA-4 have transformed the landscape of treatment of various types of cancers, including non-small cell lung cancer, melanoma and gastric cancer. Microsatellite instability (MSI) or mismatch repair (MMR) in tumors has been established as a striking biomarker for response to ICIs, regardless of the primary site (2). High-level MSI/deficient MMR (MSI-H/dMMR) is correlated with the synthesis of cancer neoantigens by increased tumor mutation burden (TMB) and is associated with the increased infiltration of T cells in the tumor microenvironment (3–5). These unique characteristics are considered to induce robust anti-tumor immune response. Pembrolizumab (anti-PD-1 inhibitor) was the first histology-independent drug approval for the MSI-high tumors, including mCRC, by the US Food and Drug Administration (FDA). In CRC, the frequency of MSI-H differs according to cancer stage. Approximately 12–16% of stages I–III CRC have MSI-H/dMMR tumor; however, MSI-H/dMMR CRC only comprises around 4% of stage IV CRC (6,7). In contrast to the striking activity of ICIs in MSI-H/dMMR mCRC, the majority (96%) of mCRC have microsatellite stable/proficient MMR (MSS/pMMR) disease associated with a poor response to ICIs. Such poor response can be explained by the immune-exclusive tumor microenvironment, which is associated with WNT signaling upregulation and poor antigenicity due to low TMB (4,5,8,9). The clinical development of effective immunotherapy is urgently required for this population. Currently, many studies are investigating the use of combinations of ICIs with other drugs such as molecular targeting agents, aiming to transform the immune-exclusive tumor microenvironment of MSS/pMMR tumor. In this review, we discuss recent clinical developments according to MSI/MMR status and the future perspectives of ICIs for targeting CRC. Immunotherapy for MSI-H/dMMR mCRC Immunotherapy using pembrolizumab or nivolumab (anti-PD-1 inhibitor) with or without ipilimumab (anti-CTLA-4 inhibitor) has shown substantial anti-tumor activity in clinical trials for MSI-H/dMMR mCRC, leading to an integration of these agents into the standard-of-care treatment. In Table 1, we summarized the selected clinical trial data of ICIs in MSI-H/dMMR mCRC. Table 1 Selected clinical trial data of immune checkpoint inhibitors in MSI-H/dMMR metastatic CRC Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 40 MSI-H: 40 52% Median PFS: NR 2-year PFS: 59% Median OS: NR 2-year OS: 72% (2) Pembrolizumab (KEYNOTE-164) PD-1 2 Cohort A: ≥2 Cohort B: ≥1 61 MSI-H/dMMR: 61 63 MSI-H/dMMR: 63 33% 33% Median PFS: 2.3 months 1-year PFS: 34% 2-year PFS: 31% Median PFS: 4.1 months 1-year PFS: 41% 2-year PFS: 37% Median OS: 31.4 months 1-year OS: 72% 2-year OS: 55% Median OS: NR 1-year OS: 76% 2-year OS: 63% (10) Nivolumab (CheckMate 142) PD-1 2 ≥1 74 MSI-H/dMMR: 74 31% Median PFS: 14.3 months 12-month PFS: 50% Median OS: NR 12-month OS: 73% (11) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥1 119 MSI-H/dMMR: 119 55% Median PFS: NR 9-month PFS: 76% 12-month PFS: 71% Median OS: NR 9-month OS: 87% 12-month OS: 85% (12) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 0 45 MSI-H/dMMR: 45 69% Median PFS: NR 24-month PFS: 74% Median OS: NR 12-month OS: 79% (13) Pembrolizumab versus Chemotherapy (KEYNOTE-177) PD-1 3 0 153 MSI-H/dMMR: 153 versus 154 MSI-H/dMMR: 154 43.8% versus 33.1% Median PFS: 16.5 months versus Median PFS 8.2 months HR = 0.60 (P = 0.0002) 12-month PFS: 55% 24-month PFS: 48% versus 12-month PFS: 37% 24-month PFS: 19% Not reported (14) Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 40 MSI-H: 40 52% Median PFS: NR 2-year PFS: 59% Median OS: NR 2-year OS: 72% (2) Pembrolizumab (KEYNOTE-164) PD-1 2 Cohort A: ≥2 Cohort B: ≥1 61 MSI-H/dMMR: 61 63 MSI-H/dMMR: 63 33% 33% Median PFS: 2.3 months 1-year PFS: 34% 2-year PFS: 31% Median PFS: 4.1 months 1-year PFS: 41% 2-year PFS: 37% Median OS: 31.4 months 1-year OS: 72% 2-year OS: 55% Median OS: NR 1-year OS: 76% 2-year OS: 63% (10) Nivolumab (CheckMate 142) PD-1 2 ≥1 74 MSI-H/dMMR: 74 31% Median PFS: 14.3 months 12-month PFS: 50% Median OS: NR 12-month OS: 73% (11) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥1 119 MSI-H/dMMR: 119 55% Median PFS: NR 9-month PFS: 76% 12-month PFS: 71% Median OS: NR 9-month OS: 87% 12-month OS: 85% (12) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 0 45 MSI-H/dMMR: 45 69% Median PFS: NR 24-month PFS: 74% Median OS: NR 12-month OS: 79% (13) Pembrolizumab versus Chemotherapy (KEYNOTE-177) PD-1 3 0 153 MSI-H/dMMR: 153 versus 154 MSI-H/dMMR: 154 43.8% versus 33.1% Median PFS: 16.5 months versus Median PFS 8.2 months HR = 0.60 (P = 0.0002) 12-month PFS: 55% 24-month PFS: 48% versus 12-month PFS: 37% 24-month PFS: 19% Not reported (14) MSI-H, microsatellite instability-high; dMMR, deficient mismatch repair; CRC, colorectal cancer; PD-1, programmed death 1; PFS, progression-free survival; OS, overall survival; NR, not reached; CTLA-4, cytotoxic T lymphocyte antigen 4; HR, hazard ratio. Open in new tab Table 1 Selected clinical trial data of immune checkpoint inhibitors in MSI-H/dMMR metastatic CRC Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 40 MSI-H: 40 52% Median PFS: NR 2-year PFS: 59% Median OS: NR 2-year OS: 72% (2) Pembrolizumab (KEYNOTE-164) PD-1 2 Cohort A: ≥2 Cohort B: ≥1 61 MSI-H/dMMR: 61 63 MSI-H/dMMR: 63 33% 33% Median PFS: 2.3 months 1-year PFS: 34% 2-year PFS: 31% Median PFS: 4.1 months 1-year PFS: 41% 2-year PFS: 37% Median OS: 31.4 months 1-year OS: 72% 2-year OS: 55% Median OS: NR 1-year OS: 76% 2-year OS: 63% (10) Nivolumab (CheckMate 142) PD-1 2 ≥1 74 MSI-H/dMMR: 74 31% Median PFS: 14.3 months 12-month PFS: 50% Median OS: NR 12-month OS: 73% (11) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥1 119 MSI-H/dMMR: 119 55% Median PFS: NR 9-month PFS: 76% 12-month PFS: 71% Median OS: NR 9-month OS: 87% 12-month OS: 85% (12) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 0 45 MSI-H/dMMR: 45 69% Median PFS: NR 24-month PFS: 74% Median OS: NR 12-month OS: 79% (13) Pembrolizumab versus Chemotherapy (KEYNOTE-177) PD-1 3 0 153 MSI-H/dMMR: 153 versus 154 MSI-H/dMMR: 154 43.8% versus 33.1% Median PFS: 16.5 months versus Median PFS 8.2 months HR = 0.60 (P = 0.0002) 12-month PFS: 55% 24-month PFS: 48% versus 12-month PFS: 37% 24-month PFS: 19% Not reported (14) Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 40 MSI-H: 40 52% Median PFS: NR 2-year PFS: 59% Median OS: NR 2-year OS: 72% (2) Pembrolizumab (KEYNOTE-164) PD-1 2 Cohort A: ≥2 Cohort B: ≥1 61 MSI-H/dMMR: 61 63 MSI-H/dMMR: 63 33% 33% Median PFS: 2.3 months 1-year PFS: 34% 2-year PFS: 31% Median PFS: 4.1 months 1-year PFS: 41% 2-year PFS: 37% Median OS: 31.4 months 1-year OS: 72% 2-year OS: 55% Median OS: NR 1-year OS: 76% 2-year OS: 63% (10) Nivolumab (CheckMate 142) PD-1 2 ≥1 74 MSI-H/dMMR: 74 31% Median PFS: 14.3 months 12-month PFS: 50% Median OS: NR 12-month OS: 73% (11) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥1 119 MSI-H/dMMR: 119 55% Median PFS: NR 9-month PFS: 76% 12-month PFS: 71% Median OS: NR 9-month OS: 87% 12-month OS: 85% (12) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 0 45 MSI-H/dMMR: 45 69% Median PFS: NR 24-month PFS: 74% Median OS: NR 12-month OS: 79% (13) Pembrolizumab versus Chemotherapy (KEYNOTE-177) PD-1 3 0 153 MSI-H/dMMR: 153 versus 154 MSI-H/dMMR: 154 43.8% versus 33.1% Median PFS: 16.5 months versus Median PFS 8.2 months HR = 0.60 (P = 0.0002) 12-month PFS: 55% 24-month PFS: 48% versus 12-month PFS: 37% 24-month PFS: 19% Not reported (14) MSI-H, microsatellite instability-high; dMMR, deficient mismatch repair; CRC, colorectal cancer; PD-1, programmed death 1; PFS, progression-free survival; OS, overall survival; NR, not reached; CTLA-4, cytotoxic T lymphocyte antigen 4; HR, hazard ratio. Open in new tab KEYNOTE-016 was a multicenter phase 2 investigator-initiated trial that evaluated the clinical activity of pembrolizumab (10 mg/kg, every 2 weeks) in different cohorts of pretreated patients with mCRC [MSS mCRC (N = 18), MSI-H mCRC (N = 10)] (2,3). According to the results published in 2015, the overall response rate (ORR) was 40% in MSI-H mCRC and 0% in MSS mCRC (3). An updated publication of this study, including 40 patients with MSI-H CRC, reported an ORR of 52%, a 2-year progression-free survival (PFS) rate of 59% and a 2-year overall survival (OS) rate of 72% (2). Furthermore, a significant correlation between somatic mutation loads and prolongation of PFS was found, supplementing the advantage of ICIs in MSI-H/dMMR CRC that tends to have a high TMB (3). KEYNOTE-164 consolidated the clinical activity of pembrolizumab in 124 patients with previously treated MSI-H/dMMR mCRC (10). In that study, pembrolizumab (200 mg/body, every 3 weeks) was administered and its efficacy was evaluated in two cohorts: patients treated with ≥2 prior lines of standard therapy (cohort A) and those treated with ≥1 prior line of therapy (cohort B). The ORR was 33% in both cohorts, the median PFS was 2.3 months in the cohort A and 4.1 months in the cohort B, and the median OS was 31.4 months in the cohort A and was not reached in the cohort B. Based on the integrated analysis of five trials (KEYNOTE-016, -164, -012, -028 and -158) that evaluated a total of 149 patients with MSI-H/dMMR tumors including 90 patients with mCRC, pembrolizumab was approved by the US FDA for MSI-H/dMMR solid tumors regardless of the primary tumor site on 13 May 2017. The clinical activity of nivolumab in MSI-H/dMMR mCRC treated with prior chemotherapy was shown in a nivolumab cohort in the CheckMate 142 trial (11). A total of 74 patients were treated with nivolumab (3 mg/kg, every 2 weeks) and the ORR was 31.1% by investigator assessment. The median PFS was 14.3 months with a 12-month PFS of 50% and the median OS was not reached. Nivolumab and low-dose ipilimumab demonstrated an encouraging result for MSI-H/dMMR mCRC in a cohort of CheckMate 142 (12,13). In the nivolumab and ipilimumab cohort including previously treated patients, 119 patients received nivolumab (3 mg/kg, every 3 weeks) plus ipilimumab (1 mg/kg, every 3 weeks) for 4 cycles followed by nivolumab (3 mg/kg, every 2 weeks). Most patients (76%) were pretreated with more than two lines of previous therapy. The ORR by investigator assessment was 55%. The median PFS was not reached with the 12-month PFS rate of 71%. The median OS was also not reached and the 12-month OS rate was 85%. With these encouraging results, nivolumab with or without ipilimumab was also approved by the US FDA for patients with previously treated MSI-H/dMMR mCRC (nivolumab on 31 July 2017; nivolumab plus ipilimumab on 10 July 2018). ICIs were also investigated in the first-line setting for MSI-H/dMMR mCRC. KEYNOTE-177, a randomized phase 3 trial, is underway to compare pembrolizumab (200 mg/body, every 3 weeks) versus standard chemotherapy [5-fluorouracil, leucovorin and oxaliplatin (FOLFOX) or 5-fluorouracil, leucovorin and irinotecan (FOLFIRI), with or without a molecular targeting agent (bevacizumab or cetuximab)] as first-line treatment in patients with MSI-H/dMMR mCRC. The first report of KEYNOTE-177 was presented at the American Society of Clinical Oncology (ASCO) 2020 Virtual Scientific Program (14). Of 307 patients, 153 patients received pembrolizumab and 154 patients received chemotherapy. The co-primary endpoints of this trial were PFS and OS. At the median follow-up duration of 32.4 months, the median PFS was significantly longer in the pembrolizumab group (16.5 months) versus in the chemotherapy group (8.2 months) [hazard ratio (HR) = 0.60, 95% confidence interval (CI) 0.45–0.80; P = 0.0002] and the PFS rates at 12 and 24 months were 55 and 48% in the pembrolizumab group and 37 and 19% in the chemotherapy group, respectively. The confirmed ORR was 43.8% with pembrolizumab and 33.1% with chemotherapy. On 29 June 2020, pembrolizumab was approved by US FDA for the first-line treatment of patients with MSI-H/dMMR mCRC. Furthermore, the combination of nivolumab and ipilimumab was evaluated in the untreated patient cohort in CheckMate 142 (13). Nivolumab (3 mg/kg, every 2 weeks) plus ipilimumab (1 mg/kg, every 6 weeks) was administered in 45 patients. At the median follow-up of 29.0 months, 31 of 45 patients (69%) had achieved an investigator-assessed objective response (the primary endpoint) with a complete response rate of 13% (6/45). The median PFS and OS were not reached, and the 12-month PFS rate was 74% and the 12-month OS rate was 79%. ICIs other than nivolumab and ipilimumab are also under clinical development for MSI-H/dMMR mCRC. Atezolizumab, which targets programmed death ligand-1 (PD-L1), in combination with bevacizumab was investigated in a phase 1b trial that enrolled 10 pretreated patients with dMMR mCRC based on a rationale of bevacizumab-induced immunomodulatory effects (15). The ORR and disease control rate were 40 and 90%, respectively. Currently, a phase 3 trial (COMMIT, NRG-GI004/SWOG-S1610) of mFOLFOX6 plus bevacizumab with or without atezolizumab or atezolizumab monotherapy as a first-line treatment in patients with dMMR CRC (NCT02997228) is underway. Other PD-L1 inhibitors, durvalumab and avelumab, have also demonstrated anti-tumor activity for MSI-H/dMMR mCRC in early phase trials (16,17). Those encouraging results lead to the approval of ICIs in the first-line or later-line settings for MSI-H/dMMR mCRC and investigations of new strategies using ICIs, indicating the importance of testing MSI/MMR status before the first-line treatment. Immunotherapy for MSS/pMMR mCRC In contrast to MSI-H/dMMR mCRC, the results of clinical trials using ICIs alone have been disappointing with no approved agents for MSS/pMMR mCRC to date. Pembrolizumab provided no objective response in a MSS mCRC cohort enrolled in KEYNOTE-016 (3). Nivolumab plus ipilimumab also conferred an objective response to only 1 patient in 20 patients with MSS/pMMR in the CheckMate 142 trial (18). Although tremelimumab (anti-CTLA-4 antibody) plus durvalumab (anti-PD-L1 antibody) showed a meaningful improvement of OS compared with best supportive care in a subset of patients with MSS mCRC in a randomized phase 2 trial (CO.26 Study), study design and missing results of MSI status in 11 patients allocated to the best supportive care group hampered the evaluation of true efficacy of immunotherapy (19). Aiming to transform ‘immune-cold’ tumors into ‘immune-hot’ tumors by using molecular targeting agents or radiotherapy, as suggested by preclinical studies, therapeutic strategies by combining those treatment with ICIs are eagerly under investigation to improve the anti-tumor effect of ICIs targeting MSS/pMMR CRC. In Table 2, we summarized the selected clinical trial data of ICIs in MSS/pMMR mCRC. Table 2 Selected clinical trial data of immune checkpoint inhibitors in mainly MSS/pMMR metastatic CRC Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 18 MSS: 18 0% Median PFS: 2.2 months Median OS: 5.0 months (3) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥2 10 MSS/pMMR: 10 (Nivo 1 mg/kg plus 3 mg/kg) 10 MSS/pMMR: 10 (Nivo 3 mg/kg plus 1 mg/kg) 10% 0% Median PFS: 2.28 months Median PFS: 1.31 months Median OS: 11.53 months Median OS: 3.73 months (18) Tremelimumab + durvalumab versus Best supportive care (CO.26) PD-L1 CTLA-4 r2 ≥2 119 MSI-H/: 1 (1%) MSS: 117 (98%) Unknown: 1 (1%) versus 61 MSI-H: 1 (2%) MSS: 117 (80%) Unknown: 1 (18%) DCR 23% versus 7% (P = 0.006) Median PFS: 1.8 months versus Median PFS 1.9 months HR = 1.01 (P = 0.97) Median OS: 6.6 months versus Median OS: 4.1 months HR = 0.72 (P = 0.07) (MSS subgroup) HR = 0.66 (P = 0.02) (19) Capecitabine + bevacizumab + atezolizumab versus Capecitabine + bevacizumab + placebo (BACCI) PD-L1 VEGF-A r2 ≥2 82 MSS/pMMR: 85.7% versus 46 MSS/pMMR: 86.7% 8.54% versus 4.35% (P = 0.5) Median PFS: 4.4 months versus Median PFS 3.3 months HR = 0.725 (P = 0.051) 12-month OS: 52% versus 12-month OS: 43% HR = 0.94 (P = 0.4) (23) Nivolumab + regorafenib (REGONIVO, EPOC1603) PD-1 VEGFR1/2/3 1b ≥2 25 MSI-H/dMMR: 1 (4%) MSS/pMMR: 24 (96%) 36% Median PFS: 7.9 months 1-year PFS: 41.8% Median OS: 12.3 months 1-year OS: 68.0% (24) Avelumab + regorafenib (REGOMUNE) PD-L1 VEGFR1/2/3 2 ≥1 47 MSS: 47 (100%) 0% Median PFS: 3.6 months Median OS: 10.8 months (25) Atezolizumab + cobimetinib (NCT0198889) PD-L1 MEK 1/1b ≥1 84 MSS: 62 (74%) MSI-H: 2 (2%) Unknown: 29 (35%) 8% Median PFS: 1.9 months 12-month PFS: 11% Median OS: 9.8 months 12-month OS: 43% (30) Atezolizumab + cobimetinib versus Atezolizumab versus Regorafenib (IMblaze370) PD-L1 MEK VEGFR1/2/3 3 ≥2 183 MSS: 170 (93%) MSI-H: 3 (2%) Unknown: 10 (5%) versus 90 MSS: 83 (92%) MSI-H: 3 (3%) Unknown: 4 (4%) versus 90 MSS: 80 (89%) Unknown: 10 (11%) 3% versus 2% versus 2% Median PFS: 1.91 months versus Median PFS 1.94 months versus Median PFS: 2.00 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.25 Atezolizumab versus Regorafenib HR = 1.39 Median OS: 8.87 months versus Median OS: 7.10 months versus Median OS: 8.51 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.00 (P = 0.99) Atezolizumab versus Regorafenib HR = 1.19 (P = 0.34) (31) BBI608 + pembrolizumab (SCOOP) STAT3 WNT PD-1 1/2 ≥1 40 MSS: 40 (100%) 10 MSI-H: 10 (10%) 10% 50% Median PFS: 1.6 months Median PFS: NR Median OS: 7.3 months Median OS: NR (34) Tremelimumab + durvalumab + FOLFOX (MEDITREME) PD-L1 CTLA-4 1b/II 0 16 MSS: 16 (100%) 62.5% Median PFS: Not reported 6-month PFS: 62.5% 12-month PFS: 50% Not reported (35) Pembrolizumab + radiotherapy PD-1 1 ≥2 22 MSS/pMMR: 100% 4.5% Not reported Not reported (38) Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 18 MSS: 18 0% Median PFS: 2.2 months Median OS: 5.0 months (3) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥2 10 MSS/pMMR: 10 (Nivo 1 mg/kg plus 3 mg/kg) 10 MSS/pMMR: 10 (Nivo 3 mg/kg plus 1 mg/kg) 10% 0% Median PFS: 2.28 months Median PFS: 1.31 months Median OS: 11.53 months Median OS: 3.73 months (18) Tremelimumab + durvalumab versus Best supportive care (CO.26) PD-L1 CTLA-4 r2 ≥2 119 MSI-H/: 1 (1%) MSS: 117 (98%) Unknown: 1 (1%) versus 61 MSI-H: 1 (2%) MSS: 117 (80%) Unknown: 1 (18%) DCR 23% versus 7% (P = 0.006) Median PFS: 1.8 months versus Median PFS 1.9 months HR = 1.01 (P = 0.97) Median OS: 6.6 months versus Median OS: 4.1 months HR = 0.72 (P = 0.07) (MSS subgroup) HR = 0.66 (P = 0.02) (19) Capecitabine + bevacizumab + atezolizumab versus Capecitabine + bevacizumab + placebo (BACCI) PD-L1 VEGF-A r2 ≥2 82 MSS/pMMR: 85.7% versus 46 MSS/pMMR: 86.7% 8.54% versus 4.35% (P = 0.5) Median PFS: 4.4 months versus Median PFS 3.3 months HR = 0.725 (P = 0.051) 12-month OS: 52% versus 12-month OS: 43% HR = 0.94 (P = 0.4) (23) Nivolumab + regorafenib (REGONIVO, EPOC1603) PD-1 VEGFR1/2/3 1b ≥2 25 MSI-H/dMMR: 1 (4%) MSS/pMMR: 24 (96%) 36% Median PFS: 7.9 months 1-year PFS: 41.8% Median OS: 12.3 months 1-year OS: 68.0% (24) Avelumab + regorafenib (REGOMUNE) PD-L1 VEGFR1/2/3 2 ≥1 47 MSS: 47 (100%) 0% Median PFS: 3.6 months Median OS: 10.8 months (25) Atezolizumab + cobimetinib (NCT0198889) PD-L1 MEK 1/1b ≥1 84 MSS: 62 (74%) MSI-H: 2 (2%) Unknown: 29 (35%) 8% Median PFS: 1.9 months 12-month PFS: 11% Median OS: 9.8 months 12-month OS: 43% (30) Atezolizumab + cobimetinib versus Atezolizumab versus Regorafenib (IMblaze370) PD-L1 MEK VEGFR1/2/3 3 ≥2 183 MSS: 170 (93%) MSI-H: 3 (2%) Unknown: 10 (5%) versus 90 MSS: 83 (92%) MSI-H: 3 (3%) Unknown: 4 (4%) versus 90 MSS: 80 (89%) Unknown: 10 (11%) 3% versus 2% versus 2% Median PFS: 1.91 months versus Median PFS 1.94 months versus Median PFS: 2.00 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.25 Atezolizumab versus Regorafenib HR = 1.39 Median OS: 8.87 months versus Median OS: 7.10 months versus Median OS: 8.51 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.00 (P = 0.99) Atezolizumab versus Regorafenib HR = 1.19 (P = 0.34) (31) BBI608 + pembrolizumab (SCOOP) STAT3 WNT PD-1 1/2 ≥1 40 MSS: 40 (100%) 10 MSI-H: 10 (10%) 10% 50% Median PFS: 1.6 months Median PFS: NR Median OS: 7.3 months Median OS: NR (34) Tremelimumab + durvalumab + FOLFOX (MEDITREME) PD-L1 CTLA-4 1b/II 0 16 MSS: 16 (100%) 62.5% Median PFS: Not reported 6-month PFS: 62.5% 12-month PFS: 50% Not reported (35) Pembrolizumab + radiotherapy PD-1 1 ≥2 22 MSS/pMMR: 100% 4.5% Not reported Not reported (38) MSS, microsatellite stable; pMMR, proficient mismatch repair; PD-L1, programmed death ligand-1; r2, randomized phase 2 trial; DCR, disease control rate; VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth factor receptor; FOLFOX, 5-fluorouracil, leucovorin and oxaliplatin; MEK, mitogen-activated protein kinase kinase; STAT3, signal transducer and activator of transcription 3; WNT, WNT signaling. Open in new tab Table 2 Selected clinical trial data of immune checkpoint inhibitors in mainly MSS/pMMR metastatic CRC Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 18 MSS: 18 0% Median PFS: 2.2 months Median OS: 5.0 months (3) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥2 10 MSS/pMMR: 10 (Nivo 1 mg/kg plus 3 mg/kg) 10 MSS/pMMR: 10 (Nivo 3 mg/kg plus 1 mg/kg) 10% 0% Median PFS: 2.28 months Median PFS: 1.31 months Median OS: 11.53 months Median OS: 3.73 months (18) Tremelimumab + durvalumab versus Best supportive care (CO.26) PD-L1 CTLA-4 r2 ≥2 119 MSI-H/: 1 (1%) MSS: 117 (98%) Unknown: 1 (1%) versus 61 MSI-H: 1 (2%) MSS: 117 (80%) Unknown: 1 (18%) DCR 23% versus 7% (P = 0.006) Median PFS: 1.8 months versus Median PFS 1.9 months HR = 1.01 (P = 0.97) Median OS: 6.6 months versus Median OS: 4.1 months HR = 0.72 (P = 0.07) (MSS subgroup) HR = 0.66 (P = 0.02) (19) Capecitabine + bevacizumab + atezolizumab versus Capecitabine + bevacizumab + placebo (BACCI) PD-L1 VEGF-A r2 ≥2 82 MSS/pMMR: 85.7% versus 46 MSS/pMMR: 86.7% 8.54% versus 4.35% (P = 0.5) Median PFS: 4.4 months versus Median PFS 3.3 months HR = 0.725 (P = 0.051) 12-month OS: 52% versus 12-month OS: 43% HR = 0.94 (P = 0.4) (23) Nivolumab + regorafenib (REGONIVO, EPOC1603) PD-1 VEGFR1/2/3 1b ≥2 25 MSI-H/dMMR: 1 (4%) MSS/pMMR: 24 (96%) 36% Median PFS: 7.9 months 1-year PFS: 41.8% Median OS: 12.3 months 1-year OS: 68.0% (24) Avelumab + regorafenib (REGOMUNE) PD-L1 VEGFR1/2/3 2 ≥1 47 MSS: 47 (100%) 0% Median PFS: 3.6 months Median OS: 10.8 months (25) Atezolizumab + cobimetinib (NCT0198889) PD-L1 MEK 1/1b ≥1 84 MSS: 62 (74%) MSI-H: 2 (2%) Unknown: 29 (35%) 8% Median PFS: 1.9 months 12-month PFS: 11% Median OS: 9.8 months 12-month OS: 43% (30) Atezolizumab + cobimetinib versus Atezolizumab versus Regorafenib (IMblaze370) PD-L1 MEK VEGFR1/2/3 3 ≥2 183 MSS: 170 (93%) MSI-H: 3 (2%) Unknown: 10 (5%) versus 90 MSS: 83 (92%) MSI-H: 3 (3%) Unknown: 4 (4%) versus 90 MSS: 80 (89%) Unknown: 10 (11%) 3% versus 2% versus 2% Median PFS: 1.91 months versus Median PFS 1.94 months versus Median PFS: 2.00 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.25 Atezolizumab versus Regorafenib HR = 1.39 Median OS: 8.87 months versus Median OS: 7.10 months versus Median OS: 8.51 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.00 (P = 0.99) Atezolizumab versus Regorafenib HR = 1.19 (P = 0.34) (31) BBI608 + pembrolizumab (SCOOP) STAT3 WNT PD-1 1/2 ≥1 40 MSS: 40 (100%) 10 MSI-H: 10 (10%) 10% 50% Median PFS: 1.6 months Median PFS: NR Median OS: 7.3 months Median OS: NR (34) Tremelimumab + durvalumab + FOLFOX (MEDITREME) PD-L1 CTLA-4 1b/II 0 16 MSS: 16 (100%) 62.5% Median PFS: Not reported 6-month PFS: 62.5% 12-month PFS: 50% Not reported (35) Pembrolizumab + radiotherapy PD-1 1 ≥2 22 MSS/pMMR: 100% 4.5% Not reported Not reported (38) Agent(s) (trial or identifier) . Target . Phase . Prior treatment line . No. of patients . Objective response rate . PFS . OS . Reference . Pembrolizumab (KEYNOTE-016) PD-1 2 ≥2 18 MSS: 18 0% Median PFS: 2.2 months Median OS: 5.0 months (3) Nivolumab + ipilimumab (CheckMate 142) PD-1 CTLA-4 2 ≥2 10 MSS/pMMR: 10 (Nivo 1 mg/kg plus 3 mg/kg) 10 MSS/pMMR: 10 (Nivo 3 mg/kg plus 1 mg/kg) 10% 0% Median PFS: 2.28 months Median PFS: 1.31 months Median OS: 11.53 months Median OS: 3.73 months (18) Tremelimumab + durvalumab versus Best supportive care (CO.26) PD-L1 CTLA-4 r2 ≥2 119 MSI-H/: 1 (1%) MSS: 117 (98%) Unknown: 1 (1%) versus 61 MSI-H: 1 (2%) MSS: 117 (80%) Unknown: 1 (18%) DCR 23% versus 7% (P = 0.006) Median PFS: 1.8 months versus Median PFS 1.9 months HR = 1.01 (P = 0.97) Median OS: 6.6 months versus Median OS: 4.1 months HR = 0.72 (P = 0.07) (MSS subgroup) HR = 0.66 (P = 0.02) (19) Capecitabine + bevacizumab + atezolizumab versus Capecitabine + bevacizumab + placebo (BACCI) PD-L1 VEGF-A r2 ≥2 82 MSS/pMMR: 85.7% versus 46 MSS/pMMR: 86.7% 8.54% versus 4.35% (P = 0.5) Median PFS: 4.4 months versus Median PFS 3.3 months HR = 0.725 (P = 0.051) 12-month OS: 52% versus 12-month OS: 43% HR = 0.94 (P = 0.4) (23) Nivolumab + regorafenib (REGONIVO, EPOC1603) PD-1 VEGFR1/2/3 1b ≥2 25 MSI-H/dMMR: 1 (4%) MSS/pMMR: 24 (96%) 36% Median PFS: 7.9 months 1-year PFS: 41.8% Median OS: 12.3 months 1-year OS: 68.0% (24) Avelumab + regorafenib (REGOMUNE) PD-L1 VEGFR1/2/3 2 ≥1 47 MSS: 47 (100%) 0% Median PFS: 3.6 months Median OS: 10.8 months (25) Atezolizumab + cobimetinib (NCT0198889) PD-L1 MEK 1/1b ≥1 84 MSS: 62 (74%) MSI-H: 2 (2%) Unknown: 29 (35%) 8% Median PFS: 1.9 months 12-month PFS: 11% Median OS: 9.8 months 12-month OS: 43% (30) Atezolizumab + cobimetinib versus Atezolizumab versus Regorafenib (IMblaze370) PD-L1 MEK VEGFR1/2/3 3 ≥2 183 MSS: 170 (93%) MSI-H: 3 (2%) Unknown: 10 (5%) versus 90 MSS: 83 (92%) MSI-H: 3 (3%) Unknown: 4 (4%) versus 90 MSS: 80 (89%) Unknown: 10 (11%) 3% versus 2% versus 2% Median PFS: 1.91 months versus Median PFS 1.94 months versus Median PFS: 2.00 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.25 Atezolizumab versus Regorafenib HR = 1.39 Median OS: 8.87 months versus Median OS: 7.10 months versus Median OS: 8.51 months Atezolizumab + cobimetinib versus Regorafenib HR = 1.00 (P = 0.99) Atezolizumab versus Regorafenib HR = 1.19 (P = 0.34) (31) BBI608 + pembrolizumab (SCOOP) STAT3 WNT PD-1 1/2 ≥1 40 MSS: 40 (100%) 10 MSI-H: 10 (10%) 10% 50% Median PFS: 1.6 months Median PFS: NR Median OS: 7.3 months Median OS: NR (34) Tremelimumab + durvalumab + FOLFOX (MEDITREME) PD-L1 CTLA-4 1b/II 0 16 MSS: 16 (100%) 62.5% Median PFS: Not reported 6-month PFS: 62.5% 12-month PFS: 50% Not reported (35) Pembrolizumab + radiotherapy PD-1 1 ≥2 22 MSS/pMMR: 100% 4.5% Not reported Not reported (38) MSS, microsatellite stable; pMMR, proficient mismatch repair; PD-L1, programmed death ligand-1; r2, randomized phase 2 trial; DCR, disease control rate; VEGF, vascular endothelial growth factor; VEGFR, vascular endothelial growth factor receptor; FOLFOX, 5-fluorouracil, leucovorin and oxaliplatin; MEK, mitogen-activated protein kinase kinase; STAT3, signal transducer and activator of transcription 3; WNT, WNT signaling. Open in new tab VEGF plays a role in cancer immune evasion by inhibiting T-cell function by increasing inhibitory immune checkpoints (e.g. PD-L1, CTLA-4, TIM-3) and recruiting immune suppressive cells, including regulatory T cells and myeloid-derived suppressor cells (20,21). The blockades of VEGF and PD-L1 result in increased CD8+ T-cell infiltration and expression of major histocompatibility complex 1 (MHC-1) in patients with renal cell carcinoma (22). Regarding combination of VEGF blockade with immunotherapy in mCRC, several reports of clinical trials are available. A randomized phase II BACCI trial was conducted to evaluate the superiority of atezolizumab in combination with capecitabine plus bevacizumab versus placebo with capecitabine plus bevacizumab in pretreated patients with mCRC (mostly MSS/pMMR tumors) (23). In that trial, 133 patients were randomly (2:1) assigned to the atezolizumab/capecitabine/bevacizumab group or the placebo/capecitabine/bevacizumab group. The ORR was 8.54% in the atezolizumab/capecitabine/bevacizumab group and 4.35% in the placebo/capecitabine/bevacizumab group. The median PFS was numerically longer in patients receiving the atezolizumab/capecitabine/bevacizumab group compared with the placebo/capecitabine/bevacizumab group: 4.4 versus 3.3 months (HR = 0.725, 95% CI 0.491–1.07; P = 0.051). Recently, the promising results of the phase 1b REGONIVO trial, which assessed the safety and efficacy of regorafenib plus nivolumab for mCRC and metastatic gastric cancer, was reported (24). In the mCRC cohort of 25 patients, 24 patients (96%) had MSS/pMMR mCRC. Regorafenib at doses of 80–160 mg/day plus nivolumab at a dose of 3 mg/kg was administered. The maximum tolerated dose and optimal doses of regorafenib were determined as 120 and 80 mg, respectively. In the mCRC cohort, the ORR was 36%, and the median PFS and median OS were 7.9 months and not reached, respectively. Although the sample size was small, these promising results provide a biological rationale for the use of nivolumab in combination with regorafenib for a large phase 3 trial. Furthermore, a phase II REGOMUNE trial evaluated the efficacy of regorafenib in combination with avelumab in pretreated patients with MSS mCRC with an ORR of 0% (25). In addition to these trials, early phase trials using antiangiogenic agents plus ICIs in patients with mCRC are ongoing [NCT03081494, PDR001 (anti-PD-1 inhibitor) plus regorafenib; NCT03396926, pembrolizumab in combination with capecitabine plus bevacizumab; NCT02876224, atezolizumab in combination with bevacizumab plus cobimetinib (MEK inhibitor); NCT02848443, nivolumab in combination with TAS-102, oxaliplatin and bevacizumab]. EGFR is another major molecule in RAS-wild mCRC targeted by cetuximab and panitumumab. Cetuximab is an immune-enhancing agent that promotes T-cell infiltration into CRC and upregulates inhibitory immune checkpoints (e.g. PD-L1 and LAG3) (26,27). A phase Ib/II study (NCT02713373) of cetuximab and pembrolizumab in pretreated patients with RAS-wild mCRC is ongoing. Early results of nine patients reported that six patients (67%) achieved stable disease with a duration of ≥16 weeks (28). Early phase trials using anti-EGFR antibodies plus ICIs in patients with RAS-wild mCRC are ongoing [NCT03442569, nivolumab and ipilimumab with panitumumab; NCT03174405 (AVETUX), avelumab plus cetuximab in combination with FOLFOX; EudraCT 2017-004932-32 (CAVE Colon), avelumab plus cetuximab). MEK inhibition resulted in T-cell infiltration into tumors with upregulation of MHC1 expression, and the dual inhibition of MEK and PD-L1 showed synergistic tumor regression in a preclinical CRC model (29). Cobimetinib in combination with atezolizumab was investigated in a phase 1b trial that enrolled 84 patients with mCRC (mostly MSS tumors), resulting in an objective response of 8% (in 6 patients with an MSS tumor and 1 patient with an MSI-H tumor) (30). However, the phase 3 IMblaze 370 trial, in which 363 patients with pretreated mCRC (MSS tumor: ~90%) were randomized (2:1:1) to receive atezolizumab with or without cobimetinib or regorafenib, showed no benefit of the combination of ICI and a MEK inhibitor (31). At the median follow-up of 7.3 months, the median OS did not differ between the atezolizumab plus cobimetinib group (8.87 months) versus the regorafenib group (8.51 months) [HR = 1.00 (95% CI: 0.73–1.38), P = 0.99] or the atezolizumab group (7.10 months) versus the regorafenib group (8.51 months) [HR = 1.19 (95% CI: 0.83–1.71), P = 0.34]. The lack of superiority of ICIs was consistent across clinical or molecular subgroups. Currently, CheckMate 9N9, a phase 1/2 trial is ongoing to evaluate the safety and efficacy of trametinib (MEK inhibitor) plus nivolumab with or without ipilimumab (NCT03377361). Activation of WNT signaling is commonly observed in mCRC due to genetic alterations including APC, CTNNB1 and RNF43 and is inversely correlated with T-cell infiltration in tumor, leading to immune-exclusive tumor microenvironment (8,32). In a preclinical model of melanoma, Wnt signaling inhibition restores T-cell infiltration in tumor, and dual inhibition of Wnt and CTLA-4 elicits synergistic anti-tumor