Plant Physiology

Minorsky, Peter V.

doi: 10.1104/pp.104.900202pmid: N/A

The Cause of Canola's Green Seed Problem Developing canola (Brassica napus) seeds typically produce chloroplasts during early seed development and then catabolize the photosynthetic machinery during seed maturation, producing seeds that are essentially free of chlorophyll (Chl). However, an untimely frost during seed development can disrupt the Chl degradation process, causing green seed at harvest and devaluing the crop. Chung et al. (pp. 88–97) present evidence that freezing interferes with the induction of Pheophorbide a oxygenase (PaO), an enzyme that is a key regulator of Chl degradation. The authors report that the regulation of PaO activity was largely posttranslational, and it was at this level that freezing interfered with PaO activation in canola seeds. The mechanism of the posttranslational control is unknown, but the increase in PaO activity during seed maturation corresponds to a decrease in the phosphorylation of the PaO enzyme. In view of evidence that Ca2+ fluxes play a major role in plant responses to cold, it may be germane that canola has two PaO genes, each of which contains two possible Ca2+-dependent protein kinase phosphorylation sites. Geomagnetism and the Coconut Twist In plants with alternately arranged foliage, such as the coconut palm (Cocos nucifera), leaves are attached to the stem in either an ascending clockwise (left-handed [L]) or counterclockwise (right-handed [R]) spiral (Fig. 1 Figure 1. Open in new tabDownload slide The prominent leaf scars on this coconut palm trunk reveal the right-handed direction of its foliar spiral. Minorsky and Bronstein suggest that asymmetries in foliar spiral direction, a non-Mendelian trait, may arise from geomagnetic activity. Figure 1. Open in new tabDownload slide The prominent leaf scars on this coconut palm trunk reveal the right-handed direction of its foliar spiral. Minorsky and Bronstein suggest that asymmetries in foliar spiral direction, a non-Mendelian trait, may arise from geomagnetic activity. ). Foliar spiral direction (FSD) is a classic case of morphological antisymmetry, in which L and R forms are not inherited and are equally common within a species. Data collected from more than 70,000 coconut palms in more than 40 locations around the world revealed, however, that the FSD of coconut palms varies with latitude: R trees predominate in the northern hemisphere, and L trees predominate in the southern. A reanalysis of this data indicated that hemispheric asymmetries in FSD are significantly better correlated with magnetic (dip) latitude than with geographic or geomagnetic (centered dipole) latitude, suggesting that latitudinal asymmetries in FSD might be associated with the temporally varying component of Earth's magnetic field. The Induced Current Hypothesis proposes that asymmetries in FSD result from earth currents in trees that are induced by variations in the vertical Z component of the geomagnetic field, and that these earth currents consequently cause a tangential bias in the axial electrophoresis of phyllotaxy-determining morphogens (e.g. auxin transporters). Minorsky and Bronstein (pp. 40–44) report that asymmetries in FSD are also evident in populations of coconut palms on opposite sides of islands and that asymmetries between cohorts vary with an 11-year periodicity—two discoveries consistent with the hypothesis that geomagnetic variations underlie asymmetries in coconut palm FSD. Phytosulfokines Affect Callus Formation and Longevity Even when sufficient amounts of growth regulators and nutrients are supplied, populations of living cells are often required to support callus growth in vitro. This population dependence is alleviated by the addition of conditioned medium in which cells have previously been grown, indicating the involvement of a chemical signal produced by growing cells in this phenomenon. Phytosulfokine (PSK) is a 5-amino-acid sulfated peptide that has been detected in conditioned medium of plant cell cultures. The addition of chemically synthesized PSK to culture medium, even at nanomolar concentrations, significantly increases the rate of callus growth, even when the initial cell population is below the critical density. These results suggest that PSK may be the critical component in conditioned media that gives such media their growth-promoting properties. PSK is known to act by binding to a membrane-localized PSK receptor, PSKR1. The carrot (Daucus carota) PSK receptor, DcPSKR1, exhibits a high percentage of amino acid identity with a Leu-rich repeat ribonuclease inhibitor (AtPSKR1) found in the Arabidopsis (Arabidopsis thaliana) genome. Matsubayashi et al. (pp. 45–53) have analyzed the function of this putative Arabidopsis PSK receptor gene by gain-of-function and loss-of-function strategies. Although AtPSKR1-deficient seedlings exhibited normal growth that was phenotypically indistinguishable from wild-type for the first 3 weeks after germination, they gradually lost their potential to form calluses as tissues matured. Moreover, the calluses derived from the immature tissues of AtPSKR1-deficient seedlings also exhibited premature senescence accompanied by browning within 3 weeks of culture. These results suggest that PSK signaling affects the growth potential and longevity of plant cells. Transcript Response to Elevated Carbon Dioxide Because soybean (Glycine max) is the most widely grown seed legume in the world, it is important to understand how it will respond to the 50% increase in atmospheric [CO2] that is projected to occur by the year 2050. Toward this end, a Free Air CO2 Enrichment (FACE) experiment was established in Illinois in 2001. From this long-term experiment and others, it has been established that elevated [CO2] increases carbon uptake, foliar carbohydrate content, plant growth, and yield, while decreasing stomatal conductance. The increased carbon assimilation and water-use efficiency under conditions of high atmospheric [CO2] also leads to increases in leaf area index (LAI). The combination of increased photosynthesis and increased LAI leads to significant increases in soybean seed yield. At the molecular level, the basis for changes in LAI at elevated [CO2] is largely unknown, although both cell production rates and cell expansion have been shown to be affected. Ainsworth et al. (pp. 135–147) have investigated the transcriptome responses of rapidly growing and fully expanded leaves to elevated [CO2] at the soybean FACE facility. Their research suggests that at the transcript level, elevated [CO2] stimulates the respiratory breakdown of carbohydrates, which likely provides increased fuel for leaf expansion and growth at elevated [CO2]. New Insights into Light-Regulated Transcription The events leading to transcription of eukaryotic protein-coding genes culminate in the positioning of RNA polymerase II at the correct initiation site. The core promoter, which can extend approximately 35 bp upstream and/or downstream of this site, plays a central role in regulating initiation. Specific DNA elements within the core promoter bind the factors that nucleate the assembly of a functional pre-initiation complex and integrate stimulatory and repressive signals from factors bound at distal sites. The eukaryotic promoters of protein-coding genes have one or more of the three conserved sequences in the core promoter region, i.e. the TATA box, the initiator region, and the downstream promoter element. TATA boxes are T/A-rich DNA sequences (cis-regulatory elements) found in the promoter region of most genes about 25 to 30 bp upstream of the transcription site. TATA boxes have been highly conserved through evolution and have a core DNA sequence 5′-TATAAA-3′, which is usually followed by two or more adenine bases. Although the minimal promoter is generally believed to determine the rate of transcription and the point of its initiation, there is some evidence suggesting that it also plays a role in promoter selectivity. For example, two different TATA boxes in transgenic mice expressing the human globin gene determine the regulation of γ-globin gene expression during embryogenesis and in the adult stage, respectively. Kiran et al. (pp. 364–376) have examined the effects of mutations at each position in a 13-nucleotide-long prototype TATA box, on promoter function in tobacco (Nicotiana tabacum) leaf tissue. Light-regulated gene expression was examined in leaves using gusA as a reporter gene. Their results suggest that the sequence architecture in the TATA region may be important not only in modulating the level of gene expression, but also in determining the selectivity of promoter function in response to light or dark, and the quality of light. For example, some mutations, such as T7 or A8 → C or G, completely inactivated the expression of the minimal promoter in the light but not in the dark, and an A at the eighth position was specifically involved in the red-light response of the promoter. KNOX Proteins Induce Cytokinin Biosynthesis in Rice KNOX proteins are transcriptional regulators that play critical roles in shoot apical meristem formation and maintenance. A complete understanding of KNOX protein function requires the identification of the genes targeted by them and knowledge of the transcriptional regulation of those genes. Previous studies in dicot species have revealed that KNOX proteins suppress the expression of genes that encode for GA 20-oxidase, the enzyme that catalyzes the rate-limiting step of bioactive GA synthesis. Another candidate for regulation by KNOX proteins is cytokinin (CK) biosynthesis because production of bioactive CKs such as trans-zeatin and isopentenyladenine is significantly increased in KNOX overproducers. To elucidate the functional interaction between KNOX proteins and CK biosynthesis in monocot plants, Sakamoto et al. (pp. 54–62) have identified eight rice (Oryza sativa) genes that code for adenosine phosphate isopentenyltransferase (IPT), the enzyme that catalyzes the rate-limiting step of CK biosynthesis. The overexpression of OsIPTs in transgenic rice inhibited root development and promoted axillary bud growth, indicating that OsIPTs are functional in vivo. The phenotypes of OsIPT overexpressors resembled those of KNOX-overproducing transgenic rice, although OsIPT overexpressors did not form roots or ectopic meristems, both of which are observed in KNOX overproducers. The authors propose that the ectopic expression of KNOX proteins induces specific IPT gene expression and de novo CK biosynthesis, and that this cascade is conserved in both monocots and dicots. Another important function of KNOX proteins—repression of GA biosynthesis by the suppression of GA 20-oxidase gene expression—is also apparently conserved between monocots and dicots. These results support the hypothesis that plant meristems need high-CK and low-GA conditions to maintain their activity, and that KNOX proteins act as central regulators to control these phytohormones at adequate levels in both monocots and dicots. www.plantphysiol.org/cgi/doi/10.1104/pp.104.900202. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Chrispeels, Maarten J.; Raikhel, Natasha V.; Ort, Donald R.