effects (33). As for mCRC, a phase 1/2 trial (SCOOP) of BBI608 [an inhibitor for signal transducer and activator of transcription 3 (STAT3) and WNT signaling] in combination with pembrolizumab was conducted (34). In the phase 2 part, the ORRs were 10% in patients with MSS tumor and 50% in those with MSI tumor. Early phase trials using WNT signaling inhibitors plus ICIs in patients with mCRC are ongoing [NCT03647839 (MODULATE), BBI 607 plus nivolumab; NCT01351103, LGK974 plus PDR001; NCT02675946 (KEYNOTE-596), CGX1321 plus pembrolizumab]. The combination of ICIs with cytotoxic agents is also being investigated for this population. The interim results of a phase 1b/2 trial (MEDITREME) of durvalumab and tremelimumab in combination with FOLFOX as a first-line treatment in patients with RAS-mutant, MSS mCRC were reported with a median follow-up duration of 13.4 months (NCT03202758) (35). The patients received six cycles of FOLFOX with durvalumab (4 doses) and tremelimumab followed by durvalumab maintenance. Of 16 patients, 10 patients (62.5%) had achieved an objective response, including 5 patients with a complete response. At 6 and 12 months, the PFS rates were 62.5 and 50%, respectively. CheckMate 9X8 (NCT03414983), a randomized phase 2/3 trial to assess the superiority of adding nivolumab to FOLFOX plus bevacizumab, and NIVACOR (NCT04072198), a phase 2 trial to evaluate the efficacy of nivolumab in combination with 5-fluorouracil, leucovorin, oxaliplatin and irinotecan (FOLFOXIRI) plus bevacizumab are under investigation at first-line settings in mCRC regardless of the MSI/MMR status. Radiotherapy is expected to improve the anti-tumor activity of immunotherapy by eliciting a pro-inflammatory tumor microenvironment by diverse mechanisms such as increasing tumor antigen release, production of interferons and cytokines, and immune cells recruitment (36,37). Moreover, radiotherapy may elicit tumor shrinkage beyond the irradiated site, known as the ‘abscopal effect’ (37). Therefore, the use of radiotherapy is considered as an attractive strategy for enhancing the efficacy of immunotherapy. Currently, however, available reports regarding the combination of ICI and radiotherapy are limited. The interim analysis of a phase 2 trial (NCT02437071), which examined the efficacy of combining pembrolizumab and radiotherapy in 22 pretreated patients with pMMR mCRC, was reported (38). Although only one patient achieved an objective response, regressions of non-irradiated metastases were observed in this patient, suggesting the potential utility of exploiting radiotherapy with ICIs. Currently, several clinical trials to examine the clinical activity of this combined treatment for MSS/pMMR mCRC are ongoing (NCT03104439, nivolumab plus ipilimumab in combination with radiotherapy; NCT03007407/NCT02888743, durvalumab and tremelimumab with or after radiotherapy; NCT02837263, pembrolizumab in combination with radiotherapy). Large clinical trials using ICIs are awaited for MSS/pMMR mCRC based on some encouraging data using combination strategies to promote immune modulation. Immunotherapy as neoadjuvant or adjuvant treatment for resectable CRC The neoadjuvant use of ICIs has shown impressive anti-tumor responses in other types of cancers, such as melanoma, lung cancer and urothelial carcinoma (39–42). A phase 2 NICHE trial suggested promising future opportunities for the use of ICIs for resectable colon cancer in a neoadjuvant setting (43). After the completion of patient enrollment in a run-in period (N = 3), patients with dMMR tumors (N = 20) or pMMR tumors (N = 17) were enrolled in the study. All patients with dMMR tumors were allocated to receive nivolumab plus ipilimumab. Patients with pMMR were randomly assigned to receive nivolumab plus ipilimumab with or without celecoxib for immune modulation. Patients in the nivolumab plus ipilimumab group [dMMR (N = 20), pMMR (N = 9)] received 1 dose of ipilimumab at 1 mg/kg (on day 1) and 2 doses of nivolumab at 3 mg/kg (on days 1 and 15). Patients in the nivolumab plus ipilimumab with celecoxib group [pMMR (N = 8)] received the same regimen as those in the nivolumab plus ipilimumab group with celecoxib (from day 1 until the day before surgery). The maximum duration between consent and surgery was predefined as 6 weeks. The primary objective was safety and feasibility. Five patients (13%) experienced grade ≥ 3 adverse events, including rash (N = 2), colitis (N = 1), lipase increase (N = 2) and amylase increase (N = 1). All patients received curative surgery as planned. Grade ≥ 3 surgery-related adverse events were observed in eight patients (20%), including grade 3 anastomotic leakage (N = 4) and wound/abdominal infection (N = 4). Among 35 eligible patients [dMMR (N = 20), pMMR (N = 15)] for the further analysis, a pathological response rate was 100% with a pathological complete response (pCR) rate of 60% in the patients with dMMR tumors and 27% with a pCR rate of 13% in those with pMMR tumors, respectively. These encouraging results support the hypothesis that ICIs confer deep responses in stages I–III colon cancer. On the other hand, the VOLTAGE-A trial was conducted to evaluate the safety and efficacy of neoadjuvant chemoradiotherapy (50.4 Gy with capecitabine 1650 mg/m2), followed by nivolumab (240 mg every 2 weeks for 5 cycles) with curative surgery for patients with locally advanced rectal cancer (44). pCR, the primary endpoint, was 30% in the MSS/pMMR cohort (N = 37) and 100% in the MSI-H/dMMR cohort (N = 2) with mild toxicities. Several clinical trials of ICIs in the adjuvant setting after resection of CRC are ongoing. The ATOMIC trial, a phase 3 trial, is recruiting patients with stage III dMMR colon cancer for a comparison of FOLFOX with FOLFOX plus atezolizumab (NCT02912559). The POLEM trial, a phase 3 trial, is comparing avelumab following 5-fluorouracil-based adjuvant treatment with 5-fluorouracil-based adjuvant treatment in patients with stage III dMMR or POLE-mutant CRC (NCT03827044). Safety of ICIs in CRC The restoration of an immune response by blocking inhibitory immune signaling may result in immune-related adverse events (irAEs), which are major concerns in clinical practice. ICIs cause a variety of irAEs that can potentially involve multiple organs such as the skin (e.g. rash), the lung (e.g. pneumonitis), the cardiovascular system (e.g. myocarditis), the gastrointestinal tract (e.g. colitis), the endocrine system (e.g. hypothyroidism), and the nervous system (e.g. myasthenia gravis). Although the development of irAEs might be associated with favorable responses to ICIs (45,46), severe irAEs can be life-threatening and lead to permanent discontinuation of the treatment. The incidences of grade ≥ 3 irAEs in clinical trials were 13–22% by ICI monotherapy (2,10,11,14) and 22%–64% by dual immune checkpoint inhibition (12,13,47). Multidisciplinary care for the early recognition and appropriate management of irAEs is important for the administration of ICIs, particularly when combinations of ICIs are used. Clinical guidelines published by the National Comprehensive Cancer Network (NCCN) and ASCO are helpful for the management of irAEs (47,48). Future perspectives After the success in the clinical development of ICIs, pembrolizumab and nivolumab with or without ipilimumab have been considered as treatment options for pretreated patients with MSI-H/dMMR mCRC. In addition, the significant prolongation of PFS in the pembrolizumab group in the KEYNOTE-177 trial supports pembrolizumab as a new treatment option in untreated patients with MSI-H/dMMR mCRC. Considering these results, ICIs are major therapeutic options for MSI-H/dMMR mCRC at an early line setting. In addition to those clinical success of ICIs for MSI-H/dMMR mCRC, transformation of ‘immune-cold tumors’ into ‘immune-hot tumors’ by using other non-ICI agents or radiotherapy has been promising strategy for the development of ICI targeting MSS/pMMR mCRC (Fig. 1). However, there are several clinical issues regarding the use of ICIs. Figure 1. Open in new tabDownload slide Summary of the clinical development of ICI for mCRC. MSI-H, microsatellite instability-high; dMMR, deficient mismatch repair; mCRC, metastatic colorectal cancer; TMB, tumor mutation burden; MSS, microsatellite stable; pMMR, proficient mismatch repair; ICI, immune checkpoint inhibitor; VEGF, vascular endothelial growth factor; EGFR, endothelial growth factor receptor; MEK, mitogen-activated protein kinase kinase; WNT, WNT signaling. Figure 1. Open in new tabDownload slide Summary of the clinical development of ICI for mCRC. MSI-H, microsatellite instability-high; dMMR, deficient mismatch repair; mCRC, metastatic colorectal cancer; TMB, tumor mutation burden; MSS, microsatellite stable; pMMR, proficient mismatch repair; ICI, immune checkpoint inhibitor; VEGF, vascular endothelial growth factor; EGFR, endothelial growth factor receptor; MEK, mitogen-activated protein kinase kinase; WNT, WNT signaling. Currently, no biomarker has been established for a favorable response to ICIs for MSI-H/dMMR mCRC. Although ICIs confer durable disease control to responded patients, a small but significant proportion of patients with MSI-H/dMMR mCRC experience early progression after ICI treatment, especially when it was administered as monotherapy. Progressive disease rates in this population range from 10 to 46% with ICI monotherapy (2,10,11,14) and from 12 to 13% with dual ICIs (12,13). Therefore, there is a need for biomarker exploration to identify subgroups that may achieve benefit from ICIs. PD-L1 expression on tumor and immune cells has been widely explored as a predictive biomarker for the response of ICIs in various types of cancers. In CRC, the frequency of PD-L1 expression on tumors is ~5% in all populations with a significant increase in dMMR tumors compared with pMMR tumors (18 versus 2%, P < 0.001) (49). However, PD-L1 expression on tumor or immune cells was not correlated with responses to ICIs in clinical trials targeting mCRC (11,12,24). Moreover, TMB is a noteworthy biomarker that may predict the response to ICIs. It is thought that a high TMB is correlated with the cancer neoantigen burden that renders tumors immunogenic and responsive to ICIs, leading to a favorable response to ICIs regardless of the tumor type (50). KEYNOTE-158 showed the clinical activity of pembrolizumab in both patients with TMB-high tumors (ORR: 28.3%) and those with TMB-H/non-MSI-H tumors (ORR: 24.8%). Based on this result, the US FDA approved the use of pembrolizumab for TMB-H solid tumors on 16 June 2020, potentially expanding the target population for ICIs to include MSS/pMMR mCRC. Clinical studies with correlational research should be continued to validate these potential biomarkers or for the discovery of novel molecules for the prediction of a favorable response to ICIs in mCRC. The elucidation of acquired resistance to ICIs is also important for future development. Genetic alterations in β2 microglobulin and Janus kinases (JAK) and WNT signaling activation are proposed as potential mechanisms for acquired resistance in melanoma (51,52). Currently, our understanding of the mechanism of ICI resistance in patients with CRC is poor. Translational research using serial samples (e.g. tumor biopsy, peripheral blood) is required to evaluate the dynamic changes in immune status such as the expression of inhibitory immune checkpoints and intratumoral T-cell infiltration, and to generate rationales for designing novel approaches to overcome resistance. Summary ICIs are options of standard-of-care as first-line or later-line therapy for patients with MSI-H/dMMR mCRC based on the prospective studies that showed a striking anti-tumor activity. While there are no approved ICIs for MSS/pMMR mCRC, ongoing trials using ICIs in combination with molecular targeting agents or radiotherapy might improve the clinical utility of ICIs with immunomodulatory effects for these populations. Future studies should identify predictive biomarkers for responses, elucidate acquired resistance mechanisms and develop more effective immunotherapy for patients with CRC. Funding None declared. Conflict of interest statement Hidekazu Hirano received honoraria for lectures from Lilly, Taiho and Novartis. Atsuo Takashima received honoraria for lectures from Lilly, Taiho, Ono Pharmaceutical, Chugai, Takeda and Merck Serono and grants from Ono Pharmaceutical, Takeda, Merck Sharp & Dohme, Eisai, Bayer and Bristol-Myers Squibb. Tetsuya Hamaguchi received honoraria for lectures from Chugai, Merck Serono, Takeda, Taiho, Ono Pharmaceutical, Yakult, Lilly, Bristol-Myers Squibb, Bayer, Fuji Film, Novartis and grants from Chugai, Taiho, Ono Pharmaceutical, Eisai, BeiGene and Astellas. Dai Shida and Yukihide Kanemitsu have no conflict of interest. References 1. Bray F , Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries . CA Cancer J Clin 2018 ; 68 : 394 – 424 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Le DT , Durham JN, Smith KN, et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade . Science 2017 ; 357 : 409 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Le DT , Uram JN, Wang H, et al. PD-1 blockade in tumors with mismatch-repair deficiency . N Engl J Med 2015 ; 372 : 2509 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Mlecnik B , Bindea G, Angell HK, et al. Integrative analyses of colorectal cancer show immunoscore is a stronger predictor of patient survival than microsatellite instability . Immunity 2016 ; 44 : 698 – 711 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Giannakis M , Mu XJ, Shukla SA, et al. Genomic correlates of immune-cell infiltrates in colorectal carcinoma . Cell Rep 2016 ; 17 : 1206 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Lee V , Murphy A, Le DT, Diaz LA Jr. Mismatch repair deficiency and response to immune checkpoint blockade . Oncologist 2016 ; 21 : 1200 – 11 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Okamoto W , Nakamura Y, Shiozawa M, et al. Microsatellite instability status in metastatic colorectal cancer and effect of immune checkpoint inhibitors on survival in MSI-high metastatic colorectal cancer . Ann Oncol 2019 ; 30 : v231 – v2 . Google Scholar Crossref Search ADS WorldCat 8. Grasso CS , Giannakis M, Wells DK, et al. Genetic mechanisms of immune evasion in colorectal cancer . Cancer Discov 2018 ; 8 : 730 – 49 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Salem ME , Puccini A, Grothey A, et al. Landscape of tumor mutation load, mismatch repair deficiency, and PD-L1 expression in a large patient cohort of gastrointestinal cancers . Mol Cancer Res 2018 ; 16 : 805 – 12 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Le DT , Kim TW, Van Cutsem E, et al. Phase II open-label study of pembrolizumab in treatment-refractory, microsatellite instability-high/mismatch repair-deficient metastatic colorectal cancer: KEYNOTE-164 . J Clin Oncol 2020 ; 38 : 11 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Overman MJ , McDermott R, Leach JL, et al. Nivolumab in patients with metastatic DNA mismatch repair-deficient or microsatellite instability-high colorectal cancer (CheckMate 142): an open-label, multicentre, phase 2 study . Lancet Oncol 2017 ; 18 : 1182 – 91 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Overman MJ , Lonardi S, Wong KYM, et al. Durable clinical benefit with nivolumab plus ipilimumab in DNA mismatch repair-deficient/microsatellite instability-high metastatic colorectal cancer . J Clin Oncol 2018 ; 36 : 773 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Lenz H-J , Lonardi S, Zagonel V, et al. Nivolumab (NIVO)+ low-dose ipilimumab (IPI) as first-line (1L) therapy in microsatellite instability-high/mismatch repair-deficient (MSI-H/dMMR) metastatic colorectal cancer (mCRC): two-year clinical update . Proc Am Soc Clin Oncol 2020 . Google Scholar OpenURL Placeholder Text WorldCat 14. Andre T , Shiu K-K, Kim TW, et al. Pembrolizumab versus chemotherapy for microsatellite instability-high/mismatch repair deficient metastatic colorectal cancer: the phase 3 KEYNOTE-177 study . Proc Am Soc Clin Oncol 2020 . Google Scholar OpenURL Placeholder Text WorldCat 15. Hochster HS , Bendell JC, Cleary JM, et al. Efficacy and safety of atezolizumab (atezo) and bevacizumab (bev) in a phase Ib study of microsatellite instability (MSI)-high metastatic colorectal cancer (mCRC) . Am Soc Clin Oncol 2017 . Google Scholar OpenURL Placeholder Text WorldCat 16. Kim JH , Kim SY, Baek JY, et al. A phase II study of avelumab monotherapy in patients with mismatch repair-deficient/microsatellite instability-high or POLE-mutated metastatic or unresectable colorectal cancer . Cancer Res Treat 2020 . Epub ahead of print. Google Scholar OpenURL Placeholder Text WorldCat 17. Segal NH , Wainberg ZA, Overman MJ, et al. Safety and clinical activity of durvalumab monotherapy in patients with microsatellite instability–high (MSI-H) tumors . Am Soc Clin Oncol 2019 . Google Scholar OpenURL Placeholder Text WorldCat 18. Overman MJ , Kopetz S, McDermott RS, et al. Nivolumab ± ipilimumab in treatment (tx) of patients (pts) with metastatic colorectal cancer (mCRC) with and without high microsatellite instability (MSI-H): CheckMate-142 interim results . Am Soc Clin Oncol 2016 . Google Scholar OpenURL Placeholder Text WorldCat 19. Chen EX , Jonker DJ, Loree JM, et al. Effect of combined immune checkpoint inhibition vs best supportive care alone in patients with advanced colorectal cancer: the Canadian Cancer Trials Group CO.26 Study . JAMA Oncol 2020 ; 6 : 1 – 8 . Google Scholar OpenURL Placeholder Text WorldCat 20. Yang J , Yan J, Liu B. Targeting VEGF/VEGFR to modulate antitumor immunity . Front Immunol 2018 ; 9 : 978 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Arai H , Battaglin F, Wang J, et al. Molecular insight of regorafenib treatment for colorectal cancer . Cancer Treat Rev 2019 ; 81 :101912. Google Scholar OpenURL Placeholder Text WorldCat 22. Wallin JJ , Bendell JC, Funke R, et al. Atezolizumab in combination with bevacizumab enhances antigen-specific T-cell migration in metastatic renal cell carcinoma . Nat Commun 2016 ; 7 :12624. Google Scholar OpenURL Placeholder Text WorldCat 23. Mettu N , Twohy E, Ou F-S, et al. BACCI: a phase II randomized, double-blind, multicenter, placebo-controlled study of capecitabine (C) bevacizumab (B) plus atezolizumab (A) or placebo (P) in refractory metastatic colorectal cancer (mCRC): an ACCRU network study . Ann Oncol 2019 ; 30 : v203 . Google Scholar Crossref Search ADS WorldCat 24. Fukuoka S , Hara H, Takahashi N, et al. Regorafenib plus nivolumab in patients with advanced gastric or colorectal cancer: an open-label, dose-escalation, and dose-expansion phase Ib trial (REGONIVO, EPOC1603) . J Clin Oncol 2020 ;Jco1903296. Google Scholar OpenURL Placeholder Text WorldCat 25. Cousin S , Bellera CA, Guégan JP, et al. REGOMUNE: a phase II study of regorafenib plus avelumab in solid tumors—results of the non-MSI-H metastatic colorectal cancer (mCRC) cohort . Am Soc Clin Oncol 2020 . Google Scholar OpenURL Placeholder Text WorldCat 26. Inoue Y , Hazama S, Suzuki N, et al. Cetuximab strongly enhances immune cell infiltration into liver metastatic sites in colorectal cancer . Cancer Sci 2017 ; 108 : 455 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Woolston A , Khan K, Spain G, et al. Genomic and transcriptomic determinants of therapy resistance and immune landscape evolution during anti-EGFR treatment in colorectal cancer . Cancer Cell 2019 ; 36 : 35 – 50.e9 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Boland PM , Hutson A, Maguire O, Minderman H, Fountzilas C, Iyer RV. A phase Ib/II study of cetuximab and pembrolizumab in RAS-wt mCRC . Proc Am Soc Clin Oncol 2018 . Google Scholar OpenURL Placeholder Text WorldCat 29. Ebert PJR , Cheung J, Yang Y, et al. MAP kinase inhibition promotes T cell and anti-tumor activity in combination with PD-L1 checkpoint blockade . Immunity 2016 ; 44 : 609 – 21 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Hellmann MD , Kim TW, Lee CB, et al. Phase Ib study of atezolizumab combined with cobimetinib in patients with solid tumors . Ann Oncol 2019 ; 30 : 1134 – 42 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Eng C , Kim TW, Bendell J, et al. Atezolizumab with or without cobimetinib versus regorafenib in previously treated metastatic colorectal cancer (IMblaze370): a multicentre, open-label, phase 3, randomised, controlled trial . Lancet Oncol 2019 ; 20 : 849 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Yaeger R , Chatila WK, Lipsyc MD, et al. Clinical sequencing defines the genomic landscape of metastatic colorectal cancer . Cancer Cell 2018 ; 33 : 125 – 36 e3 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Holtzhausen A , Zhao F, Evans KS, et al. Melanoma-derived Wnt5a promotes local dendritic-cell expression of IDO and immunotolerance: opportunities for pharmacologic enhancement of immunotherapy . Cancer Immunol Res 2015 ; 3 : 1082 – 95 . Google Scholar Crossref Search ADS PubMed WorldCat 34. Hara H , Kawazoe A, Kuboki Y, et al. Scoop: multicenter phase I/II trial of BBI608 and pembrolizumab in patients with metastatic colorectal cancer (EPOC1503) . Proc Am Soc Clin Oncol 2020 . Google Scholar OpenURL Placeholder Text WorldCat 35. Ghiringhelli F , Chibaudel B, Taieb J, et al. Durvalumab and tremelimumab in combination with FOLFOX in patients with RAS-mutated, microsatellite-stable, previously untreated metastatic colorectal cancer (MCRC): results of the first intermediate analysis of the phase Ib/II MEDETREME trial . Proc Am Soc Clin Oncol 2020 . Google Scholar OpenURL Placeholder Text WorldCat 36. Weichselbaum RR , Liang H, Deng L, Fu YX. Radiotherapy and immuno-therapy: a beneficial liaison? Nat Rev Clin Oncol 2017 ; 14 : 365 – 79 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Sharabi AB , Lim M, DeWeese TL, Drake CG. Radiation and checkpoint blockade immunotherapy: radiosensitisation and potential mechanisms of synergy . Lancet Oncol 2015 ; 16 : e498 – 509 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Segal NH , Kemeny NE, Cercek A, et al. Non-randomized phase II study to assess the efficacy of pembrolizumab (Pem) plus radiotherapy (RT) or ablation in mismatch repair proficient (pMMR) metastatic colorectal cancer (mCRC) patients . Proc Am Soc Clin Oncol 2016 . Google Scholar OpenURL Placeholder Text WorldCat 39. Blank CU , Rozeman EA, Fanchi LF, et al. Neoadjuvant versus adjuvant ipilimumab plus nivolumab in macroscopic stage III melanoma . Nat Med 2018 ; 24 : 1655 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Amaria RN , Reddy SM, Tawbi HA, et al. Neoadjuvant immune checkpoint blockade in high-risk resectable melanoma . Nat Med 2018 ; 24 : 1649 – 54 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Powles T , Kockx M, Rodriguez-Vida A, et al. Clinical efficacy and biomarker analysis of neoadjuvant atezolizumab in operable urothelial carcinoma in the ABACUS trial . Nat Med 2019 ; 25 : 1706 – 14 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Forde PM , Chaft JE, Smith KN, et al. Neoadjuvant PD-1 blockade in resectable lung cancer . N Engl J Med 2018 ; 378 : 1976 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Chalabi M , Fanchi LF, Dijkstra KK, et al. Neoadjuvant immunotherapy leads to pathological responses in MMR-proficient and MMR-deficient early-stage colon cancers . Nat Med 2020 ; 26 : 566 – 76 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Yoshino T , Bando H, Tsukada Y, et al. O-010 VOLTAGE: investigator-initiated clinical trial of nivolumab monotherapy and subsequent radical surgery following preoperative chemoradiotherapy in patients with microsatellite stable locally advanced rectal cancer . Ann Oncol 2019 ; 30 :mdz154. 009. Google Scholar OpenURL Placeholder Text WorldCat 45. Lo JA , Fisher DE, Flaherty KT. Prognostic significance of cutaneous adverse events associated with pembrolizumab therapy . JAMA Oncol 2015 ; 1 : 1340 – 1 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Masuda K , Shoji H, Nagashima K, et al. Correlation between immune-related adverse events and prognosis in patients with gastric cancer treated with nivolumab . BMC Cancer 2019 ; 19 : 974 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Thompson JA , Schneider BJ, Brahmer J, et al. NCCN Guidelines Insights: Management of Immunotherapy-Related Toxicities, Version 1.2020 . J Natl Compr Cancer Netw 2020 ; 18 : 230 – 41 . Google Scholar Crossref Search ADS WorldCat 48. Brahmer JR , Lacchetti C, Schneider BJ, et al. Management of immune-related adverse events in patients treated with immune checkpoint inhibitor therapy: American Society of Clinical Oncology Clinical Practice Guideline . J Clin Oncol 2018 ; 36 : 1714 – 68 . Google Scholar Crossref Search ADS PubMed WorldCat 49. Lee LH , Cavalcanti MS, Segal NH, et al. Patterns and prognostic relevance of PD-1 and PD-L1 expression in colorectal carcinoma . Mod Pathol 2016 ; 29 : 1433 – 42 . Google Scholar Crossref Search ADS PubMed WorldCat 50. Samstein RM , Lee CH, Shoushtari AN, et al. Tumor mutational load predicts survival after immunotherapy across multiple cancer types . Nat Genet 2019 ; 51 : 202 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 51. Zaretsky JM , Garcia-Diaz A, Shin DS, et al. Mutations associated with acquired resistance to PD-1 blockade in melanoma . N Engl J Med 2016 ; 375 : 819 – 29 . Google Scholar Crossref Search ADS PubMed WorldCat 52. Trujillo JA , Luke JJ, Zha Y, et al. Secondary resistance to immunotherapy associated with β-catenin pathway activation or PTEN loss in metastatic melanoma . J Immunother Cancer 2019 ; 7 :295. Google Scholar OpenURL Placeholder Text WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Kawazoe,, Akihito;Shitara,, Kohei;Boku,, Narikazu;Yoshikawa,, Takaki;Terashima,, Masanori

doi: 10.1093/jjco/hyaa202pmid: 33241322

Abstract Recently, immune checkpoint inhibitors such as anti-programmed cell death-1 (PD-1) or programmed cell death ligand-1 (PD-L1) monoclonal antibodies have improved the overall survival of various types of cancers including advanced gastric cancer (AGC). Until now, two ant-PD-1 inhibitors were approved for AGC in Japan: nivolumab as third- or later-line treatment for AGC and pembrolizumab for previously treated patients with microsatellite instability-high tumours. However, a limited number of patients achieved clinical benefit, highlighting the importance of the better selection of patients or additional treatment to overcome resistance to PD-1/PD-L1 blockade. This review focused on pivotal clinical trials, biomarkers and novel combination therapy of immune checkpoint inhibitors for AGC. gastric cancer, immunotherapy, immune checkpoint inhibitors, clinical trials, predictive biomarkers, combination therapies Introduction Gastric cancer is the fifth most common malignancy and the third leading cause of cancer-related death worldwide (1). Although fluoropyrimidine and platinum-based chemotherapy combination regimens (with trastuzumab for HER2-positive cases) as first-line therapy and taxane agents with or without ramucirumab as second-line are the standard treatment for advanced gastric cancer (AGC), the prognosis remains poor, with the median survival being ~1 year (2–5). Recently, blockade of immune checkpoint molecules with monoclonal antibodies has emerged as a promising strategy in several malignancies (6–10). PD-1, which belongs to the CD28 family of proteins, is a negative costimulatory receptor expressed on the surface of activated T cells (11). The binding of PD-1 and its ligands, PD-L1 and PD-L2 in tumour or immune cells, can inhibit a cytotoxic T-cell response, which leads tumour cells to escape from immune surveillance (11). Accordingly, the blockade of this interaction restores the antitumour activity of T cells (11). Clinical trials of anti-PD-1/PD-L1 monoclonal antibodies have reported durable antitumour response and prolonged overall survival (OS) in several malignancies (6–10). In AGC, the phase III ATTRACTION-2 trial of nivolumab, a fully human immunoglobulin four monoclonal antibody against PD-1, showed a survival benefit in third- or later-line treatment in an Asian patient population, which led to the approval of nivolumab as a treatment for AGC in Japan (12). Pembrolizumab, another anti-PD-1 monoclonal antibody, received accelerated approval for treatment of PD-L1-positive AGC in third-line or later treatment by the US Food and Drug Administration (FDA) on the basis of results of a large phase II trial (13). Pembrolizumab was also granted accelerated approval for treatment of patients with unresectable or metastatic, microsatellite instability-high (MSI-H), or mismatch repair deficient (MMR-D) solid tumours that have progressed following prior treatment by FDA and were approved in Japan. Based on these approval statuses, nivolumab is recommended as the third-line or later line treatment for AGC patients according to the Japanese gastric cancer treatment guidelines (14). Pembrolizumab is also recommended as second-line or later-line treatments for MSI-H/MMR-D patients (15). This review will discuss the current status of immunotherapy for gastric cancer including pivotal clinical trials, biomarkers, and future perspectives. Pivotal clinical trials of anti-PD-1/PD-L1 therapies as monotherapy or combination with chemotherapy for gastric cancer Table 1 summarized 15 pivotal clinical trials of anti-PD-1/PD-L1 therapies for gastric cancer; three in third- or later-line setting, two in the second-line setting, seven in the first-line setting and three in the perioperative setting. Seven trials with anti-PD-1/PD-L1 monotherapy or a combination of chemotherapy have been already reported as follows. Table 1 Pivotal clinical trials of anti-PD-1/PD-L1 therapies for gastric cancer Target . Phase . Trial . Line . Agents (experimental) . Control . Primary Endpoint . Result . Difference mOS (m) . PD-1 III ATTRACTION-2 (NCT02267343) 3rd or later Nivolumab PBO OS Positive +1.2 (HR 0.63) PD-1 II KEYNOTE-059 (NCT02335411) 3rd or later Pembrolizumab – ORR Positive – PD-L1 III JAVELIN300 (NCT02625623) 3rd Avelumab Irinotecan/taxanes/BSC OS Negative −0.4 (HR 1.1) PD-1 III KEYNOTE-061 (NCT02370498) 2nd Pembrolizumab Paclitaxel OS/PFS Negative +0.8 (HR 0.82) PD-1 III KEYNOTE-063 (NCT03019588) 2nd Pembrolizumab Paclitaxel OS Terminated – PD-1 III KEYNOTE-062 (NCT02494583) 1st Pembrolizumab or Pembrolizumab+CTx XP/FP OS/PFS Negative −0.5 (HR 0.91) +1.4 (HR 0.85) PD-L1 III JAVELIN100 (NCT02625610) 1st maintenance Avelumab CapeOX/FOLFOX OS Negative −0.5 (HR 0.91) PD-1/CTLA-4 III CheckMate-649 (NCT02872116) 1st +Nivolumab Ipilimumab+Nivo CapeOX/FOLFOX OS/PFS positive +3.3 (HR 0.71) for CPS≥5 patients PD-1 III ATTRACTION-4 (NCT02746796) 1st +Nivolumab SOX/CapeOX OS/PFS positive for PFS/negative for OS +0.3 (HR 0.9) PD-1 III KEYNOTE-811 (NCT03615326) 1st +Pembrolizumab FP/CapeOX/SOX +Tmab OS/PFS Ongoing – PD-1 III KEYNOTE-859 (NCT03675737) 1st +Pembrolizumab FP/CapeOX OS/PFS Ongoing – PD-1/Lag-3 II/III MAHOGANY (NCT4082364) 1st margetuximab INCMGA00012 CapeOX/FOLFOX +Tmab OS Ongoing - PD-1 III KEYNOTE-585 (NCT03221426) Neoadjuvant +Pembrolizumab XP/FP/FLOT OS/EFS/pCR Ongoing – PD-1 III ATTRACTION-5 (NCT03006705) Adjuvant +Nivolumab S-1/CapeOX RFS Ongoing – PD-1 III CheckMate-577 (NCT02743494) Adjuvant Nivolumab PBO DFS Ongoing – Target . Phase . Trial . Line . Agents (experimental) . Control . Primary Endpoint . Result . Difference mOS (m) . PD-1 III ATTRACTION-2 (NCT02267343) 3rd or later Nivolumab PBO OS Positive +1.2 (HR 0.63) PD-1 II KEYNOTE-059 (NCT02335411) 3rd or later Pembrolizumab – ORR Positive – PD-L1 III JAVELIN300 (NCT02625623) 3rd Avelumab Irinotecan/taxanes/BSC OS Negative −0.4 (HR 1.1) PD-1 III KEYNOTE-061 (NCT02370498) 2nd Pembrolizumab Paclitaxel OS/PFS Negative +0.8 (HR 0.82) PD-1 III KEYNOTE-063 (NCT03019588) 