doi: 10.1104/pp.104.900203pmid: 16957131

Dr. Martin Gibbs died at his home on July 24, 2006, in Lexington, MA, at the age of 83. We three succeed Marty as chief editors of Plant Physiology, a position he held from 1963 to 1992. We offer this brief accounting in celebration of his professional career. In the fall of 1940, Marty began his undergraduate studies at the Philadelphia College of Pharmacy and Science, concentrating in chemistry. According to his own account, it was not until his third and final year that he took an elective course on pharmacognosy and discovered biology (Gibbs, 1999). Two inspiring professors, Edmund MacLaughlin and Theodor P. Haas, cemented his interest in biology, but especially plant biology. To pursue graduate studies, he accepted a teaching fellowship in the Department of Chemistry at the University of Illinois, but his desire to major in the application of chemistry to botany was not supported by the department at the time so he transferred to Botany. Under the guidance of F. Lyle Wynd and Harry Fuller, he completed his doctoral degree in 1947, working on the chemical changes occurring during the growth of diploid and tetraploid forms of Datura stramonium. Nearly 50 years later, in 1996, the University of Illinois honored Marty with the Liberal Arts and Sciences Alumni Achievement award. At the suggestion of Kenneth Thimann who was at the time at Cal Tech, Marty applied for a position at the newly established Atomic Energy Commission's Brookhaven National Laboratory. Using radioactive 14CO2 made at Oak Ridge National Laboratory, he was initially responsible for synthesizing radiocarbon-labeled simple sugars from Canna indica, a sucrose accumulator. He went on to develop these compounds as tools to study metabolism. Collaborating with I.C. Gunsalus, Marty quickly adapted new discoveries about the metabolism of Leuconostoc mesenteroides to identify those individual carbon atoms of glucose that were radiolabeled. The resolution of individual sugar atoms led to the surprising discovery of an asymmetric labeling of carbon atoms in hexoses during photosynthesis 14C fixation, which became known as the “Gibbs Effect.” The isotope work drew a host of other biologists, including future winners of the Nobel Prize, to Brookhaven to learn about 14C. While at Brookhaven he also delineated the pentose phosphate pathway of plants and the NADPH-dependent reduction of glyceraldehyde-3-phosphate in photosynthesis. In 1957, he left Brookhaven for a faculty position in the College of Agriculture at Cornell. He remained at Cornell until 1964, when he accepted a position at Brandeis University. At both Cornell and Brandeis universities, his pioneering work on isolated chloroplasts focused on the induction process, photochemistry, and CO2 assimilation. He also returned to an unresolved problem in certain algae of how hydrogen is produced and combined with oxygen to reduce CO2 in the dark. These studies led him into chloroplast respiration and to the discovery of new pathways of carbon and electron flow. Marty's distinguished, if not at times controversial, research career led to numerous awards, including election to the American Academy of Arts and Sciences in 1972 and the National Academy of Sciences in 1974. Open in new tabDownload slide Open in new tabDownload slide In 1963, at the age of 41, Marty became Editor-in-Chief of Plant Physiology. He was the fifth editor since the journal's inception in 1926 under founding Editor Charles A. Shull (Editor 1926–1945). Allan Brown, Editor from 1958 to 1962, wrote of his successor: “It is a pleasure for me to acknowledge formally the transfer of editorial responsibilities to my successor, Dr. Martin Gibbs of the Biochemistry Department, Cornell University. … The selection of Marty Gibbs as our next editor was the responsibility of the editorial board and the president (2 presidents, in fact, since the selection process overlapped a change in ASPP officers). … I heartily approve the wise choice that was made. I shall be delighted to turn over the editorial responsibilities to an able and respected colleague” (Hanson, 1989). As you might expect, a great deal of what makes Plant Physiology the journal it is today occurred during Marty's 30-year watch: Increases in published issues per year (six versus 12), volumes (one versus three), and number of pages (1,000 versus 4,800). Increases in submissions (200 versus 1,300) and percentage of declined manuscripts (20% versus 35%). Appointment of Associate Editors and an expanded Editorial Board to accommodate the increases in submissions. Transfer of the redactory service from the editorial office to the printer. Transfer of production schedule, journal format, and reading of galley and page proofs from the Editor-in-Chief to the senior production editor, Melinda (Jody) Carlson. Prior to 1967 the Editor-in-Chief was also “managing editor” and was responsible for the editorial handling of manuscripts through review, decision, and revision. Bless you, Marty! A new look for the journal cover in 1988, departing from the familiar dull green background with black Times New Roman font to a bright green background with black-and-white Helvetica font. In an era of major changes, ASPP started The Plant Cell in 1989, and in 1992 Marty handed over the reins of Plant Physiology to Maarten Chrispeels. Since that time Plant Physiology has been able to take full advantage of the foundation that Marty created for it. As plant physiology research became more sophisticated, this was reflected in the types of research papers that were published in the journal. During Marty's tenure as Editor-in-Chief, there was an increase in articles on the application of biochemistry to plant research and on plant biochemistry itself—from less than 9% to 20%, reflecting the use of these emerging disciplines to study physiology. Marty can be credited for beginning a tradition of rigorous peer review that has grown and is a major reason for Plant Physiology's continued growth in stature and in the importance of the science that is published within its covers. Today Plant Physiology is the most cited journal in plant biology, with an incredible 39,766 total citations last year, and boasts an impact factor of 6.114. Along with The Plant Cell, it has led the way among plant journals in online publishing, use of color, and turnaround times from submission to decision and publication. Marty intended for Plant Physiology to be an international journal, and it has truly grown into that vision. Currently, approximately 70% of the papers published in the journal are from non-U.S. labs, and over a third of the Editorial Board members live and work abroad. Plant Physiology continues in this tradition of innovation and is now at the forefront of plant research journals with its new Open Access initiative, which is described in the second editorial of this issue. Those who knew Marty understand that his legacy is complex, as it is for many of the larger-than-life figures of his era. However, there can be no doubt that Marty had a huge impact on Plant Physiology and that during the early years of his leadership he laid the foundation for Plant Physiology to become the top broadly based plant biology journal in the world, the journal to which others aspire. LITERATURE CITED Gibbs M ( 1999 ) Educator and editor. Annu Rev Plant Physiol Plant Mol Biol 50 : 1 – 25 Crossref Search ADS PubMed Hanson JB ( 1989 ) History of the American Society of Plant Physiologists. American Society of Plant Physiologists, Rockville, MD Author notes www.plantphysiol.org/cgi/doi/10.1104/pp.104.900203 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Ort, Donald R.

doi: 10.1104/pp.104.900204pmid: 16957132

Beginning with the January 2007 issue, all papers in Plant Physiology corresponded by ASPB members will be published with full Open Access. This means that anyone with an Internet connection anywhere in the world will have instant full access to your paper as soon as it is published, i.e. Real-Time Plant Physiology. This includes full access to the publish-ahead-of-print version (Plant Physiology Preview) as well as to the final, fully edited version, full access to supplemental data, and full access to all the advanced linking and tracking tools. Since more than 50% of the papers currently published in Plant Physiology are corresponded by ASPB members, more than half of the papers in the January 2007 issue will be fully Open Access. We anticipate that the proportion of Open Access papers will increase as submitting authors join ASPB to become eligible for this new member benefit. Last month I announced that also beginning with the January 2007 issue, charges for the first printed color image in Plant Physiology articles will be waived for those corresponding authors who are ASPB members (Ort, 2006). This is in addition to the already offered discount on page charges for ASPB members, as well as discounted subscriptions to the print versions of both Plant Physiology and The Plant Cell, free electronic access to Plant Physiology and The Plant Cell, and a discount on registration fees for ASPB meetings. Annual membership in the American Society of Plant Biologists is $115 for regular members (http://www.aspb.org/membership/) and considerably less for postdocs and students. Additionally, beginning with articles submitted October 1, 2006, free online color will be offered to all Plant Physiology authors. With the online use of Plant Physiology growing at a rapid rate, online color is becoming evermore important. This new feature will allow you to have color images in the online version of your article and black and white in the print version for no charge. Online-only color adds value when color is not critical for data interpretation but aids in presentation. Why should you be concerned whether or not your article is published with Open Access? In addition to helping fulfill the altruistic academic aspiration of making new knowledge as widely available as possible, there are strong reasons to believe that Open Access drives higher impact and citation by accelerating recognition and dissemination of research findings. A recent longitudinal bibliometric analysis of Open Access vs. non–Open Access papers published over a 6-month period in the Proceedings of the National Academy of Sciences supports this premise (Eysenbach, 2006). Even in a journal widely available in research libraries and one that publicly releases its full content after 6 months, Open Access articles were found to be twice as likely to be cited in the first 4 to 10 months compared to non–Open Access articles. While it is still too early to have a full picture, based on citation information out to 16 months postpublication, the study projected that the early recognition has been sustained and is resulting in more total citations and higher impact over time. Plant Physiology and The Plant Cell have for the past 10 months offered a similar author fee–based Open Access option. Since we introduced this option in Plant Physiology with the December 2005 issue, about 10% of the articles published in our journal have been Open Access. These articles, on average, have been accessed about 10% more often and downloaded approximately 20% more often than the non–Open Access articles published in the same volumes. It is somewhat puzzling why this so. While there is a cohort of readers that do not have subscription access and thus must wait until Plant Physiology releases content 12 months after publication, I believe a stronger factor is the ease with which Open Access papers can be directly viewed from various sorts of Web searches. Although it is too early for citation data on Plant Physiology Open Access papers to be meaningful, we believe that this early recognition will translate into an increase in article citations and impact as was seen for the 15% of articles in PNAS with that journal's author fee–based Open Access. Since more than 50% of the papers published in Plant Physiology during 2007 and beyond will be Open Access, I am a strong believer that the journal will grow in impact and stature as a result. ASPB President Mike Thomashow, in a recent article in the ASPB News (http://www.aspb.org/newsletter/), laid out the financial risks for the Society that are associated with Open Access. While Plant Physiology's membership-based Open Access model mitigates those risks, I nevertheless believe that the plant biology community will be very grateful to ASPB for signing on to this bold experiment: RT-Plant Physiology. LITERATURE CITED Eysenbach G ( 2006 ) Citation advantage for open access articles. PLoS Biol 4 : e157 Crossref Search ADS PubMed Ort DR ( 2006 ) ADD COLOR! Plant Physiol 141 : 1163 Crossref Search ADS Author notes 1 All papers submitted after October 1, 2006, will be eligible for this benefit. www.plantphysiol.org/cgi/doi/10.1104/pp.104.900204 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Travella, Silvia; Klimm, Theres E.; Keller, Beat