2nd Pembrolizumab Paclitaxel OS Terminated – PD-1 III KEYNOTE-062 (NCT02494583) 1st Pembrolizumab or Pembrolizumab+CTx XP/FP OS/PFS Negative −0.5 (HR 0.91) +1.4 (HR 0.85) PD-L1 III JAVELIN100 (NCT02625610) 1st maintenance Avelumab CapeOX/FOLFOX OS Negative −0.5 (HR 0.91) PD-1/CTLA-4 III CheckMate-649 (NCT02872116) 1st +Nivolumab Ipilimumab+Nivo CapeOX/FOLFOX OS/PFS positive +3.3 (HR 0.71) for CPS≥5 patients PD-1 III ATTRACTION-4 (NCT02746796) 1st +Nivolumab SOX/CapeOX OS/PFS positive for PFS/negative for OS +0.3 (HR 0.9) PD-1 III KEYNOTE-811 (NCT03615326) 1st +Pembrolizumab FP/CapeOX/SOX +Tmab OS/PFS Ongoing – PD-1 III KEYNOTE-859 (NCT03675737) 1st +Pembrolizumab FP/CapeOX OS/PFS Ongoing – PD-1/Lag-3 II/III MAHOGANY (NCT4082364) 1st margetuximab INCMGA00012 CapeOX/FOLFOX +Tmab OS Ongoing - PD-1 III KEYNOTE-585 (NCT03221426) Neoadjuvant +Pembrolizumab XP/FP/FLOT OS/EFS/pCR Ongoing – PD-1 III ATTRACTION-5 (NCT03006705) Adjuvant +Nivolumab S-1/CapeOX RFS Ongoing – PD-1 III CheckMate-577 (NCT02743494) Adjuvant Nivolumab PBO DFS Ongoing – Open in new tab Table 1 Pivotal clinical trials of anti-PD-1/PD-L1 therapies for gastric cancer Target . Phase . Trial . Line . Agents (experimental) . Control . Primary Endpoint . Result . Difference mOS (m) . PD-1 III ATTRACTION-2 (NCT02267343) 3rd or later Nivolumab PBO OS Positive +1.2 (HR 0.63) PD-1 II KEYNOTE-059 (NCT02335411) 3rd or later Pembrolizumab – ORR Positive – PD-L1 III JAVELIN300 (NCT02625623) 3rd Avelumab Irinotecan/taxanes/BSC OS Negative −0.4 (HR 1.1) PD-1 III KEYNOTE-061 (NCT02370498) 2nd Pembrolizumab Paclitaxel OS/PFS Negative +0.8 (HR 0.82) PD-1 III KEYNOTE-063 (NCT03019588) 2nd Pembrolizumab Paclitaxel OS Terminated – PD-1 III KEYNOTE-062 (NCT02494583) 1st Pembrolizumab or Pembrolizumab+CTx XP/FP OS/PFS Negative −0.5 (HR 0.91) +1.4 (HR 0.85) PD-L1 III JAVELIN100 (NCT02625610) 1st maintenance Avelumab CapeOX/FOLFOX OS Negative −0.5 (HR 0.91) PD-1/CTLA-4 III CheckMate-649 (NCT02872116) 1st +Nivolumab Ipilimumab+Nivo CapeOX/FOLFOX OS/PFS positive +3.3 (HR 0.71) for CPS≥5 patients PD-1 III ATTRACTION-4 (NCT02746796) 1st +Nivolumab SOX/CapeOX OS/PFS positive for PFS/negative for OS +0.3 (HR 0.9) PD-1 III KEYNOTE-811 (NCT03615326) 1st +Pembrolizumab FP/CapeOX/SOX +Tmab OS/PFS Ongoing – PD-1 III KEYNOTE-859 (NCT03675737) 1st +Pembrolizumab FP/CapeOX OS/PFS Ongoing – PD-1/Lag-3 II/III MAHOGANY (NCT4082364) 1st margetuximab INCMGA00012 CapeOX/FOLFOX +Tmab OS Ongoing - PD-1 III KEYNOTE-585 (NCT03221426) Neoadjuvant +Pembrolizumab XP/FP/FLOT OS/EFS/pCR Ongoing – PD-1 III ATTRACTION-5 (NCT03006705) Adjuvant +Nivolumab S-1/CapeOX RFS Ongoing – PD-1 III CheckMate-577 (NCT02743494) Adjuvant Nivolumab PBO DFS Ongoing – Target . Phase . Trial . Line . Agents (experimental) . Control . Primary Endpoint . Result . Difference mOS (m) . PD-1 III ATTRACTION-2 (NCT02267343) 3rd or later Nivolumab PBO OS Positive +1.2 (HR 0.63) PD-1 II KEYNOTE-059 (NCT02335411) 3rd or later Pembrolizumab – ORR Positive – PD-L1 III JAVELIN300 (NCT02625623) 3rd Avelumab Irinotecan/taxanes/BSC OS Negative −0.4 (HR 1.1) PD-1 III KEYNOTE-061 (NCT02370498) 2nd Pembrolizumab Paclitaxel OS/PFS Negative +0.8 (HR 0.82) PD-1 III KEYNOTE-063 (NCT03019588) 2nd Pembrolizumab Paclitaxel OS Terminated – PD-1 III KEYNOTE-062 (NCT02494583) 1st Pembrolizumab or Pembrolizumab+CTx XP/FP OS/PFS Negative −0.5 (HR 0.91) +1.4 (HR 0.85) PD-L1 III JAVELIN100 (NCT02625610) 1st maintenance Avelumab CapeOX/FOLFOX OS Negative −0.5 (HR 0.91) PD-1/CTLA-4 III CheckMate-649 (NCT02872116) 1st +Nivolumab Ipilimumab+Nivo CapeOX/FOLFOX OS/PFS positive +3.3 (HR 0.71) for CPS≥5 patients PD-1 III ATTRACTION-4 (NCT02746796) 1st +Nivolumab SOX/CapeOX OS/PFS positive for PFS/negative for OS +0.3 (HR 0.9) PD-1 III KEYNOTE-811 (NCT03615326) 1st +Pembrolizumab FP/CapeOX/SOX +Tmab OS/PFS Ongoing – PD-1 III KEYNOTE-859 (NCT03675737) 1st +Pembrolizumab FP/CapeOX OS/PFS Ongoing – PD-1/Lag-3 II/III MAHOGANY (NCT4082364) 1st margetuximab INCMGA00012 CapeOX/FOLFOX +Tmab OS Ongoing - PD-1 III KEYNOTE-585 (NCT03221426) Neoadjuvant +Pembrolizumab XP/FP/FLOT OS/EFS/pCR Ongoing – PD-1 III ATTRACTION-5 (NCT03006705) Adjuvant +Nivolumab S-1/CapeOX RFS Ongoing – PD-1 III CheckMate-577 (NCT02743494) Adjuvant Nivolumab PBO DFS Ongoing – Open in new tab Third- or later-line setting A phase III trial of nivolumab (ATTRACTION-2) demonstrated an improvement in OS compared with placebo as third- or later-line treatment in patients with AGC (median 5.26 months versus 4.14 months; hazard ratio [HR] = 0.63; P < 0.0001) (12), associated with numerically higher 1-year, 2-year and 3-year OS rates in nivolumab (27.3%, 10.6% and 5.6%) than those in placebo (11.6%, 3.2% and 1.9%) (16). Subgroup analysis showed consistent improvements in OS across most subgroups. In comparison with placebo, nivolumab was also associated with improvements in progression-free survival (PFS) (median 1.61 months versus 1.45 months; HR = 0.60; P < 0.0001), objective response rate (ORR) (11.2% versus 0%; P < 0.0001), and disease control rate (40.3% versus 25%; P = 0.0036). Treatment-related adverse events (TRAEs) of any grade were reported in 43% of patients with nivolumab, including 10% grade 3 or 4 TRAEs. All-grade TRAE reported in 5% or more of patients with nivolumab were pruritus (9%), diarrhea (7%), rash (6%) and fatigue (5%). Common grade 3 or 4 TRAEs in the nivolumab group were decreased appetite, diarrhea, fatigue and aspartate transaminase increased. TRAEs such as interstitial lung disease, acute hepatitis and pneumonitis led to discontinuation of nivolumab in 3% of patients. Deaths attributed to study treatment occurred in 1% of patients with nivolumab (acute hepatitis, cardiac arrest, exertional dyspnea and pneumonia). Most patients experienced their first TRAEs within 3 months after starting nivolumab (16). No new safety signals were identified. Cohort 1 of a phase II trial (KENOTE-059) evaluated the safety and efficacy of pembrolizumab as third- or later-line treatment in patients with AGC (13). ORR was 11.6% (95% CI 8.0–16.1%) in the entire population. In this study, PD-L1 expression was assessed using the pharmDx immunohistochemistry assay (PD-L1 IHC 22 C3; Agilent Thechnologies). Tumours were considered PD-L1 positive if the combined positive score (CPS) (number of PD-L1-positive cells including tumour cells, macrophages and lymphocytes divided by the total number of tumour cells, multiplied by 100) was 1 or greater. ORR was 15.5% for patients with PD-L1-positive tumours (CPS ≥1) as determined by 22C3 IHC assay, while ORR was 6.4% for those with PD-L1-negative tumours (CPS <1), resulting in the FDA approval of pembrolizumab for PD-L1-positive AGC and PD-L1 22C3 IHC as a companion diagnostic assay. Median PFS was 2.0 months (95% CI 2.0–2.1), with a 6-month PFS rate of 14.1% (95% CI 10.1–19.7%). Median OS was 5.6 months (95% CI 4.3–6.9), with a 6-month OS rate of 46.5% (95% CI 40.2–52.6%). Safety profiles of pembrolizumab in KEYNOTE-059 were comparable to those of nivolumab in ATTRACTION-2. TRAEs of any grade were observed in 60% of patients, and 18% of patients had grade 3 or worse TRAEs. Meanwhile, a global phase III trial of Avelumab, which is a human IgG1 monoclonal antibody against PD-L1 (JAVELIN 300), failed to show a survival benefit compared with the chemotherapy of investigators’ choice such as paclitaxel or irinotecan as third-line treatment in patients with AGC (median 4.6 months versus 5.0 months; HR = 1.1; P = 0.81) (17). Second-line setting A phase III trial of pembrolizumab as second-line treatment (KENOTE-061) did not significantly prolong OS (median 9.1 months versus 8.3 months; HR = 0.82) compared with paclitaxel in AGC patients with PD-L1 CPS ≥1 AGC (18). The survival curves crossed around the median which showed favourable trend of paclitaxel until 8 months and thereafter a better OS rate of pembrolizumab than paclitaxel. Moreover, PDL-1 negative population showed a trend of shorter OS with pembrolizumab than paclitaxel. Therefore, it is necessary to select patients who should receive pembrolizumab at second-line treatment. Indeed, long-term survival benefit with pembrolizumab in KENOTE-061 was suggested in several subgroups such as ECOG performance status (PS) of 0, PD-L1 CPS ≥10 and MSI-H populations. Of note, median OS was not reached with pembrolizumab vs 8.1 months with paclitaxel (HR 0.42) in MSI-H patients based on post-hoc analysis. First-line setting Recently, results of a phase III study (KEYNOTE-062) were reported which compared first-line pembrolizumab monotherapy or pembrolizumab plus chemotherapy versus chemotherapy in patients with PD-L1 CPS ≥1 and CPS ≥10 AGC (19). Pembrolizumab was non-inferior to chemotherapy for OS in patients with CPS ≥1 (median 10.6 months versus 11.1 months; HR = 0.91 [99.2% CI 0.69–1.18], P value for non-inferiority 0.162, non-inferiority margin = 1.2), with relatively shorter median PFS (2.0 months versus 6.4 months) and lower ORR (15% versus 37%) compared to chemotherapy. OS curves showed an early favourable trend toward chemotherapy. Meanwhile, the separation in favour of pembrolizumab was sustained at long-term follow-up, which was similar to that of KEYNOTE-061.12- and 24-month OS rates for patients with CPS ≥1 were 46.9% and 26.5% with pembrolizumab versus 45.6% and 19.2% with chemotherapy. The discrepancy between poor PFS/ORR and long-term OS benefit in patients with pembrolizumab compared to chemotherapy might be partially explained by the observations that immune checkpoint inhibitors could enhance the antitumour response to subsequent chemotherapy (20–23). Moreover, pembrolizumab prolonged OS (versus chemotherapy) in patients with CPS ≥10 (median 17.4 months versus 10.8 months, HR = 0.69 [95% CI 0.49–0.97]), although this difference was not statistically tested. Twelve- and twenty-four-month OS rates for patients with CPS ≥10 were 56.5% and 39.0% with pembrolizumab versus 46.7% and 22.2% with chemotherapy. However, the crossing of survival curves in CPS ≥ 10 populations still suggested that some patients with pembrolizumab exhibited early disease progression resulting in poor prognosis, thus additional biomarker or multifactorial analyses are necessary to define an optimal population who would benefit from pembrolizumab monotherapy in the first-line. Of note, the survival benefit of pembrolizumab was greater than chemotherapy in MSI-H populations in post-hoc analysis. Median OS with pembrolizumab was not reached versus 8.5 months with chemotherapy (HR 0.29). Chemotherapy in combination with pembrolizumab was not superior to chemotherapy alone for OS in both CPS ≥1 (median 12.5 months versus 11.1 months; HR = 0.85 [0.70–1.03], P = 0.046 [>0.025 for prespecified significant value]) and CPS ≥10 (median 12.3 months versus 10.8 months, HR = 0.85 [0.62–1.17], P = 0.158) populations, although ORR was higher in pembrolizumab plus chemotherapy (49% vs 37% in CPS ≥1). Grade 3–5 treatment-related event rates for pembrolizumab, pembrolizumab plus chemotherapy and chemotherapy were 17, 73 and 69%, respectively. Other several phase III trials, ATTRACTION-4 (NCT02746796), CheckMate-649 (NCT02872116) and KEYNOTE-859 (NCT03675737), are currently ongoing to further evaluate the efficacy and safety of a fluoropyrimidine plus oxaliplatin in combination with nivolumab or pembrolizumab as first-line treatment for AGC (Table 1). A phase III trial of avelumab (JAVELIN 100) did not meet its primary objective of demonstrating superior OS with avelumab maintenance versus continued chemotherapy or best supportive care as first-line treatment in AGC patients, either in all randomized patients (median 10.4 months versus 10.9 months; HR = 0.91; P = 0.1779) or in PD-L1-positive (≥1% of tumour cells) population (median 16.2 months versus 17.7 months; HR = 1.13; P = 0.6352) (24). In an exploratory subset analysis, PD-L1-positive population defined by CPS ≥1 showed a trend for longer OS with avelumab (median 14.9 months versus 11.6 months; HR = 0.72). Perioperative setting A preclinical study showed that neoadjuvant treatment with anti-PD-1 plus anti-CD137 monoclonal antibodies improved survival with increased the number of cancer antigen-specific CD8+ T cells compared to adjuvant therapy after primary tumour resection in mouse models of triple-negative breast cancer (25). Indeed, several clinical studies demonstrated promising antitumour activity of PD-1 blockade with or without standard chemotherapy as neoadjuvant setting in patients with triple-negative breast cancer, non-small-cell lung cancer, melanoma, and head and neck cancer (26–29). Currently, a phase III KEYNOTE-585 trial (NCT03221426) has been conducted to evaluate the efficacy and safety of pembrolizumab plus chemotherapy compared with placebo plus chemotherapy as neoadjuvant/adjuvant treatment for localized gastric cancer is ongoing (Table 1). Also, adjuvant nivolumab or pembrolizumab improved recurrence-free survival compared with placebo in patients with resected melanoma (30, 31). In gastric cancer, phase III trial, ATTRACTION-5 (NCT03006705), is ongoing to investigate standard adjuvant chemotherapy with S-1 or capecitabine plus oxaliplatin in the combination of nivolumab for patients with pathological Stage III gastric cancer (including esophagogastric junction cancer) after D2 or more extensive lymph node dissection (Table 1). Biomarkers of anti-PD-1/PD-L1 therapies in gastric cancer PD-L1 expression An exploratory analysis of ATTRACTION-2 indicated no predictive value of PD-L1 expression on tumour cells, although proportion of patients with available tumour samples was <40% (12). Moreover, in JAVELIN 300, which failed to confirm a survival benefit for avelumab compared with the investigators’ choice of chemotherapy with paclitaxel or irinotecan for patients with AGC, no difference was observed in the OS based on the PD-L1 expression, which was defined as PD-L1 staining on 1% of tumour cells (17). In contrast, a correlation between higher PD-L1 CPS and higher treatment effect was suggested in phase II (KEYNOTE-059) and III trials (KEYNOTE-061 and KEYNOTE-062) of pembrolizumab (13, 18, 19). KEYNOTE-061 suggested that PD-L1 negative (CPS < 1) was a negative predictive factor for the survival benefit of pembrolizumab. An exploratory analysis of JAVELIN 100 showed that patients with CPS ≥1 had a trend of longer OS with avelumab compared to continued chemotherapy or best supportive care (24). These results suggested the some utility of CPS1 score as predictive factors for benefit of anti-PD1/PD-L1 inhibitor as a single agent. But optimal cut-off requires further evaluation in clinical trials at each treatment lines. Meanwhile, a phase II trial of SOX with pembrolizumab (KEYNOTE-659) produced ORRs of 72.2% (CPS ≥1) and 71.0% (CPS ≥10), with no apparent association between efficacy outcomes and PD-L1 expression level (32). This result is generally consistent with KEYNOTE-062, suggesting that PD-L1 expression level might not be a robust predictive factor for pembrolizumab combined with chemotherapy in AGC patients. It is anticipated that future results from ongoing studies such as ATTRACTION-4, CheckMate-649, and KEYNOTE-859 will clarify the association between PD-L1 expression status and treatment efficacy of chemotherapy plus nivolumab or pembrolizumab. Microsatellite instability-high In stage IV AGC, MSI-H or MMR-D is identified in 6.2% cases (33). As shown in TCGA 2014 and ACRG 2015 reports, the MSI-H subtype exhibits frequent mutations in multiple genes (including frameshifts or missense mutations) and hypermethylation (including hypermethylation at the MLH1 promoter), which contribute to the enhanced expression of neoantigens (34, 35). MSI-H/MMR-D colorectal cancer has higher mutation loads compared with MSS/MMR-proficient (MMR-P), associated with high infiltration of CD8+ T cells presumably because of the recognition of a high number of tumour neoantigens and its corresponding expression of immune checkpoints in the tumour microenvironment (36). Indeed, FDA approved pembrolizumab for patients with previously treated MSI-H/MMR-D solid tumours, including AGC based on the durable response in several trials (37–40). Pembrolizumab was also approved for patients with previously treated MSI-H solid tumours in Japan. In a phase II trial of pembrolizumab (KEYNOTE-158) demonstrating that ORR was 37.2% for 94 patients with MSI-H/MMR-D non-colorectal solid tumours, including patients in Japan, 6 of 13 patients with AGC attained an objective response (ORR, 46.2%) (39). Moreover, a subgroup analysis of KEYNOTE-059, KEYNOTE-061 and KEYNOTE-062 revealed consistent efficacies that the ORR was 57, 47 and 57% for patients with MSI-H/MMR-D AGC, respectively (13, 16, 19). As described before, post-hoc analysis of KEYNOTE-061 and KEYNOTE-062 suggested remarkable survival benefit of pembrolizumab in MSI-H patients. Based on this evidence, Japanese guidelines for the management of patients with metastatic GC and recommended that pembrolizumab as a treatment option for patients with MSI-H/MMR-D AGC in the second-line or later settings (41). Tumour mutation burden As patients with MSI-H/MMR-D form a small minority of AGC patients, novel biomarkers to predict response to immunotherapy among MSS/MMR-P are desired. It has been reported that tumour mutation burden (TMB)-high correlated with enhanced survival in patients receiving immune checkpoint inhibitors across multiple cancer types (42). Indeed, TMB-high solid tumours with pembrolizumab were associated with higher ORR (30.3% [27.1% after excluding MSI-H] versus 6.7%) and higher 6-, 12- and 24-months PFS rates compared with non-TMB-high tumours in KEYNOTE-158 (43). TMB-high was defined as ≥10 mut/Mb using FoundationOne CDx™ assay in this study. Based on these results, pembrolizumab and FoundationOne CDx™ as a companion diagnostic assay have been just recently approved by FDA for patients with TMB-high solid tumours. Several clinical trials also reported that TMB was a potential biomarker of anti-PD-1 monotherapies for AGC (44–46). Most recently, an exploratory analysis of KEYNOTE-061 demonstrated a stronger association between TMB and favourable clinical efficacy with pembrolizumab compared to PD-L1 CPS (47, 48). This positive association was maintained after exclusion of MSI-H patients, which warrants further evaluations in a large cohort. These results suggested that patient selection by TMB as well as CPS might be important in future phase III trials of immune checkpoint inhibitors. Also, the precise mechanism regarding the impact of TMB on the efficacy of PD-1/PD-L1 blockade should be investigated in the near future. Epstein-Barr virus (EBV) In stage IV AGC, EBV tumour is identified in 6.2% cases (33). EBV-positive gastric cancer is often accompanied by more extensive infiltration of CD8-positive cytotoxic T cells and a higher number of mature dendritic cells than EBV-negative gastric cancer (33). The TCGA reported that the amplification of the CD274 gene (which encodes PD-L1) and the PDCD1LG2 gene (which encodes PD-L2) was frequently observed in EBV-positive GC (34). Indeed, extremely high ORR (100%) were reported in six patients with EBV-positive AGC in a previous phase II study of pembrolizumab (44). Notably, Panda et al. (49) reported that a patient with EBV-positive AGC exhibited a durable response from treatment with the anti-PD-L1 antibody avelumab, although this type of tumour had a low mutation burden. Meanwhile, one of four patients (25%) with EBV-positive achieved an objective response in a phase Ib/II study of toripalimab (an anti-PD-1 antibody) (45). It has been also reported that two of six patients (33%) with EBV-positive achieved an objective response (50). Thus, the impact of EBV status on the efficacy of anti-PD-1 monotherapy is still controversial. Further analysis for EBV-positive AGC patients treated with anti-PD-1 therapy must be necessary. Hyperprogressive disease Recently, anti-PD-1/PD-L1 antibodies have anecdotally been reported to cause rapid progression of some cancer types, which is called hyperprogressive disease (HPD), although its definition has not been established and its precise incidence in AGC remains unclear (51–54). Since HPD has been suggested to be associated with poor prognoses, it is necessary to identify predictive factors of HPD. It has been previously reported that an ECOG PS of 1 or more, liver metastasis and a large tumour size at baseline were significantly associated with HPD when nivolumab was administered in patients with AGC (55). Another study showed that an ECOG PS of 1 or more and the presence of two or more metastatic sites were associated with a trend of higher frequencies with HPD, though there is no significant difference (56). Recently, Kamada et al. (57) reported an increase in regulatory T cells (Tregs) with proliferative capacity among tumour-infiltrating lymphocytes in AGC patients who exhibited HPD after treatment with an anti-PD-1 antibody. Moreover, an in vitro study reported that PD-1 blockade activated not only effector T cells but also Tregs, which promoted tumour progression in a fraction of patients (57). Also, Lo Russo et al. (58) illustrated the role of innate immunity in mediating HPD via Fc/FcR triggering on macrophages by anti-PD-1 antibody. Further investigations in larger cohorts are warranted to validate HPD-associated biomarkers. Novel combination therapy of immune checkpoint inhibitors Anti-PD-1 antibody plus anti-CTLA4 antibody One of the possible mechanism of resistance of PD-1/PD-L1 blockade for advanced cancers is the presence of immune suppression through the immune checkpoints other than the PD-1/PD-L1 axis regulating lymphocyte activation (11). Cytotoxic T lymphocyte antigen 4 (CTLA-4), a key negative regulator of T-cell responses, restrict the antitumour immune response. Indeed, in the AGC cohort of CheckMate-032, ORR was higher in patients with 1 mg/kg nivolumab plus 3 mg/kg ipilimumab as anti-CTLA-4 monoclonal antibody (24%) than in those with 3 mg/kg nivolumab (12%) or 3 mg/kg nivolumab plus 1 mg/kg ipilimumab (8%) (33), which needs further evaluation in ongoing CheckMate-649. However, the enrollment to the cohort of 3 mg/kg nivolumab plus 1 mg/kg ipilimumab was closed earlier than chemotherapy plus nivolumab or chemotherapy alone arms (Table 1). We should await efficacy and safety results from the CheckMate-649 study. Targeting immune suppressive cells Immune suppressive cells including forkhead box P3 (Foxp3) + CD25+ Tregs, and tumour-associated macrophages (TAMs) also potentially induce treatment failure with PD-1 blockade for advanced cancers (62–61). As described above, Tregs or TAMS have been considered to be associated with HPD during PD-1 blockade (57, 58). A previous in vivo study reported that selective inhibition of the VEGF pathway with an anti-VEGF antibody or anti-VEGF TKIs effectively controlled tumour growth and inhibited the infiltration of immune suppressive cells such as Tregs, TAMs and myeloid-derived suppressor cells while increasing the mature dendritic cell fraction (62). Thus, PD-1 blockade in combination with VEGF inhibitors might not only enhance antitumour activity but also reduce HPD. Indeed, several phases I/II trials of nivolumab plus ramucirumab (anti-VEGFR2 antibody), pembrolizumab plus ramucirumab, nivolumab combined with paclitaxel plus ramucirumab showed encouraging efficacies for AGC patients (63–65). Most recently, anti-PD-1 antibodies in combination with multikinase inhibitors targeting VEGF receptors and other receptor tyrosine kinases such as regorafenib or lenvatinib also demonstrated promising results for AGC patients (66, 67). A phase Ib trial of regorafenib plus nivolumab showed that ORR was 44% and median PFS was 5.6 months for AGC patients (66). Furthermore, three of seven AGC patients refractory to previous PD-1 targeting therapy achieved response with regorafenib plus nivolumab, which supports the concept of overcoming the resistance of anti-PD-1 targeting therapy using regorafenib. Also, a phase II trial of lenvatinib plus pembrolizumab promising antitumour activity with ORR of 69% and median PFS of 7.1 months for AGC patients in first- or second-line setting (67). However, these trials were not randomized as phases I/II trials with a small sample size, thus the efficacy results are preliminary in nature. Currently, confirmatory study is under planning. Combinations with anti-HER2 therapies In a preclinical study, combining anti-PD-1 and anti-HER2 therapy-induced T-cell activation and augmented antibody-dependent cellular cytotoxicity (68). A phase II trial of the addition of trastuzumab plus pembrolizumab to the first-line chemotherapy exhibited promising results with ORR of 91% and median PFS of 13.0 months (69), which warrants further assessment in an ongoing phase III KEYNOTE811 trial (NCT03615326) (Table 1). Also, a phase II trial of margetuximab (an Fc-optimized, anti-HER2 monoclonal antibody) plus pembrolizumab showed ORR of 33% and DCR of 69% for HER2 3+ AGC patients (70). A phase II/III MAHOGANY trial (NCT4082364) of margetuximab plus anti-PD1 antibody for AGC is also underway (Table 1). Trastuzumab deruxtecan (T-DXd) is an antibody-drug conjugate composed of an anti-HER2 antibody, a cleavable tetrapeptide-based linker, and a cytotoxic topoisomerase I inhibitor. T-Dxd showed survival benefit in HER2 positive gastric cancer at third-line or later line compared with standard chemotherapy (irinotecan or paclitaxel) (71). Meanwhile, T-DXd enhanced antitumour immunity, as evidenced by the increased expression of markers of dendritic cells, augmented expression of MHC class I on tumour cells in the mouse model (72). Combination with an immune checkpoint inhibitor is currently under investigation in a phases I/II trial (NCT04379596). Summary Current standard position of anti-PD1 monotherapy for AGC is at third- or later-line with nivolumab or at second-line with pembrolizumab for MSI-H/MMR-D tumours based on available evidences. However, it remains unclear how to select nivolumab or other available treatments such as irinotecan or trifluridine/tipiracil as a third- or later-line treatment for AGC. Thus, the optimal treatment sequences of these agents warrant further investigation in a future study. Given that the efficacy of PD-1 blockade might be limited in a small subset of AGC patients with MSS/MMR-P tumour, better biomarkers to select optimal patients for single-agent anti-PD-1 or PD-L1 inhibitors in earlier treatment lines or combination therapy to overcome resistance should be also established in the near future. Funding The study was supported in part by the National Cancer Center Research and Development Funds (2020-J-3). Conflict of interest statement A.K. reports grants and personal fees from Taiho, grants and personal fees from Ono, grants from Sumitomo Dainippon, grants from MSD, outside the submitted work. K.S. reports paid for consulting or advisory roles from Astellas, Lilly, Bristol-Myers Squibb, Takeda, Pfizer, Ono, and MSD; honoraria from Novartis, AbbVie, and Yakult; and research funding from Astellas, Lilly, Ono, Sumoitomo Dainippon, Daiichi Sankyo, Taiho, Chugai, MSD and Medi Science. N.B. reports grants from Taiho Pharmaceutical Co. and Takeda Pharmaceutical Company Limited, and personal fees from Taiho Pharmaceutical Co, Ono Pharmaceutical Co. and Bristol-Myers Squibb outside the submitted work. T.Y. reports Lecture fee from MSD, BM, Taiho, Lilly, Chugai, Daiichi-Sankyo, Nihon-Kayaku, Pfizer, Covidien, Johnson and Johnson, and Terumo and Grant from Lilly. M.T. reports personal fees from Taiho, personal fees from Chugai, personal fees from Ono, personal fees from BMS, personal fees from Yakult, personal fees from Takeda, personal fees from Eli Lilly, personal fees from Pfizer, personal fees from Daiichi Sankyo, outside the submitted work. References 1. International Agency for Research on Cancer . Globocan 2018: stomach . https://gco.iarc.fr/today/data/factsheets/cancers/7-Stomach-fact-sheet.pdf (4 October 2018, date last accessed) . 2. Cunningham D , Starling N, Rao S et al. Capecitabine and oxaliplatin for advanced esophagogastric cancer . N Engl J Med 2008 ; 358 : 36 – 46 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Koizumi W , Narahara H, Hara T et al. S-1 plus cisplatin versus S-1 alone for first-line treatment of advanced gastric cancer (SPIRITS trial): a phase III trial . Lancet Oncol 2008 ; 9 : 215 – 21 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Bang YJ , Van Cutsem E, Feyereislova A et al. Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, randomized controlled trial . Lancet 2010 ; 376 : 687 – 97 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Wilke H , Muro K, Van Cutsem E et al. Ramucirumab plus paclitaxel versus placebo plus paclitaxel in patients with previously treated advanced gastric or gastro-oesophageal junction adenocarcinoma (RAINBOW): a double-blind, randomised phase 3 trial . Lancet Oncol 2014 ; 15 : 1224 – 35 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Topalian SL , Hodi FS, Brahmer JR et al. Safety, activity, and immune correlates of anti-PD-1 antibody in cancer . N Engl J Med 2012 ; 366 : 2443 – 54 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Robert C , Long GV, Brady B et al. Nivolumab in previously untreated melanoma without BRAF mutation . N Engl J Med 2015 ; 372 : 320 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Reck M , Rodríguez-Abreu D, Robinson AG et al. Pembrolizumab versus chemotherapy for PD-L1-positive non-small-cell lung cancer . N Engl J Med 2016 ; 375 : 1823 – 33 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Herbst RS , Baas P, Kim DW et al. Pembrolizumab versus docetaxel for previously treated, PD-L1-positive, advanced non-small-cell lung cancer (KEYNOTE-010): a randomised controlled trial . Lancet 2016 ; 387 : 1540 – 50 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Motzer RJ , Escudier B, McDermott DF et al. Nivolumab versus everolimus in advanced renal-cell carcinoma . N Engl J Med 2015 ; 373 : 1803 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Pardoll DM . The blockade of immune checkpoints in cancer immunotherapy . Nat Rev Cancer 2012 ; 12 : 252 – 64 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Kang YK , Boku N, Satoh T et al. Nivolumab in patients with advanced gastric or gastro-oesophageal junction cancer refractory to, or intolerant of, at least two previous chemotherapy regimens (ONO-4538-12, ATTRACTION-2): a randomised, doubleblind, placebo-controlled, phase 3 trial . Lancet 2017 ; 390 : 2461 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Fuchs CS , Doi T, Jang RW et al. Safety and efficacy of Pembrolizumab Monotherapy in patients with previously treated advanced gastric and Gastroesophageal junction cancer: phase 2 clinical KEYNOTE-059 trial . JAMA Oncol 2018 ; 4 :e180013. Google Scholar OpenURL Placeholder Text WorldCat 14. Japanese gastric cancer treatment guidelines 2018 (5th edition) . Gastric Cancer . 