doi: 10.1104/pp.106.084517pmid: 16861570

Abstract Insertional mutagenesis and gene silencing are efficient tools for the determination of gene function. In contrast to gain- or loss-of-function approaches, RNA interference (RNAi)-induced gene silencing can possibly silence multigene families and homoeologous genes in polyploids. This is of great importance for functional studies in hexaploid wheat (Triticum aestivum), where most of the genes are present in at least three homoeologous copies and conventional insertional mutagenesis is not effective. We have introduced into bread wheat double-stranded RNA-expressing constructs containing fragments of genes encoding Phytoene Desaturase (PDS) or the signal transducer of ethylene, Ethylene Insensitive 2 (EIN2). Transformed plants showed phenotypic changes that were stably inherited over at least two generations. These changes were very similar to mutant phenotypes of the two genes in diploid model plants. Quantitative real-time polymerase chain reaction revealed a good correlation between decreasing mRNA levels and increasingly severe phenotypes. RNAi silencing had the same quantitative effect on all three homoeologous genes. The most severe phenotypes were observed in homozygous plants that showed the strongest mRNA reduction and, interestingly, produced around 2-fold the amount of small RNAs compared to heterozygous plants. This suggests that the effect of RNAi in hexaploid wheat is gene-dosage dependent. Wheat seedlings with low mRNA levels for EIN2 were ethylene insensitive. Thus, EIN2 is a positive regulator of the ethylene-signaling pathway in wheat, very similar to its homologs in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). Our data show that RNAi results in stably inherited phenotypes and therefore represents an efficient tool for functional genomic studies in polyploid wheat. A major challenge in the postgenome era of plant biology is to determine the functions of all the genes in a plant genome. A straightforward approach to this problem is to reduce or knock out expression of a gene to induce a mutant phenotype that is indicative of the gene function. Insertional mutagenesis is a useful tool for this type of study and is based on transposon/T-DNA insertions (Page and Grossniklaus, 2002). However, this approach is limited by the time required to saturate a genome, by lethal knockouts, and is restricted to a few plant species. In addition, it is complicated by the problem of genetic redundancy caused by multigene families and polyploidy. In contrast to insertional mutagenesis, RNA interference (RNAi) is based on sequence-specific RNA degradation that follows the formation of double-stranded RNA (dsRNA) homologous in sequence to the targeted gene (Marx, 2000; Carthew, 2001; Baulcombe, 2004). RNAi allows silencing one, several, or all members of a multigene family or homoeologous gene copies in polyploids by targeting sequences that are unique or shared by several genes (Lawrence and Pikaard, 2003; Miki et al., 2005). dsRNA is detected by the host plant genome as aberrant and is cleaved by the action of Dicer-like enzymes (Hamilton and Baulcombe, 1999; Zamore et al., 2000; Djikeng et al., 2001; Tang et al., 2003) into two distinct classes of small interfering RNA (siRNA): long and short siRNAs (Hamilton et al., 2002; Tang et al., 2003). These two classes of small RNAs were proposed to have distinct RNA silencing functions: approximately 21-mers to direct posttranscriptional signaling via mRNA degradation and the approximately 24-mers to trigger systemic silencing and the methylation of homologous DNA (Hamilton et al., 2002). Biochemical experiments in wheat (Triticum aestivum) germ and cauliflower (Brassica oleracea) extracts provided clear evidence that each class of siRNAs is generated by distinct Dicer-like enzymes (Tang et al., 2003). Through sequence complementarity, siRNA in association with an RNA-induced silencing complex directs the cleavage of endogenous RNA transcripts. siRNAs are also responsible for amplifying the silencing signal by priming endogenous RNA, which can be converted to dsRNA by the action of RNA-directed RNA polymerase (RdRP) encoded in the plant genome (Lipardi et al., 2001; Sijen et al., 2001). Tang et al. (2003) showed that wheat germ extracts contained an RdRP activity. Thus, a few trigger dsRNA molecules suffice to inactivate a continuously transcribed target mRNA for long periods of time. The inactivation persists through cell division, spreads to untreated cells and tissues of plants, and is inherited to subsequent generations. RNAi has proven to be very efficient in interfering with gene expression in various plant systems such as Petunia hybrida, Arabidopsis (Arabidopsis thaliana), Papaver somniferum, Torenia hybrida, Coffea arabica, and rice (Oryza sativa; Stam et al., 1997; Chuang and Meyerowitz, 2000; Wesley et al., 2001; Stoutjesdijk et al., 2002; Allen et al., 2004; Fukusaki et al., 2004; Lee et al., 2004; Ogita et al., 2004; Miki et al., 2005). The wide use of this powerful technique reflects its ease of application and the possibilities for genome-wide reverse genetics. Gene constructs encoding intron-spliced RNA with a self-complementary hairpin (hp) structure have been shown to induce posttranscriptional gene silencing with almost 100% efficiency when directed against viruses or endogenous genes and transgenes (Smith et al., 2000). In functional gene analysis and isolation of agronomically important genes, wheat is clearly lagging behind compared to other major food crops such as maize (Zea mays), rice, and also species such as tomato (Lycopersicon esculentum). This is mainly due to the lack of efficient tools to study gene function in polyploid species. Hexaploid wheat has a large genome (16,000 Mb) that consists of three closely related homoeologous genomes (A, B, and D) and has a high content of repetitive DNA (80%; Flavell et al., 1974). Genes are found to be organized in gene islands or as single genes separated by large regions of nested repetitive elements (Feuillet and Keller, 2002). Due to the hexaploid nature of its genome, bread wheat has three (or a multiple of three) copies of most genes. It was found that many of these homoeologous genes are expressed (Mochida et al., 2003) and that there is, therefore, a high degree of functional gene redundancy in hexaploid wheat. In wheat and barley (Hordeum vulgare), Schweizer et al. (2000), Christensen et al. (2004), and Douchkov et al. (2005) showed that delivery of specific dsRNA into single epidermal cells transiently interfered with gene function. Single-cell RNAi, as well as virus-induced gene silencing (VIGS; Burch-Smith et al., 2004; Hein et al., 2005; Scofield et al., 2005), can be used as tools for reverse genetics, but there are several drawbacks to these transient approaches. The analysis of whole-organism gene function is not possible with these techniques, and they do not introduce stable genetic change in plants. Yan et al. (2004) and Loukoianov et al. (2005) used RNAi to stably transform wheat and demonstrate that reduction of VRN2 and VRN1 transcript levels, respectively, accelerated and delayed flowering initiation in winter wheat. However, in both studies, only one independent transgenic plant showed the expected silenced phenotype. Regina et al. (2005) also used RNAi to generate high-amylose wheat. These studies did not report any molecular analyses on the long-term phenotypic stability of RNAi-mediated gene silencing over several generations; neither did they report any molecular details on silencing of homoeologous genes. To develop RNAi technology for functional genomics in wheat, there is a need to characterize in molecular detail the silencing of homoeologous genes as well as the inheritance of RNAi-induced phenotype. To investigate the potential of dsRNAi in wheat, we introduced into hexaploid wheat dsRNA-expressing constructs of two genes that have not yet been cloned in wheat, but with previously defined functions in other plant species and with unambiguous phenotypes in corresponding mutant plants. The first gene was Phytoene Desaturase (PDS), which is often used to evaluate VIGS efficiency because of its distinct phenotype (Holzberg et al., 2002). PDS is an enzyme of the carotenoid biosynthetic pathway, and reduction or loss of this enzyme results in inhibition of the carotenoid biosynthesis and subsequently in a photobleaching phenotype due to chlorophyll photooxidation (Bartley and Scolnik, 1995). To assess whether genes that do not encode enzymes can also be effectively silenced by RNAi in wheat, we decided to target Ethylene Insensitive 2 (EIN2), which encodes a transmembrane protein of the ethylene signaling pathway (Alonso et al., 1999). It has been identified in Arabidopsis, where all 25 ein2 mutant alleles showed a clear phenotype of complete insensitivity to ethylene at the morphological, physiological, and molecular levels (Alonso et al., 1999). In our study, RNAi constructs expressing these two genes were delivered into wheat by particle bombardment-mediated transformation and were stably integrated into the genome. In addition to high specificity and heritability, a phenotypic series (weak, intermediate, and strong) was obtained from dsRNAi. Furthermore, quantitative real-time experiments showed that the endogenous target mRNA levels of all three homoeologous genes are decreased in RNAi transgenic lines and that siRNA production is gene-dosage dependent. Thus, specific and inheritable dsRNAi offers a useful and efficient tool for functional genomics in hexaploid wheat and provides a powerful tool to manipulate gene expression experimentally. RESULTS Identification of Wheat Expressed Sequence Tags for PDS and EIN2 The two genes selected for testing RNAi in hexaploid wheat, PDS and EIN2, have not yet been described in the wheat genome. A BLASTN search using the barley PDS cDNA sequence (AY062039; Holzberg et al., 2002) identified several wheat expressed sequence tags (ESTs) showing high nucleotide (nt) identity (E < 10−100) to the barley sequence. Seven wheat ESTs that were homologous to the 5′ end of the barley sequence were used in a multiple sequence alignment to find out whether more than one PDS gene is expressed in wheat. Two groups of three and four ESTs, with more than 97% nt identity, could be clearly distinguished based on characteristic simple nt polymorphisms (SNPs). A pair of primers (Table I Table I. Primers designed on wheat ESTs for the specific amplification of sequences used for RNAi EST sources and product sizes amplified by RT-PCR are shown. Restriction sites are shown in bold (GGATCC for BamHI and AGATCT for BglII). Primers designed to perform quantitative real-time PCR are designated by RT. Primer Name . Sequence (5′ → 3′) . Source . Product Size . bp PDS-F CCAAGGATCCGAATTTGTTTGCTGAGCTTGG BG908924 480 PDS-R GGCAAGATCTGCCTTTCAGGAGGATTACCA BG908924 PDS-RT-F CAGCAGTGTCCAGGCACTA CK163183 115 PDS-RT-R ACAACCTGCAGAGCACGAAG CK163183 PDS-RT-F1 ACCTTTAGTTCGACTTCCCC Contig 1 68 PDS-RT-R1 AGAGCACGAAGTCCACGT Contig 1 PDS-RT-F2 CAGGCACTAAAAACCAGTCAC Contig 2 96 PDS-RT-R2 AGAGCACGAAGTCCACCG Contig 2 PDS-RT-F3 CAGCAGTGTCCAGGCACTA Contig 3 106 PDS-RT-R3 AGAGCACGAAGTCCATGA Contig 3 EIN2-F CTAAGGATCCACAAAGCCCAGCAATGAATC AL816731 518 EIN2-R CCTAAGATCTTGAAGAAGCTCTGCCTCACA AL816731 EIN2-RT-F TGGGTTCATCCAACTGGTC CD925940 80 EIN2-RT-R AAGATGGCATATTGAAATTTG CD925940 EIN2-RT-F1 GCAGCTTACTTGAGCAAAATC Contig 1 92 EIN2-RT-R1 ATGAATAGTAGCAGGCTGATAGA Contig 1 EIN2-RT-F2 GCAGCTTACTTGAGCCAAATG Contig 2 92 EIN2-RT-R2 ATGAATAGTAGCAGGCTGATAGG Contig 2 EIN2-RT-F3 GGATATCAGCTGGCATCTT Contig 3 132 EIN2-RT-R3 CATAACAGGATCAGCATAGTTAGA Contig 3 TAK14-F TGGAAGATCTTGATATCCGTTCTGTTTCTA AF325198 568 TAK14-R TTCAGGATCCTTGTGCCAGATATTTGCTCC AF325198 SC255-RT-F GTACAACGCTGGAACGAACA TC264870 84 SC255-RT-R GAAAGGTTCTCGGTGTCGTC TC264870 GAPDH-RT-F TTAGACTTGCGAAGCCAGCA AF251217 81 GAPDH-RT-R AAATGCCCTTGAGGTTTCCC AF251217 TAK14-3′-F CATGGTGCCATGGTTCAAAG AF325198 Variable NOS-R CAAGACCGGCAACAGGATTC PBI101TD Mlo-F CCTGACGCTATTCCAGAACG AF361932 518 Mlo-R AGACCGACCTTCTCCTGTCA AF361932 Primer Name . Sequence (5′ → 3′) . Source . Product Size . bp PDS-F CCAAGGATCCGAATTTGTTTGCTGAGCTTGG BG908924 480 PDS-R GGCAAGATCTGCCTTTCAGGAGGATTACCA BG908924 PDS-RT-F CAGCAGTGTCCAGGCACTA CK163183 115 PDS-RT-R ACAACCTGCAGAGCACGAAG CK163183 PDS-RT-F1 ACCTTTAGTTCGACTTCCCC Contig 1 68 PDS-RT-R1 AGAGCACGAAGTCCACGT Contig 1 PDS-RT-F2 CAGGCACTAAAAACCAGTCAC Contig 2 96 PDS-RT-R2 AGAGCACGAAGTCCACCG Contig 2 PDS-RT-F3 CAGCAGTGTCCAGGCACTA Contig 3 106 PDS-RT-R3 AGAGCACGAAGTCCATGA Contig 3 EIN2-F CTAAGGATCCACAAAGCCCAGCAATGAATC AL816731 518 EIN2-R CCTAAGATCTTGAAGAAGCTCTGCCTCACA AL816731 EIN2-RT-F TGGGTTCATCCAACTGGTC CD925940 80 EIN2-RT-R AAGATGGCATATTGAAATTTG CD925940 EIN2-RT-F1 GCAGCTTACTTGAGCAAAATC Contig 1 92 EIN2-RT-R1 ATGAATAGTAGCAGGCTGATAGA Contig 1 EIN2-RT-F2 GCAGCTTACTTGAGCCAAATG Contig 2 92 EIN2-RT-R2 ATGAATAGTAGCAGGCTGATAGG Contig 2 EIN2-RT-F3 GGATATCAGCTGGCATCTT Contig 3 132 EIN2-RT-R3 CATAACAGGATCAGCATAGTTAGA Contig 3 TAK14-F TGGAAGATCTTGATATCCGTTCTGTTTCTA AF325198 568 TAK14-R TTCAGGATCCTTGTGCCAGATATTTGCTCC AF325198 SC255-RT-F GTACAACGCTGGAACGAACA TC264870 84 SC255-RT-R GAAAGGTTCTCGGTGTCGTC TC264870 GAPDH-RT-F TTAGACTTGCGAAGCCAGCA AF251217 81 GAPDH-RT-R AAATGCCCTTGAGGTTTCCC AF251217 TAK14-3′-F CATGGTGCCATGGTTCAAAG AF325198 Variable NOS-R CAAGACCGGCAACAGGATTC PBI101TD Mlo-F CCTGACGCTATTCCAGAACG AF361932 518 Mlo-R AGACCGACCTTCTCCTGTCA AF361932 Open in new tab Table I. Primers designed on wheat ESTs for the specific amplification of sequences used for RNAi EST sources and product sizes amplified by RT-PCR are shown. Restriction sites are shown in bold (GGATCC for BamHI and AGATCT for BglII). Primers designed to perform quantitative real-time PCR are designated by RT. Primer Name . Sequence (5′ → 3′) . Source . Product Size . bp PDS-F CCAAGGATCCGAATTTGTTTGCTGAGCTTGG BG908924 480 PDS-R GGCAAGATCTGCCTTTCAGGAGGATTACCA BG908924 PDS-RT-F CAGCAGTGTCCAGGCACTA CK163183 115 PDS-RT-R ACAACCTGCAGAGCACGAAG CK163183 PDS-RT-F1 ACCTTTAGTTCGACTTCCCC Contig 1 68 PDS-RT-R1 AGAGCACGAAGTCCACGT Contig 1 PDS-RT-F2 CAGGCACTAAAAACCAGTCAC Contig 2 96 PDS-RT-R2 AGAGCACGAAGTCCACCG Contig 2 PDS-RT-F3 CAGCAGTGTCCAGGCACTA Contig 3 106 PDS-RT-R3 AGAGCACGAAGTCCATGA Contig 3 EIN2-F CTAAGGATCCACAAAGCCCAGCAATGAATC AL816731 518 EIN2-R CCTAAGATCTTGAAGAAGCTCTGCCTCACA AL816731 EIN2-RT-F TGGGTTCATCCAACTGGTC CD925940 80 EIN2-RT-R AAGATGGCATATTGAAATTTG CD925940 EIN2-RT-F1 GCAGCTTACTTGAGCAAAATC Contig 1 92 EIN2-RT-R1 ATGAATAGTAGCAGGCTGATAGA Contig 1 EIN2-RT-F2 GCAGCTTACTTGAGCCAAATG Contig 2 92 EIN2-RT-R2 ATGAATAGTAGCAGGCTGATAGG Contig 2 EIN2-RT-F3 GGATATCAGCTGGCATCTT Contig 3 132 EIN2-RT-R3 CATAACAGGATCAGCATAGTTAGA Contig 3 TAK14-F TGGAAGATCTTGATATCCGTTCTGTTTCTA AF325198 568 TAK14-R TTCAGGATCCTTGTGCCAGATATTTGCTCC AF325198 SC255-RT-F GTACAACGCTGGAACGAACA TC264870 84 SC255-RT-R GAAAGGTTCTCGGTGTCGTC TC264870 GAPDH-RT-F TTAGACTTGCGAAGCCAGCA AF251217 81 GAPDH-RT-R AAATGCCCTTGAGGTTTCCC AF251217 TAK14-3′-F CATGGTGCCATGGTTCAAAG AF325198 Variable NOS-R CAAGACCGGCAACAGGATTC PBI101TD Mlo-F CCTGACGCTATTCCAGAACG AF361932 518 Mlo-R AGACCGACCTTCTCCTGTCA AF361932 Primer Name . Sequence (5′ → 3′) . Source . Product Size . bp PDS-F CCAAGGATCCGAATTTGTTTGCTGAGCTTGG BG908924 480 PDS-R GGCAAGATCTGCCTTTCAGGAGGATTACCA BG908924 PDS-RT-F CAGCAGTGTCCAGGCACTA CK163183 115 PDS-RT-R ACAACCTGCAGAGCACGAAG CK163183 PDS-RT-F1 ACCTTTAGTTCGACTTCCCC Contig 1 68 PDS-RT-R1 AGAGCACGAAGTCCACGT Contig 1 PDS-RT-F2 CAGGCACTAAAAACCAGTCAC Contig 2 96 PDS-RT-R2 AGAGCACGAAGTCCACCG Contig 2 PDS-RT-F3 CAGCAGTGTCCAGGCACTA Contig 3 106 PDS-RT-R3 AGAGCACGAAGTCCATGA Contig 3 EIN2-F CTAAGGATCCACAAAGCCCAGCAATGAATC AL816731 518 EIN2-R CCTAAGATCTTGAAGAAGCTCTGCCTCACA AL816731 EIN2-RT-F TGGGTTCATCCAACTGGTC CD925940 80 EIN2-RT-R AAGATGGCATATTGAAATTTG CD925940 EIN2-RT-F1 GCAGCTTACTTGAGCAAAATC Contig 1 92 EIN2-RT-R1 ATGAATAGTAGCAGGCTGATAGA Contig 1 EIN2-RT-F2 GCAGCTTACTTGAGCCAAATG Contig 2 92 EIN2-RT-R2 ATGAATAGTAGCAGGCTGATAGG Contig 2 EIN2-RT-F3 GGATATCAGCTGGCATCTT Contig 3 132 EIN2-RT-R3 CATAACAGGATCAGCATAGTTAGA Contig 3 TAK14-F TGGAAGATCTTGATATCCGTTCTGTTTCTA AF325198 568 TAK14-R TTCAGGATCCTTGTGCCAGATATTTGCTCC AF325198 SC255-RT-F GTACAACGCTGGAACGAACA TC264870 84 SC255-RT-R GAAAGGTTCTCGGTGTCGTC TC264870 GAPDH-RT-F TTAGACTTGCGAAGCCAGCA AF251217 81 GAPDH-RT-R AAATGCCCTTGAGGTTTCCC AF251217 TAK14-3′-F CATGGTGCCATGGTTCAAAG AF325198 Variable NOS-R CAAGACCGGCAACAGGATTC PBI101TD Mlo-F CCTGACGCTATTCCAGAACG AF361932 518 Mlo-R AGACCGACCTTCTCCTGTCA AF361932 Open in new tab ) was designed within the conserved region and based on the BG908924 hexaploid wheat sequence that shared the highest nt identity (95%) with the barley PDS cDNA (AY062039). This BG908924 wheat sequence (785 bp) belongs to the consensus sequence TC236658 of 2,464 bp (http://www.tigr.org/tigr-scripts/tgi/tc_report.pl?tc=&species=wheat) and aligns with the full-length cDNA of PDS of rice (AF049356; 2,027 bp) between nts 311 and 1,075 with an 89% identity (Fig. 1A Figure 1. Open in new tabDownload slide Location of the wheat ESTs used to construct the RNAi vectors in their corresponding wheat consensus sequence and in the corresponding full-length cDNAs identified in rice. A, Wheat EST BG908924 aligned with its consensus sequence TC236658 and the full-length cDNA of PDS of rice (OsPDS; AF049356). B, Wheat EST AL816731 aligned with its consensus sequence TC257467 and the full-length cDNA of EIN2 of rice (OsEIN2; AY396568). Base pairs, percentage of identity, and overlapping areas (shaded boxes) are indicated (not on scale). C, Self-complementary hp construct derived from hp transgene used in the bombardment experiments. Gene-specific sequences (black arrows indicating the orientation) in the antisense and sense orientations were cloned with a 548-bp fragment of the TAK14 (AF325198) wheat intron (white box) and were controlled by the constitutive ubi promoter (hatched box) and the nopaline synthase terminator (dotted box). Restriction enzymes HindIII (H) and EcoRI (E) used for Southern-blot hybridization analysis are indicated. Figure 1. Open in new tabDownload slide Location of the wheat ESTs used to construct the RNAi vectors in their corresponding wheat consensus sequence and in the corresponding full-length cDNAs identified in rice. A, Wheat EST BG908924 aligned with its consensus sequence TC236658 and the full-length cDNA of PDS of rice (OsPDS; AF049356). B, Wheat EST AL816731 aligned with its consensus sequence TC257467 and the full-length cDNA of EIN2 of rice (OsEIN2; AY396568). Base pairs, percentage of identity, and overlapping areas (shaded boxes) are indicated (not on scale). C, Self-complementary hp construct derived from hp transgene used in the bombardment experiments. Gene-specific sequences (black arrows indicating the orientation) in the antisense and sense orientations were cloned with a 548-bp fragment of the TAK14 (AF325198) wheat intron (white box) and were controlled by the constitutive ubi promoter (hatched box) and the nopaline synthase terminator (dotted box). Restriction enzymes HindIII (H) and EcoRI (E) used for Southern-blot hybridization analysis are indicated. ). A 480-bp fragment of wheat PDS (wPDS) was amplified by reverse transcription (RT)-PCR from wheat leaf cDNA and was used for the RNAi construct. The RT-PCR product was also cloned, and several independent transformants were sequenced. Following a multiple sequence alignment, three distinct groups of sequences were identified based on SNPs (Supplemental Fig. 1A; the same SNPs were detected in three independent RT-PCR reactions), indicating that there are at least three active copies of the PDS gene in the wheat genome. The same RT-PCR fragment was used as a probe to estimate the number of copies of wPDS in the wheat genome by hybridization to hexaploid (cv Bobwhite and cv Chinese Spring) and diploid (Triticum monococcum cv DV92) wheat DNA digested with several restriction enzymes (Supplemental Fig. 2A). The hybridization pattern was simple for several enzyme combinations, showing between one and two bands in the diploid T. monococcum species and between two and four bands in hexaploid wheat. Southern hybridizations to nullitetrasomic lines of Chinese Spring (Sears, 1966) digested with HindIII allowed mapping wPDS on chromosomes 4A and 4D (Supplemental Fig. 2B). In a recent study, Cenci et al. (2004) localized durum wheat (Triticum durum) bacterial artificial chromosome clones containing the PDS genes on chromosome 4A as well as 4B. The nullitetrasomic 4B line used in our study was probably not genetically pure. Indeed, several SSR markers specific of chromosome 4B could be amplified (data not shown), suggesting the presence of chromosome 4B in this nullitetrasomic 4B line. Therefore, additional fragments of PDS could not be mapped on chromosome 4B. A BLASTN search using the barley EIN2 cDNA sequence (BM816947) identified eight wheat EST sequences, but only one EST (AL816731) showed high nt identity (E < 10−100; 93%) to the barley sequence. This AL816731 wheat sequence (564 bp) belongs to the consensus sequence TC257467 of 1,213 bp (http://www.tigr.org/tigr-scripts/tgi/tc_report.pl?tc=c_report.pl?tc=TC257467) and aligns with the full-length cDNA of EIN2 of rice (AY396568; 4,646 bp) between nts 3,061 and 3,527 with an 80% identity (Fig. 1B). A pair of primers (Table I) was designed based on the AL816731 wheat sequence, and a 518-bp fragment of wEIN2 was amplified by RT-PCR from wheat leaf cDNA to make the RNAi construct. As described above for the wPDS genes, the RT-PCR product was also cloned, and several independent transformants were sequenced. A multiple sequence alignment identified three distinct groups of sequences based on SNPs (Supplemental Fig. 3A; the same SNPs were detected in three independent RT-PCR reactions), indicating that there are at least three active EIN2 genes in the wheat genome. The same RT-PCR wEIN2 fragment was used as a probe to estimate the number of copies of wEIN2 in the wheat genome (Supplemental Fig. 2C). The hybridization pattern was simple for several enzyme combinations, showing between one and three bands in the diploid T. monococcum species and between two and five bands in hexaploid wheat. Southern hybridizations to nullitetrasomic lines of Chinese Spring (Sears, 1966) digested with HindIII allowed mapping wEIN2 on chromosomes 5A, 5B, and 5D (Supplemental Fig. 2D). These results suggest that for both wPDS and wEIN2 genes, there are three expressed copies in hexaploid wheat, with one copy on each of the homoeologous genomes. Specific Silencing of the PDS Genes Induces Photobleaching in Hexaploid Wheat One hundred and fifty three putative transgenic plants were produced by particle bombardment with the intron-spliced self-complementary construct containing the sense and antisense repeats of the wPDS cDNA sequence. Genomic DNA from these plants was digested with HindIII, and the wPDS sequence was used as a probe for DNA Southern-blot hybridization. Eighty-two lines, which correspond to 53% of the analyzed plants, contained the expected three intact HindIII fragments of the construct (0.5, 1, and 2.2 kb; Fig. 1C; Supplemental Fig. 4A) and 64 of