2020 . https://doi.org/10.1007/s10120-020-01042-y (20 October 2020, date last accessed). OpenURL Placeholder Text WorldCat 15. http://www.jgca.jp/pdf/news20190318.pdf 16. Chen LT , Kang YK, Satoh T et al. A phase III study of nivolumab (Nivo) in previously treated advanced gastric or gastric esophageal junction (G/GEJ) cancer (ATTRACTION-2): three-year update data . J Clin Oncol 2020 ; 38 : 383 – 3 . Google Scholar Crossref Search ADS WorldCat 17. Bang YJ , Ruiz EY, Van Cutsem E et al. Phase III, randomised trial of Avelumab versus Physician's choice of chemotherapy as third-line treatment of patients with advanced gastric or gastro-oesophageal junction cancer: primary analysis of JAVELIN gastric 300 . Ann Oncol 2018 ; 29 : 2052 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Shitara K , Ozguroglu M, Bang YJ et al. Pembrolizumab versus paclitaxel for previously treated, advanced gastric or gastro-oesophageal junction cancer (KEYNOTE-061): a randomised, open-label, controlled, phase 3 trial . Lancet 2018 ; 392 : 123 – 33 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Shitara K , Van Cutsem E, Bang YJ et al. Efficacy and Safety of Pembrolizumab or Pembrolizumab Plus Chemotherapy vs Chemotherapy Alone for Patients With First-line, Advanced Gastric Cancer: The KEYNOTE-062 Phase 3 Randomized Clinical Trial . JAMA Oncol 2020 ; 6 : 1 – 10 . Google Scholar Crossref Search ADS WorldCat 20. Shiono A , Kaira K, Mouri A et al. Improved efficacy of ramucirumab plus docetaxel after nivolumab failure in previously treated non-small cell lung cancer patients . Thorac Cancer 2019 ; 10 : 775 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Park SE , Lee SH, Ahn JS, Ahn MJ, Park K, Sun JM. Increased response rates to salvage chemotherapy administered after PD-1/PD-L1 inhibitors in patients with non-small cell lung cancer . J Thorac Oncol 2018 ; 13 : 106 – 11 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Schvartsman G , Peng SA, Bis G, Lee JJ, Benveniste MFK, Zhang J et al. Response rates to single-agent chemotherapy after exposure to immune checkpoint inhibitors in advanced non-small cell lung cancer . Lung Cancer 2017 ; 112 : 90 – 5 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Harada D , Takata K, Mori S et al. Previous immune checkpoint inhibitor treatment to increase the efficacy of Docetaxel and Ramucirumab combination chemotherapy . Anticancer Res 2019 ; 39 : 4987 – 93 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Moehler MH , Dvorkin M, Ozguroglu M et al. Results of the JAVELIN gastric 100 phase 3 trial: avelumab maintenance following first-line (1L) chemotherapy (CTx) vs continuation of CTx for HER2− advanced gastric or gastroesophageal junction cancer (GC/GEJC) . J Clin Oncol 2020 ; 38 : 278 – 8 . Google Scholar Crossref Search ADS WorldCat 25. Liu J , Blake SJ, Yong MC et al. Improved efficacy of neoadjuvant compared to adjuvant immunotherapy to eradicate metastatic disease . Cancer Discov 2016 ; 6 : 1382 – 99 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Schmid P , Cortes J, Pusztai L et al. Pembrolizumab for early triple-negative breast Cance . N Engl J Med 2020 ; 382 : 810 – 21 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Shu CA , Gainor JF, Awad MM et al. Neoadjuvant Atezolizumab and chemotherapy in patients with Resectable non-small-cell lung cancer: an open-label, multicentre, single-arm, phase 2 trial . Lancet Oncol 2020 ; 21 : 786 – 95 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Huang AC , Orlowski RJ, Xu X et al. A single dose of Neoadjuvant PD-1 blockade predicts clinical outcomes in Resectable melanoma . Nat Med 2019 ; 25 : 454 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Uppaluri R , Zolkind P, Lin T et al. Neoadjuvant pembrolizumab in surgically resectable, locally advanced HPV negative head and neck squamous cell carcinoma (HNSCC) . J Clin Oncol 2017 ; 35 : 6012 – 2 . Google Scholar Crossref Search ADS WorldCat 30. Eggermont AMM , Blank CU, Mandala M et al. Adjuvant Pembrolizumab versus placebo in resected stage III melanoma . N Engl J Med 2018 ; 378 : 1789 – 801 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Weber J , Mandala M, Del Vecchio M et al. Adjuvant Nivolumab versus Ipilimumab in resected stage III or IV melanoma . N Engl J Med 2017 ; 377 : 1824 – 35 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Kawazoe A , Yamaguchi K, Yasui H et al. Safety and efficacy of Pembrolizumab in combination with S-1 plus Oxaliplatin as a first-line treatment in patients with advanced gastric/gastroesophageal junction cancer: cohort 1 data from the KEYNOTE-659 phase IIb study . Eur J Cancer 2020 ; 129 : 97 – 106 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Kawazoe A , Kuwata T, Kuboki Y et al. Clinicopathological features of programmed death ligand 1 expression with tumour-infiltrating lymphocyte, mismatch repair, and Epstein-Barr virus status in a large cohort of gastric cancer patients . Gastric Cancer 2017 ; 20 : 407 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat 34. The Cancer Genome Atlas Research Network . Comprehensive molecular characterization of gastric adenocarcinoma . Nature 2014 ; 513 : 202 – 9 . Crossref Search ADS PubMed WorldCat 35. Cristescu R , Lee J, Nebozhyn M et al. Molecular analysis of gastric cancer identifies subtypes associated with distinct clinical outcomes . Nat Med 2015 ; 21 : 449 – 56 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Llosa NJ , Cruise M, Tam A et al. The vigorous immune microenvironment of microsatellite instable colon cancer is balanced by multiple counter-inhibitory checkpoints . Cancer Discov 2015 ; 5 : 43 – 51 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Le DT , Uram JN, Wang H et al. PD-1 blockade in tumors with mismatch-repair deficiency . N Engl J Med 2015 ; 372 : 2509 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Le DT , Durham JN, Smith KN et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade . Science 2017 ; 357 : 409 – 13 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Marabelle A , Le DT, Ascierto PA et al. Efficacy of Pembrolizumab in patients with noncolorectal high microsatellite instability/mismatch repair-deficient cancer: results from the phase II KEYNOTE-158 study . J Clin Oncol 2020 ; 38 : 1 – 10 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Le DT , Kim TW, Van Cutsem E et al. Phase II open-label study of Pembrolizumab in treatment-refractory, microsatellite instability-high/mismatch repair-deficient metastatic colorectal cancer: KEYNOTE-164 . J Clin Oncol 2020 ; 38 : 11 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Muro K , Van Cutsem E, Narita Y et al. Pan-Asian adapted ESMO clinical practice guidelines for the management of patients with metastatic gastric cancer; a JSMO-ESMO initiative endorsed by CSCO, KSMO, MOS, SSO and TOS . Ann Oncol 2019 ; 30 : 19 – 33 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Samstein RM , Lee CH, Shoushtari AN et al. Tumor mutational load predicts survival after immunotherapy across multiple cancer types . Nat Genet 2019 ; 51 : 202 – 6 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Marabelle A , Fakih M, Lopez J et al. Association of Tumor Mutational Burden with outcomes in patients with select advanced solid Tumors treated with Pembrolizumab in KEYNOTE-158 . Ann Oncol 2019 ; 30 : v475 – 532 . Google Scholar OpenURL Placeholder Text WorldCat 44. Kim ST , Cristescu R, Bass AJ et al. Comprehensive molecular characterization of clinical responses to PD-1 inhibition in metastatic gastric cancer . Nat Med 2018 ; 24 : 1449 – 58 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Wang F , Wei1 XL, Wang FH et al. Safety, efficacy and tumor mutational burden as a biomarker of overall survival benefit in chemo-refractory gastric cancer treated with toripalimab, a PD-1 antibody in phase Ib/II clinical trial NCT02915432 . Ann Oncol 2019 ; 30 : 1479 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Kim JH , Ryu MH, Park YS et al. Predictive biomarkers for the efficacy of nivolumab as ≥ third-line therapy in patients with advanced gastric cancer (AGC): from a subset analysis of ATTRACTION-2 phase III trial . J Clin Oncol 2019 ; 37 : 152 – 2 . Google Scholar Crossref Search ADS WorldCat 47. Fuchs CS , Özgüroğlu M, Bang YJ et al. The Association of Molecular Biomarkers with efficacy of Pembrolizumab versus paclitaxel in patients with gastric cancer from KEYNOTE-061 . J Clin Oncol 2020 ; 38 : 4512 – 2 . Google Scholar Crossref Search ADS WorldCat 48. Shitara K , Özgüroğlu M, Bang YJ et al. The association of tissue tumor mutational burden using the foundation medicine genomic platform with efficacy of Pembrolizumab versus paclitaxel in patients with gastric cancer from KEYNOTE-061 . J Clin Oncol 2020 ; 38 : 4537 – 7 . Google Scholar Crossref Search ADS WorldCat 49. Panda A , Mehnert JM, Hirshfield KM et al. Immune activation and benefit from avelumab in EBV-positive gastric cancer . J Natl Cancer Inst 2018 ; 110 : 316 – 20 . Google Scholar Crossref Search ADS PubMed WorldCat 50. Kubota Y , Kawazoe A, Sasaki A et al. The impact of molecular subtype on efficacy of chemotherapy and checkpoint inhibition in advanced gastric cancer . Clin Cancer Res 2020 . doi: 10.1158/1078-0432.CCR-20-0075 . Google Scholar OpenURL Placeholder Text WorldCat Crossref 51. Champiat S , Dercle L, Ammari S et al. Hyperprogressive disease is a new pattern of progression in cancer patients treated by anti-PD-1/PD-L1 . Clin Cancer Res 2017 ; 23 : 1920 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 52. Saada-Bouzid E , Defaucheux C, Karabajakian A et al. Hyperprogression during anti-PD-1/PD-L1 therapy in patients with recurrent and/or metastatic head and neck squamous cell carcinoma . Ann Oncol 2017 ; 28 : 1605 – 11 . Google Scholar Crossref Search ADS PubMed WorldCat 53. Kato S , Goodman A, Walavalkar V, Barkauskas DA, Sharabi A, Kurzrock R. Hyperprogressors after immunotherapy: analysis of genomic alterations associated with accelerated growth rate . Clin Cancer Res 2017 ; 23 : 4242 – 50 . Google Scholar Crossref Search ADS PubMed WorldCat 54. Kurman JS , Murgu SD. Hyperprogressive disease in patients with non-small cell lung cancer on immunotherapy . J Thorac Dis 2018 ; 10 : 1124 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 55. Sasaki A , Nakamura Y, Mishima S et al. Predictive factors for hyperprogression during nivolumab treatment in patients with advanced gastric cancer . Gastric Cancer 2019 ; 22 : 793 – 802 . Google Scholar Crossref Search ADS PubMed WorldCat 56. Aoki M , Shoji H, Nagashima K et al. Hyperprogressive disease during nivolumab or irinotecan treatment in patients with advanced gastric cancer . ESMO Open 2019 ; 4 :e000488. Google Scholar OpenURL Placeholder Text WorldCat 57. Kamada T , Togashi Y, Tay C et al. PD-1 + regulatory T cells amplified by PD-1 blockade promote Hyperprogression of cancer . Proc Natl Acad Sci USA 2019 ; 116 : 9999 – 10008 . Google Scholar Crossref Search ADS PubMed WorldCat 58. Lo Russo G , Moro M, Sommariva M et al. Antibody-fc/FcR interaction on macrophages as a mechanism for hyperprogressive disease in non-small cell lung cancer subsequent to PD-1/PD-L1 blockade . Clin Cancer Res 2019 ; 25 : 989 – 99 . Google Scholar Crossref Search ADS PubMed WorldCat 59. Togashi Y , Shitara K, Nishikawa H. Regulatory T cells in cancer immunosuppression - implications for anticancer therapy . Nat Rev Clin Oncol 2019 ; 16 : 356 – 71 . Google Scholar Crossref Search ADS PubMed WorldCat 60. Mantovani A , Marchesi F, Malesci A et al. Tumour-associated macrophages as treatment targets in oncology . Nat Rev Clin Oncol 2017 ; 14 : 399 – 416 . Google Scholar Crossref Search ADS PubMed WorldCat 61. Arlauckas SP , Garris CS, Kohler RH et al. In vivo imaging reveals a tumor-associated macrophage-mediated resistance pathway in anti-PD-1 therapy . Sci Transl Med 2017 ;9; eaal3604 . Google Scholar OpenURL Placeholder Text WorldCat 62. Roland CL , Lynn KD, Toombs JE et al. Cytokine levels correlate with immune cell infiltration after anti-VEGF therapy in preclinical mouse models of breast cancer . PLoS One 2009 ; 4 :e7669. Google Scholar OpenURL Placeholder Text WorldCat 63. Herbst RS , Arkenau HT, Santana-Davila R et al. Ramucirumab plus Pembrolizumab in patients with previously treated advanced non-small-cell lung cancer, gastro-oesophageal cancer, or Urothelial carcinomas (JVDF): a multicohort, non-randomised, open-label, phase 1a/b trial . Lancet Oncol 2019 ; 20 : 1109 – 23 . Google Scholar Crossref Search ADS PubMed WorldCat 64. Hara H , Takahari D, Esaki T et al. Phase I/II study of ramucirumab plus nivolumab in patients in second-line treatment for advanced gastric adenocarcinoma (NivoRam study) . J Clin Oncol 2019 ; 37 : 129 . Google Scholar Crossref Search ADS WorldCat 65. Kadowaki S , Minashi S, Nishina T et al. Multicenter phase I/II study of nivolumab combined with paclitaxel plus ramucirumab as the second-line treatment in patients with advanced gastric cancer . Ann Oncol 2019 ; 30 :iv122. Google Scholar OpenURL Placeholder Text WorldCat 66. Fukuoka S , Hara H, Takahashi N et al. Regorafenib plus nivolumab in patients with advanced gastric or colorectal cancer: an open-label, dose-escalation, and dose-expansion phase Ib trial (REGONIVO, EPOC1603) . J Clin Oncol 2020 ; 38 : 2053 – 61 . Google Scholar Crossref Search ADS PubMed WorldCat 67. Kawazoe A , Fukuoka S, Nakamura Y et al. Lenvatinib plus pembrolizumab in patients with advanced gastric cancer in the first-line or second-line setting (EPOC1706): an open-label, single-arm, phase 2 trial . Lancet Oncol 2020 ; 23 : P1057 – 65 . Google Scholar Crossref Search ADS WorldCat 68. Taylor C , Hershman D, Shah N et al. Augmented HER-2 specific immunity during treatment with trastuzumab and chemotherapy . Clin Cancer Res 2007 ; 13 : 5133 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat 69. Janjigian YY , Maron SB, Chatila WK et al. First-line Pembrolizumab and Trastuzumab in HER2-positive oesophageal, gastric, or gastro-oesophageal junction cancer: an open-label, single-arm, phase 2 trial . Lancet Oncol 2020 ; 21 : 821 – 31 . Google Scholar Crossref Search ADS PubMed WorldCat 70. Catenacci DVT , Lim KH, Uronis HE et al. Antitumor activity of margetuximab (M) plus pembrolizumab (P) in patients (pts) with advanced HER2+ (IHC3+) gastric carcinoma (GC) . J Clin Oncol 2019 ; 37 : 65 – 5 . Google Scholar Crossref Search ADS WorldCat 71. Shitara K , Bang YJ, Iwasa S et al. Trastuzumab Deruxtecan in previously treated HER2-positive gastric cancer . N Engl J Med 2020 ; 382 : 2419 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 72. Iwata TN , Ishii C, Ishida S et al. A HER2-targeting antibody-drug conjugate, Trastuzumab Deruxtecan (DS-8201a), enhances antitumour immunity in a mouse model . Mol Cancer Ther 2018 ; 17 : 1494 – 503 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Yotsukura,, Masaya;Nakagawa,, Kazuo;Suzuki,, Kenji;Takamochi,, Kazuya;Ito,, Hiroyuki;Okami,, Jiro;Aokage,, Keiju;Shiono,, Satoshi;Yoshioka,, Hiroshige;Aoki,, Tadashi;Tsutani,, Yasuhiro;Okada,, Morihito;Watanabe,, Shun-ichi;the Lung Cancer Surgical Study Group (LCSSG) of the Japan Clinical Oncology Group, (JCOG)

Naito,, Tomoyuki;Shiraishi,, Hideaki;Fujiwara,, Yutaka

doi: 10.1093/jjco/hyaa192pmid: 33147606

Abstract Major issues in anaplastic lymphoma kinase-positive non-small cell lung carcinoma are acquired resistance against anaplastic lymphoma kinase inhibitors and control of central nervous system metastasis. The development of these inhibitors has changed therapeutic strategy in patients with advanced anaplastic lymphoma kinase-positive non-small cell lung carcinoma. Brigatinib and lorlatinib were designed to penetrate the blood–brain barrier and to inhibit resistant mutations against anaplastic lymphoma kinase inhibitors. We review the clinical data supporting treatment of advanced anaplastic lymphoma kinase-positive non-small cell lung carcinoma with brigatinib and lorlatinib. Brigatinib has shown promising antitumour activity, including substantial activity against central nervous system metastases, in crizotinib-treated (ALTA trial) patients and crizotinib-naïve (ALTA-1L trial) patients with anaplastic lymphoma kinase-positive non-small cell lung carcinoma. In addition, brigatinib improved progression-free survival compared with crizotinib in anaplastic lymphoma kinase inhibitor-naïve patients with anaplastic lymphoma kinase-positive non-small cell lung carcinoma. Lorlatinib has demonstrated clinical antitumour activity against both intracranial and extracranial lesions in patients with anaplastic lymphoma kinase- or c-ros oncogene 1 (ROS1)-positive non-small cell lung carcinoma. Ongoing trials and further studies of these agents’ biological and clinical properties would provide insight into the optimal therapeutic strategy for administering them to achieve the best survival benefit. ALK, brigatinib, lorlatinib, non-small cell lung carcinoma, ROS1 Introduction Anaplastic lymphoma kinase (ALK) gene translocations are present in ~5% of non-small cell lung carcinomas (NSCLC) (1–3). The development of ALK inhibitors has enlarged the therapeutic strategies in patients with ALK-positive NSCLC. Crizotinib was the first ALK inhibitor to be approved for treatment of patients with ALK-positive NSCLC (4). Though crizotinib improves survival in patients with ALK-positive NSCLC (5,6), most patients with ALK-positive NSCLC relapse on crizotinib because of acquired resistance (5,6). Mutations in the ALK domain, including G1269A, L1196M, C1156Y, L1152R, S1206Y, 1151Tins, G1202R and F1174L, as well as amplification and upregulation of bypass signalling pathways, have been demonstrated as contributing to crizotinib resistance (7–10). Second-generation ALK inhibitors such as alectinib and ceritinib have shown antitumour activity and improvement of survival in patients with crizotinib-resistant ALK-positive NSCLC (11–13). In vitro, ceritinib potently overcomes crizotinib-resistant mutations, such as G1269A, L1196M, C1156Y and S1206Y; however, ceritinib did not overcome two mutations, G1202R and F1174C, and one of these mutations was observed in 5 of 11 patients with acquired resistance to ceritinib (Table 1) (12,14,15). Alectinib-resistant mutations, G1202R, V1180L and I1171T, have also been reported (12,16,17). Table 1 IC50 of crizotinib, ceritinib, alectinib, brigatinib, lorlatinib on cellular ALK phosphorylation in Ba/F3 cells harbouring native EML4-ALK variant 1 or ALK-resistant mutations (12,14,15) Open in new tab Table 1 IC50 of crizotinib, ceritinib, alectinib, brigatinib, lorlatinib on cellular ALK phosphorylation in Ba/F3 cells harbouring native EML4-ALK variant 1 or ALK-resistant mutations (12,14,15) Open in new tab Central nervous system (CNS) metastasis is a major concern in lung cancer. CNS metastases are present at diagnosis in ~30% of patients with ALK-positive NSCLC (18). The blood–brain barrier (BBB) contributes to CNS homeostasis by protecting the CNS from potentially harmful substance (19). BBB active drug efflux transporters of the adenosine triphosphate (ATP)-binding cassette gene family, such as the P-glycoprotein, the multidrug resistance protein and breast cancer resistance protein, are recognized to be important for drug disposition and response (20–24). Consequences of ATP-binding cassette efflux transporters in the BBB include minimizing or avoiding neurotoxic adverse effects of drugs; however, ABC efflux transporters may also limit the central distribution of drugs that are beneficial to treat CNS metastasis (19). The CNS is the most frequent relapse site in patients treated with crizotinib (25). Use of crizotinib for CNS metastasis in patients with ALK-positive NSCLC resulted in intracranial objective response rates (ORRs) of 18% and 33%, in previously untreated and treated metastases, respectively (25). Alectinib and ceritinib have identifiable antitumour activity against CNS metastasis in crizotinib-resistant ALK-positive NSCLC (13,26). Preclinical studies had shown that alectinib had high penetration into the CNS and was not transported out by P-glycoprotein. However, patients with ALK-positive NSCLC still relapsed with CNS metastasis under treatment with alectinib and ceritinib (27). Brigatinib (AP 26113) and lorlatinib (PF-06463922) were designed to inhibit ALK-resistant mutations and penetrate the BBB (15,28). In this review, we provide an overview of the clinical efficacy and safety of brigatinib and lorlatinib in the treatment of ALK-positive NSCLC. Brigatinib Introduction of brigatinib Brigatinib is a small-molecule tyrosine kinase receptor inhibitor with broad-spectrum in vitro activity against ALK, c-ros oncogene 1 (ROS1), fms-like tyrosine kinase 3 and insulin-like growth factor-1 receptor as well as epidermal growth factor receptor (EGFR) (15,29) (Table 2). Brigatinib showed in vitro activity against a panel of 17 ALK mutations that conferred resistance to crizotinib, ceritinib and alectinib, including C1156Y, I1171S/T, V1180L, L1196M, L1152R/P, E1210K and G1269A (15). In vivo, brigatinib reduced tumour burden and prolonged survival in mice with tumours implanted intracranially with an ALK gene rearrangement tumour cell line (15). Table 2 Characteristics of approved ALK inhibitors Open in new tab Table 2 Characteristics of approved ALK inhibitors Open in new tab Clinical efficacy of brigatinib Phase I/II trial A phase I/II study (NCT01449461) was performed to evaluate the safety and activity of brigatinib in 137 patients with advanced malignancies, particularly ALK-positive NSCLC from nine participating sites in the USA and Spain (30) (Table 3). The primary endpoint of phase I was establishment of the recommended phase II dose. In phase I, using a dose escalation 3 + 3 design (total daily doses of 30–300 mg), dose-limiting toxicities (DLT) included grade 3 increases in liver enzymes [240 mg per day (q.d.)] and grade 4 dyspnoea (300 mg q.d.). A dose of 180 mg q.d. was chosen as the recommended phase II dose. However, early-onset pulmonary events (EOPEs), such as dyspnoea, were documented in patients starting at a dose of 180 mg q.d. in the phase II stage. Therefore, the phase II stage examined three oral q.d. regimens (90, 180 and 180 mg with a 7-day dose escalation starting at 90 mg). Patients were enrolled into five cohorts: 4 ALK inhibitor-naïve patients with ALK-positive NSCLC (cohort 1), 42 patients with crizotinib-treated ALK-positive NSCLC (cohort 2), 1 patient with EGFR T790M-positive NSCLC resistant to previous EGFR tyrosine kinase inhibitor (cohort 3), 18 patients with other cancers with abnormalities of molecular pathways targeted by brigatinib (cohort 4) and 6 patients with crizotinib-naïve or crizotinib-treated ALK-positive NSCLC with active intracranial CNS metastases (cohort 5). The primary endpoint of phase II was an objective response to brigatinib in cohorts 1–4. Responses to brigatinib were observed only in NSCLCs: ORRs were 100% in cohort 1, 74% in cohort 2, 0% in cohort 3, 17% in cohort 4 and 83% in cohort 5. Fifty-one (72%) of 71 patients with crizotinib-treated ALK-positive NSCLC had an objective response. All eight patients with crizotinib-naïve ALK-positive NSCLC had an objective response. Three (50%) of six patients in cohort 5 had an intracranial response. The most common grade 3–4 treatment-related adverse events (AEs) across all doses were increased lipase concentration (9%), dyspnoea (6%) and hypertension (5%). Across all doses, EOPEs occurred in 11 (8%) of 137 patients (grade 2: 1 patient, grade 3: 6 patients, grade 4: 2 patients, grade 5: 2 patients). Ten (7%) patients had an event within the first 7 days of initiating treatment. The incidence rate of EOPEs increased with higher starting doses [one (2%) at 90 mg, one (9%) at 120 mg, six (14%) at 180 mg, one (10%) at 240 mg and one (50%) at 300 mg]. None of the 32 patients treated with 180 mg q.d. with a 7-day dose escalation from 90 mg had an EOPE after escalation to 180 mg. Consequently, both brigatinib 90 mg q.d. and 180 mg q.d. with a 7-day dose escalation from 90 mg were recommended. Table 3 Clinical efficacy of brigatinib and lorlatinib in patients with advanced ALK-positive NSCLC Brigatinib . Clinical trial (reference) . Phase . Treatment arm . N . Previous ALK-TKI . ORR (%) . Intracranial response rate (%) . Phase II (30) . II . B 90–180 mg . 4 . — . 100 . 50 . 42 . C . 74 . ALTA (31) . II . B 90 mg . 112 . C . 45 . 42 . B 90 mg 7 day → 180 mg . 110 . 54 . 67 . J-ALTA (32) . II . B 90 mg 7 day → 180 mg . 72 . A . 30 . 25 . ALTA-1 L (34–36) . III . B 90 mg 7 day → 180 mg . 137 . — . 71 . 78 . C 500 mg . 138 . — . 60 . 26 . Lorlatinib Phase I/II (45, 47) II L 100 mg 30 (EXP1) — 90 67 59 (EXP2-3A) 1 TKI (C) 70 87 28 (EXP3B) 1 TKI (except C) 33 55 111 (EXP4–5) ≥2 TKIs 39 53 39 (Japanese) 1 TKI 55 47 Brigatinib . Clinical trial (reference) . Phase . Treatment arm . N . Previous ALK-TKI . ORR (%) . Intracranial response rate (%) . Phase II (30) . II . B 90–180 mg . 4 . — . 100 . 50 . 42 . C . 74 . ALTA (31) . II . B 90 mg . 112 . C . 45 . 42 . B 90 mg 7 day → 180 mg . 110 . 54 . 67 . J-ALTA (32) . II . B 90 mg 7 day → 180 mg . 72 . A . 30 . 25 . ALTA-1 L (34–36) . III . B 90 mg 7 day → 180 mg . 137 . — . 71 . 78 . C 500 mg . 138 . — . 60 . 26 . Lorlatinib Phase I/II (45, 47) II L 100 mg 30 (EXP1) — 90 67 59 (EXP2-3A) 1 TKI (C) 70 87 28 (EXP3B) 1 TKI (except C) 33 55 111 (EXP4–5) ≥2 TKIs 39 53 39 (Japanese) 1 TKI 55 47 NSCLC, non-small-cell lung carcinoma; ORR, objective response rate; B, brigatinib; C, crizotinib; A, alectinib; L, lorlatinib. Open in new tab Table 3 Clinical efficacy of brigatinib and lorlatinib in patients with advanced ALK-positive NSCLC Brigatinib . Clinical trial (reference) . Phase . Treatment arm . N . Previous ALK-TKI . ORR (%) . Intracranial response rate (%) . Phase II (30) . II . B 90–180 mg . 4 . — . 100 . 50 . 42 . C . 74 . ALTA (31) . II . B 90 mg . 112 . C . 45 . 42 . B 90 mg 7 day → 180 mg . 110 . 54 . 67 . J-ALTA (32) . II . B 90 mg 7 day → 180 mg . 72 . A . 30 . 25 . ALTA-1 L (34–36) . III . B 90 mg 7 day → 180 mg . 137 . — . 71 . 78 . C 500 mg . 138 . — . 60 . 26 . Lorlatinib Phase I/II (45, 47) II L 100 mg 30 (EXP1) — 90 67 59 (EXP2-3A) 1 TKI (C) 70 87 28 (EXP3B) 1 TKI (except C) 33 55 111 (EXP4–5) ≥2 TKIs 39 53 39 (Japanese) 1 TKI 55 47 Brigatinib . Clinical trial (reference) . Phase . Treatment arm . N . Previous ALK-TKI . ORR (%) . Intracranial response rate (%) . Phase II (30) . II . B 90–180 mg . 4 . — . 100 . 50 . 42 . C . 74 . ALTA (31) . II . B 90 mg . 112 . C . 45 . 42 . B 90 mg 7 day → 180 mg . 110 . 54 . 67 . J-ALTA (32) . II . B 90 mg 7 day → 180 mg . 72 . A . 30 . 25 . ALTA-1 L (34–36) . III . B 90 mg 7 day → 180 mg . 137 . — . 71 . 78 . C 500 mg . 138 . — . 60 . 26 . Lorlatinib Phase I/II (45, 47) II L 100 mg 30 (EXP1) — 90 67 59 (EXP2-3A) 1 TKI (C) 70 87 28 (EXP3B) 1 TKI (except C) 33 55 111 (EXP4–5) ≥2 TKIs 39 53 39 (Japanese) 1 TKI 55 47 NSCLC, non-small-cell lung carcinoma; ORR, objective response rate; B, brigatinib; C, crizotinib; A, alectinib; L, lorlatinib. Open in new tab ALTA trial The ALTA trial (NCT02094573) was a phase II, multicentre, randomized study that evaluated brigatinib in patients with crizotinib-refractory ALK-positive NSCLC (31). A total of 222 patients were randomly assigned to oral brigatinib 90 mg q.d. (112 patients, arm A) or 180 mg with a 7-day dose escalation starting at 90 mg q.d. (110 patients, arm B). The primary endpoint was investigator-assessed confirmed ORR. Investigator-assessed ORRs were 45% in arm A and 54% in arm B. Intracranial response rates were 42% (11 of 26 patients) in arm A and 67% (12 of 18 patients) in arm B. Investigator-assessed median progression-free survival (PFS) was 9.2 months in arm A and 12.9 months in arm B. The PFS hazard ratio (HR) was 0.55 [95% confidence interval (CI): 0.3–0.86; arm B vs. arm A]. The 1-year overall survival (OS) rates were 71% in arm A and 80% in arm B. Common treatment-related AEs were nausea (arm A: 33%, arm B: 40%), diarrhoea (arm A: 19%, arm B: 38%), headache (arm A: 28%, arm B: 27%) and cough (arm A: 18%, arm B: 34%). EOPEs were observed (median onset: day 2) in 6% of 222 patients (all grades: 6%, grade 3: 3%); none occurred after escalation to 180 mg in arm B. Of 14 patients with EOPEs, 7 patients were successfully retreated with brigatinib. A dose of brigatinib 180 mg q.d. starting with a 7-day dose escalation from 90 mg showed consistently better efficacy than that of 90 mg q.d., with acceptable safety. J-ALTA trial The J-ALTA trial (NCT03410108) was a single-arm, phase II trial to evaluate efficacy and safety of oral brigatinib 180 mg q.d. with a 7-day dose escalation starting at 90 mg q.d. in Japanese patients with ALK-positive NSCLC. A total of 72 patients who have progressed on alectinib with or without prior crizotinib were enrolled (32). The primary endpoint was investigator-assessed ORR. The investigator-assessed ORR was 30% and intracranial response rate was 25%. The median PFS was 7.3 months. Common severe treatment-related AEs included blood creatine phosphokinase increase (18%), lipase increase (14%), hypertension (11%), amylase increase (4%) and pneumonitis (1%). Brigatinib also demonstrated efficacy in patients with refractory secondary mutations in the ALK domain, including G1202R, I1171N, V1180L and L1196M. On the basis of the ALTA and J-ALTA trials, brigatinib received approval in the USA, the European Union (EU), Japan, China and in many other countries for the treatment of patients with advanced ALK-positive NSCLC who have progressed on or are intolerant of crizotinib (33). ALTA-1L trial The ALTA-1L trial (NCT02094573) was an open-label, phase III, international randomized study that compared the efficacy of brigatinib with crizotinib in patients with ALK-positive NSCLC who had not previously received ALK inhibitors (34–36). A total of 275 patients were randomly assigned (1:1) to brigatinib 180 mg q.d. with a 7-day dose escalation starting at 90 mg q.d. or twice daily (b.i.d.) crizotinib 250 mg. The primary endpoint was PFS. Secondary endpoints were ORR and intracranial response rate. Interim analysis of the 1-year PFS rate was reported first (34), followed by a 2-year updated result (35, 36). At the data cutoff for the second interim analysis, the median PFS in the brigatinib group was statistically higher than that in the crizotinib group (29.4 vs. 9.2 months, HR: 0.49; 95% CI: 0.35–0.68, P < 0.001). The confirmed ORRs were 71% with brigatinib and 60% with crizotinib. Intracranial response rates were 78% in the brigatinib group and 26% in the crizotinib group. New safety concerns were not reported (Table 4). On the basis of the ALTA-1L trial, brigatinib received approval in the USA and the EU as first-line treatment for patients with ALK-positive NSCLC (33). Table 4 Major AEs of approved ALK inhibitors in pivotal studies Drug [trial (REF)] . Crizotinib [PROFILE 1007 (5)] . Alectinib [Alex (59)] . Ceritinib [ACEND-5 (60)] . Brigatinib [ALTA-1 L (34)] . Lorlatinib [Phase II (45)] . All Grade (%) > 20% . Nausea (56%) Diarrhoea (55%) Constipation (42%) Vomiting (39%) Edema (39%) Increased ALT (32%) . Constipation (34%) Fatigue (26%) Myalgia (23%) Edema (22%) . Diarrhoea (72%) Nausea (66%) Vomiting (52%) Increased ALT (43%) Anorexia (42%) Increased AST (37%) Weight loss (30%) . Fatigue (27%) Increased ALP (23%) Increased GGT (23%) Asthenia (22%) Abdominal pain (22%) Back pain (22%) . Diarrhoea (49%) Increased CK (39%) Nausea (26%) Cough (25%) Hypertension (23%) . Hypercholesterolaemia (81%) Hypertriglyceridaemia (61%) Edema (43%) Peripheral neuropathy (30%) . Grade 3–4 (%) > 5% Increased ALT (9%) Increased AST (5%) Increased ALT (5%) Anaemia (5%) Increased ALT (21%) Increased GGT (21%) Increased AST (14%) Nausea (8%) Vomiting (8%) Increased ALP (6%) Increased CK (16%) Increased lipase (13%) Hypertension (10%) Hypertriglyceridaemia (16%) Hypercholesterolaemia (15%) Drug [trial (REF)] . Crizotinib [PROFILE 1007 (5)] . Alectinib [Alex (59)] . Ceritinib [ACEND-5 (60)] . Brigatinib [ALTA-1 L (34)] . Lorlatinib [Phase II (45)] . All Grade (%) > 20% . Nausea (56%) Diarrhoea (55%) Constipation (42%) Vomiting (39%) Edema (39%) Increased ALT (32%) . Constipation (34%) Fatigue (26%) Myalgia (23%) Edema (22%) . Diarrhoea (72%) Nausea (66%) Vomiting (52%) Increased ALT (43%) Anorexia (42%) Increased AST (37%) Weight loss (30%) . Fatigue (27%) Increased ALP (23%) Increased GGT (23%) Asthenia (22%) Abdominal pain (22%) Back pain (22%) . Diarrhoea (49%) Increased CK (39%) Nausea (26%) Cough (25%) Hypertension (23%) . Hypercholesterolaemia (81%) Hypertriglyceridaemia (61%) Edema (43%) Peripheral neuropathy (30%) . Grade 3–4 (%) > 5% Increased ALT (9%) Increased AST (5%) Increased ALT (5%) Anaemia (5%) Increased ALT (21%) Increased GGT (21%) Increased AST (14%) Nausea (8%) Vomiting (8%) Increased ALP (6%) Increased CK (16%) Increased lipase (13%) Hypertension (10%) Hypertriglyceridaemia (16%) Hypercholesterolaemia (15%) REF, reference; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALP, alkaline phosphatase; GGT, γ-glutamyl transpeptidase; CK, creatine kinase. Open in new tab Table 4 Major AEs of approved ALK inhibitors in pivotal studies Drug [trial (REF)] . Crizotinib [PROFILE 1007 (5)] . Alectinib [Alex (59)] . Ceritinib [ACEND-5 (60)] . Brigatinib [ALTA-1 L (34)] . Lorlatinib [Phase II (45)] . All Grade (%) > 20% . Nausea (56%) Diarrhoea (55%) Constipation (42%) Vomiting (39%) Edema (39%) Increased ALT (32%) . Constipation (34%) Fatigue (26%) Myalgia (23%) Edema (22%) . Diarrhoea (72%) Nausea (66%) Vomiting (52%) Increased ALT (43%) Anorexia (42%) Increased AST (37%) Weight loss (30%) . Fatigue (27%) Increased ALP (23%) Increased GGT (23%) Asthenia (22%) Abdominal pain (22%) Back pain (22%) . Diarrhoea (49%) Increased CK (39%) Nausea (26%) Cough (25%) Hypertension (23%) . Hypercholesterolaemia (81%) Hypertriglyceridaemia (61%) Edema (43%) Peripheral neuropathy (30%) . Grade 3–4 (%) > 5% Increased ALT (9%) Increased AST (5%) Increased ALT (5%) Anaemia (5%) Increased ALT (21%) Increased GGT (21%) Increased AST (14%) Nausea (8%) Vomiting (8%) Increased ALP (6%) Increased CK (16%) Increased lipase (13%) Hypertension (10%) Hypertriglyceridaemia (16%) Hypercholesterolaemia (15%) Drug [trial (REF)] . Crizotinib [PROFILE 1007 (5)] . Alectinib [Alex (59)] . Ceritinib [ACEND-5 (60)] . Brigatinib [ALTA-1 L (34)] . Lorlatinib [Phase II (45)] . All Grade (%) > 20% . Nausea (56%) Diarrhoea (55%) Constipation (42%) Vomiting (39%) Edema (39%) Increased ALT (32%) . Constipation (34%) Fatigue (26%) Myalgia (23%) Edema (22%) . Diarrhoea (72%) Nausea (66%) Vomiting (52%) Increased ALT (43%) Anorexia (42%) Increased AST (37%) Weight loss (30%) . Fatigue (27%) Increased ALP (23%) Increased GGT (23%) Asthenia (22%) Abdominal pain (22%) Back pain (22%) . Diarrhoea (49%) Increased CK (39%) Nausea (26%) Cough (25%) Hypertension (23%) . Hypercholesterolaemia (81%) Hypertriglyceridaemia (61%) Edema (43%) Peripheral neuropathy (30%) . Grade 3–4 (%) > 5% Increased ALT (9%) Increased AST (5%) Increased ALT (5%) Anaemia (5%) Increased ALT (21%) Increased GGT (21%) Increased AST (14%) Nausea (8%) Vomiting (8%) Increased ALP (6%) Increased CK (16%) Increased lipase (13%) Hypertension (10%) Hypertriglyceridaemia (16%) Hypercholesterolaemia (15%) REF, reference; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALP, alkaline phosphatase; GGT, γ-glutamyl transpeptidase; CK, creatine kinase. Open in new tab ATOMIC ARI-AT-002 trial The ATOMIC ARI-AT-002 trial (NCT02706626) is ongoing. It is a single-arm, phase II study to evaluate efficacy against ALK-resistant mutations after second-generation ALK inhibitor treatment other than brigatinib in patients with ALK-positive NSCLC (37). The dose of brigatinib treatment was 180 mg with a 7-day dose escalation starting at 90 mg q.d. The primary objective is ORR; an ORR of 20% was determined to be worthy of further investigation. Interim analysis of ORR in the first stage with 20 patients was reported (37). Sixteen (80%) of 20 patients had prior alectinib therapy and 6 (30%) of 20 patients had prior ceritinib therapy. ORR was observed in 8 (40%) of 20 patients (partial response (PR): 8 patients, stable disease (SD): 7 patients, progressive disease (PD): 3 patients, not evaluated: 2 patients). This study continues to enrol additional patients. Depending on the result of this study, brigatinib would be proven to have antitumour activity after progression on second-generation ALK inhibitors. AEs of brigatinib (EOPEs) Common AEs due to brigatinib were gastrointestinal disorders (nausea, diarrhoea, vomiting, constipation and abdominal pain); respiratory disorders (cough, dyspnoea and pneumonia); headache; fatigue; decreased appetite; pyrexia; musculoskeletal and connective tissue disorders (muscle spasms, arthralgia and back pain); increased levels of blood creatine phosphokinase, amylase and aminotransferase; rash and hypertension. In clinical trials, EOPEs were found to be the major cause of discontinuation and treatment-related death. In the phase I/II, ALTA and ALTA-1L trials, 8%, 6% and 3% of patients had at least possible EOPEs on brigatinib, respectively, with frequency appearing to increase with the initial dosage (30,31,34). In 440 patients starting brigatinib 180 mg q.d. with a 7-day dose escalation starting at 90 mg q.d. across three trials, 20 patients (5%) had at least possible EOPEs (38). Seven patients (1.5%) had grade 1–2 AEs and successfully continued brigatinib. A total of 12 patients (3%) had grade 3–4 AEs leading to discontinuation of brigatinib. Throughout these clinical trials, grade 5 EOPEs were not identified. Pooled analysis of three trials revealed that the occurrence of EOPEs was significantly associated with age, Eastern Cooperative Oncology Group performance status and number of previous regimens. One hypothesis of the occurrence of EOPEs with brigatinib is that a short crizotinib washout time could decrease the metabolic clearance of brigatinib and increase exposure after starting doses of brigatinib because crizotinib is a time-dependent inhibitor of CYP3A4 (39), the main drug-metabolizing enzyme for brigatinib. This hypothesis may explain the lower incidence rates of EOPEs in the later trials, which mandated at least a 7-day crizotinib washout time and an initial 7-day lead-in at 90 mg dose strategy before dose escalation. However, population pharmacokinetic analysis showed there were no differences between brigatinib exposure after first dose of brigatinib and shorter crizotinib washout time. Another hypothesis is that the distinctive property of being a potent dual ALK and EGFR kinase inhibitor may broaden the risks of developing pulmonary toxicities over other ALK inhibitors that do not possess EGFR inhibition properties. Although the mechanism that EGFR kinase inhibitors induce pulmonary toxicities has not been investigated in detail, EGFR kinase inhibitors directly injure the endothelium of alveolar capillaries and/or pneumocytes (40). Cytokines are released and the inflammatory cells are recruited. Released cytokines induce the dysfunction of endothelial and lung oedema. Lorlatinib Introduction of lorlatinib Lorlatinib is a third-generation ALK and ROS1 kinase inhibitor (41). Lorlatinib was developed from crizotinib to penetrate the BBB and to reduce the P-glycoprotein-dependent efflux (41–43). In vivo and in vitro, lorlatinib demonstrated antitumour activity against multiple mutant forms of the ALK, including acquired mutations, such as G1202R, which conferred resistance to crizotinib and ALK inhibitors (28). Lorlatinib is primarily metabolized via cytochrome P450 3A4 (CYP3A4) and UDP-glucuronosyltransferase 1A4 (UGT1A4). Concomitant use of CYP3A strong inducers or inhibitors should be avoided. Clinical efficacy of lorlatinib Phase I/II trial A phase I/II trial (NCT01970865) is an open-label, ongoing study evaluating the safety, activity and pharmacokinetic properties of lorlatinib in patients with advanced ALK- or ROS1-positive NSCLC (44–46). The results phase I stage were first published in 2017 (44), followed by preliminary data concerning the ALK-positive NSCLC cohort (45) and the results of the ROS1-positive NSCLC cohort (46). The primary endpoint in phase I was DLT in cycle 1 (21 days). Lorlatinib was administered orally at doses of 10–200 mg q.d. or 35–100 mg b.i.d. A total of 54 patients, including 41 patients with ALK-positive NSCLC, 12 patients with ROS1-positive NSCLC and 1 patient with unconfirmed ALK/ROS1 status, were treated with lorlatinib. One DLT event occurred at 200 mg [failure to receive 16 of 21 planned lorlatinib doses in cycle 1 because of grade 2 CNS effects (slowed speech and mentation and word-finding difficulty)]. Because no maximum tolerated dose was identified, a dose of 100 mg daily was determined as the recommended phase II dose based on the safety profile seen across all doses, the expected plasma coverage over the lorlatinib concentrations predicted to inhibit ALK G1202R and ease of administration. ORRs were 46% in patients with ALK-positive NSCLC and 42% in ROS1-positive NSCLC. Intracranial responses were observed in 11 (46%) of 24 patients (ALK: 42%, ROS1: 60%) who had measurable CNS lesions at baseline. The most common treatment-related AEs amongst the 54 patients were hypercholesterolaemia (72%), hypertriglyceridaemia (39%), peripheral neuropathy (39%), peripheral oedema (39%), cognitive effects (24%), speech effects (19%), increased weight (17%), mood effects (15%) and fatigue (15%). In the phase II stage, patients were enrolled into six different expansion cohorts (EXP1–6) according to ALK and ROS1 status and previous therapy (45). Enrollment criteria for each expansion cohort were as follows: ALK-positive and treatment-naïve (EXP1), ALK-positive and previous crizotinib only (EXP2), ALK-positive and previous crizotinib and one or two regimens of other chemotherapy (EXP3A), ALK-positive and received one previous non-crizotinib ALK inhibitor with or without chemotherapy (EXP3B), ALK-positive and received two previous ALK inhibitors (EXP4), ALK-positive and received three previous ALK inhibitors (EXP5) and ROS1-positive with any previous treatment (EXP6). In the preliminary data published, 276 patients were enrolled. Patients were given lorlatinib 100 mg q.d. The primary endpoint of the phase II trial was objective response and intracranial response in those with measurable baseline CNS metastases in pooled subgroups. In 30 EXP1 patients, an objective response and intracranial responses were observed in 27 (90%) of 30 patients and 2 (67%) of 3 patients, respectively. A total 198 patients received at least one previous ALK inhibitor before enrolling (EXP2–5). In EXP2–5, 77 (39%) of 198 patients received crizotinib as their last previous ALK inhibitor, 62 (31%) received alectinib, 47 (24%) received ceritinib, 8 (4%) received brigatinib and 4 (2%) received another ALK inhibitor. Of these patients, objective response and intracranial responses were achieved in 93 (47%) of 198 patients (69% in EXP2–3A, 32% in EXP3B, 39% in EXP4–5) and in 51 (67%) of 81 patients (87% in EXP2–3A, 56% in EXP3B, 53% in EXP4–5), respectively. Twenty-three (37%) of 62 patients who received alectinib as their last previous ALK inhibitor before lorlatinib achieved an objective response in comparison with 19 (40%) of 47 who received ceritinib and 3 (38%) of 8 who received brigatinib. The most common treatment-related AEs across 275 patients were hypercholesterolaemia (all grades: 81%, grade 3–4: 6%), hypertriglyceridaemia (all grades: 60%, grade 3–4: 16%), oedema (all grades: 41%, grade 3–4: 2%), peripheral neuropathy (all grades: 28%, grade 3–4: 2%) and cognitive effects (all grades: 17%, grade 3–4: 1%). Although serious treatment-related AEs and permanent discontinuation of lorlatinib due to treatment-related AEs were observed in 19 (7%) of 275 patients and 7 patients (3%), respectively, no treatment-related deaths were reported. A subgroup analysis amongst Japanese patients was published in 2020 (47). Thirty-nine patients with ALK-positive or ROS1-positive disease were included. In EXP2–5, an objective responses and intracranial response were observed in 17 (55%) of 31 patients and 7 (47%) of 15 patients. The commonest treatment-related AE was hypercholesterolaemia (79.5%). Hypertriglyceridaemia was the most common severe AE (25.6%). The pharmacokinetic profiles amongst the Japanese patients were similar to those in the non-Japanese patients. On the basis of this phase I/II trial, lorlatinib is approved in the USA, the EU, Japan, China and in many other countries for second- or third-line treatment for patients with ALK-positive NSCLC (48). The efficacy of lorlatinib in 69 patients with ROS1-positive NSCLC in the phase I/II trial cohort, a Japanese lead-in cohort and a drug–drug interaction and Holter monitoring study cohort included 21 (30%) patients who were ROS1 kinase inhibitor-naïve, 40 (58%) who had received crizotinib only as their ROS1 kinase inhibitor and 8 (12%) who had received one non-crizotinib ROS1 kinase inhibitor or two or more ROS1 kinase inhibitors. ORR was 41% amongst all patients. Objective responses were achieved in 13 (62%) of 21 ROS1 kinase inhibitor-naïve patients and 14 (35%) of 40 patients treated with crizotinib as their only ROS1 kinase inhibitor. Intracranial responses were observed in 7 (64%) of 11 ROS1 kinase inhibitor-naïve patients and 12 (50%) of 24 patients treated with crizotinib as their only ROS1 inhibitor. New safety concerns were not reported. Ongoing study The CROWN trial (NCT03052608) is an ongoing, open-label, randomized, two-arm study comparing lorlatinib with crizotinib as first-line treatment in patients with advanced ALK-positive NSCLC (49). The primary endpoint is PFS, and the secondary endpoints are OS, ORR, intracranial response rate and AEs. The estimated completion date of the study is 1 February 2024. Depending upon the results of this study, lorlatinib may be proven to have clinical efficacy as first-line treatment for patients with ALK-positive NSCLC. The Javelin Lung 101 trial (NCT025846634) is a phase Ib/II, ongoing, open label, dose-finding study evaluating safety, efficacy, pharmacokinetics and pharmacodynamics of avelumab in combination with either crizotinib or lorlatinib in patients with advanced NSCLC (50). The estimated completion date of this study is 31 December 2021. This trial might provide a new strategy of combining an immune checkpoint inhibitor with lorlatinib. AEs of lorlatinib The most common AEs (>10%) due to lorlatinib were hypercholesterolaemia, hypertriglyceridaemia, oedema, peripheral neuropathy, weight increase, cognitive effects, mood effects, fatigue, diarrhoea, arthralgia and increased aspartate aminotransferase (45). The most common grade 3–4 AEs (>10%) were hypertriglyceridaemia and hypercholesterolaemia (45). The mechanism of hypertriglyceridaemia and hypercholesterolaemia induced by lorlatinib has not been investigated in detail. Hypercholesterolaemia and hypertriglyceridaemia are regularly managed by lipid-lowering agents. Amongst several, we recommend rosuvastatin, pravastatin and pitavastatin on the basis of their lower involvement with specific CYP450 enzymes (51). Conclusion Brigatinib and lorlatinib are the second and third ALK inhibitors with antitumour activity against both extracranial and intracranial lesions in patients with advanced ALK-positive NSCLC. Ongoing trials and additional information about biological and clinical aspects of ALK-positive NSCLC would provide insight into the optimal strategy to provide patients with the best chances of survival. Acknowledgment We thank Libby Cone, MD, MA, from DMC Corp. for editing drafts of this manuscript. Funding The authors have not received any funding for this study. Conflict of interest statement Dr Yutaka Fujiwara reports grants and personal fees from Astra Zeneca, grants from Abbvie, grants and personal fees from Bristol-Myers Squibb, grants and personal fees from Chugai Pharma, grants and personal fees from Daiichi Sankyo, grants from Eisai, grants from Eli Lilly, grants from Incyte, grants from Merck Serono, grants and personal fees from MSD, grants and personal fees from Novartis, personal fees from Ono Pharmaceutical, outside the submitted work. The other authors have no potential conflict of interest to declare. References 1. Soda M , Isobe K, Inoue A, et al. A prospective PCR-based screening for the EML4-ALK oncogene in non-small cell lung cancer . Clin Cancer Res 2012 ; 18 : 5682 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Gainor JF , Varghese AM, Ou SH, et al. ALK rearrangements are mutually exclusive with mutations in EGFR or KRAS: an analysis of 1,683 patients with non-small cell lung cancer . Clin Cancer Res 2013 ; 19 : 4273 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Camidge DR , Kono SA, Flacco A, et al. Optimizing the detection of lung cancer patients harboring anaplastic lymphoma kinase (ALK) gene rearrangements potentially suitable for ALK inhibitor treatment . Clin Cancer Res 2010 ; 16 : 5581 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Roskoski R Jr. Properties of FDA-approved small molecule protein kinase inhibitors: a 2020 update . Pharmacol Res 2020 ; 152 :104609. Google Scholar OpenURL Placeholder Text WorldCat 5. Shaw AT , Kim DW, Nakagawa K, et al. Crizotinib versus chemotherapy in advanced ALK-positive lung cancer . N Engl J Med 2013 ; 368 : 2385 – 94 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Solomon BJ , Mok T, Kim DW, et al. First-line crizotinib versus chemotherapy in ALK-positive lung cancer . N Engl J Med 2014 ; 371 : 2167 – 77 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Katayama R , Shaw AT, Khan TM, et al. Mechanisms of acquired crizotinib resistance in ALK-rearranged lung cancers . Sci Transl Med 2012 ; 4 :120ra17. Google Scholar OpenURL Placeholder Text WorldCat 8. Kim S , Kim TM, Kim DW, et al. Heterogeneity of genetic changes associated with acquired crizotinib resistance in ALK-rearranged lung cancer . J Thorac Oncol 2013 ; 8 : 415 – 22 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Sasaki T , Koivunen J, Ogino A, et al. A novel ALK secondary mutation and EGFR signaling cause resistance to ALK kinase inhibitors . Cancer Res 2011 ; 71 : 6051 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Kim HR , Kim WS, Choi YJ, et al. Epithelial-mesenchymal transition leads to crizotinib resistance in H2228 lung cancer cells with EML4-ALK translocation . Mol Oncol 2013 ; 7 : 1093 – 102 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Ou SH , Ahn JS, De Petris L, et al. Alectinib in Crizotinib-refractory ALK-rearranged non-small-cell lung cancer: a phase II global study . J Clin Oncol 2016 ; 34 : 661 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Friboulet L , Li N, Katayama R, et al. The ALK inhibitor ceritinib overcomes crizotinib resistance in non-small cell lung cancer . Cancer Discov 2014 ; 4 : 662 – 73 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Shaw AT , Kim DW, Mehra R, et al. Ceritinib in ALK-rearranged non-small-cell lung cancer . N Engl J Med 2014 ; 370 : 1189 – 97 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Kodama T , Tsukaguchi T, Yoshida M, et al. Selective ALK inhibitor alectinib with potent antitumor activity in models of crizotinib resistance . Cancer Lett 2014 ; 351 : 215 – 21 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Zhang S , Anjum R, Squillace R, et al. The potent ALK inhibitor Brigatinib (AP26113) overcomes mechanisms of resistance to first- and second-generation ALK inhibitors in preclinical models . Clin Cancer Res 2016 ; 22 : 5527 – 38 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Ignatius Ou SH , Azada M, Hsiang DJ, et al. Next-generation sequencing reveals a novel NSCLC ALK F1174V mutation and confirms ALK G1202R mutation confers high-level resistance to alectinib (CH5424802/RO5424802) in ALK-rearranged NSCLC patients who progressed on crizotinib . J Thorac Oncol 2014 ; 9 : 549 – 53 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Katayama R , Friboulet L, Koike S, et al. Two novel ALK mutations mediate acquired resistance to the next-generation ALK inhibitor alectinib . Clin Cancer Res 2014 ; 20 : 5686 – 96 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Johung KL , Yeh N, Desai NB, et al. Extended survival and prognostic factors for patients with ALK-rearranged non-small-cell lung cancer and brain metastasis . J Clin Oncol 2016 ; 34 : 123 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Löscher W , Potschka H. Blood-brain barrier active efflux transporters: ATP-binding cassette gene family . NeuroRx 2005 ; 2 : 86 – 98 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Silverman JA . Multidrug-resistance transporters . Pharm Biotechnol 1999 ; 12 : 353 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Fromm MF . P-glycoprotein: a defense mechanism limiting oral bioavailability and CNS accumulation of drugs . Int J Clin Pharmacol Ther 2000 ; 38 : 69 – 74 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Litman T , Druley TE, Stein WD, Bates SE. From MDR to MXR: new understanding of multidrug resistance systems, their properties and clinical significance . Cell Mol Life Sci 2001 ; 58 : 931 – 59 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Schinkel AH , Jonker JW. Mammalian drug efflux transporters of the ATP binding cassette (ABC) family: an overview . Adv Drug Delivery Rev 2003 ; 55 : 3 – 29 . Google Scholar Crossref Search ADS WorldCat 24. Lin JH . How significant is the role of P-glycoprotein in drug absorption and brain uptake? Drugs Today (Barc) 2004 ; 40 : 5 – 22 . Google Scholar Crossref Search ADS PubMed WorldCat 25. Costa DB , Shaw AT, S-HI O, et al. Clinical experience with Crizotinib in patients with advanced ALK-rearranged non–small-cell lung cancer and brain metastases . J Clin Oncol 2015 ; 33 : 1881 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Gadgeel SM , Gandhi L, Riely GJ, et al. Safety and activity of alectinib against systemic disease and brain metastases in patients with crizotinib-resistant ALK-rearranged non-small-cell lung cancer (AF-002JG): results from the dose-finding portion of a phase 1/2 study . Lancet Oncol 2014 ; 15 : 1119 – 28 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Toyokawa G , Seto T, Takenoyama M, et al. Insights into brain metastasis in patients with ALK+ lung cancer: is the brain truly a sanctuary? Cancer Metastasis Rev 2015 ; 34 : 797 – 805 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Zou HY , Friboulet L, Kodack DP, et al. PF-06463922, an ALK/ROS1 inhibitor, overcomes resistance to first and second generation ALK inhibitors in preclinical models . Cancer Cell 2015 ; 28 : 70 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat 29. FDA . Prescribing Information of Brigatinib. https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/208772lbl.pdf#search=%27RIAD+Pharmaceuticals+Inc.+ALUNBRIGTM+%28brigatinib%29%3A+US+prescribing+information.+2017%27 ( 17 August 2020, date last accessed ). 30. Gettinger SN , Bazhenova LA, Langer CJ, et al. Activity and safety of brigatinib in ALK- rearranged non-small-cell lung cancer and other malignancies: a single-arm, open-label, phase 1/2 trial . Lancet Oncol 2016 ; 17 : 1683 – 96 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Kim DW , Tiseo M, Ahn MJ, et al. Brigatinib in patients with Crizotinib-refractory anaplastic lymphoma kinase-positive non-small-cell lung cancer: a randomized multicenter phase II trial . J Clin Oncol 2017 ; 35 : 2490 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Yoshida T , Nishio M, Kumagai T, et al. Brigatinib in Japanese ALK positive NSCLC patients previously treated with ALK tyrosine kinase inhibitors: J-ALTA . J Clin Oncol 2020 ; 28 : (suppl; abstr 9537) . Google Scholar OpenURL Placeholder Text WorldCat 33. U.S . FDA approves Takeda’s ALUNBRIG® (brigatinib) as a first-line treatment option for patients diagnosed with rare and serious form of lung cancer . Released on 23 May 2020 . https://www.takeda.com/newsroom/newsreleases/2020/u.s.-fda-approves-takedas-alunbrig-brigatinib-as-a-first-line-treatment-option-for-patients-diagnosed-with-rare-and-serious-form-of-lung-cancer/ (12 October 2020, date last accessed). 34. Camidge DR , Kim HR, Ahn MJ, et al. Brigatinib versus Crizotinib in ALK-positive non-small-cell lung cancer . N Engl J Med 2018 ; 379 : 2027 – 39 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Camidge DR , Kim HR, Ahn MJ, et al. Brigatinib vs crizotinib in patients with ALK inhibitor-naive advanced ALK+ NSCLC: updated results. ESMO Asia Congress 2019 , 23 November 2019 . Singapore. 36. Takeda presents long-term data in ALK+ NSCLC showing ALUNBRIG® (brigatinib) continues to demonstrate, press released on 23 November 2019 . https://www.takeda.com/newsroom/newsreleases/2019/takeda-presents-long-term-data-in-alk-nsclc-showing-alunbrig-brigatinib-continues-to-demonstrate-superiority-in-the-first-line-after-two-years-of-follow-up/ (12 October 2020, date last accessed). 37. Stinchcombe T , Doebele RC, Wang XF, et al. Preliminary results of single arm phase 2 trial of brigatinib in patients (pts) with progression disease (PD) after next-generation (NG) anaplastic lymphoma kinase (ALK) tyrosine kinase inhibitors (TKIs) in ALK + non-small cell lung cancer (NSCLC) . J Clin Oncol 2019 ; 37 : 9027 – 7 . Google Scholar Crossref Search ADS WorldCat 38. Ng TL , Narasimhan N, Gupta N, Venkatakrishnan K, Kerstein D, Camidge DR. Early-onset pulmonary events associated with Brigatinib use in advanced NSCLC . J Thorac Oncol 2020 ; 15 : 1190 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Mao J , Johnson TR, Shen Z, Yamazaki S. Prediction of crizotinib-midazolam interaction using the Simcyp population-based simulator: comparison of CYP3A time-dependent inhibition between human liver microsomes versus hepatocytes . Drug Metab Dispos 2013 ; 41 : 343 – 52 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Vahid B , Marik PE. Pulmonary complications of novel antineoplastic agents for solid tumors . Chest 2008 ; 133 : 528 – 38 . Google Scholar Crossref Search ADS PubMed WorldCat 41. Johnson TW , Richardson PF, Bailey S, et al. Discovery of (10R)-7-amino-12-fluoro-2,10,16-trimethyl-15-oxo-10,15,16,17-tetrahydro-2H-8,4-(m etheno)pyrazolo[4,3-h][2,5,11]-benzoxadiazacyclotetradecine-3-carbonitrile (PF-06463922), a macrocyclic inhibitor of anaplastic lymphoma kinase (ALK) and c-ROS oncogene 1 (ROS1) with preclinical brain exposure and broad-spectrum potency against ALK-resistant mutations . J Med Chem 2014 ; 57 : 4720 – 44 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Huang Q , Johnson TW, Bailey S, et al. Design of potent and selective inhibitors to overcome clinical anaplastic lymphoma kinase mutations resistant to crizotinib . J Med Chem 2014 ; 57 : 1170 – 87 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Collier TL , Normandin MD, Stephenson NA, et al. Synthesis and preliminary PET imaging of (11)C and (18)F isotopologues of the ROS1/ALK inhibitor lorlatinib . Nat Commun 2017 ; 8 :15761. Google Scholar OpenURL Placeholder Text WorldCat 44. Shaw AT , Felip E, Bauer TM, et al. Lorlatinib in non-small-cell lung cancer with ALK or ROS1 rearrangement: an international, multicentre, open-label, single-arm first-in-man phase 1 trial . Lancet Oncol 2017 ; 18 : 1590 – 9 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Solomon BJ , Besse B, Bauer TM, et al. Lorlatinib in patients with ALK-positive non-small-cell lung cancer: results from a global phase 2 study . Lancet Oncol 2018 ; 19 : 1654 – 67 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Shaw AT , Solomon BJ, Chiari R, et al. Lorlatinib in advanced ROS1-positive non-small-cell lung cancer: a multicentre, open-label, single-arm, phase 1–2 trial . Lancet Oncol 2019 ; 20 : 1691 – 701 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Seto T , Hayashi H, Satouchi M, et al. Lorlatinib in previously-treated ALK-rearranged non-small cell lung cancer: Japanese subgroup analysis of a global study . Cancer Sci 2020 . doi: https://doi.org/10.1111/cas.14576 . Google Scholar OpenURL Placeholder Text WorldCat Crossref 48. Syed YY . Lorlatinib: first global approval . Drugs 2019 ; 79 : 93 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 49. Neuvonen PJ , Niemi M, Backman JT. Drug interactions with lipid-lowering drugs: mechanisms and clinical relevance . Clin Pharmacol Ther 2006 ; 80 : 565 – 81 . Google Scholar Crossref Search ADS PubMed WorldCat 50. CrinicalTrials.gov . A study of Lorlatinib versus Crizotinib in first line treatment of patients with ALK-positive NSCLC . https://clinicaltrials.gov/ct2/show/NCT03052608?cond=lorlatinib&draw=2&rank=12 (17 August 2020, date last accessed) . 51. ClinicalTrials.gov. Study to Evaluate Safety , Efficacy, pharmacokinetics and pharmacodynamics of avelumab in combination with either crizotinib or PF-06463922 in patients with NSCLC. (javelin lung 101) . Accessed 17 August 2020 . https://clinicaltrials.gov/ct2/show/NCT02584634?cond=lorlatinib&draw=2&rank=20 52. Zou HY , Li Q, Lee JH, et al. An orally available small-molecule inhibitor of c-met, PF-2341066, exhibits cytoreductive antitumor efficacy through antiproliferative and antiangiogenic mechanisms . Cancer Res 2007 ; 67 : 4408 – 17 . Google Scholar Crossref Search ADS PubMed WorldCat 53. FDA . Prescribing information of crizotinib . https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/202570s021lbl.pdf#search=%27PRESCRIBING+INFORMATION+crizotnib%27 (17 August 2020, date last accessed) . 54. Sakamoto H , Tsukaguchi T, Hiroshima S, et al. CH5424802, a selective ALK inhibitor capable of blocking the resistant gatekeeper mutant . Cancer Cell 2011 ; 19 : 679 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 55. FDA . Prescribing information of alectinib . https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/208434s003lbl.pdf#search=%27PRESCRIBING+INFORMATION+alectinib%27 (17 August 2020, date last accessed) . 56. Marsilje TH , Pei W, Chen B. Synthesis, structure-activity relationships, and in vivo efficacy of the novel potent and selective anaplastic lymphoma kinase (ALK) inhibitor 5-chloro-N2-(2-isopropoxy-5-methyl-4-(piperidin-4-yl)phenyl)-N4-(2-(isopropylsulf onyl)phenyl)pyrimidine-2,4-diamine (LDK378) currently in phase 1 and phase 2 clinical trials . J Med Chem 2013 ; 56 : 5675 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 57. FDA . Prescribing information of ceritinib . https://www.accessdata.fda.gov/drugsatfda_docs/label/2017/205755s009lbl.pdf#search=%27PRESCRIBING+INFORMATION+ceritinib%27 (17 August 2020, date last accessed) . 58. FDA . Prescribing information of lorlatinib . https://www.accessdata.fda.gov/drugsatfda_docs/label/2018/210868s000lbl.pdf#search=%27lorlatinib+FDA%27 (17 August 2020, date last accessed) . 59. Peters S , Camidge DR, Shaw AT, et al. Alectinib versus Crizotinib in untreated ALK-positive non-small-cell lung cancer . N Engl J Med 2017 ; 337 : 829 – 38 . Google Scholar Crossref Search ADS WorldCat 60. Shaw AT , Kim TM, Crinò L, et al. Ceritinib versus chemotherapy in patients with ALK-rearranged non-small-cell lung cancer previously given chemotherapy and crizotinib (ASCEND-5): a randomised, controlled, open-label, phase 3 trial . Lancet Oncol 2017 ; 18 : 874 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Tabei, Yusuke; Kobayashi, Keiichi; Saito, Kuniaki; Shimizu, Saki; Suzuki, Kaori; Sasaki, Nobuyoshi; Shiokawa, Yoshiaki; Nagane, Motoo

doi: 10.1093/jjco/hyaa162pmid: 32888020