them (78%) exhibited photobleaching at the seedling stage, indicating specific silencing of endogenous PDS (Fig. 2 Figure 2. Open in new tabDownload slide An RNAi construct expressing a wPDS cDNA fragment induces photobleaching in hexaploid wheat. The PDS-RNAi transgenic T0 lines were arranged based on the severity of photobleaching. A, Strong photobleached phenotype resulting in albino plants and lethality. B, Intermediate phenotype with patterns of streaks where photobleaching is affecting one-half of the leaf surface. C, Intermediate phenotype with patterns of streaks where photobleaching is affecting the central part of the leaves with the margins still green. D, Weak phenotype where only a small sector of the leaves is affected by photobleaching. Figure 2. Open in new tabDownload slide An RNAi construct expressing a wPDS cDNA fragment induces photobleaching in hexaploid wheat. The PDS-RNAi transgenic T0 lines were arranged based on the severity of photobleaching. A, Strong photobleached phenotype resulting in albino plants and lethality. B, Intermediate phenotype with patterns of streaks where photobleaching is affecting one-half of the leaf surface. C, Intermediate phenotype with patterns of streaks where photobleaching is affecting the central part of the leaves with the margins still green. D, Weak phenotype where only a small sector of the leaves is affected by photobleaching. ). The PDS-RNAi transgenic lines were arranged into a phenotypic series based on the severity of the photobleached phenotype (strong, intermediate, and weak). Most of the lines (41 lines) developed a strong photobleached phenotype, resulting in a lethal albino phenotype (Fig. 2A). Fifteen lines showed an intermediate phenotype with continuous parallel streaks (Fig. 2, B and C) where photobleaching affected either one-half of the leaves (Fig. 2B) or only the middle part of the leaf, whereas the leaf margins maintained the wild-type phenotype (Fig. 2C). The remaining eight lines produced a weak phenotype where only a small part of the leaves was affected by photobleaching (Fig. 2D). Both single and multiple copy lines with extensive DNA rearrangements showed photobleaching (Supplemental Fig. 4A; Fig. 3A Figure 3. Open in new tabDownload slide RNAi-mediated specific silencing of the wPDS genes in hexaploid wheat. A, Quantitative real-time PCR of eight wPDS-RNAi transgenic T0 primary transformants with primers designed within the conserved nt sequence region identified on wheat EST CK163183 and with primers specific to each of the homoeologous wPDS genes (see Supplemental Fig. 1). Relative mRNA levels of wPDS were normalized to the mRNA level of wild-type (Wt) plants (=1). The GAPDH gene was used as an internal standard. Data are the average of triplicate samples (±sd). The numbering of the transgenic lines analyzed by quantitative real-time PCR refers to the Southern-blot data shown in Supplemental Figure 4, and the Southern analysis is summarized at the bottom of A. Transgenic (+) and non transgenic (−) T0 lines. In A, the photobleached phenotype is indicated. A, Albino; S, streaks; and –, wild-type phenotype. B, C, D, and E, T1 generation analysis of the T0 PDS-RNAi transgenic line 5. B, Detection of the hp transgene by PCR. The top band corresponds to the transgene and the bottom band to the wheat homolog of the barley Mlo gene used here as an internal control. pPDS, hp construct used in the transformation experiments. C, Relative mRNA levels of wPDS, which were normalized to the mRNA level of wild-type (Wt) plants (=1). Line T0 from which this population is derived is shown. Plants 7, 11, and 15 were not analyzed, because they did not produce enough leaf material for RNA extraction. Data are the average of triplicate samples (±sd). D, Phenotypes. S, Streaks; P, photobleaching; B, bleaching only at the base of the leaf; n.a., not analyzed; and –, wild type. E, Detection of small RNAs in T1 heterozygous plants (plants 3, 5, and 17 from C) and T1 homozygous plants (plants 4, 8, 10, and 20 from C) of the T0 PDS-RNAi transgenic line 5. Low M r RNA fractions were hybridized with a mixture of 11 DNA oligos complementary to the sequence of interest (Supplemental Fig. 6A). The 20-nt, 26-nt, and 29-nt DNA oligos were used as size controls (size indicated in nts); Wt, wild type. The same blot was hybridized with the housekeeping GAPDH gene as a control (top segment). The relative intensity of the hybridization signals in the transgenics versus wild-type plants was determined with a phosphoimager (Cyclone gene array system, Perkin-Elmer). The relative mean value of wPDS small RNAs per plant ± sd is indicated by the thick arrowhead. Figure 3. Open in new tabDownload slide RNAi-mediated specific silencing of the wPDS genes in hexaploid wheat. A, Quantitative real-time PCR of eight wPDS-RNAi transgenic T0 primary transformants with primers designed within the conserved nt sequence region identified on wheat EST CK163183 and with primers specific to each of the homoeologous wPDS genes (see Supplemental Fig. 1). Relative mRNA levels of wPDS were normalized to the mRNA level of wild-type (Wt) plants (=1). The GAPDH gene was used as an internal standard. Data are the average of triplicate samples (±sd). The numbering of the transgenic lines analyzed by quantitative real-time PCR refers to the Southern-blot data shown in Supplemental Figure 4, and the Southern analysis is summarized at the bottom of A. Transgenic (+) and non transgenic (−) T0 lines. In A, the photobleached phenotype is indicated. A, Albino; S, streaks; and –, wild-type phenotype. B, C, D, and E, T1 generation analysis of the T0 PDS-RNAi transgenic line 5. B, Detection of the hp transgene by PCR. The top band corresponds to the transgene and the bottom band to the wheat homolog of the barley Mlo gene used here as an internal control. pPDS, hp construct used in the transformation experiments. C, Relative mRNA levels of wPDS, which were normalized to the mRNA level of wild-type (Wt) plants (=1). Line T0 from which this population is derived is shown. Plants 7, 11, and 15 were not analyzed, because they did not produce enough leaf material for RNA extraction. Data are the average of triplicate samples (±sd). D, Phenotypes. S, Streaks; P, photobleaching; B, bleaching only at the base of the leaf; n.a., not analyzed; and –, wild type. E, Detection of small RNAs in T1 heterozygous plants (plants 3, 5, and 17 from C) and T1 homozygous plants (plants 4, 8, 10, and 20 from C) of the T0 PDS-RNAi transgenic line 5. Low M r RNA fractions were hybridized with a mixture of 11 DNA oligos complementary to the sequence of interest (Supplemental Fig. 6A). The 20-nt, 26-nt, and 29-nt DNA oligos were used as size controls (size indicated in nts); Wt, wild type. The same blot was hybridized with the housekeeping GAPDH gene as a control (top segment). The relative intensity of the hybridization signals in the transgenics versus wild-type plants was determined with a phosphoimager (Cyclone gene array system, Perkin-Elmer). The relative mean value of wPDS small RNAs per plant ± sd is indicated by the thick arrowhead. ). Thus, PDS dsRNA-mediated genetic interference causes photobleaching in hexaploid wheat in a similar way to plants treated with a chemical inhibitor of PDS (Böger and Sandmann, 1998) or to virus-induced PDS gene silencing (VIGS) in barley (Holzberg et al., 2002). The consistent appearance of bleached tissue in the large number of regenerated plants suggests that the endogenous PDS genes are no longer functional in these tissues due to RNAi. dsRNA Interferes with wPDS mRNA Accumulation of All Three Homoeologous Genes The expression of PDS in the RNAi transgenic wheat lines was determined by real-time quantitative RT-PCR. Primers were designed to specifically measure effective endogenous PDS mRNA levels and not the transgene transcripts. Primers were located on the wheat EST sequence CK163183 (Table I; Supplemental Fig. 1A) upstream of the conserved nt sequence regions used to design the primers for the RNAi construct. Cloning and sequencing of the products produced by RT-PCR revealed that the activity of all three genes described above was measured. The primer binding sites were completely conserved in the three expressed genes, and three distinct sequences were identified based on SNPs (Supplemental Fig. 1A; the same SNPs were detected in three independent RT-PCR reactions). The SNPs allowed the design of additional primers for specifically amplifying each of the homoeologous copies of the wPDS gene (Supplemental Fig. 1B). The reduction of relative mRNA levels of wPDS was very similar in each of the three homoeologous genes (Fig. 3A). Therefore, the RNAi silencing mechanism affects all three copies of the gene in the same way. The severity of the photobleached phenotype inversely correlated with PDS mRNA expression levels in the leaves of all the transgenic RNAi lines analyzed. As shown in Figure 3A, expression levels of lines that exhibited an albino phenotype (lines 1, 3, 9, and 10) were 11%, 8.4%, 15%, and 7.2% of the wild type, respectively. A transcript reduction relative to the wild type was also observed in lines showing streaks of photobleaching (5 and 11 in Fig. 3A), but they accumulated more mRNA than the albino lines (38% and 48% of the wild type, respectively). In all the other transgenic RNAi lines not showing any photobleaching, PDS mRNA expression levels were not significantly different from the wild type. These results indicate that PDS mRNA levels decline with increasingly severe phenotypes and suggest that endogenous PDS mRNA is a target of dsRNA-mediated genetic interference that equally silences the three homoeologous copies. Phytoene Accumulates in Bleached Tissue as a Result of RNAi-Based Silencing of Endogenous Wheat PDS Blockage of the carotenoid pathway can be mimicked chemically with the herbicide norflurazon, a specific inhibitor of the PDS enzyme. This inhibition causes accumulation of phytoene in treated tissues (Böger and Sandmann, 1998). To confirm that the bleached phenotype in our experiments was due to PDS silencing, we used HPLC to determine phytoene levels in RNAi transgenic lines with or without bleached tissues and in norflurazon-treated and -untreated wild-type plants. In addition to a specific retention time on reverse-phase columns, carotenoids are characterized by their spectral properties, consisting of three peak maxima with a unique spectral shape (ratio of peaks II/III), which are influenced by the solvent used (Wurtzel et al., 2001). As shown in Supplemental Figure 5A, leaf tissue from wild-type norflurazon-treated plants contained two spectral peaks at 286 nm, with a retention time of 3.65 min (peak 1) and 5.61 min (peak 2; Supplemental Fig. 5G). These two peaks were absent in wild-type untreated plants (Supplemental Fig. 5B), which contained another type of spectral peak absorbing at a maximum of 446 nm, with a retention time of 4 min (Supplemental Fig. 5G). The spectra of numbered peaks 1 and 2 (Supplemental Fig. 5, D and E) show the characteristics of the compound phytoene (three peaks maxima and peaks shape), which is identical to previously published spectral profiles of phytoene (Li et al., 1996; Wurtzel et al., 2001). The spectrum detected in wild-type untreated plants (peak 3, Supplemental Fig. 5F) showed no phytoene peaks but the characteristics of the compound lutein (Suzuki and Shioi, 2003), which is derived from subsequent series of desaturations and cyclizations in the carotenoid biosynthesis pathway when PDS is active. PDS-RNAi transgenic lines, which showed an albino phenotype, also contained two peaks with virtually identical spectra to the spectrum of phytoene from norflurazon-treated wild-type tissue (Supplemental Fig. 5, A, D, and E). Leaves with photobleached streaks contained a mixture of peaks corresponding to the two compounds phytoene and lutein that were present in norflurazon-treated and -untreated wild-type tissue, respectively (Supplemental Fig. 5C). PDS-RNAi transgenic lines, which did not show any phenotype, produced a spectrum identical to the one detected in wild-type untreated plants (Supplemental Fig. 5B). Moreover, as shown in Supplemental Figure 5G, a comparison of peak retention times, peak maxima, and peak ratios II/III between the norflurazon-treated wild-type plants and the RNAi transgenic lines corroborated the presence or absence of phytoene in relation to the efficiency of silencing. These results demonstrate that phytoene accumulation and photobleaching are correlated and provide biochemical confirmation of PDS gene inactivation in hexaploid wheat. Inheritance of the Genetic Interference of wPDS and Detection of siRNA in Silenced Plants T0 PDS-RNAi lines that showed an albino phenotype did not set seeds and therefore could not be analyzed further. The progeny from each PDS-RNAi line that had intermediate phenotypes (streaks on leaves; 23 lines) all showed a 3:1 segregation for the presence and absence of the hp transgene, as shown in Figure 3B, with an example of PCR analysis in the progeny of line 5. This result suggests that the primary transformants integrated the hp transgene at a single locus, although separate integration at very closely linked loci cannot be excluded. All the T1 progeny showed Mendelian segregation for the photobleached phenotype on the leaves. Surprisingly, the intermediate phenotype with continuous parallel streaks (Fig. 2, B–D) of some of the T0 transgenic lines was never observed again in the following generations. Twenty-five percent of the T1 plants containing the hp transgene showed strong photobleaching of the leaves with large albino areas, which in a few cases eventually developed into completely albino plants (Fig. 3D). The other T1 plants that had integrated the transgene (approximately 50%) showed a weak phenotype, where photobleaching was affecting only the base of the leaves (Fig. 3D). Quantitative real-time PCR revealed again a correlation between the level of mRNA and the severity of the photobleached phenotype. As shown in Figure 3C, the T1 plants (derived from T0 line no. 5) having a reduction of endogenous wPDS transcripts to less than 20% of wild type (T1 plants 4, 8, 10, and 20) showed strong photobleaching. Among the T1 plants that showed a weak phenotype, plants 3, 5, 6, 13, 14, 16, 17, 18, and 19 accumulated mRNA levels between 30% and 70% of wild type (medium reduction). Plants 1, 2, 9, and 12, which did not contain the hp transgene, had the same mRNA levels as the wild type. We subsequently analyzed each of the PDS-RNAi lines in the T2 generation by selfing different T1 plants showing strong/weak photobleaching and wild-type phenotypes. The T1 plants that showed strong photobleaching were homozygous, since all the T2 progenies contained the transgene, showed large albino areas, and had their mRNA levels of endogenous wPDS genes reduced to less than 40% of the wild type (data not shown). The T1 plants that showed weak photobleaching were heterozygous, since all the T2 progenies were still segregating for the phenotype and the transgene. Small RNA-gel blots were used to test whether the amounts of siRNA were different in homozygous and heterozygous lines. Small RNAs were recovered from a subset of the T1 plants used as the source of total RNA for quantitative real-time PCR. We detected sequence-specific siRNAs of around 24 bp in both homozygous and heterozygous plants showing strong/weak photobleaching (Fig. 3E). Wild-type plants did not accumulate small PDS RNAs. Thus, small PDS RNAs accumulated only upon silencing of the PDS genes. The relative intensity of the hybridization signals in the transgenic versus wild-type plants indicated that the homozygous plants contain around double the amount of small RNAs compared to heterozygous plants. It is therefore likely that the strong photobleached phenotype observed in the homozygous plants is in part related to a higher accumulation of siRNAs. This genetic analysis indicates that RNAi of wPDS is stably inherited over at least two generations in a Mendelian fashion of a single locus. Small RNAs specific for the silenced gene were detected and their accumulation was quantitatively different in homozygous and heterozygous lines. In homozygous plants, accumulation of siRNAs was significantly higher to give effective gene silencing and to develop the most severe phenotype. These results suggest that the effect of RNAi in hexaploid wheat is probably gene-dosage dependent. The reason for the discrepancy of hemizygous phenotypes at T0 versus later generations is not known, but it is intriguing that the streak phenotype of the T0 generation was never recovered in later generations. EIN2 dsRNA-Mediated Genetic Interference in Hexaploid Wheat To assess whether the EIN2 signal transducer of ethylene can also be effectively silenced by RNAi in wheat, 33 putative transgenic plants were produced by particle bombardment with the intron-spliced self-complementary construct containing the sense and antisense repeats of the wEIN2 cDNA sequence. Genomic DNA from these plants was digested with EcoRI, and blots were hybridized with a probe corresponding to the wEIN2 cDNA sequence of the hpRNA construct. Eighteen lines, which correspond to 54% of the analyzed plants, contained the expected intact EcoRI fragment of the construct (2 kb; Supplemental Fig. 4B; Fig. 1C). We identified by quantitative real-time PCR six T0 primary transgenic lines (33% of the lines that contained the full-length RNAi fragment) with a significant reduction of mRNA expression of the endogenous wEIN2 genes (Fig. 4A Figure 4. Open in new tabDownload slide RNAi-mediated specific silencing of the wEIN2 genes in hexaploid wheat. A, Quantitative real-time PCR of eight wEIN2-RNAi transgenic T0 primary transformants with primers designed within the conserved nt sequence region identified on wheat EST CD925940 and with primers specific to each of the homoeologous wEIN2 genes (see Supplemental Fig. 3). Relative mRNA levels of wEIN2 were normalized to the mRNA level of wild-type (Wt) plants (=1). The GAPDH gene was used as an internal standard. Data are the average of triplicate samples (±sd). The numbering of the transgenic lines analyzed by quantitative real-time PCR refers to the Southern-blot data shown in Supplemental Figure 4, and the Southern analysis is summarized at the bottom of A. +, Transgenic; –, nontransgenic T0 lines. B, C, and D, Analysis of the ethylene response in the T1 generation of the T0 EIN2-RNAi transgenic line 10. B, Wild-type seeds germinated in presence and in absence of ACC. C, T1 seeds germinated in presence of ACC. Bars in B and C = 4 cm. D, Relative mRNA levels of wEIN2 that were normalized to the mRNA level of wild-type (Wt) plants (=1). Line T0 from which this population is derived is also shown. Length measurements of each T1 plant are shown on the same diagram. PCR analysis for the presence/absence of the transgene is shown in D. Figure 4. Open in new tabDownload slide RNAi-mediated specific silencing of the wEIN2 genes in hexaploid wheat. A, Quantitative real-time PCR of eight wEIN2-RNAi transgenic T0 primary transformants with primers designed within the conserved nt sequence region identified on wheat EST CD925940 and with primers specific to each of the homoeologous wEIN2 genes (see Supplemental Fig. 3). Relative mRNA levels of wEIN2 were normalized to the mRNA level of wild-type (Wt) plants (=1). The GAPDH gene was used as an internal standard. Data are the average of triplicate samples (±sd). The numbering of the transgenic lines analyzed by quantitative real-time PCR refers to the Southern-blot data shown in Supplemental Figure 4, and the Southern analysis is summarized at the bottom of A. +, Transgenic; –, nontransgenic T0 lines. B, C, and D, Analysis of the ethylene response in the T1 generation of the T0 EIN2-RNAi transgenic line 10. B, Wild-type seeds germinated in presence and in absence of ACC. C, T1 seeds germinated in presence of ACC. Bars in B and C = 4 cm. D, Relative mRNA levels of wEIN2 that were normalized to the mRNA level of wild-type (Wt) plants (=1). Line T0 from which this population is derived is also shown. Length measurements of each T1 plant are shown on the same diagram. PCR analysis for the presence/absence of the transgene is shown in D. ). As for the wPDS genes, the RT-PCR primers were designed to specifically detect the endogenous EIN2 and not the transgene transcripts. Primers were located on the wheat EST sequence CD925940 (Table I; Supplemental Fig. 3A) upstream of the conserved nt sequence regions used to design the primers for the RNAi construct. Cloning and sequencing of the RT-PCR products revealed that the activity of all three homoeologous genes was measured (Supplemental Fig. 3A). Three distinct sequences were identified based on SNPs (the same SNPs were detected in three independent RT-PCR reactions). Quantitative real-time PCR with primers specific to each of the homoeologous copies of the wEIN2 gene (Supplemental Fig. 3B) revealed that the RNAi silencing mechanism is affecting all three homoeologous genes in the same way (Fig. 4A). For five lines, wEIN2 transcript level was reduced to between 30% and 50% compared to the wild type (intermediate reduction in lines 2, 7, 10, 13, and 19 of Fig. 4A). Line 18 had a strong reduction of the wEIN2 mRNA level, which was only 1% of the level detected in the wild-type plant (Fig. 4A). As for the wPDS genes, both single and multiple copy lines with extensive DNA rearrangements showed a significant reduction of wEIN2 mRNA levels (Supplemental Fig. 4B; Fig. 4A). The six T0 primary transgenic lines with lower EIN2 expression showed a normal phenotype, and their ethylene response signaling was studied in the next generations. Ethylene Response Signaling in Wheat EIN2-RNAi Lines EIN2 was identified as a central component of the ethylene signaling pathway both in Arabidopsis (Alonso et al., 1999) and in rice (Jun et al., 2004). All six T0 EIN2-RNAi transgenic wheat lines with lower EIN2 expression set seeds, and we could therefore examine whether their ethylene response was altered. Twenty T1 seeds of each of these six lines, wild-type plants, and five primary transgenic lines that did not show any reduction of the wEIN2 transcript were germinated at 25°C under light (16-h light, 8-h dark) on Murashige and Skoog medium in the presence of 20 μ m 1-aminocyclopropane-1-carboxylic acid (ACC), the immediate precursor of ethylene. Plant length was determined 15 d after sowing. All T1 families showed a 3:1 segregation for the presence and absence of the hp transgene, suggesting that the primary transformants integrated the hp transgene at a single locus, although separate integration at very closely linked loci cannot be excluded. The six T1 families derived from the T0 lines with lower EIN2 expression showed Mendelian segregation for normal and stunted growth when grown in the presence of 20 μ m ACC (e.g. in Fig. 4C, six T1 plants derived from T0 line 10 are shown). Wild-type plants and the other five transgenic lines tested (negative controls) showed a stunted morphology on ACC-containing medium (Fig. 4B). As observed with the wPDS genes, 25% of the T1 plants containing the hp transgene showed complete insensitivity to ethylene (Fig. 4C; T1 plant 1) and a normal growth in presence of ACC. Seedling lengths of these ethylene-insensitive plants were significantly higher (p = 1.18 × 10−5) than the rest of the population in the presence of ACC. The other T1 plants that had the transgene (approximately 50%) showed a growth only partially affected by the presence of ACC (Fig. 4C; T1 plants 3 and 4), and the length of the seedlings was also significantly higher (p = 2.78 × 10−8) than the T1 plants that did not contain the hp transgene (Fig. 4C; T1 plants 2, 5, and 6). There was a very high negative linear correlation (r 2 = −0.976) between the length of the seedlings in the presence of ACC and the amount of wEIN2 transcript measured in the T1 progenies. As observed with the wPDS genes, EIN2 mRNA levels declined with increasingly severe phenotypes (Fig. 4D). T1 plants completely insensitive to ethylene showed the strongest mRNA reduction (around 70%) compared to wild type. T1 plants with an intermediate phenotype accumulated mRNA levels around 50% of wild type, whereas all the other T1 plants that did not contain the hp transgene and were sensitive to ethylene with a stunted morphology had the same mRNA levels as the wild type. By analyzing the T2 generation, we confirmed that those T1 plants that had the strongest mRNA reduction and were completely insensitive to ethylene were homozygous plants, because all their T2 progeny contained the transgene (Fig. 5A Figure 5. Open in new tabDownload slide T2 generation analysis of the homozygous T1 EIN2-RNAi transgenic plant 1 generated from the T0 line 10. A, Detection of the hp transgene by PCR; the top band corresponds to the transgene and the bottom band to the wheat homolog of the barley Mlo gene used here as an internal control. pEIN2, hp construct used in the transformation experiments. B, Relative mRNA levels of wEIN2 that were normalized to the mRNA level of wild-type (Wt) plants (=1). The T1 plant from which this population is derived is also shown. Length measurements of each T2 plants are shown on the same diagram. C, Phenotype of the T2 plants which are all ethylene insensitive. Bar in C = 7 cm. Figure 5. Open in new tabDownload slide T2 generation analysis of the homozygous T1 EIN2-RNAi transgenic plant 1 generated from the T0 line 10. A, Detection of the hp transgene by PCR; the top band corresponds to the transgene and the bottom band to the wheat homolog of the barley Mlo gene used here as an internal control. pEIN2, hp construct used in the transformation experiments. B, Relative mRNA levels of wEIN2 that were normalized to the mRNA level of wild-type (Wt) plants (=1). The T1 plant from which this population is derived is also shown. Length measurements of each T2 plants are shown on the same diagram. C, Phenotype of the T2 plants which are all ethylene insensitive. Bar in C = 7 cm. ), had their mRNA levels reduced to less than 40% of the wild-type (Fig. 5B), and showed complete ethylene insensitivity in the presence of ACC (Fig. 5, B and C). T1 plants that were partially affected by ethylene were heterozygous, since their T2 progeny were still segregating for normal and stunted growth when grown in the presence of ACC. These results demonstrate that the EIN2-RNAi transgenic wheat lines produced in this study are ethylene insensitive. This is consistent with the hypothesis that EIN2 is a positive signal component in ethylene signaling and that inhibiting its expression reduces the ethylene response. We conclude that RNAi silencing in hexaploid wheat is also effective for the silencing of a gene involved in a signaling process. DISCUSSION We have demonstrated that RNAi-mediated gene silencing is effective in hexaploid wheat and can efficiently induce reduction of mRNA levels of three homoeologous genes. Expression of the three homoeologous genes was reduced to the same extent, suggesting that RNAi can resolve the issue of genetic redundancy in hexaploid wheat in an efficient way, as it was also suggested by studies in the two allotetraploid species Arabidopsis suenica (Lawrence and Pikaard, 2003) and cotton (Gossypium hirsutum; Liu et al., 2000). Knowledge of the complete and exact sequence of the target genes was not essential to induce specific gene silencing, as sequence information from ESTs was sufficient. This is important for the development of high-throughput methods for functional genomics. Trigger-dsRNAs as short as 23 to 26 bp have been shown to induce degradation of target mRNAs (Hamilton and Baulcombe, 1999; Thomas et al., 2001), and several studies reported that sequences that are 88% to 100% identical to the endogenous gene target caused silencing (Jones et al., 1998; Ingelbrecht et al., 1999; Schweizer et al., 2000; Xu et al., 2001; Holzberg et al., 2002). In our study, we used wheat EST sequences of around 500 bp to construct the RNAi vectors. A specific EST is derived from a specific gene, but it is known that homoeologous genes in wheat share up to 99% identity at the nt sequence level in the coding regions (Kimbara et al., 2004). Therefore, there is a high chance that homoeologous genes will retain regions of identity, resulting in silencing of all the genes. The suppression of the homoeologous genes was probably also facilitated by the use of a sequence within the conserved regions identified among homologous wheat ESTs. Concerns have arisen that siRNA could cause other effects than those related to the knockdown of the target gene due to cross hybridization or binding in a sequence-dependent manner to various cellular proteins (off-target effects; Jackson et al., 2003; Scacheri et al., 2004). Standard software can now be used for improving detection of sequence identity to accurately and systematically evaluate and minimize RNAi off-target effects between siRNA sequences and target genes (Qiu et al., 2005). We have used two different genes to assess the effectiveness of RNAi in hexaploid wheat, the enzyme PDS and the ethylene signaling component EIN2. These genes were chosen because mutant alleles have been reported to give distinct phenotypes in diploid plant species. It was also important to assess whether a gene that encodes a regulatory factor can be effectively silenced in wheat. Indeed, a reduction of enzyme amount might allow the detection of a mutant phenotype, whereas silencing of a signaling component might not be sufficient to cause a mutant phenotype, because even a strongly reduced amount of protein might still be sufficient for proper function. We have shown that RNAi-mediated silencing of both genes results in the reduction of transcripts by up to 93% for PDS and 99% for EIN2. Therefore, dsRNAs corresponding to these two genes caused strong and specific genetic interference, suggesting that dsRNA-mediated gene silencing under the control of the ubiquitin promoter can occur in the tissues where these genes normally function. We found a strong correlation between decreased levels of mRNA and increased severity of phenotypes. A phenotypic series was obtained from the RNAi lines with a full spectrum of the effect of RNAi (weak, intermediate, and strong) on gene expression, which is in agreement with the results in Arabidopsis (Chuang and Meyerowitz, 2000; Wang et al., 2005) and tomato (Xiong et al., 2005). Part of the variation of the RNAi effect can be explained by transgene copy number and/or positional effects of particular DNA insertion events. However, our results suggest that the severity of phenotypes is not related to the transgene copy number, because both single and multiple copy lines with extensive DNA rearrangements showed a mutant phenotype. Chuang and Meyerowitz (2000) and Wang et al. (2005) also found no relationship between severity of the phenotype and transgene copy number in Arabidopsis. In contrast, Kerschen et al. (2004) described that multicopy RNAi Arabidopsis lines reduced target mRNA levels to a lesser extent and with more variability between lines than did single-copy lines. A number of studies in rice and wheat have reported that there is no evidence for any direct relationship between transgene copy number and transgene expression or stability (Kohli et al., 1999; Stoger et al., 1999). Thus, we can assume that the phenotypic series observed in the T0 transgenic lines is due to positional effects of the DNA insertion event. The variation in the degree of silencing observed in the transformants showing both reduction and loss of function may be a useful feature for gene discovery and functional genomics. Complete silencing of genes encoding a key element in basic cell functions or at particular developmental stages may result in lethality, whereas the reduced gene expression may give viable plants with phenotypes indicative of the role of the target gene. Systems to deliver inducible RNAi offer the advantage of silencing gene expression at specific developmental stages or in specific tissues, because they provide flexibility for the timing and the degree of gene inactivation and have the potential for reversal of silencing by withdrawal of the inducer (Guo et al., 2003; Wielopolska et al., 2005). It has been shown by Smith et al. (2000) and Wesley et al. (2001) that 66% to 100% of the plants (tobacco [Nicotiana tabacum], Arabidopsis, cotton, and rice) transformed with an intron-containing hp construct can be silenced. In our investigation, 78% of the wheat PDS-RNAi and 33% of the wheat EIN2-RNAi transgenic lines showed silencing. One explanation for the difference in efficiency of silencing between the two genes may be that some phenotypes (such as silencing of EIN2) are less sensitive to the level of gene expression and that a reduced amount of protein is still sufficient to confer the proper function. The effectiveness of silencing appears to be gene dependent and could reflect accessibility of target mRNA or the relative abundance of the target mRNA and the hpRNA in cells in which the gene is active (Helliwell and Waterhouse, 2003). Kerschen et al. (2004) and Wang et al. (2005) suggested that RNAi efficiency and the endogenous transcription level of the target gene are not necessarily related. We confirmed that the expression of the RNAi phenotype is stably inherited over at least two generations for both wPDS and wEIN2 genes, possibly making this approach a reliable tool not only for functional genomics but also for the genetic modification of agronomically interesting traits. In our study, dsRNA-expressing constructs were inherited in a Mendelian fashion as a single locus, and the most severe phenotype was observed in homozygous plants that showed the strongest mRNA reduction. Among the phenotypic series that we obtained from the transgenic PDS-RNAi lines, we have also observed T0 lines showing a strong phenotype in a hemizygous state. This strong phenotype was lethal for the wPDS genes but had no effect in the case of the wEIN2 genes (Fig. 5A, plant 18). The intermediate phenotype of wPDS with continuous parallel streaks (Fig. 2, B–D) of some of the T0 transgenic lines was never observed again in the following generations. This suggests that in the early development of newly transformed T0 seedlings, RNAi is not fully established, and therefore, the mutant phenotypes differ from later generations. Thus, it might be advisable to not only study the T0 generation in wheat RNAi projects but also in later generations. Our results indicate that the most efficient silenced phenotypes are stably recovered in homozygous lines, suggesting that the effect of RNAi in hexaploid wheat is gene-dosage dependent. This is possibly due to the progressive repression of the target gene with increasing allelic concentration of the transgene. This hypothesis is supported by our observation of gene-dosage dependence of specific siRNAs that were approximately double the amount in homozygous plants compared to heterozygous plants. These results are in agreement with García-Pérez et al. (2004), who reported that tobacco leaves of homozygous rootstocks have accumulated approximately double the amount of secondary siRNAs than the heterozygous rootstocks, suggesting that the induction of systemic silencing was strikingly dosage dependent. Similarly, several studies have suggested that transgene dosage can affect resistance of a transgenic line carrying transgenes homologous to viral sequences, because homozygous, but not hemizygous, R2 progenies were able to confer high level of resistance to different strains (Dinant et al., 1997; McDonald et al., 1997; Tenllado and Díaz-Ruíz, 1999; Tennant et al., 2001). New studies provide convincing biochemical and genetic evidence that RdRP plays a critical role in amplifying the RNAi effect, explaining the extreme efficiency and the self-sustaining nature of RNAi (Lipardi et al., 2001; Sijen et al., 2001). An RdRP can use the siRNAs as primers and the target mRNAs as templates to produce newly formed