Abstract Backgrounds Mutations in the isocitrate dehydrogenase (IDH)1 gene are favourable prognostic factors in newly diagnosed diffuse gliomas, whereas it remains controversial in the recurrent glioblastoma setting. Methods A total of 171 patients with newly diagnosed glioblastoma, either ‘primary’ glioblastoma or ‘secondary’ glioblastoma, treated at Kyorin University Hospital or Japanese Red Cross Medical Center from 2000 to 2015 were included. Patients with confirmed IDH1 status and O6-methylguanine-DNA methyltransferase promoter methylation status were retrospectively analysed for overall survival from the initial diagnosis (n = 147) and after the first progression (n = 122). Results IDH1 mutation but not IDH2 was noted in 19 of 147 patients with glioblastoma (12.9%). In patients with ‘primary’ glioblastoma (n = 136), median overall survival after the first progression was 13.5 and 10.5 months for mutant IDH1 and wild-type IDH1 glioblastoma, respectively (P = 0.747). Multivariate analysis revealed O6-methylguanine-DNA methyltransferase promoter methylation, and Karnofsky Performance status 60 or higher, were independent prognostic factors for better overall survival after the first progression. When ‘primary’ glioblastoma and ‘secondary’ glioblastoma were combined, median overall survival from the first progression was not significantly different between the mutant IDH1 group (10.1 months) and wild-type IDH1 group (10.5 months) (P = 0.559), whereas median overall survival from the initial diagnosis was significantly different (47.5 months vs.18.3 months, respectively; P = 0.035). Conclusions These results suggest that IDH1 mutation may not be a prognostic factor for survival at the first progression of patients with ‘primary’ glioblastoma and pretreated ‘secondary’ glioblastoma, and further warrant investigation in prospective studies. IDH status, glioblastoma, recurrent glioblastoma, overall survival, MGMT Introduction Glioblastoma (GBM) is the most common malignant brain tumour in adults. The current standard treatment for GBM comprises maximal safe resection and administration of temozolomide (TMZ) combined with radiotherapy (RT), followed by 6–12 cycles of TMZ with or without tumour-treating fields as a maintenance therapy (1,2). Even after this standard treatment, progression occurs in almost all patients, resulting in a dismal survival outcome; median progression-free survival (PFS) and median overall survival (mOS) remain ~7 months and only 14–18 months, respectively (1–5). There is no established treatment method for recurrent GBM and it is an urgent task, as several ongoing clinical trials indicate. It is well known that somatic mutations of the isocitrate dehydrogenase (IDH) 1 and 2 genes are important prognostic factors in gliomas. Parsons et al. reported that the IDH1 mutation was associated with significantly longer OS in patients with newly diagnosed GBM (6). Yan et al. also showed a similar survival superiority in patients with mIDH GBM (mOS 31 months) over those with wild-type IDH (wtIDH) GBM (mOS 15 months) (P = 0.002) (7). These reports also revealed that IDH mutations are present in only 5–10% of ‘primary’ GBM (pGBM) cases, whereas IDH mutations are more frequently observed in cases of WHO Grade II or III gliomas which are also collectively known as lower grade glioma (LrGG)s, or in ‘secondary’ GBM (sGBM) cases, who were histopathologically diagnosed as GBM on relapse or progression following the initial diagnosis of LrGG (7–9). With the revision of the WHO classification of tumours of the central nervous system (revised fourth edition) in 2016, GBM has been classified as either GBM, IDH-mutant (mIDH GBM) and GBM, IDH-wild type (wtIDH GBM). mIDH GBM corresponds almost exclusively to ‘secondary GBM’ and patients with mIDH GBM have significantly longer OS than those with wtIDH GBM which mostly corresponds to ‘primary GBM’ (10). However, it remains unclear whether IDH gene mutation status also affects prognosis following the timepoint of progression. There are few reports that describe whether prognosis after progression of GBM is better in patients with mIDH GBM than those with wtIDH GBM. This clinical question may be an important issue, especially in the planning of clinical trials concerning recurrent GBM. In this study, we retrospectively analysed survival of the patients with GBM in our cohorts with regard to prognosis after the first progression of GBM. Patients and methods Patients A total of 171 patients with pathologically confirmed GBM, who were treated at Kyorin University Hospital or Japanese Red Cross Medical Center from 2000 to 2015, were identified in our institutional database. Pathological diagnosis was reconfirmed by a pathologist at Kyorin University Hospital. Thirty-seven patients whose tumour samples were not available for IDH1gene mutation status were excluded. The remaining 147 patients were included in the study. As for survival analysis after progression, 25 patients were further excluded due to either lack of progression as GBM (n = 6) or inability to evaluate progression. In order to evaluate survival of the patients with pGBM, 11 patients with sGBM which had progressed from preceding LrGG albeit initial post-operative adjuvant therapy were excluded for the primary analysis (Fig. 1). The present study was approved by the Medicine Ethics Committee of Kyorin University Faculty of Medicine, and all subjects signed a specimen preservation and gene search study form. Figure 1. Open in new tabDownload slide Study diagram. GBM patients (171 cases) treated at Kyorin University Hospital or Japanese Red Cross Medical Center (JRCMC) from 2000 to 2015 were retrospectively identified. Those whose IDH1 status and clinical history were not available were excluded (24 cases). Investigated 147 patients consisted of 19 with mutated IDH1 GBM and 128 with wild-type IDH GBM. Six mIDH1 GBM patients were excluded because three patients had not shown tumour progression, whereas three patients were not evaluated in detail at progression, thus remaining 13 mIDH1 GBM patients were investigated for survival after first progression. Nineteen wtIDH1 GBM patients were excluded because four patients had not shown progresssion, whereas 15 patients were not evaluated in detail at progression, resulting in remaining 109 wtIDH1 GBM patients being eligible for survival analysis after first progression. In the primary analysis, 11 patients with secondary GBM were excluded, and 106 patients with wtIDH1 pGBM and five patients with mIDH1 pGBM were eligible for survival analysis after the first progression. Figure 1. Open in new tabDownload slide Study diagram. GBM patients (171 cases) treated at Kyorin University Hospital or Japanese Red Cross Medical Center (JRCMC) from 2000 to 2015 were retrospectively identified. Those whose IDH1 status and clinical history were not available were excluded (24 cases). Investigated 147 patients consisted of 19 with mutated IDH1 GBM and 128 with wild-type IDH GBM. Six mIDH1 GBM patients were excluded because three patients had not shown tumour progression, whereas three patients were not evaluated in detail at progression, thus remaining 13 mIDH1 GBM patients were investigated for survival after first progression. Nineteen wtIDH1 GBM patients were excluded because four patients had not shown progresssion, whereas 15 patients were not evaluated in detail at progression, resulting in remaining 109 wtIDH1 GBM patients being eligible for survival analysis after first progression. In the primary analysis, 11 patients with secondary GBM were excluded, and 106 patients with wtIDH1 pGBM and five patients with mIDH1 pGBM were eligible for survival analysis after the first progression. IDH gene mutation analyses IDH1 gene mutation status was examined by direct sequencing using the Sanger method as previously described (8). Genomic DNA was extracted from frozen tumour specimens and a fragment of 129 bp in length spanning the catalytic domain of IDH1 containing codon 132 was amplified using IDH1-f: CGGTCTTCAGAGAAGCCATT and IDH1-r: GCAAAATCACATTATTGCCAAC as primers. A fragment of 288 bp in length spanning the catalytic domain of IDH2 containing R140 and R172 was amplified using IDH2-f AGCCCATCATCTGCAAAAAC and IDH2-r CTAGGCGAGGAGCTCCAGT as primers. GoTaq® DNA Polymerase (Promega, Madison, WI, USA) was used to perform polymerase chain reaction (PCR), and heat denaturation was performed at 95°C for 30 seconds, annealing at 56°C for 40 seconds, extension at 72°C for 50 seconds at 35 cycles (Supplementary Fig. 1A: Wild-type IDH1, Supplementary Fig. 1B: Mutated IDH1). Detection of IDH1R132H mutation by immunohistochemistry was performed with the mouse monoclonal antibody H09 (Dianova,1:25 dilution, Hamburg, Germany) (11). (Supplementary Fig. 1C: Wild-type IDH1, Supplementary Fig. 1D: Mutated IDH1). O6-methylguanine-DNA methyltransferase promoter methylation status Promoter methylation status analysis of O6-methylguanine-DNA methyltransferase (MGMT) gene was performed using methylation-specific PCR as described previously (12) (Supplementary Fig. 2). Statistical analysis PFS was measured from the date of initial surgery for GBM (GBM-PFS) or LrGG (LrGG-PFS) to the date of progression, death or otherwise the last follow-up date on which the patient was reported alive without disease progression. OS was measured from the date of initial surgery for GBM (GBM-OS) or LrGG (LrGG-OS) to the date of death, or otherwise the last follow-up date on which the patient was reported alive. In the pGBM cases, survival after first progression (Rec-pGBM-OS) was measured from the date of first progression to the date of death, or otherwise the last follow-up date on which the patient was reported alive. Rec-pGBM-OS in pGBM and sGBM-OS in sGBM were evaluated as OS after progression in the present study (Fig. 2). Figure 2. Open in new tabDownload slide Definitions of survival analysis. pGBM-PFS; time from initial surgery of primary GBM to the date of either first progression, death, or the final confirmed survival date in case that the date of progression cannot be determined. Rec-pGBM-OS; time from first progression of primary GBM to either death or the final survival date confirmed. pGBM-OS; time from initial surgery of primary GBM to either death or the final survival date confirmed. LrGG-PFS; time from initial surgery of glioma to the diagnosis date of secondary GBM. sGBM-OS; time from the diagnosis date of secondary GBM to either death or the final survival date confirmed. LrGG-OS; time from initial surgery of lower grade glioma to either death or the final survival date confirmed. Figure 2. Open in new tabDownload slide Definitions of survival analysis. pGBM-PFS; time from initial surgery of primary GBM to the date of either first progression, death, or the final confirmed survival date in case that the date of progression cannot be determined. Rec-pGBM-OS; time from first progression of primary GBM to either death or the final survival date confirmed. pGBM-OS; time from initial surgery of primary GBM to either death or the final survival date confirmed. LrGG-PFS; time from initial surgery of glioma to the diagnosis date of secondary GBM. sGBM-OS; time from the diagnosis date of secondary GBM to either death or the final survival date confirmed. LrGG-OS; time from initial surgery of lower grade glioma to either death or the final survival date confirmed. The correlation between IDH mutation status and clinicopathological characteristics such as age, gender, extent of surgical resection, performance status (Karnofsky Performance Status; KPS), MGMT methylation status, adjuvant treatment after initial surgery, retreatment for first progression were evaluated using chi-squared test or Fisher’s exact test. The Kaplan–Meier estimate was used for survival analysis, and univariate analysis was performed using a log-rank test with a significance level of P = 0.05 (two-tailed test). Multivariate analysis was performed by Cox proportional regression analysis, and variables included the presence or absence of IDH gene mutation, and variables which showed significant differences by univariate analysis. SPSS 18.0 J (SPSS, Inc., Chicago, IL, USA) software was used to perform all statistical analyses. Results Patient backgrounds Among the 147 patients, 19 (12.9%) had an IDH1 gene mutation (mIDH GBM). All of these mutations were IDH1 mutations. There was no IDH2 mutation detected in all but 12 patients whose specimens were insufficient for conclusive judgement (data not shown). Of the remaining 128 patients with wtIDH1 GBM, 125 accounted for pGBM (97.7%) and only three patients had sGBM (2.3%). In contrast, among the 19 patients with mIDH1 GBM, 11 accounted for pGBM (57.9%) and eight patients had sGBM (42.1%). Therefore, the incidence of IDH1 mutation was significantly higher in the sGBM group (P < 0.0001). Among patients with pGBM (n = 136), the median age of those with mIDH1 was 42 years (range 25–65), which was significantly younger than those with wtIDH1 (65 years, range 16–86) (P < 0.0001). There were more patients with age younger than 50 years old (P < 0.001) and more females (P = 0.022) in the mIDH1 pGBM group. The proportion of patients who received gross total resection (GTR), patients with KPS 60 or higher on initial diagnosis, or MGMT promotor methylation were not significantly different between the wtIDH1 pGBM group and mIDH1 pGBM group. Nearly all patients received first-line therapy consisting of RT and chemotherapy. The combination of RT and TMZ was the mostly used regimen and was well-balanced between wtIDH and mIDH groups (Table 1). At the first progression, variable treatments were given dependent on the history of the prior therapy and conditions of the patients. Repeated surgery or RT was used infrequently, whereas chemotherapy including TMZ, bevacizumab (BEV) or nimustine was administered in most of patients (>80%) regardless of IDH1 status. No significant differences were noted between wtIDH1 GBM and mIDH1 GBM group (Table 2). Table 1 Patient characteristics and treatments of primary GBM according to IDH1 mutation status Variable . Result . IDH1 mutation status . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) Age <50y/≧50y 19 (15.2)/106 (84.8) 7 (63.6)/4 (36.4) <0.001 Gender Male/female 73 (58.4)/52 (41.6) 3 (27.3)/8 (72.7) 0.022 Extent of resection GTR/non-GTR 51 (40.8)/74 (59.2) 6 (54.5)/5 (45.5) 0.393 KPS ≧60/<60 91 (72.8)/31 (24.8%) 7 (63.6)/4 (36.4) 0.444 Unknown 3 (2.4%) 0 (0) MGMT Met/UM 58 (46.4)/67 (53.6) 8 (72.7)/3 (27.3) 0.089 IDH2 mutation Mutant/wildtype 0/113(90.4) 0/11(100) Unknown 12 (9.6) 0 (0) First-line treatment Received/not received 124 (99.2)/1 (0.8) 10 (90.9)/1 (9.1) 0.156 Radiotherapy (RT) 118 (94.4) 10 (90.9) 0.543   (RT alone) 11 (8.9) 0 (0) Chemotherapy 113 (90.4) 10 (90.9) 0.684   (TMZ alone) 6 (4.8) 0 (0) RT + chemotherapy 107 (85.6) 10 (90.9) 0.526   (RT + TMZ) 90 (72.6) 9 (90.0) (RT + TMZ + BEV) 8 (6.5) 1 (10.0)   (RT + ACNU) 8 (6.5) 0 (0)   (RT + BEV) 1 (0.8) 0 (0) Variable . Result . IDH1 mutation status . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) Age <50y/≧50y 19 (15.2)/106 (84.8) 7 (63.6)/4 (36.4) <0.001 Gender Male/female 73 (58.4)/52 (41.6) 3 (27.3)/8 (72.7) 0.022 Extent of resection GTR/non-GTR 51 (40.8)/74 (59.2) 6 (54.5)/5 (45.5) 0.393 KPS ≧60/<60 91 (72.8)/31 (24.8%) 7 (63.6)/4 (36.4) 0.444 Unknown 3 (2.4%) 0 (0) MGMT Met/UM 58 (46.4)/67 (53.6) 8 (72.7)/3 (27.3) 0.089 IDH2 mutation Mutant/wildtype 0/113(90.4) 0/11(100) Unknown 12 (9.6) 0 (0) First-line treatment Received/not received 124 (99.2)/1 (0.8) 10 (90.9)/1 (9.1) 0.156 Radiotherapy (RT) 118 (94.4) 10 (90.9) 0.543   (RT alone) 11 (8.9) 0 (0) Chemotherapy 113 (90.4) 10 (90.9) 0.684   (TMZ alone) 6 (4.8) 0 (0) RT + chemotherapy 107 (85.6) 10 (90.9) 0.526   (RT + TMZ) 90 (72.6) 9 (90.0) (RT + TMZ + BEV) 8 (6.5) 1 (10.0)   (RT + ACNU) 8 (6.5) 0 (0)   (RT + BEV) 1 (0.8) 0 (0) GBM, glioblastoma; IDH, isocitrate dehydrogenase; wtIDH1 GBM, wild-type IDH1 glioblastoma; mIDH1 GBM, mutant IDH1 glioblastoma; KPS, Karnofsky Performance Score; GTR, gross total resection; MMT, O6-methylguanine-DNA methyltransferase; Met, methylated; UM, unmethylated; RT, radiotherapy; ACNU, nimustine; TMZ, temozolomide; BEV, bevacizumab. Open in new tab Table 1 Patient characteristics and treatments of primary GBM according to IDH1 mutation status Variable . Result . IDH1 mutation status . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) Age <50y/≧50y 19 (15.2)/106 (84.8) 7 (63.6)/4 (36.4) <0.001 Gender Male/female 73 (58.4)/52 (41.6) 3 (27.3)/8 (72.7) 0.022 Extent of resection GTR/non-GTR 51 (40.8)/74 (59.2) 6 (54.5)/5 (45.5) 0.393 KPS ≧60/<60 91 (72.8)/31 (24.8%) 7 (63.6)/4 (36.4) 0.444 Unknown 3 (2.4%) 0 (0) MGMT Met/UM 58 (46.4)/67 (53.6) 8 (72.7)/3 (27.3) 0.089 IDH2 mutation Mutant/wildtype 0/113(90.4) 0/11(100) Unknown 12 (9.6) 0 (0) First-line treatment Received/not received 124 (99.2)/1 (0.8) 10 (90.9)/1 (9.1) 0.156 Radiotherapy (RT) 118 (94.4) 10 (90.9) 0.543   (RT alone) 11 (8.9) 0 (0) Chemotherapy 113 (90.4) 10 (90.9) 0.684   (TMZ alone) 6 (4.8) 0 (0) RT + chemotherapy 107 (85.6) 10 (90.9) 0.526   (RT + TMZ) 90 (72.6) 9 (90.0) (RT + TMZ + BEV) 8 (6.5) 1 (10.0)   (RT + ACNU) 8 (6.5) 0 (0)   (RT + BEV) 1 (0.8) 0 (0) Variable . Result . IDH1 mutation status . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) Age <50y/≧50y 19 (15.2)/106 (84.8) 7 (63.6)/4 (36.4) <0.001 Gender Male/female 73 (58.4)/52 (41.6) 3 (27.3)/8 (72.7) 0.022 Extent of resection GTR/non-GTR 51 (40.8)/74 (59.2) 6 (54.5)/5 (45.5) 0.393 KPS ≧60/<60 91 (72.8)/31 (24.8%) 7 (63.6)/4 (36.4) 0.444 Unknown 3 (2.4%) 0 (0) MGMT Met/UM 58 (46.4)/67 (53.6) 8 (72.7)/3 (27.3) 0.089 IDH2 mutation Mutant/wildtype 0/113(90.4) 0/11(100) Unknown 12 (9.6) 0 (0) First-line treatment Received/not received 124 (99.2)/1 (0.8) 10 (90.9)/1 (9.1) 0.156 Radiotherapy (RT) 118 (94.4) 10 (90.9) 0.543   (RT alone) 11 (8.9) 0 (0) Chemotherapy 113 (90.4) 10 (90.9) 0.684   (TMZ alone) 6 (4.8) 0 (0) RT + chemotherapy 107 (85.6) 10 (90.9) 0.526   (RT + TMZ) 90 (72.6) 9 (90.0) (RT + TMZ + BEV) 8 (6.5) 1 (10.0)   (RT + ACNU) 8 (6.5) 0 (0)   (RT + BEV) 1 (0.8) 0 (0) GBM, glioblastoma; IDH, isocitrate dehydrogenase; wtIDH1 GBM, wild-type IDH1 glioblastoma; mIDH1 GBM, mutant IDH1 glioblastoma; KPS, Karnofsky Performance Score; GTR, gross total resection; MMT, O6-methylguanine-DNA methyltransferase; Met, methylated; UM, unmethylated; RT, radiotherapy; ACNU, nimustine; TMZ, temozolomide; BEV, bevacizumab. Open in new tab Table 2 Treatment for the first progression of primary GBM according to IDH1 mutation status Variable . Result . IDH1 mutation status . . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) First progression Progression/progression-free 106 (84.8)/4 (3.2) 5 (45.4)/3 (27.3) 0.053 Censored 15 (12.0) 3 (27.3) Treatment for first progression Received/not received 71 (67.0)/35 (33.0) 5 (100)/0 0.177 Surgery 18 (25.4) 2 (40.0) 0.396 Re-radiotherapy (RT) 27 (21.6) 0 (0.0) (Re-RT alone) 11 (45.5) 0 (0.0) Chemotherapy 60 (84.5) 5 (100) 0.447 (TMZ) 18 (25.4)* 3 (60.0) (BEV) 14 (19.7)* 0 (0.0)   (Platinum-based) 11 (15.5) 0 (0.0)   (ACNU-based) 6 (8.5) 1 (20.0)   (ddTMZ) 4 (5.6) 0 (0.0)   (BEV + ACNU) 3 (4.2) 1 (20.0)   (Others) 4 (5.6) 0 (0.0) Variable . Result . IDH1 mutation status . . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) First progression Progression/progression-free 106 (84.8)/4 (3.2) 5 (45.4)/3 (27.3) 0.053 Censored 15 (12.0) 3 (27.3) Treatment for first progression Received/not received 71 (67.0)/35 (33.0) 5 (100)/0 0.177 Surgery 18 (25.4) 2 (40.0) 0.396 Re-radiotherapy (RT) 27 (21.6) 0 (0.0) (Re-RT alone) 11 (45.5) 0 (0.0) Chemotherapy 60 (84.5) 5 (100) 0.447 (TMZ) 18 (25.4)* 3 (60.0) (BEV) 14 (19.7)* 0 (0.0)   (Platinum-based) 11 (15.5) 0 (0.0)   (ACNU-based) 6 (8.5) 1 (20.0)   (ddTMZ) 4 (5.6) 0 (0.0)   (BEV + ACNU) 3 (4.2) 1 (20.0)   (Others) 4 (5.6) 0 (0.0) ddTMZ, dose-dense temozolomide. *Containing a case treated by BEV combined with TMZ. Open in new tab Table 2 Treatment for the first progression of primary GBM according to IDH1 mutation status Variable . Result . IDH1 mutation status . . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) First progression Progression/progression-free 106 (84.8)/4 (3.2) 5 (45.4)/3 (27.3) 0.053 Censored 15 (12.0) 3 (27.3) Treatment for first progression Received/not received 71 (67.0)/35 (33.0) 5 (100)/0 0.177 Surgery 18 (25.4) 2 (40.0) 0.396 Re-radiotherapy (RT) 27 (21.6) 0 (0.0) (Re-RT alone) 11 (45.5) 0 (0.0) Chemotherapy 60 (84.5) 5 (100) 0.447 (TMZ) 18 (25.4)* 3 (60.0) (BEV) 14 (19.7)* 0 (0.0)   (Platinum-based) 11 (15.5) 0 (0.0)   (ACNU-based) 6 (8.5) 1 (20.0)   (ddTMZ) 4 (5.6) 0 (0.0)   (BEV + ACNU) 3 (4.2) 1 (20.0)   (Others) 4 (5.6) 0 (0.0) Variable . Result . IDH1 mutation status . . P value . wtIDH1 GBM (n = 125) mIDH1 GBM (n = 11) Number of cases (%) Number of cases (%) First progression Progression/progression-free 106 (84.8)/4 (3.2) 5 (45.4)/3 (27.3) 0.053 Censored 15 (12.0) 3 (27.3) Treatment for first progression Received/not received 71 (67.0)/35 (33.0) 5 (100)/0 0.177 Surgery 18 (25.4) 2 (40.0) 0.396 Re-radiotherapy (RT) 27 (21.6) 0 (0.0) (Re-RT alone) 11 (45.5) 0 (0.0) Chemotherapy 60 (84.5) 5 (100) 0.447 (TMZ) 18 (25.4)* 3 (60.0) (BEV) 14 (19.7)* 0 (0.0)   (Platinum-based) 11 (15.5) 0 (0.0)   (ACNU-based) 6 (8.5) 1 (20.0)   (ddTMZ) 4 (5.6) 0 (0.0)   (BEV + ACNU) 3 (4.2) 1 (20.0)   (Others) 4 (5.6) 0 (0.0) ddTMZ, dose-dense temozolomide. *Containing a case treated by BEV combined with TMZ. Open in new tab Characteristics of mIDH1 GBM patients Among the 19 patients with mIDH1 GBM, there were 11 patients with pGBM, and eight patients with sGBM. All but one patient among the 11 patients with pGBM were initially treated with RT and concomitant TMZ. Three patients were in poor general condition with KPS 40 or lower. One of them could not receive RT nor chemotherapy due to perioperative death. Among the eight patients with sGBM, six of them had already received RT as the treatment for initial LrGG. Various treatments were given after the diagnosis of sGBM. The preceding tumours consisted of diffuse astrocytoma (WHO 2007 classification Grade II) in five patients (62.5%), gliomatosis cerebri (Grade III) in two (25%) and one anaplastic astrocytoma (AA; Grade III). The median time from initial diagnosis to the diagnosis of sGBM was 47.0 months (range 12.9–75.0) (Table 3). Table 3 Characteristics, treatment and outcome in patients with mIDH1 glioblastoma Case No. . Diagnosis . MGMT status . Initial KPS . Age . Sex . Diagnosis for LrGG . EOR for LrGG . RT for LrGG (Gy) . Chemotherapy for LrGG . LrGG- PFS (m) . EOR for GBM . RT for GBM (Gy) . Chemotherapy for GBM . GBM PFS (m) . Treatment at the time of second progression . Rec-pGBM-OS/ sGBM- OS (m) . LrGG-OS/ pGBM-OS (m) . GBM-OS(m) . Status . 1 pGBM Met 20 51 M G 60 TMZ 12.9 – – 12.9 12.9 Censored 2 pGBM Met 40 38 F G 60 TMZ 5.8 TMZ 3.8 9.5 9.5 Dead 3 pGBM Met 70 31 F N 60 TMZ 25.7 no pro. – 25.7 25.7 Alive 4 pGBM Met 70 51 M N 60 T + BEV 13.4 TMZ, ICE 5.5 18.8 18.8 Dead 5 pGBM Met 80 31 F N 60 TMZ 6.9 A 15 27.5 27.5 Alive 6 pGBM Met 90 51 F N 60 TMZ 28.3 no pro. – 28.3 28.3 Alive 7 pGBM Met 100 25 F G 60 TMZ 29.9 no pro. – 29.9 29.9 Alive 8 pGBM Met 100 49 F G 60 TMZ 69.4 TMZ, BEV, CK 13.5 82.9 82.9 Dead 9 pGBM UM 10 34 M N – – 0.5 – – 0.5 0.5 Dead 10 pGBM UM 60 65 F G 60 TMZ 10.5 – – 10.5 10.5 Dead 11 pGBM UM 90 42 F G 60 TMZ 13.3 A + BEV, CK, ITK 23.2 36.5 36.5 Dead 12 sGBM Met 30 65 F GC N - PAV 46.1 N – TMZ 2.4 – 2.4 48.5 2.4 Dead 13 sGBM Met 70 28 F GC N 50 TMZ 52.1 G – CE 9.2 CE, BEV 9.2 60.3 9.2 Dead 14 sGBM Met 70 52 M DA N 56 – 75.0 N – T + BEV 8.6 SRT, BEV 15.9 90.9 15.9 Dead 15 sGBM Met 90 23 M DA N – – 12.9 N 60 PAV 2 PAV, TMZ 10.1 22.9 10.1 Dead 16 sGBM Met 90 35 F AA N 60 AE 48.4 U – TMZ 8.1 TMZ, CE 11.9 60.4 11.9 Dead 17 sGBM Met 90 38 F DA N 54 – 34.2 N – TMZ 1.4 TMZ, ICE 7.1 41.4 7.1 Dead 18 sGBM UM 70 34 F DA G 54 – 41.2 N – TMZ 4.3 – 6.3 47.6 6.3 Dead 19 sGBM UM 70 42 M DA N 60 A 65.5 N – TMZ 7.3 BEV, ICE, A 19.4 84.9 19.4 Dead Case No. . Diagnosis . MGMT status . Initial KPS . Age . Sex . Diagnosis for LrGG . EOR for LrGG . RT for LrGG (Gy) . Chemotherapy for LrGG . LrGG- PFS (m) . EOR for GBM . RT for GBM (Gy) . Chemotherapy for GBM . GBM PFS (m) . Treatment at the time of second progression . Rec-pGBM-OS/ sGBM- OS (m) . LrGG-OS/ pGBM-OS (m) . GBM-OS(m) . Status . 1 pGBM Met 20 51 M G 60 TMZ 12.9 – – 12.9 12.9 Censored 2 pGBM Met 40 38 F G 60 TMZ 5.8 TMZ 3.8 9.5 9.5 Dead 3 pGBM Met 70 31 F N 60 TMZ 25.7 no pro. – 25.7 25.7 Alive 4 pGBM Met 70 51 M N 60 T + BEV 13.4 TMZ, ICE 5.5 18.8 18.8 Dead 5 pGBM Met 80 31 F N 60 TMZ 6.9 A 15 27.5 27.5 Alive 6 pGBM Met 90 51 F N 60 TMZ 28.3 no pro. – 28.3 28.3 Alive 7 pGBM Met 100 25 F G 60 TMZ 29.9 no pro. – 29.9 29.9 Alive 8 pGBM Met 100 49 F G 60 TMZ 69.4 TMZ, BEV, CK 13.5 82.9 82.9 Dead 9 pGBM UM 10 34 M N – – 0.5 – – 0.5 0.5 Dead 10 pGBM UM 60 65 F G 60 TMZ 10.5 – – 10.5 10.5 Dead 11 pGBM UM 90 42 F G 60 TMZ 13.3 A + BEV, CK, ITK 23.2 36.5 36.5 Dead 12 sGBM Met 30 65 F GC N - PAV 46.1 N – TMZ 2.4 – 2.4 48.5 2.4 Dead 13 sGBM Met 70 28 F GC N 50 TMZ 52.1 G – CE 9.2 CE, BEV 9.2 60.3 9.2 Dead 14 sGBM Met 70 52 M DA N 56 – 75.0 N – T + BEV 8.6 SRT, BEV 15.9 90.9 15.9 Dead 15 sGBM Met 90 23 M DA N – – 12.9 N 60 PAV 2 PAV, TMZ 10.1 22.9 10.1 Dead 16 sGBM Met 90 35 F AA N 60 AE 48.4 U – TMZ 8.1 TMZ, CE 11.9 60.4 11.9 Dead 17 sGBM Met 90 38 F DA N 54 – 34.2 N – TMZ 1.4 TMZ, ICE 7.1 41.4 7.1 Dead 18 sGBM UM 70 34 F DA G 54 – 41.2 N – TMZ 4.3 – 6.3 47.6 6.3 Dead 19 sGBM UM 70 42 M DA N 60 A 65.5 N – TMZ 7.3 BEV, ICE, A 19.4 84.9 19.4 Dead pGBM, primary glioblastoma; sGBM, secondary glioblastoma; M, male; F, female; AA, anaplastic astrocytoma; DA, diffuse astrocytoma; GC, gliomatosis cerebri; G, gross total removal; N, non-gross total removal; ND, not known dose; MGMT: O6-methylguanine-DNA methyltransferase, Gy, grey; A, ACNU(nimustine); PAV, procarbazine, ACNU and vincristine; AE, ACNU and etoposide; LrGG-PFS, lower grade glioma-progression-free survival; T + BEV, temozolomide and bevacizumab; CE, carboplatin and etoposide; CK, cyberknife; ITK, personalized peptide vaccine; ICE, low dose ifosfamide, carboplatin and etoposide; rec., recurrence. Open in new tab Table 3 Characteristics, treatment and outcome in patients with mIDH1 glioblastoma Case No. . Diagnosis . MGMT status . Initial KPS . Age . Sex . Diagnosis for LrGG . EOR for LrGG . RT for LrGG (Gy) . Chemotherapy for LrGG . LrGG- PFS (m) . EOR for GBM . RT for GBM (Gy) . Chemotherapy for GBM . GBM PFS (m) . Treatment at the time of second progression . Rec-pGBM-OS/ sGBM- OS (m) . LrGG-OS/ pGBM-OS (m) . GBM-OS(m) . Status . 1 pGBM Met 20 51 M G 60 TMZ 12.9 – – 12.9 12.9 Censored 2 pGBM Met 40 38 F G 60 TMZ 5.8 TMZ 3.8 9.5 9.5 Dead 3 pGBM Met 70 31 F N 60 TMZ 25.7 no pro. – 25.7 25.7 Alive 4 pGBM Met 70 51 M N 60 T + BEV 13.4 TMZ, ICE 5.5 18.8 18.8 Dead 5 pGBM Met 80 31 F N 60 TMZ 6.9 A 15 27.5 27.5 Alive 6 pGBM Met 90 51 F N 60 TMZ 28.3 no pro. – 28.3 28.3 Alive 7 pGBM Met 100 25 F G 60 TMZ 29.9 no pro. – 29.9 29.9 Alive 8 pGBM Met 100 49 F G 60 TMZ 69.4 TMZ, BEV, CK 13.5 82.9 82.9 Dead 9 pGBM UM 10 34 M N – – 0.5 – – 0.5 0.5 Dead 10 pGBM UM 60 65 F G 60 TMZ 10.5 – – 10.5 10.5 Dead 11 pGBM UM 90 42 F G 60 TMZ 13.3 A + BEV, CK, ITK 23.2 36.5 36.5 Dead 12 sGBM Met 30 65 F GC N - PAV 46.1 N – TMZ 2.4 – 2.4 48.5 2.4 Dead 13 sGBM Met 70 28 F GC N 50 TMZ 52.1 G – CE 9.2 CE, BEV 9.2 60.3 9.2 Dead 14 sGBM Met 70 52 M DA N 56 – 75.0 N – T + BEV 8.6 SRT, BEV 15.9 90.9 15.9 Dead 15 sGBM Met 90 23 M DA N – – 12.9 N 60 PAV 2 PAV, TMZ 10.1 22.9 10.1 Dead 16 sGBM Met 90 35 F AA N 60 AE 48.4 U – TMZ 8.1 TMZ, CE 11.9 60.4 11.9 Dead 17 sGBM Met 90 38 F DA N 54 – 34.2 N – TMZ 1.4 TMZ, ICE 7.1 41.4 7.1 Dead 18 sGBM UM 70 34 F DA G 54 – 41.2 N – TMZ 4.3 – 6.3 47.6 6.3 Dead 19 sGBM UM 70 42 M DA N 60 A 65.5 N – TMZ 7.3 BEV, ICE, A 19.4 84.9 19.4 Dead Case No. . Diagnosis . MGMT status . Initial KPS . Age . Sex . Diagnosis for LrGG . EOR for LrGG . RT for LrGG (Gy) . Chemotherapy for LrGG . LrGG- PFS (m) . EOR for GBM . RT for GBM (Gy) . Chemotherapy for GBM . GBM PFS (m) . Treatment at the time of second progression . Rec-pGBM-OS/ sGBM- OS (m) . LrGG-OS/ pGBM-OS (m) . GBM-OS(m) . Status . 1 pGBM Met 20 51 M G 60 TMZ 12.9 – – 12.9 12.9 Censored 2 pGBM Met 40 38 F G 60 TMZ 5.8 TMZ 3.8 9.5 9.5 Dead 3 pGBM Met 70 31 F N 60 TMZ 25.7 no pro. – 25.7 25.7 Alive 4 pGBM Met 70 51 M N 60 T + BEV 13.4 TMZ, ICE 5.5 18.8 18.8 Dead 5 pGBM Met 80 31 F N 60 TMZ 6.9 A 15 27.5 27.5 Alive 6 pGBM Met 90 51 F N 60 TMZ 28.3 no pro. – 28.3 28.3 Alive 7 pGBM Met 100 25 F G 60 TMZ 29.9 no pro. – 29.9 29.9 Alive 8 pGBM Met 100 49 F G 60 TMZ 69.4 TMZ, BEV, CK 13.5 82.9 82.9 Dead 9 pGBM UM 10 34 M N – – 0.5 – – 0.5 0.5 Dead 10 pGBM UM 60 65 F G 60 TMZ 10.5 – – 10.5 10.5 Dead 11 pGBM UM 90 42 F G 60 TMZ 13.3 A + BEV, CK, ITK 23.2 36.5 36.5 Dead 12 sGBM Met 30 65 F GC N - PAV 46.1 N – TMZ 2.4 – 2.4 48.5 2.4 Dead 13 sGBM Met 70 28 F GC N 50 TMZ 52.1 G – CE 9.2 CE, BEV 9.2 60.3 9.2 Dead 14 sGBM Met 70 52 M DA N 56 – 75.0 N – T + BEV 8.6 SRT, BEV 15.9 90.9 15.9 Dead 15 sGBM Met 90 23 M DA N – – 12.9 N 60 PAV 2 PAV, TMZ 10.1 22.9 10.1 Dead 16 sGBM Met 90 35 F AA N 60 AE 48.4 U – TMZ 8.1 TMZ, CE 11.9 60.4 11.9 Dead 17 sGBM Met 90 38 F DA N 54 – 34.2 N – TMZ 1.4 TMZ, ICE 7.1 41.4 7.1 Dead 18 sGBM UM 70 34 F DA G 54 – 41.2 N – TMZ 4.3 – 6.3 47.6 6.3 Dead 19 sGBM UM 70 42 M DA N 60 A 65.5 N – TMZ 7.3 BEV, ICE, A 19.4 84.9 19.4 Dead pGBM, primary glioblastoma; sGBM, secondary glioblastoma; M, male; F, female; AA, anaplastic astrocytoma; DA, diffuse astrocytoma; GC, gliomatosis cerebri; G, gross total removal; N, non-gross total removal; ND, not known dose; MGMT: O6-methylguanine-DNA methyltransferase, Gy, grey; A, ACNU(nimustine); PAV, procarbazine, ACNU and vincristine; AE, ACNU and etoposide; LrGG-PFS, lower grade glioma-progression-free survival; T + BEV, temozolomide and bevacizumab; CE, carboplatin and etoposide; CK, cyberknife; ITK, personalized peptide vaccine; ICE, low dose ifosfamide, carboplatin and etoposide; rec., recurrence. Open in new tab Survival analysis The primary analysis included only the ‘primary’ GBM cases to avoid any potentially confounding effects by incorporating both ‘primary’ and ‘secondary’ GBMs. mOS after the first progression was 13.5 months (95% confidence interval [CI] 3.7–23.2) for patients with mIDH1 pGBM (n = 5) and 10.5 months(95% CI 8.6–12.4) for those with wtIDH1 pGBM (n = 106) (Fig. 3A). Although there is a potential bias due to the small number of patients with mIDH1 pGBM, no statistically significant difference in OS by the IDH1 mutation status was observed (P = 0.747). Also, there was no significant difference in OS from the initial diagnosis of pGBM between wtIDH1 GBM (n = 125, 18.3 months, 95% CI 15.0–21.5) and mIDH1 GBM (n = 11, 36.4 months, 95% CI 10.6–62.2) (P = 0.224) (Fig. 3B; pGBM-OS by IDH1 mutation status). However, when patients whose initial KPS was <60, including three out of 11 patients with mIDH1 pGBM, were excluded, there was significant difference in mOS from the initial diagnosis between patients with wtIDH1 pGBM (20.8 months, 95% CI 17.1–24.5) and those with mIDH pGBM (82.9 months, 95% CI not determined) (P = 0.039). Figure 3. Open in new tabDownload slide Kaplan–Meier plots of survival analysis for 147 patients with glioblastoma. (A) OS from the first progression of primary GBM (Rec-pGBM-OS) by IDH1 mutation status. (B) OS from initial diagnosis of primary GBM (pGBM-OS) by IDH1 mutation status. (C) OS from first progression of primary GBM or diagnosis of secondary GBM (Rec-pGBM OS/sGBM-OS) by IDH1 mutation status. (D) OS from initial diagnosis of glioma (OS from initial diagnosis of primary GBM or initial diagnosis lower grade glioma; pGBM-OS/LrGG-OS) by IDH1 mutation status. (E) OS from initial diagnosis of GBM (pGBM-OS) by MGMT status. (F) OS from first progression of primary GBM (Rec-pGBM-OS) by MGMT status. (G) OS from first progression of pGBM (Rec-GBM-OS) by KPS score of under 60 or 60 or greater. Figure 3. Open in new tabDownload slide Kaplan–Meier plots of survival analysis for 147 patients with glioblastoma. (A) OS from the first progression of primary GBM (Rec-pGBM-OS) by IDH1 mutation status. (B) OS from initial diagnosis of primary GBM (pGBM-OS) by IDH1 mutation status. (C) OS from first progression of primary GBM or diagnosis of secondary GBM (Rec-pGBM OS/sGBM-OS) by IDH1 mutation status. (D) OS from initial diagnosis of glioma (OS from initial diagnosis of primary GBM or initial diagnosis lower grade glioma; pGBM-OS/LrGG-OS) by IDH1 mutation status. (E) OS from initial diagnosis of GBM (pGBM-OS) by MGMT status. (F) OS from first progression of primary GBM (Rec-pGBM-OS) by MGMT status. (G) OS from first progression of pGBM (Rec-GBM-OS) by KPS score of under 60 or 60 or greater. In addition, we evaluated survival in patients with both ‘primary’ and ‘secondary’ GBM as an ancillary analysis. OS after the first progression by IDH1 status was also similar irrespective of IDH1 status. mOS after the first progression in pGBM (Rec-pGBM-OS) or OS after the time of GBM diagnosis in sGBM (sGBM-OS) was 10.1 months (95% CI 4.4–15.7) in patients with mIDH1 and 10.5 months (95% CI 8.9–12.1) in those with wtIDH1 (P = 0.559) (Fig. 3C). Similarly, survival from the first progression was almost equivalent between patients with pGBM (mostly wtIDH1; mOS 10.5 months, 95% CI 8.7–12.3) and sGBM (mostly mIDH1; mOS 10.1 months, 95% CI 5.7–14.4; P = 0.478), and mOS of mIDH1 sGBM was only 9.2 m (95% CI 5.0–13.4). In contrast, survival from initial onset of primary GBM and LrGG (pGBM-OS/LrGG-OS) was different by IDH1 mutation status. mOS of mIDH1 patients [47.5 months, 95% CI 36.0–59.0] was significant longer than that of wtIDH1 patients (18.3 months, 95% CI 15.1–21.6; P = 0.035) (Fig. 3D). Prognostic factors associated with survival We also examined relationships between survival and other prognostic factors including methylation status of MGMT, age, extent of resection and KPS. By univariate analyses, there was a significant difference in OS from initial diagnosis of pGBM between the MGMT methylated group (27.9 months, 95% CI 24.6–31.2) and the unmethylated group (15.5 months, 95% CI 13.7–17.3) (Fig. 3E; P < 0.0001). Regarding survival following first progression (Rec-pGBM-OS), a significant difference was observed as well (MGMT methylated group, 16.0 months, 95% CI 9.2–22.7; unmethylated group, 9.2 months, 95% CI 7.8–10.6) (Fig. 3F; P < 0.001). KPS 60 or higher was significantly associated with better survival from initial diagnosis (P = 0.004) and first progression (P < 0.0001) (Fig. 3G). Extent of resection at the initial surgery was a significant prognostic factor only for OS from initial diagnosis (P < 0.001). Young age (<50 years old) was not associated with better survival. By multivariate analyses using Cox regression analysis (Table 4A and B), IDH1 mutation status was not a significant prognostic factor for OS both from initial diagnosis of pGBM (pGBM-OS) and from first progression of pGBM (Rec-pGBM-OS). MGMT promoter methylation status, GTR and KPS (all P < 0.001) were found to be independent prognostic factors for newly diagnosed GBM (Table 4A), whereas only MGMT status (P = 0.019) and KPS at progression (P < 0.001) were independently associated with favourable OS after first progression (Rec-pGBM-OS) (Table 4B). Table 4 Multivariate analysis of factors associated with overall survival for pGBM (pGBM-OS) and recurrent pGBM (Rec-pGBM-OS) Parameter . . Parameter estimated . Standard error . P value . Hazard ratio . 95% CI . A. pGBM (pGBM-OS) IDH1 wtIDH1 vs. mIDH1 0.105 0.453 0.817 1.111 0.457 2.702 MGMT Methylated vs. unmethylated −1.010 0.2 <0.001 0.364 0.227 0.586 Age <50y vs. ≧50y 0.379 0.290 0.192 1.461 0.827 2.581 EOR GTR vs. non-GTR 0.844 0.239 <0.001 2.326 1.455 3.719 KPS <60 vs. ≧60 0.821 0.229 <0.001 2.272 1.450 3.560 B. Recurrent pGBM (Rec-pGBM-OS) IDH1 wtIDH1 vs. mIDH1 −0.137 0.606 0.821 0.872 0.266 2.859 MGMT methylated vs. unmethylated −0.617 0.263 0.019 0.539 0.322 0.903 Age at recurrence <50y vs. ≧50y −0.356 0.401 0.375 0.701 0.319 1.537 KPS at recurrence <60 vs. ≧60 1.132 0.287 <0.001 3.101 1.768 5.438 Parameter . . Parameter estimated . Standard error . P value . Hazard ratio . 95% CI . A. pGBM (pGBM-OS) IDH1 wtIDH1 vs. mIDH1 0.105 0.453 0.817 1.111 0.457 2.702 MGMT Methylated vs. unmethylated −1.010 0.2 <0.001 0.364 0.227 0.586 Age <50y vs. ≧50y 0.379 0.290 0.192 1.461 0.827 2.581 EOR GTR vs. non-GTR 0.844 0.239 <0.001 2.326 1.455 3.719 KPS <60 vs. ≧60 0.821 0.229 <0.001 2.272 1.450 3.560 B. Recurrent pGBM (Rec-pGBM-OS) IDH1 wtIDH1 vs. mIDH1 −0.137 0.606 0.821 0.872 0.266 2.859 MGMT methylated vs. unmethylated −0.617 0.263 0.019 0.539 0.322 0.903 Age at recurrence <50y vs. ≧50y −0.356 0.401 0.375 0.701 0.319 1.537 KPS at recurrence <60 vs. ≧60 1.132 0.287 <0.001 3.101 1.768 5.438 EOR, extent of resection; wt, wild-type; m, mutant; CI, confidence interval. Open in new tab Table 4 Multivariate analysis of factors associated with overall survival for pGBM (pGBM-OS) and recurrent pGBM (Rec-pGBM-OS) Parameter . . Parameter estimated . Standard error . P value . Hazard ratio . 95% CI . A. pGBM (pGBM-OS) IDH1 wtIDH1 vs. mIDH1 0.105 0.453 0.817 1.111 0.457 2.702 MGMT Methylated vs. unmethylated −1.010 0.2 <0.001 0.364 0.227 0.586 Age <50y vs. ≧50y 0.379 0.290 0.192 1.461 0.827 2.581 EOR GTR vs. non-GTR 0.844 0.239 <0.001 2.326 1.455 3.719 KPS <60 vs. ≧60 0.821 0.229 <0.001 2.272 1.450 3.560 B. Recurrent pGBM (Rec-pGBM-OS) IDH1 wtIDH1 vs. mIDH1 −0.137 0.606 0.821 0.872 0.266 2.859 MGMT methylated vs. unmethylated −0.617 0.263 0.019 0.539 0.322 0.903 Age at recurrence <50y vs. ≧50y −0.356 0.401 0.375 0.701 0.319 1.537 KPS at recurrence <60 vs. ≧60 1.132 0.287 <0.001 3.101 1.768 5.438 Parameter . . Parameter estimated . Standard error . P value . Hazard ratio . 95% CI . A. pGBM (pGBM-OS) IDH1 wtIDH1 vs. mIDH1 0.105 0.453 0.817 1.111 0.457 2.702 MGMT Methylated vs. unmethylated −1.010 0.2 <0.001 0.364 0.227 0.586 Age <50y vs. ≧50y 0.379 0.290 0.192 1.461 0.827 2.581 EOR GTR vs. non-GTR 0.844 0.239 <0.001 2.326 1.455 3.719 KPS <60 vs. ≧60 0.821 0.229 <0.001 2.272 1.450 3.560 B. Recurrent pGBM (Rec-pGBM-OS) IDH1 wtIDH1 vs. mIDH1 −0.137 0.606 0.821 0.872 0.266 2.859 MGMT methylated vs. unmethylated −0.617 0.263 0.019 0.539 0.322 0.903 Age at recurrence <50y vs. ≧50y −0.356 0.401 0.375 0.701 0.319 1.537 KPS at recurrence <60 vs. ≧60 1.132 0.287 <0.001 3.101 1.768 5.438 EOR, extent of resection; wt, wild-type; m, mutant; CI, confidence interval. Open in new tab Discussion The present study shows that in patients with recurrent GBM, IDH1 mutation status was not significantly associated with OS from the first progression. This result suggests that the better prognostic property derived from IDH1 mutation in newly diagnosed settings (7) does not translate into outcomes in recurrent settings for GBMs. It might also reflect malignant progression with acquisition of additional highly aggressive alterations that could override the survival benefit of IDH1 mutation for the initial gliomas. A subanalysis for prognostic factors in the randomized phase II BELOB trial, exploring a potential benefit of an anti-angiogenic monoclonal antibody, BEV, when added to an alkylating agent, lomustine (CCNU), in patients with recurrent GBM, identified seven IDH1 mutations out of 114 patients (6.1%). Univariate analysis highlighted that IDH1 mutation status was a factor which significantly correlated with OS (P = 0.04). However, multivariate analysis revealed no statistically significant impact of IDH1 mutation on OS (P = 0.144), besides other favourable prognostic factors (13). There are no other studies that evaluated prognostic effects of IDH1 mutation in recurrent primary GBMs with a greater number of mtIDH1 GBMs. In the present study, multivariate analysis revealed that KPS at progression and MGMT methylation status were independent prognostic factors for OS after the first progression, while age at progression, and IDH1 status were not associated with outcome (Table 4B). Both high KPS and MGMT promoter methylation are well-established prognosticators for better survival of GBM patients (14,15), and were identified as significant independent prognostic factors for OS in the newly diagnosed setting as well (Table 4A and B). Notably, MGMT promoter was methylated in 4/5 (80%) mIDH1 pGBMs, suggesting that mIDH1 GBM patients were further enriched with a prognostically favourable population in addition to IDH1 mutation. As we had not explored other molecular alteration profiles including CDKN2A/B deletion, EGFR gene amplification, mutations of the PTEN gene and the TERT promoter, there remains a possibility that mIDH GBMs analysed in the present study carried these alterations at a higher incidence potentially leading to aggressive behaviour, despite having better prognostic factors. In addition to the primary analysis on survival after progression with only pGBMs, we further investigated the mixed cohort of pGBM and sGBM as an ancillary analysis to see if the poor outcome after progression of pGBM could be observed for GBM in general. In the mixed cohort of pGBM and sGBM, mOS from the first progression was not statistically different between mIDH1 and wtIDH GBMs. OS from the diagnosis of ‘secondary’ GBMs (sGBM-OS), mostly pretreated with adjuvant therapy, was also unfavourable (10.1 months, n = 11), albeit most of them harboured mIDH1. It was almost same as the survival time from the first recurrence for ‘primary GBM’ (Rec-pGBM-OS). These results suggest that the better prognostic property derived from IDH1 mutation in newly diagnosed settings (7) does not translate into outcomes in recurrent settings for GBMs, perhaps due at least partially to malignant progression with acquisition of additional highly aggressive alterations that could override the survival benefit of IDH1 mutation for the initial gliomas. Along this line, Ohno et al. reported that time from initial diagnosis of glioma to sGBM diagnosis was significantly longer for mIDH sGBM than for wtIDH sGBM (50.1 vs.13.4 months), but there was no difference in mOS from the sGBM diagnosis between mIDH sGBM and wtIDH sGBM (6.75 vs. 6.8 months) (16). Mandel et al. also showed that there was no significant difference in OS from either the first progression of pGBM, or from the timepoint of diagnosis of progressed GBM from sGBM between mIDH1 (9.6 months) and wtIDH1 (8.7 months) groups (17). Given that IDH1 mutations have consistently been associated with better prognosis in adult patients with newly diagnosed diffuse gliomas WHO grades II–IV (GBM) (6,7, 18–21), it would be expected to see a similar tendency in the present study cohort. Along this line, there was also a trend towards better survival from the initial diagnosis in patients with mIDH1 pGBM (n = 11; 36.4 months; 95% CI: 10.6–62.2) compared with those with wtIDH1 pGBM (n = 125: 18.3 months, 95% CI 15.0–21.5), although not reaching statistical significance (P = 0.224). The non-significance might be due to the inclusion of patients with poor initial performance status in the mIDH1 group with a small patient number (n = 11); one patient (Table 3, Case 9) immediately died post-operatively without any adjuvant therapies, and another (Table 3, Case 2) had relatively early tumour progression (Table 3). When the patients with KPS <60 who might do worse regardless of the molecular status were excluded from both groups, there was a significant difference in OS from the initial diagnosis between mIDH1 and wtIDH1 pGBM patients (82.9 vs. 20.8 months; P = 0.039). Indeed, as shown in Table 4, multivariate analysis showed that KPS (60 or higher vs. <60) was an independent strong prognostic factor in the newly diagnosed setting. Limitations of this study include that this is a retrospective analysis and allowed a long inclusion period encompassing 16 years since 2000, which was partly due to the rarity of IDH1 mutations in GBM (22). In the 122 eligible patients collected throughout this period, there were only 13 mIDH1 GBMs identified, which rendered low statistical power. In addition, TMZ and BEV were approved in Japan for GBM in 2006 and 2013, respectively, during this period resulting in a variety of upfront treatment regimens used among patients dependent on their treated era, especially for the initial LrGG treatment in those with ‘secondary’ mIDH1 GBM (Table 3). With regard to the treatment for recurrent GBM, patients were also treated heterogeneously with either TMZ, BEV, nimustine or platinum derivatives, with or without salvage RT. To overcome these limitations, it is necessary to perform a large-scale prospective trial for recurrent pGBM including the mIDH subset with uniform treatment methods. However, it might be difficult to plan such a study in the future since the cIMPACT NOW update 5 has recently advocated a new term ‘astrocytoma, IDH-mutant, grade 4’ for the IDH mutated glioma carrying GBM features, distinct from ‘GBM, IDH-mutant’, to be incorporated in the next revision of WHO brain tumour criteria (23). In conclusions, although IDH1 mutation has consistently been demonstrated as a prognosticator for better survival in patients with diffuse gliomas including GBM, it may not be the case for recurrent GBMs that have progressed after initial treatments including TMZ and RT. OS of the patients with mIDH1 GBM after the first progression from the ‘primary’ GBM as well as from preceding LrGG was similar to that of those with wtIDH1, despite a higher proportion of methylated MGMT in mIDH1 GBM. Since this is a retrospective, single institutional study with heterogeneous patient backgrounds, it is important to evaluate a larger number of recurrent mIDH ‘primary’ GBM population for survival after the first progression in prospective trials to confirm the impact of IDH status. Acknowledgements This work was supported in part by grant from Japan Agency for Medical Research and Development (AMED) (17824890 to M.N.). We thank Prof. Junji Shibahara for review of pathological diagnosis, Dr Ichiro Suzuki, the former Director of Department of Neurosurgery, the Japanese Red Cross Medical Center, for supporting research opportunity of Y.T., and all the members and staffs of Department of Neurosurgery, Kyorin University Faculty of Medicine for kind assistance. Conflict of interest statement Keiichi Kobayashi received honoraria from Daiichi-Sankyo and UCB Japan. Kuniaki Saito received honoraria from Daiichi-Sankyo and Eisai. Yoshiaki Shiokawa received research funding from Eisai, Chugai, Ono, MSD, Nippon Kayaku, Daiichi Sankyo/UCB Japan, AbbVie, Toray Industries, Mitsubishi Tanabe Pharma, Takeda, Shionogi Pharma, Otsuka, Pfizer, Astellas Pharma, Tsumura & Co. and Sanofi. Motoo Nagane has served as an advisor for and received honoraria from Novocure, Chugai, Ono, Daiichi Sankyo, AbbVie, Dainippon Sumitomo, RIEMSER, Bristol-Myers-Squibb, received research grants and honoraria from Eisai, Chugai, Ono, MSD, Nippon Kayaku, Daiichi Sankyo/UCB Japan, AbbVie, Otsuka, received research grants from Toray Industries, Mitsubishi Tanabe Pharma, Takeda, Shionogi Pharma, Pfizer, Astellas Pharma, Tsumura & Co. and Sanofi. The remaining authors declare no potential conflicts of interest. References 1. Stupp R , Mason WP, van den Bent MJ, et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma . N Engl J Med 2005 ; 352 : 987 – 96 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Stupp R , Taillibert S, Kanner AA, et al. Maintenance therapy with tumor-treating fields plus temozolomide vs temozolomide alone for glioblastoma: a randomized clinical trial . JAMA 2015 ; 314 : 2535 – 43 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Chinot O , Wick W, Mason W, et al. , editors. Final efficacy and safety results from AVAglio, a phase III traila of bevacizumab (BEV) plus temozolomide (TMZ) and radiotherapy (RT) in newly diagnosed glioblastoma. Abstract #NO-031. The 4th Quadrennial Meeting of the World Federation of Neuro-Oncology in conjunction with the18th Annual Meeting of the Society for Neuro-Oncology ; 2013 ; San Francisco, CA . 4. Gilbert M , Dignam J, Won M, editors. RTOG 0825: Phase III double-blind placebo-controlled trial evaluating bevacizumab in patients with newly diagnosed glioblastoma. Abstract #PL-1. American Society for Clinical Oncology (ASCO) ; 2013 ; Chicago . 5. Gilbert MR , Wang M, Aldape KD, et al. Dose-dense temozolomide for newly diagnosed glioblastoma: a randomized phase III clinical trial . J Clin Oncol 2013 ; 31 : 4085 – 91 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Parsons DW , Jones S, Zhang X, et al. An integrated genomic analysis of human glioblastoma multiforme . Science 2008 ; 321 : 1807 – 12 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Yan H , Parsons DW, Jin G, et al. IDH1 and IDH2 mutations in gliomas . N Engl J Med 2009 ; 360 : 765 – 73 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Balss J , Meyer J, Mueller W, Korshunov A, Hartmann C, von Deimling A. Analysis of the IDH1 codon 132 mutation in brain tumors . Acta Neuropathol 2008 ; 116 : 597 – 602 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Ichimura K , Pearson DM, Kocialkowski S, et al. IDH1 mutations are present in the majority of common adult gliomas but rare in primary glioblastomas . Neuro Oncol 2009 ; 11 : 341 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Louis DN , Ohgaki H, Wiestler OD, et al. , editor. WHO classification of tumours of the central nervous system , Revised 4th edn. Lyon : IARC Press , 2016 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 11. Hartmann C , Hentschel B, Wick W, et al. Patients with IDH1 wild type anaplastic astrocytomas exhibit worse prognosis than IDH1-mutated glioblastomas, and IDH1 mutation status accounts for the unfavorable prognostic effect of higher age: implications for classification of gliomas . Acta Neuropathol 2010 ; 120 : 707 – 18 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Nagane M , Nozue K, Shimizu S, et al. Prolonged and severe thrombocytopenia with pancytopenia induced by radiation-combined temozolomide therapy in a patient with newly diagnosed glioblastoma--analysis of O6-methylguanine-DNA methyltransferase status . J Neurooncol 2009 ; 92 : 227 – 32 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Erdem-Eraslan L , van den Bent MJ, Hoogstrate Y, et al. Identification of patients with recurrent glioblastoma who may benefit from combined bevacizumab and CCNU therapy: a report from the BELOB trial . Cancer Res 2016 ; 76 : 525 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Hegi ME , Diserens AC, Gorlia T, et al. MGMT gene silencing and benefit from temozolomide in glioblastoma . N Engl J Med 2005 ; 352 : 997 – 1003 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Li J , Wang M, Won M, et al. Validation and simplification of the radiation therapy oncology group recursive partitioning analysis classification for glioblastoma . Int J Radiat Oncol Biol Phys 2011 ; 81 : 623 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Ohno M , Narita Y, Miyakita Y, et al. Secondary glioblastomas with IDH1/2 mutations have longer glioma history from preceding lower-grade gliomas . Brain Tumor Pathol 2013 ; 30 : 224 – 32 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Mandel JJ , Cachia D, Liu D, et al. Impact of IDH1 mutation status on outcome in clinical trials for recurrent glioblastoma . J Neurooncol 2016 ; 129 : 147 – 54 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Baumert BG , Hegi ME, van den Bent MJ, et al. Temozolomide chemotherapy versus radiotherapy in high-risk low-grade glioma (EORTC 22033-26033): a randomised, open-label, phase 3 intergroup study . Lancet Oncol 2016 ; 17 : 1521 – 32 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Cairncross JG , Wang M, Jenkins RB, et al. Benefit from procarbazine, lomustine, and vincristine in oligodendroglial tumors is associated with mutation of IDH . J Clin Oncol 2014 ; 32 : 783 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Wahl M , Phillips JJ, Molinaro AM, et al. Chemotherapy for adult low-grade gliomas: clinical outcomes by molecular subtype in a phase II study of adjuvant temozolomide . Neuro Oncol 2017 ; 19 : 242 – 51 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 21. Wick W , Roth P, Hartmann C, et al. Long-term analysis of the NOA-04 randomized phase III trial of sequential radiochemotherapy of anaplastic glioma with PCV or temozolomide . Neuro Oncol 2016 ; 18 : 1529 – 37 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 22. Nobusawa S , Watanabe T, Kleihues P, Ohgaki H. IDH1 mutations as molecular signature and predictive factor of secondary glioblastomas . Clin Cancer Res 2009 ; 15 : 6002 – 7 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Brat DJ , Aldape K, Colman H, et al. cIMPACT-NOW update 5: recommended grading criteria and terminologies for IDH-mutant astrocytomas . Acta Neuropathol 2020 ; 139 : 603 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected]. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] © The Author(s) 2020. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: [email protected].

Nanki,, Yoshiko;Nomura,, Hiroyuki;Iwasa,, Naomi;Saotome,, Keiko;Dozen,, Ai;Yoshihama,, Tomoko;Hirano,, Takuro;Hashimoto,, Shiho;Chiyoda,, Tatsuyuki;Yamagami,, Wataru;Kataoka,, Fumio;Aoki,, Daisuke

Yamamoto,, Azusa;Yamaguchi,, Tatsuro;Suzuki,, Okihide;Ito,, Tetsuya;Chika,, Noriyasu;Kamae,, Nao;Tamaru,, Jun-ichi;Nagai,, Tomonori;Seki,, Hiroyuki;Arai,, Tomio;Tachikawa,, Tetsuhiko;Akagi,, Kiwamu;Eguchi,, Hidetaka;Okazaki,, Yasushi;Ishida,, Hideyuki

Kinoshita, Tomohiro; Hatake, Kiyohiko; Yamamoto, Kazuhito; Higuchi, Yusuke; Murakami, Satsuki; Terui, Yasuhito; Yokoyama, Masahiro; Maruyama, Dai; Makita, Shinichi; Hida, Yukari; Saito, Tomohisa; Tobinai, Kensei

doi: 10.1093/jjco/hyaa169pmid: 33029633

Abstract Objective A phase 1 dose-escalation study of polatuzumab vedotin (pola) was conducted to assess safety, pharmacokinetics and preliminary antitumor activity of pola in Japanese patients with relapsed/refractory B-cell non-Hodgkin lymphoma. Methods Patients received pola (1.0 or 1.8 mg/kg) intravenously every 21 days until disease progression or intolerance. Intra-patient dose escalation was prohibited. Tolerability was determined by the standard 3 + 3 rule. Blood sampling was performed to characterize pharmacokinetics. Antitumor activity was evaluated through computed tomography and bone marrow sampling. Results Four patients received pola 1.0 mg/kg; three received 1.8 mg/kg. Patients had follicular lymphoma (n = 4) or diffuse large B-cell lymphoma (n = 3), median age of 62 years, received a median of 3 prior therapies; six were female. Pola was well tolerated in both cohorts, with no dose-limiting toxicities observed. The most common adverse event was peripheral sensory neuropathy (n = 4). Grade 3 adverse events were cholecystitis and neutrophil count decreased (one each; both 1.0 mg/kg), and syncope and cataract (one each; both 1.8 mg/kg). The plasma half-life of antibody-conjugate monomethyl auristatin E was 4.43–7.98 days, and systemic exposure of unconjugated monomethyl auristatin E was limited in both cohorts. Four patients achieved objective responses (three complete, one partial) without disease progression during the study. Conclusions This phase 1 dose-escalation study demonstrated that pola has an acceptable safety profile and offers encouraging antitumor activity to Japanese patients with relapsed/refractory B-cell non-Hodgkin lymphoma. Pola 1.8 mg/kg, the recommended phase 2 dose, was tolerable in Japanese patients. polatuzumab vedotin, phase 1 clinical trial, pharmacokinetics, B-cell lymphoma Introduction In patients with B-cell non-Hodgkin lymphoma (NHL), relapsed/refractory disease remains a major cause of morbidity and mortality, despite improved clinical outcomes with rituximab and chemotherapy regimens (1). With standard therapy, including rituximab plus cyclophosphamide, doxorubicin, vincristine and prednisone (R-CHOP), approximately one-third of diffuse large B-cell lymphoma (DLBCL) patients will eventually develop relapsed/refractory disease (2). Salvage chemotherapy followed by autologous stem cell transplantation is the standard second-line treatment for relapsed/refractory DLBCL (3). However, 3-year progression-free survival rates for DLBCL patients receiving the widely used regimens R-ICE (rituximab plus ifosfamide, carboplatin and etoposide) and R-DHAP (rituximab plus high-dose cytosine arabinoside, cisplatin and dexamethasone) are only 31 and 42%, respectively (4). In this context, antibody–drug conjugates (ADCs) have been increasingly investigated as an alternative approach for relapsed/refractory B-cell NHL. ADCs are tripartite molecules consisting of a targeted monoclonal antibody, a covalent linker and a cytotoxic payload (5). ADCs use an antibody-mediated method of delivering cytotoxic drugs to tumors in a targeted manner. Therefore, ADCs can improve efficacy by increasing the accumulation of cytotoxic drugs within or near the tumor site and minimize toxicity by reducing systemic effects (6). Polatuzumab vedotin (pola) is a CD79b-targeted antibody-drug conjugate delivering monomethyl auristatin E (MMAE), a microtubule inhibitor (7). CD79b is a component of the B-cell receptor and is found to be expressed in nearly all major subtypes of B-cell NHL (8,9). Pola bound to CD79b on B cells is rapidly internalized and its linker cleaved; the released MMAE inhibits cell division and induces cell apoptosis (10). Numerous studies have explored pola-based immunochemotherapy in relapsed/refractory B-cell NHL patients (11–18). In a phase 1 study conducted in the USA, Canada, France and the Netherlands, pola showed encouraging clinical activity as a single agent, with a generally acceptable safety profile in patients with relapsed/refractory B-cell NHL (18). Here, we report the results of a phase 1 dose-escalation study, the aims of which were to assess the safety, PK and antitumor activity of pola monotherapy in Japanese patients with relapsed/refractory B-cell NHL. Patients and methods Study design This open-label, multicenter, dose-escalation phase 1 study was conducted in Japanese patients with relapsed/refractory B-cell NHL. The primary objectives were to assess the safety and PK of pola, while a key secondary objective was to evaluate the antitumor activity of pola. Although three dose levels (1.0, 1.8 and 2.4 mg/kg) of pola were initially planned, the highest dose in this study was reduced from 2.4 to 1.8 mg/kg and two dose levels (1.0 and 1.8 mg/kg) of pola were set due to the concerns raised in a previous study about the increased number of grade ≥2 peripheral neuropathy events at higher doses (19,20). There were two dose cohorts (pola 1.0 mg/kg; pola 1.8 mg/kg), with each patient participating in only one of the dose cohorts (three to six patients). Pola was administered intravenously at 1.0 or 1.8 mg/kg every 21 days until disease progression or unacceptable toxicity, or patient or physician decision. The criteria for dose reduction and treatment discontinuation are shown in Supplementary Table S1. Patient eligibility Patients were eligible for enrollment if they were 20–74 years old and had histologically confirmed relapsed/refractory B-cell NHL, for which there was no standard therapy available. Other inclusion criteria were an Eastern Cooperative Oncology Group performance status of 0 or 1, one or more measurable lesions [in two dimensions by computed tomography (CT) scan with longest diameter > 1.5 cm], a life expectancy of ≥12 weeks after enrollment and no history of allogeneic stem cell transplantation. Eligibility criteria also included adequate renal, liver and bone marrow function, defined as hemoglobin ≥9 g/dl, neutrophil count ≥1500/μl and platelet count ≥75 000/μl, aspartate aminotransferase and alanine aminotransferase ≤2.5 of upper limit of normal (ULN), total bilirubin ≤1.5 of ULN and serum creatinine ≤1.5 of ULN. A washout period was required to eliminate effects from prior therapies (blood transfusion or hematopoietic growth factors, ≥2 weeks; surgery, chemotherapy, radiotherapy, monoclonal antibodies and ADC, or other investigational products, ≥4 weeks; radioimmunotherapy, autologous hematopoietic stem cell transplantation, ≥12 weeks). Patients with chronic lymphocytic leukemia diagnosed according to the National Cancer Institute Working Group diagnostic criteria were excluded. The full exclusion criteria for this study are provided in the Supplementary Methods. The protocol was approved by applicable ethics committees and institutional review boards, and the study was conducted in accordance with the Declaration of Helsinki and Good Clinical Practice guidelines. All patients provided written informed consent before the start of the study. The study was registered with clinicaltrials.jp, trial identifier: JapicCTI-142580 (JO29138). Dose escalation The dose escalation followed the standard 3 + 3 design. Three patients were evaluated at the first dose level, and in the absence of dose-limiting toxicities (DLTs), three additional patients were enrolled at the next dose level. If one of the initial three patients experienced a DLT, three patients were added at the same dose level. If two or more patients experienced a DLT, no new patients were enrolled in the cohort and the dose was not escalated. A DLT was defined as any grade ≥3 AE related to pola during the first cycle, with the exception of the following: grade 3 or 4 lymphocyte count decreased and white blood cell count decreased; grade 3 or 4 neutrophil count decreased that resolves or improves to grade ≤2 by the scheduled infusion date of the next cycle; grade 3 or 4 platelet count decreased that resolves or improves to grade ≤2 by the scheduled infusion date of the next cycle in the absence of bleeding and without requiring platelet transfusion; grade 3 infusion reaction that resolves or improves to grade ≤1 within 24 hours with supportive care and other measures; grade 3 nausea or vomiting that can be managed with supportive care; and transient asymptomatic laboratory abnormalities associated with antitumor effect of pola that resolve or improve to grade ≤2 within 1 week. The severity of AEs was graded according to Common Terminology Criteria for Adverse Events, v4.03. The maximum tolerated dose was defined as the highest dose level at which <33% of patients evaluated for DLT will experience DLTs. Evaluation of patients Safety evaluations were based on the incidence and severity of AEs, DLTs at each dose level and changes in clinical laboratory test results over time. AEs were monitored and recorded continuously during the study. Laboratory evaluations including hematology and blood chemistry were evaluated at screening, on days 1, 2, 8 and 15 of cycle 1; on days 1, 8 and 15 of cycles 2–4; on days 1 and 15 of cycles 5–8 and day 1 of each cycle thereafter, and at the final evaluation (28 days after last dosing). Antitumor activity was evaluated every 4 cycles by investigators in accordance with Revised Response Criteria for Malignant Lymphoma (21). CT scans were performed at screening and every 4 cycles from day 1 of cycle 4 until the final evaluation. Bone marrow was sampled at screening and during the study, in order to confirm a complete response (CR) in patients with bone-marrow involvement at baseline, or if clinically indicated. Leukocyte phenotyping using flow cytometry was conducted at screening, on day 1 of cycle 1 and every 4 cycles from day 1 of cycle 4 until the final evaluation, to determine changes in the number of peripheral blood B cells (CD19+), T cells (CD3+, CD4+ and CD8+) and natural killer (NK) cells (CD16+/CD56+). Pharmacokinetic analysis Blood samples for PK analyses were collected pre-dosing, at 30 minutes and 4 hours after the first dose of pola, and on days 2, 4/5, 8, 11 and 15 of cycle 1; pre-dosing and at 30 minutes and 4 hours after dosing on day 1 of cycle 2 and pre-dosing and 30 minutes after dosing on day 1 of cycles 3–8 and cycle 12 and every 4 cycels thereafter, on day 8 and 15 of cycles 2–4 and on day 15 of cycle 8. Final sampling occurred 28 days after the last dosing of pola. The PK profile of pola was characterized by analyzing serum total antibody (including conjugated and unconjugated antibody) by a validated enzyme-linked immunosorbent assay and by analyzing plasma antibody-conjugated MMAE (acMMAE) and unconjugated MMAE by validated liquid chromatography–tandem mass spectrometry. The calculated PK parameters were the maximum plasma or serum concentration (Cmax), time to reach maximum drug concentration (tmax), plasma or serum terminal phase half-life (t1/2), area under the concentration–time curve from zero to infinity (AUCinf), clearance (CL) and volume of distribution at steady state (Vss). Statistics The number of patients in each proposed cohort was based on the standard 3 + 3 design for dose-escalation studies. A total of 6–12 patients were planned to assess the safety and tolerability of pola, depending on observed toxicities. Descriptive statistics were used for the evaluation of safety, PK and antitumor activity. Patients were considered evaluable for safety and antitumor activity if they received at least one dose of pola. PK analyses were performed in patients who received at least one dose of pola and had data for serum total antibody, acMMAE and unconjugated MMAE. Statistical analyses were carried out with SAS v9.2. Non-compartmental analysis for PK parameters was performed with Phoenix WinNonlin v6.4. Results Patients Seven patients were enrolled (1.0 mg/kg cohort, n = 4; 1.8 mg/kg cohort, n = 3). All seven patients enrolled in the study were treated with pola, and all seven patients were included in the intent to treat (ITT) and safety analysis populations. Per protocol, a further patient was enrolled to receive pola 1.0 mg/kg to keep the number of PK evaluation population as planned in 1.0 mg/kg because there were defective PK samples in cycle 1 of one of three patients who had been enrolled in 1.0 mg/kg. The PK sampling from this patient in cycle 1 was enough to conduct PK evaluation. Yet, since this patient in 1.0 mg/kg discontinued treatment due to disease progression during the DLT evaluation period, the patient was excluded from the DLT evaluation population. All four patients enrolled to receive 1.0 mg/kg pola were included in the ITT, safety and PK analysis populations. Patient demographics and baseline characteristics are shown in Table 1. Patients had a median age of 62 years (range, 42–67 years), and the majority were female (n = 6). There were four patients with follicular lymphoma (FL) and three patients with DLBCL. Median number of prior therapies was 3 (range, 1–5). Table 1 Patient demographics and baseline characteristics Characteristics . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Sex, n  Male 1 0 1  Female 3 3 6 Median age, years (range) 64.5 (62–67) 45.0 (42–62) 62.0 (42–67) ECOG performance status, n  0 3 3 6  1 1 0 1 Histological subtype, n  FL 3 1 4  DLBCL 1 2 3 Ann Arbor stage, n  I/II 1 1 2  III/IV 3 2 5 Median number of prior therapies (range) 2.5 (2–3) 5.0 (1–5) 3.0 (1–5) Prior therapy, n  R-based chemotherapy 4 3 7  Other chemotherapy 0 1 1 Characteristics . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Sex, n  Male 1 0 1  Female 3 3 6 Median age, years (range) 64.5 (62–67) 45.0 (42–62) 62.0 (42–67) ECOG performance status, n  0 3 3 6  1 1 0 1 Histological subtype, n  FL 3 1 4  DLBCL 1 2 3 Ann Arbor stage, n  I/II 1 1 2  III/IV 3 2 5 Median number of prior therapies (range) 2.5 (2–3) 5.0 (1–5) 3.0 (1–5) Prior therapy, n  R-based chemotherapy 4 3 7  Other chemotherapy 0 1 1 Pola, polatuzumab vedotin; ECOG, Eastern Cooperative Oncology Group; FL, follicular lymphoma; DLBCL, diffuse large B-cell lymphoma; R, rituximab. Open in new tab Table 1 Patient demographics and baseline characteristics Characteristics . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Sex, n  Male 1 0 1  Female 3 3 6 Median age, years (range) 64.5 (62–67) 45.0 (42–62) 62.0 (42–67) ECOG performance status, n  0 3 3 6  1 1 0 1 Histological subtype, n  FL 3 1 4  DLBCL 1 2 3 Ann Arbor stage, n  I/II 1 1 2  III/IV 3 2 5 Median number of prior therapies (range) 2.5 (2–3) 5.0 (1–5) 3.0 (1–5) Prior therapy, n  R-based chemotherapy 4 3 7  Other chemotherapy 0 1 1 Characteristics . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Sex, n  Male 1 0 1  Female 3 3 6 Median age, years (range) 64.5 (62–67) 45.0 (42–62) 62.0 (42–67) ECOG performance status, n  0 3 3 6  1 1 0 1 Histological subtype, n  FL 3 1 4  DLBCL 1 2 3 Ann Arbor stage, n  I/II 1 1 2  III/IV 3 2 5 Median number of prior therapies (range) 2.5 (2–3) 5.0 (1–5) 3.0 (1–5) Prior therapy, n  R-based chemotherapy 4 3 7  Other chemotherapy 0 1 1 Pola, polatuzumab vedotin; ECOG, Eastern Cooperative Oncology Group; FL, follicular lymphoma; DLBCL, diffuse large B-cell lymphoma; R, rituximab. Open in new tab Safety All patients were eligible for the safety analysis. There were no dose reductions due to AEs, and the maximum tolerated dose was not reached (no DLTs). One patient in the 1.8 mg/kg cohort discontinued the study due to left ventricular dysfunction, which was considered not related to pola. Five patients experienced dose delays due to AEs (1.0 mg/kg cohort, n = 3; 1.8 mg/kg cohort, n = 2). These AEs included peripheral sensory neuropathy (n = 3), malaise (n = 2), bronchitis (n = 2), influenza (n = 1), infectious enteritis (n = 1), nausea (n = 1), vomiting (n = 1), cholecystitis (n = 1), sinus tachycardia (n = 1), decreased appetite (n = 1) and neutrophil count decreased (n = 1). A summary of treatment-emergent AEs (TEAE) occurring in two or more patients by dose cohort is shown in Table 2. The frequently reported AEs were peripheral sensory neuropathy (n = 4), abdominal discomfort (n = 3), malaise (n = 3) and influenza (n = 3); all were grade 1–2. Grade 3 AEs were cholecystitis (n = 1) and neutrophil count decreased (n = 1) in the 1.0 mg/kg cohort, and were syncope (n = 1) and cataract (n = 1) in the 1.8 mg/kg cohort. The single case of neutrophil count decreased was attributed to pola. Cholecystitis occurred on day 1416; it was not related to pola but related to a gallstone. This resulted in treatment discontinuation because patient could not resume treatment within the allowance window in the protocol; the patient recovered on day 1428. Syncope occurred on day 650 and resolved on the same day. It was not related to pola. This event did not result in a dose reduction nor treatment discontinuation. The serious AEs were cholecystitis (1.0 mg/kg cohort, n = 1) and cataract (1.8 mg/kg cohort, n = 1). No deaths were reported in either cohort. Table 2 All-grade TEAEs occurring in two or more patients TEAEs, n (%) . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Peripheral sensory neuropathy 2 (50) 2 (67) 4 (57) Abdominal discomfort 2 (50) 1 (33) 3 (43) Malaise 2 (50) 1 (33) 3 (43) Influenza 2 (50) 1 (33) 3 (43) Diarrhea 1 (25) 1 (33) 2 (29) Constipation 1 (25) 1 (33) 2 (29) Liver disorder 1 (25) 1 (33) 2 (29) Bronchitis 1 (25) 1 (33) 2 (29) Back pain 1 (25) 1 (33) 2 (29) Nasopharyngitis 2 (50) 0 (0) 2 (29) TEAEs, n (%) . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Peripheral sensory neuropathy 2 (50) 2 (67) 4 (57) Abdominal discomfort 2 (50) 1 (33) 3 (43) Malaise 2 (50) 1 (33) 3 (43) Influenza 2 (50) 1 (33) 3 (43) Diarrhea 1 (25) 1 (33) 2 (29) Constipation 1 (25) 1 (33) 2 (29) Liver disorder 1 (25) 1 (33) 2 (29) Bronchitis 1 (25) 1 (33) 2 (29) Back pain 1 (25) 1 (33) 2 (29) Nasopharyngitis 2 (50) 0 (0) 2 (29) TEAEs, treatment-emergent adverse events; Pola, polatuzumab vedotin. Open in new tab Table 2 All-grade TEAEs occurring in two or more patients TEAEs, n (%) . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Peripheral sensory neuropathy 2 (50) 2 (67) 4 (57) Abdominal discomfort 2 (50) 1 (33) 3 (43) Malaise 2 (50) 1 (33) 3 (43) Influenza 2 (50) 1 (33) 3 (43) Diarrhea 1 (25) 1 (33) 2 (29) Constipation 1 (25) 1 (33) 2 (29) Liver disorder 1 (25) 1 (33) 2 (29) Bronchitis 1 (25) 1 (33) 2 (29) Back pain 1 (25) 1 (33) 2 (29) Nasopharyngitis 2 (50) 0 (0) 2 (29) TEAEs, n (%) . Pola dose . Total . . 1.0 mg/kg (n = 4) . 1.8 mg/kg (n = 3) . (n = 7) . Peripheral sensory neuropathy 2 (50) 2 (67) 4 (57) Abdominal discomfort 2 (50) 1 (33) 3 (43) Malaise 2 (50) 1 (33) 3 (43) Influenza 2 (50) 1 (33) 3 (43) Diarrhea 1 (25) 1 (33) 2 (29) Constipation 1 (25) 1 (33) 2 (29) Liver disorder 1 (25) 1 (33) 2 (29) Bronchitis 1 (25) 1 (33) 2 (29) Back pain 1 (25) 1 (33) 2 (29) Nasopharyngitis 2 (50) 0 (0) 2 (29) TEAEs, treatment-emergent adverse events; Pola, polatuzumab vedotin. Open in new tab Pharmacokinetics The selected Cycle 1 PK parameters for acMMAE, total antibody and unconjugated MMAE are shown in Table 3. Both acMMAE and unconjugated MMAE displayed increases in plasma exposure at 1.8 mg/kg compared with 1.0 mg/kg (Fig. 1). Plasma exposure to unconjugated MMAE was lower than that of acMMAE (Fig. 1). As shown in Table 3, unconjugated MMAE Cmax was 0.46 and 0.27% of acMMAE, unconjugated MMAE exposure (AUCinf) was ~1.56 and 0.79% of acMMAE and the mean t1/2 for acMMAE was 4.43 and 7.98 days in the 1.0 and 1.8 mg/kg cohorts, respectively. The mean t1/2 for acMMAE and total antibody were similar between the two dose cohorts, with Vss for both mostly limited to plasma volume. PK profiles of plasma acMMAE and unconjugated MMAE showed no significant differences relative to the absence or presence of peripheral sensory neuropathy (Supplementary Fig. S1). Table 3 Selected cycle 1 pharmacokinetic parameters for polatuzumab vedotin: acMMAE, total antibody and unconjugated MMAE PK parameter . acMMAE . Total antibody . Unconjugated MMAE . . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . Cmax, ng/ml 315 613 19600 47400 1.46 1.67 (28.7) (67.2) (4310) (8960) (0.260) (0.471) AUCinf, day × ng/ml 823 2250 85300 336000 12.8 17.7 (177) (274) (30500) (44200) (2.47) (3.18) t1/2, days 4.43 7.98 5.77 10.8 3.68 4.65 (0.979) (1.21) (2.13) (1.01) (0.355) (0.762) Vss, ml/kg 64.3 91.7 61.9 70.5 – – (21.6) (9.98) (18.3) (7.34) CL, ml/day/kg 22.2 14.4 12.7 5.41 – – (4.24) (1.84) (4.08) (0.747) tmax, days 0.135 0.137 0.0868 0.137 3.28 4.30 (0.0845) (0.0818) (0.00318) (0.0818) (0.485) (1.45) PK parameter . acMMAE . Total antibody . Unconjugated MMAE . . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . Cmax, ng/ml 315 613 19600 47400 1.46 1.67 (28.7) (67.2) (4310) (8960) (0.260) (0.471) AUCinf, day × ng/ml 823 2250 85300 336000 12.8 17.7 (177) (274) (30500) (44200) (2.47) (3.18) t1/2, days 4.43 7.98 5.77 10.8 3.68 4.65 (0.979) (1.21) (2.13) (1.01) (0.355) (0.762) Vss, ml/kg 64.3 91.7 61.9 70.5 – – (21.6) (9.98) (18.3) (7.34) CL, ml/day/kg 22.2 14.4 12.7 5.41 – – (4.24) (1.84) (4.08) (0.747) tmax, days 0.135 0.137 0.0868 0.137 3.28 4.30 (0.0845) (0.0818) (0.00318) (0.0818) (0.485) (1.45) The PK parameters are expressed as mean (SD). The PK parameters were calculated based on data collected from cycle 1 to cycle 2 pre-infusion. The number of patients for each assessment was three except for t1/2, for which the number of patients was four (1.0 mg/kg dose cohort). acMMAE, plasma antibody-conjugated monomethyl auristatin E; MMAE, monomethyl auristatin E; PK, pharmacokinetics; Cmax, maximum plasma or serum concentration; AUCinf, area under the concentration–time curve from zero to infinity; t1/2, plasma or serum terminal phase half-life; Vss, volume of distribution at steady state; CL, clearance; tmax, time to reach maximum drug concentration; SD, standard deviation Open in new tab Table 3 Selected cycle 1 pharmacokinetic parameters for polatuzumab vedotin: acMMAE, total antibody and unconjugated MMAE PK parameter . acMMAE . Total antibody . Unconjugated MMAE . . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . Cmax, ng/ml 315 613 19600 47400 1.46 1.67 (28.7) (67.2) (4310) (8960) (0.260) (0.471) AUCinf, day × ng/ml 823 2250 85300 336000 12.8 17.7 (177) (274) (30500) (44200) (2.47) (3.18) t1/2, days 4.43 7.98 5.77 10.8 3.68 4.65 (0.979) (1.21) (2.13) (1.01) (0.355) (0.762) Vss, ml/kg 64.3 91.7 61.9 70.5 – – (21.6) (9.98) (18.3) (7.34) CL, ml/day/kg 22.2 14.4 12.7 5.41 – – (4.24) (1.84) (4.08) (0.747) tmax, days 0.135 0.137 0.0868 0.137 3.28 4.30 (0.0845) (0.0818) (0.00318) (0.0818) (0.485) (1.45) PK parameter . acMMAE . Total antibody . Unconjugated MMAE . . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . 1.0 mg/kg . 1.8 mg/kg . Cmax, ng/ml 315 613 19600 47400 1.46 1.67 (28.7) (67.2) (4310) (8960) (0.260) (0.471) AUCinf, day × ng/ml 823 2250 85300 336000 12.8 17.7 (177) (274) (30500) (44200) (2.47) (3.18) t1/2, days 4.43 7.98 5.77 10.8 3.68 4.65 (0.979) (1.21) (2.13) (1.01) (0.355) (0.762) Vss, ml/kg 64.3 91.7 61.9 70.5 – – (21.6) (9.98) (18.3) (7.34) CL, ml/day/kg 22.2 14.4 12.7 5.41 – – (4.24) (1.84) (4.08) (0.747) tmax, days 0.135 0.137 0.0868 0.137 3.28 4.30 (0.0845) (0.0818) (0.00318) (0.0818) (0.485) (1.45) The PK parameters are expressed as mean (SD). The PK parameters were calculated based on data collected from cycle 1 to cycle 2 pre-infusion. The number of patients for each assessment was three except for t1/2, for which the number of patients was four (1.0 mg/kg dose cohort). acMMAE, plasma antibody-conjugated monomethyl auristatin E; MMAE, monomethyl auristatin E; PK, pharmacokinetics; Cmax, maximum plasma or serum concentration; AUCinf, area under the concentration–time curve from zero to infinity; t1/2, plasma or serum terminal phase half-life; Vss, volume of distribution at steady state; CL, clearance; tmax, time to reach maximum drug concentration; SD, standard deviation Open in new tab Figure 1. Open in new tabDownload slide Plasma concentration–time curves of (A) acMMAE and (B) unconjugated MMAE following intravenous administration of polatuzumab vedotin 1.0 or 1.8 mg/kg. Curves shown are semi-log plots. Error bars represent standard deviation. acMMAE, plasma antibody-conjugated monomethyl auristatin E; MMAE, monomethyl auristatin E; Pola, polatuzumab vedotin. Figure 1. Open in new tabDownload slide Plasma concentration–time curves of (A) acMMAE and (B) unconjugated MMAE following intravenous administration of polatuzumab vedotin 1.0 or 1.8 mg/kg. Curves shown are semi-log plots. Error bars represent standard deviation. acMMAE, plasma antibody-conjugated monomethyl auristatin E; MMAE, monomethyl auristatin E; Pola, polatuzumab vedotin. Antitumor activity All seven patients were evaluable for efficacy. Based on investigator assessment, four of the seven patients (57%) achieved an objective response, including three CRs and one partial response (PR) (Fig. 2). In the 1.0 mg/kg cohort, two patients achieved CR. One of them achieved initially PR on day 581 and achieved a 100% decrease in tumor lesions on day 805, which was maintained until study discontinuation (day 1477). The other patient achieved PR on day140 and CR on day 552, which was maintained until study discontinuation (day 664). In the 1.8 mg/kg cohort, two patients showed a 100% decrease in tumor lesions. One of them achieved CR on day 328 and continued treatment on the data cut-off date (last tumor evaluation before the data cut-off: day 1559). The response of the other patient was assessed as PR instead of CR because bone marrow infiltration was not evaluated (this patient achieved a 100% decrease in tumor lesions on day 149). Patients with responses were all on study drug for >18 months, with a minimum number of treatment cycles of 27. Figure 2. Open in new tabDownload slide Polatuzumab vedotin treatment duration by histology and investigator-assessed best overall response. The patient who achieved a PR in the 1.8 mg/kg cohort showed a 100% decrease in tumor lesions by computed tomography, but the response was judged a PR because bone marrow infiltration was not evaluated. FL, follicular lymphoma; DLBCL, diffuse large B-cell lymphoma; CR, complete response; PR, partial response; SD, stable disease; PD, progressive disease. Figure 2. Open in new tabDownload slide Polatuzumab vedotin treatment duration by histology and investigator-assessed best overall response. The patient who achieved a PR in the 1.8 mg/kg cohort showed a 100% decrease in tumor lesions by computed tomography, but the response was judged a PR because bone marrow infiltration was not evaluated. FL, follicular lymphoma; DLBCL, diffuse large B-cell lymphoma; CR, complete response; PR, partial response; SD, stable disease; PD, progressive disease. Flow cytometry analysis confirmed that peripheral blood B cells (CD19+) were depleted in most patients before and after the administration of pola. There were no significant changes in the number of peripheral blood T cells (CD3+ CD4/CD8+) or NK cells (CD16 + CD56+). Among all seven patients who expressed CD79b, six highly expressed CD79b as determined by immunohistochemistry (data not shown). Discussion The present phase 1 study was designed to assess pola as a single agent in Japanese patients with relapsed/refractory B-cell NHL. Overall, pola showed an acceptable tolerability profile at both the 1.0 and 1.8 mg/kg doses; no DLTs were observed. This is in line with previous studies of pola in non-Japanese patients (NCT01290549) (18). Pola has demonstrated generally acceptable tolerability in patients with B-cell NHL both as monotherapy and when used in combination with chemoimmunotherapy (11–18). In particular, the safety profiles of single-agent pola shown in the current study are comparable with those from a phase 1 study conducted in non-Japanese patients (18). In non-Japanese NHL patients, TEAEs except for neutropenia were generally grade 1–2 in severity with pola 0.1–2.4 mg/kg. Among NHL patients who received pola 1.8 mg/kg, the grade 3–4 TEAEs were neutropenia (50%) and thrombocytopenia (33%), and diarrhea, peripheral sensory neuropathy, fatigue, anemia, pain in extremity and hyperglycemia (17% each). In NHL patients who received pola <1.8 mg/kg, grade 3–4 TEAEs were neutropenia (29%), fatigue (12%), peripheral sensory neuropathy, decreased appetite, pain in extremity and hyperglycemia (6% each). Notably, in the current study, the only grade 3 AEs experienced were cholecystitis and neutrophil count decreased (1.0 mg/kg cohort, one case each), and syncope and cataract (1.8 mg/kg cohort, one case each). All grade 3 AEs were considered not related to pola, except for the single case of neutrophil count decreased in the 1.0 mg/kg cohort. In the present study, four of seven patients experienced grade 1–2 peripheral sensory neuropathy, which is a common AE with pola and consistent with the mechanism of action of MMAE (22,23). A patient who had peripheral sensory neuropathy at baseline deteriorated to Grade 2 on day 98 and resolved at the time of study discontinuation (day 109). Grade 1 peripheral sensory neuropathy occurred in 3 patients and continued until the study discontinuation or last observation before the data cut-off date (onset to last observation: day 26—1477, 147—664 and 168—1559). In the phase 1 study of pola monotherapy in non-Japanese patients, among the six NHL patients who received pola at a dose of 1.8 mg/kg, peripheral sensory neuropathy was one of the main TEAEs (grade 1–2, 50%; grade 3, 17%) (18). In studies of pola in combination with other therapies, peripheral neuropathy has also been frequently reported (incidence 36–44%) (14–17). Previously, an exposure-response analysis of pola data by logistic regression suggested that pola-induced peripheral neuropathy increased with conjugate (i.e. acMMAE) exposure and treatment duration (19). It has therefore been suggested that a treatment duration of six to eight cycles and doses of 1.8 mg/kg every 21 days might offer better tolerability and reduce the risk of developing peripheral neuropathy. Preliminary data in patients with FL suggest that by reducing doses of pola from 2.4 to 1.8 mg/kg, consistent improvements in safety will be observed (in particular, a reduction in the incidence of peripheral neuropathy) without impairing efficacy (20). Furthermore, data showed that incidence of peripheral neuropathy was lower with both the 1.8 and 2.4 mg doses during the first eight cycles than at completion of pola treatment (median of 9.5 cycles: 1.8 mg/kg and 10 cycles: 2.4 mg/kg). In the present study, patients with antitumor responses were on treatment for a median follow-up period of at least 18 months. The peripheral sensory neuropathy events observed were mostly grade 1, which can be managed by dosing schedule modification, and none led to discontinuation of treatment. This suggests that pola might be safely administered at 1.0 or 1.8 mg/kg over a longer treatment period. Our results found no clinically relevant impact of plasma acMMAE exposure on the occurrence of peripheral sensory neuropathy. However, as the sample size of this phase 1 study was small and the dose range was limited (1.0 or 1.8 mg/kg), further studies are needed to clarify whether greater acMMAE exposure and longer treatment duration may increase the likelihood of pola-related peripheral neuropathy in Japanese patients. PK profile of pola was characterized by analysis of acMMAE, total antibody and unconjugated MMAE in the phase 1 study in non-Japanese B-cell NHL patients. Exposures for the key analyte acMMAE in Japanese patients and non-Japanese patients were similar. Unconjugated MMAE exposure to the analytes was slightly lower and total antibody exposure to the analytes was slightly higher in Japanese patients (18). Responses were demonstrated in one DLBCL and three FL patients. The objective response rate of 57% (four of seven) observed in this study was in line with that reported in the phase 1 study in non-Japanese B-cell NHL patients treated with single-agent pola 2.4 mg/kg (51%; 23 of 45) (18). Clinical development of pola has mainly focused on pola-based combinations with conventional cytotoxic chemotherapy or immunotherapy (11–17). For patients with relapsed/refractory DLBCL, pola in combination with bendamustine plus rituximab was approved by the US FDA to treat those who have received at least two prior therapies (7), and was also granted conditional approval by the European Medicines Agency to treat patients with stem cell transplant-ineligible relapsed/refractory DLBCL (24). In front-line treatment of DLBCL, pola is currently being evaluated as a replacement for vincristine within the standard R-CHOP regimen (NCT03274492) (25). In conclusion, this phase 1 dose-escalation study demonstrated that pola has an acceptable safety profile and offers encouraging antitumor activity to Japanese patients with relapsed/refractory B-cell NHL. Peripheral sensory neuropathy was mostly grade 1 and manageable, and pola 1.8 mg/kg was tolerable as the recommended phase 2 dose.The safety and efficacy of pola monotherapy in Japanese patients with B-cell NHL were comparable with those previously seen in non-Japanese patients. Exposures for the key analyte acMMAE in Japanese patients and non-Japanese patients were similar. This phase 1 dose-escalation study supports further clinical development of pola, as a single agent or in combination with other antitumor agents, for use in Japanese patients with B-cell NHL. Data availability statement Qualified researchers may request access to individual patient level data through the clinical study data request platform (www.clinicalstudydatarequest.com). For further details on Chugai's Data Sharing Policy and how to request access to related clinical study documents, see here (www.chugai-pharm.co.jp/english/profile/rd/ctds_request.html). Acknowledgments Editorial assistance for this manuscript was provided by Ashfield Healthcare Communications and MIMS and was funded by Chugai Pharmaceutical, Co., Ltd. Funding This work was supported by Chugai Pharmaceutical, Co., Ltd (Tokyo, Japan). Conflict of interest statement Tomohiro Kinoshita has received research support from Chugai, MSD, Eisai, Solaisia, Ono and Takeda and has received honoraria from Takeda. Kiyohiko Hatake has received honoraria from Takeda, Celgene, Daiich-Sankyoand Eisai; fees for promotional materials from Takeda and Celgene and scholarship donations from Eisai, Mochida and Kyowa Kirin. Kazuhito Yamamoto has had an advisory role in AbbVie, Astra-Zeneca, Celgene, Chugai, Daiichi Sankyo, Eisai, HUYA, Meiji Seika Pharma, MSD, Mundipharma, Ono, Otsuka, Stemline Therapeutics and Takeda; has received honoraia from AbbVie, Bristol-Myers Squibb, Celgene, Chugai, Eisai, HUYA, Janssen, Kyowa Kirin, Meiji Seika Pharma, Mochida, MSD, Mundipharma, Nippon Shinyaku, Novartis, Ono, Otsuka, Pfizer, Sanofi, Sumitomo Dainippon and Takeda; has received fees for promotional materials from Chugai, CLS Behring, Eisai, Kyowa Kirin, Pfizer and Zenyaku; and has received research support from AbbVie, ARIAD Pharmaceuticals, Astra-Zeneca, Bayer, Celgene, Chugai, Eisai, Gilead Sciences, Incyte, MSD, Mundipharma, Nippon Shinyaku, Novartis, Ono, Solasia Pharma, SymBio, Takeda and Zenyaku. Yusuke Higuchi declares no conflicts of interest. Satsuki Murakami declares no conflicts of interest. Yasuhito Terui has received honoraria from Chugai, Celgene, Bristol-Myers Squibb, Novartis and Janssen and has received research support from BMS. Masahiro Yokoyama has been a medical advisor for Chugai. Dai Maruyama has received honoraria from Mundipharma, Celgene, Janssen, Takeda, Eisai, Ono and Chugai and has received research support from Merck, Mundipharma, Janssen, Takeda, Eisai, Chugai, Ono, Celgene, AbbVie, MSD, Astellas, Amgen, Otsuka, Novartis, Pfizer, Bayer, Zenyaku, Solasia, AstraZeneca, Kyowa Kirin, Sanofi, Bristol-Myers Squibb, Daiichi Sankyo, Symbio, IQVIA and CMIC. Shinichi Makita has received honoraria from Takeda and Novartis. Yukari Hida is an employee of Chugai Pharmaceutical Co., Ltd. Tomohisa Saito is an employee of Chugai Pharmaceutical Co., Ltd. Kensei Tobinai has had an advisory role in Celgene, Zenyaku Kogyo, HUYA, Daiichi Sankyo, Takeda, Mundipharma and Ono; has received honoraria from Zenyaku Kogyo, Eisai, Takeda, Mundipharma, HUYA, Kyowa Hakko Kirin, Celgene, Chugai, Ono, Yakult, Daiichi Sankyo, Bristol-Myers Squibb, Meiji Seika Kaisha, Solasia and Verastem and has received research support from Chugai, Kyowa Hakko Kirin, Ono, Celgene, Janssen, Eisai, Mundipharma, Takeda and AbbVie. References 1. Friedberg JW . Relapsed/refractory diffuse large B-cell lymphoma . Hematology Am Soc Hematol Educ Program 2011 ; 2011 : 498 – 505 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Sehn LH , Donaldson J, Chhanabhai M, et al. Introduction of combined CHOP plus rituximab therapy dramatically improved outcome of diffuse large B-cell lymphoma in British Columbia . J Clin Oncol 2005 ; 23 : 5027 – 33 . Google Scholar Crossref Search ADS PubMed WorldCat 3. NCCN® Guidelines Version 1.2020. https://www.nccn.org/professionals/physician_gls/pdf/b-cell.pdf. 2020 (3 February 2020, date last accessed) . 4. Gisselbrecht C , Glass B, Mounier N, et al. Salvage regimens with autologous transplantation for relapsed large B-cell lymphoma in the rituximab era . J Clin Oncol 2010 ; 28 : 4184 – 90 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Herrera AF , Molina A. Investigational antibody-drug conjugates for treatment of B-lineage malignancies . Clin Lymphoma Myeloma Leuk 2018 ; 18 : 452 – 68.e4 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Wolska-Washer A , Robak P, Smolewski P, Robak T. Emerging antibody-drug conjugates for treating lymphoid malignancies . Expert Opin Emerg Drugs 2017 ; 22 : 259 – 73 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Genentech Inc . Polivy™ (Polatuzumab vedotin-piiq) for injection, for intravenous use: US prescribing information . 2019 . https://www.accessdata.fda.gov/drugsatfda_docs/label/2019/761121s000lbl.pdf. (5 September 2019, date last accessed) . 8. Dornan D , Bennett F, Chen Y, et al. Therapeutic potential of an anti-CD79b antibody-drug conjugate, anti-CD79b-vc-MMAE, for the treatment of non-Hodgkin lymphoma . Blood 2009 ; 114 : 2721 – 9 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 9. Polson AG , Yu SF, Elkins K, et al. Antibody-drug conjugates targeted to CD79 for the treatment of non-Hodgkin lymphoma . Blood 2007 ; 110 : 616 – 23 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Deeks ED . Polatuzumab vedotin: first global approval . Drugs 2019 ; 79 : 1467 – 75 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Morschhauser F , Flinn I, Advani RH, et al. Updated results of a phase II randomized study (ROMULUS) of polatuzumab vedotin or pinatuzumab vedotin plus rituximab in patients with relapsed/refractory non-Hodgkin lymphoma . Blood 2014 ; 124 : 4457 . Google Scholar Crossref Search ADS WorldCat 12. Matasar M , Herrera AF, Kamdar M, et al. Polatuzumab vedotin plus bendamustine and rituximab or obinutuzumab in relapsed/refractory FL or DLBCL: updated results of a phase 1b/2 study . Hematol Oncol 2017 ; 35 : 271 – 2 . Google Scholar Crossref Search ADS WorldCat 13. Phillips T , Brunvand M, Chen A, et al. Polatuzumab vedotin combined with obinutuzumab for patients with relapsed or refractory non-Hodgkin lymphoma: preliminary safety and clinical activity of a phase Ib/II study . Blood 2016 ; 128 : 622 . Google Scholar Crossref Search ADS WorldCat 14. Sehn LH , Herrera AF, Flowers CR, et al. Polatuzumab vedotin in relapsed or refractory diffuse large B-cell lymphoma . J Clin Oncol 2020 ; 38 : 155 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Tilly H , Sharman J, Bartlett N, et al. Pola-R-CHP: polatuzumab vedotin combined with rituximab, cyclophophamide, doxorubicin, prednisone for patients with previously untreated diffuse large B-cell lymphoma . Hematol Oncol 2017 ; 35 : 90 – 1 . Google Scholar Crossref Search ADS WorldCat 16. Morschhauser F , Flinn IW, Advani R, et al. Polatuzumab vedotin or pinatuzumab vedotin plus rituximab in patients with relapsed or refractory non-Hodgkin lymphoma: final results from a phase 2 randomised study (ROMULUS) . Lancet Haematol 2019 ; 6 : e254 – 65 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Tilly H , Morschhauser F, Bartlett NL, et al. Polatuzumab vedotin in combination with immunochemotherapy in patients with previously untreated diffuse large B-cell lymphoma: an open-label, non-randomised, phase 1b-2 study . Lancet Oncol 2019 ; 20 : 998 – 1010 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Palanca-Wessels MC , Czuczman M, Salles G, et al. Safety and activity of the anti-CD79B antibody-drug conjugate polatuzumab vedotin in relapsed or refractory B-cell non-Hodgkin lymphoma and chronic lymphocytic leukaemia: a phase 1 study . Lancet Oncol 2015 ; 16 : 704 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Lu D , Gillespie WR, Girish S, et al. Time-to-event analysis of polatuzumab vedotin-induced peripheral neuropathy to assist in the comparison of clinical dosing regimens . CPT Pharmacometrics Syst Pharmacol 2017 ; 6 : 401 – 8 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Advani RH , Flinn I, Sharman JP, et al. Two doses of polatuzumab vedotin (PoV, anti-CD79b antibody-drug conjugate) in patients (pts) with relapsed/refractory (RR) follicular lymphoma (FL): durable responses at lower dose level . J Clin Oncol 2015 ; 33 : 8503 . Google Scholar Crossref Search ADS WorldCat 21. Cheson BD , Pfistner B, Juweid ME, et al. Revised response criteria for malignant lymphoma . J Clin Oncol 2007 ; 25 : 579 – 86 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Younes A , Bartlett NL, Leonard JP, et al. Brentuximab vedotin (SGN-35) for relapsed CD30-positive lymphomas . N Engl J Med 2010 ; 363 : 1812 – 21 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Advani HJ , Lebovic D, Chen A, et al. Phase I study of the anti-CD22 antibody-drug conjugate pinatuzumab vedotin with/without rituximab in patients with relapsed/refractory B-cell non-Hodgkin lymphoma . Clin Cancer Res 2017 ; 23 : 1167 – 76 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Roche Registration GmbH . Polivy 140 mg powder for concentrate for solution for infusion: summary of product characteristics. 2020 . https://www.ema.europa.eu/en/medicines/human/EPAR/polivy#product-information-section. (3 February 2020, date last accessed) . 25. Tilly H , Flowers C, Friedberg JW, et al. POLARIX: a phase 3 study of polatuzumab vedotin (pola) plus R-CHP versus R-CHOP in patients (pts) with untreated DLBCL . J Clin Oncol 2019 ; 37 : TPS7571 . Google Scholar Crossref Search ADS WorldCat © The Author(s) 2020. Published by Oxford University Press. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] © The Author(s) 2020. Published by Oxford University Press.