dsRNAs that are subsequently cleaved to produce secondary siRNAs. Recently, it has been shown (Himber et al., 2003; García-Pérez et al., 2004) that secondary siRNAs belong exclusively to the 21-nt siRNA class. This observation argues against the previously proposed role for the 25-nt siRNAs as systemic silencing signal (Hamilton et al., 2002) and contrasts with the observation that de novo dsRNA synthesis in wheat germ extracts is linked to production of siRNAs that are almost exclusively 25-nt long (Tang et al., 2003). In addition, experiments with dsRNA suggested that the 21-mers are produced in wheat at about one-quarter the rate of the 24 to 25-nt small RNAs (Tang et al., 2003). Our results are in agreement with the observations of Hamilton et al. (2002) and Tang et al. (2003) because the RNAi wheat transgenic lines produced in our study have accumulated only one class of siRNAs, which is the 25-nt siRNAs. Identification of the RdRP responsible for systemic silencing signal in vitro will help to address the issue with the contrasting findings of Himber et al. (2003) and García-Pérez et al. (2004). Down-regulation of EIN2 by RNAi resulted in ethylene-insensitive wheat plants that showed normal wild-type growth in presence of ACC, the immediate precursor of ethylene. This is consistent with the hypothesis that EIN2 is a positive regulator of the ethylene-signaling in wheat, very similar to its homologs in Arabidopsis (Alonso et al., 1999) and rice (Jun et al., 2004). Whether the EIN2 gene product acts indirectly in ethylene signaling by affecting metal homeostasis, as other Nramp family members are thought to do in some animal systems, or whether the EIN2 protein is a family member that has been recruited to function directly in ethylene signaling, e.g. by regulating a second messenger, remains unclear (Bleecker and Kende, 2000). Our results indicate that the RNAi sequence of EIN2 efficiently suppressed the ethylene signaling pathway, affecting the target EIN2. The phytohormone ethylene plays an important role in many aspects of plant growth, development, and environmental responses (Johnson and Ecker, 1998). In particular, ethylene is important in germination and seedling growth of cereals (Locke et al., 2000). Stem-shortening plant growth regulators are often used to control lodging in modern high input cereal management, and they include GA biosynthesis inhibitors and ethylene-releasing compounds. While promotion of seedling shoot growth by ethylene has been reported for barley, oat (Avena sativa), and rice (Locke et al., 2000; Jun et al., 2004), ethylene inhibits hypocotyl elongation in wheat (Huang et al., 1997; our results) as well as in dark-grown seedlings of Arabidopsis (Alonso et al., 1999; Wesley et al., 2001). Pathogen infection is also an ethylene-modulated process that results in distinct morphological and biochemical changes (Wan et al., 2002). Pasquer et al. (2005) recently showed differences in expression patterns of wheat defense-related genes after treatment with a systemic acquired resistance enhancer and two commonly used fungicides. They raised the hypothesis that BTH [benzo(1,2,3)thiadiazole-7-carbothioic acid S-methylester, a systemic acquired resistance enhancer] is a strong trigger of signaling mediated by ethylene and salicylic acid. The ethylene-insensitive RNAi wheat plants produced in this study can be used in future studies on the role of ethylene in development, defense, and fungicide responses in wheat. RNAi silencing has an enormous potential as a tool in functional genomics of hexaploid wheat, a species for which other methods such as insertional mutagenesis are not available. dsRNA-expressing constructs, when delivered into wheat by particle bombardment-mediated transformation, created a heritable phenotypic series in the transformants that may be a useful feature for gene discovery and functional genomics. Technical barriers for high-throughput functional genomics have recently been lowered considerably by the development of pHELLSGATE vectors that utilize the Gateway recombination system and give the possibility of making hpRNA constructs for large sets of genes (Helliwell and Waterhouse, 2003). Tang and Galili (2004) raised the hypothesis that next generation RNAi vectors should contain characteristics of microRNA structures, because microRNAs do not trigger the PKR pathway, the RNA-dependent protein kinase pathway that causes nonspecific cell death in mammalian cells and could function as part of the plant stress response (Langland et al., 1995). Fast and efficient systems of transformation and regeneration of transgenic plants are necessary to successfully use RNAi constructs for plant functional genomics. Gene transfer technology is still limited in wheat by the low frequency of generation of transgenic plants. With further development and increase of the efficiency of the wheat transformation methods, an exciting perspective will be opened up to improve tools for functional analysis of wheat genes, with a strong impact on wheat breeding. MATERIALS AND METHODS Plant Material Wheat (Triticum aestivum) cv Bobwhite, accession SH98 26 (provided by Dr. A. Pellegrineschi, International Center for Development of Maize and Wheat, Mexico) was used for all experiments. Donor plants for embryo transformation and transgenic plants were grown in a greenhouse with 16-h light at 21°C and 8-h night at 16°C. Every 10 to 15 d, routine fertilizer treatments were applied to the donor plants. Generation of RNAi Lines PDS and EIN2 nt sequences were obtained from The Institute for Genome Research database (www.tigr.org). Using barley (Hordeum vulgare) sequences, a BLASTN search was carried out to find hexaploid wheat ESTs. Multiple sequence alignments were done with ClustalW (Thompson et al., 1994). PCR primers were designed on the basis of wheat ESTs similar to the target genes using the Primer3 WWW primer tool (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi; Whitehead Institute for Biomedical Research). Vector pAHC17 containing the maize (Zea mays) ubi-1 promoter and the nopaline synthase terminator (Christensen et al., 1992) were used to make the self-complementary intron-containing hp RNA constructs. Fragments of 480 and 518 bp corresponding to the wheat cDNAs of wPDS and wEIN2, respectively, were isolated by RT-PCR using specific primers with incorporated BamHI and BglII restriction sites (Table I), which produced ends compatible with each other. This allowed the gene fragments to be directionally cloned within the unique BamHI site of vector pAHC17. PCR amplification was carried out for 35 cycles of 45 s, denaturation at 94°C, 45 s annealing at 62°C, and 90 min extension at 72°C. The amplified fragments were then subcloned into pGEM-T vector (Promega) and sequenced. The cDNA fragments recovered by BamHI and BglII digestion were cloned in the BamHI restriction site of plasmid pAHC17. Each RNAi construct contained a cDNA fragment derived from the respective target gene and oriented in the antisense and sense directions at the 5′ and 3′ ends of the construct, respectively (Fig. 1C), separated by an intron derived from the wheat TAK14 gene (AF325198). The intron TAK14 fragment was produced with the same cloning strategy as described for the two RNAi target genes. The resulting plasmids were named pPDS-RNAi and pEIN2-RNAi for the wPDS and wEIN2 genes, respectively. RNAi lines were produced using particle bombardment-mediated transformation of immature embryos as described (Pellegrineschi et al., 2002). Plasmid pPDS-RNAi or pEIN2-RNAi was cotransformed with a plasmid containing phospho-Man isomerase as selectable marker (Wright et al., 2001). Regeneration and selection of the transformed plants were performed essentially as described (Wright et al., 2001; Pellegrineschi et al., 2002). Transformants were identified by DNA Southern hybridization (Stein et al., 2000) using plant genomic DNA digested with HindIII for wPDS and EcoRI for wEIN2 and probes corresponding to the selected cDNA sequences of the hpRNA construct (Fig. 1C). Hybridizations were performed overnight at 65°C in 5× sodium chloride/sodium phosphate/EDTA, 0.5% SDS, and 5× Denhardt's solution. Membranes were washed at 65°C three times for 20 min in 0.5× SSC and 0.1% SDS, and then they were autoradiographed. To determine the inheritance of the RNAi construct and the phenotype, transgenic lines were allowed to self pollinate, and segregation analyses were performed in the T1 and T2 generations by means of PCR, phenotype observation, and quantitative real-time PCR. Rapid DNA extractions at the two-leaf stage (modified for small volumes from Stein et al., 2000) and PCR techniques accelerated the screening of T1 and T2 plants. The presence of the RNAi construct was determined using a forward primer at the 3′ end of the TAK14 intron and reverse primer at the 5′ end of the nopaline synthase terminator (Table I). A PCR product corresponding to several wheat homologs of the barley Mlo gene was used as an internal standard (Table I). Quantitative Real-Time PCR Total RNA was isolated from leaves using TRIzol reagent (Invitrogen Life Technologies). Leaves were collected 3 weeks after transferring the transgenic and control plants from culture tubes to soil. For RT, 10 μg of total RNA was denatured at 70°C for 5 min in the presence of 0.07 μg of oligo(dT)21 primers. The tubes were immediately chilled on ice and reverse transcribed with 7 units of reverse transcriptase (Invitrogen Life Technologies), 1× buffer, 0.7 mm of each dNTPs, 10 mm dithiothreitol, and 1.5 units of RNase OUT (Invitrogen Life Technologies) in a total volume of 30 μL at 42°C for 90 min. Real-time PCR assays were performed with the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) using SYBR Green PCR Master mix (Applied Biosystems) in a final volume of 26 μL including cDNA template and appropriate primer pairs (Table I). The amplification conditions were 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 1 min at 60°C. To normalize results, the glyceraldehyde-3-P dehydrogenase (GAPDH; AF251217) gene was used as an internal standard (Table I). Three replicates were performed for each sample. The specificity of the unique amplification product was determined by melting curve analysis according to the manufacturer's instructions. Short Interfering RNA Detection To detect small RNAs, the procedures described by Hamilton and Baulcombe (1999) were followed. The lower M r RNAs were recovered after removal of high M r RNAs by precipitation with 10% polyethylene glycol 8000 and 0.5 m NaCl. From the different samples analyzed, a similar amount of RNA (7 μg) of the lower M r RNA fraction was separated on gel (15% polyacrylamide, 7 m urea, 1× Tris-borate/EDTA) and transferred to Hybond N+ membranes (Amersham Biosciences) by electroblotting. As size marker, three gene-specific DNA oligos were loaded on the same gels (Supplemental Fig. 6). For hybridization, the ULTRAhyb-Oligo buffer from Ambion (1× buffer) was used, and 1 μ m of around 10 DNA oligos complementary to the sequence of interest (Supplemental Fig. 6) were labeled using 0.5 units of T4 polynucleotide kinase (Roche) and 6 μL of [γ-32P]ATP (5,000 Ci/mmol). RNA-blot hybridizations were carried out at 35°C as described by Hamilton and Baulcombe (1999). The hybridization blots were then also hybridized with the housekeeping GAPDH gene (AF251217) as a control. The relative intensity of the hybridization signals in the transgenics versus wild-type plants was determined with a phosphoimager (Cyclone gene array system, Perkin-Elmer). Carotenoid Extraction and Analysis of Phytoene by HPLC from wPDS-RNAi Transgenic Lines Leaf samples were collected when the transgenic and control plants were transferred from culture tubes to soil. Norflurazon-treated wild-type plants were produced by watering 15-d-old seedlings with 3 μ m norflurazon (Syngenta) to induce bleaching. To compensate local variations within a plant, three samples were taken from each transgenic and control plant, corresponding to three different leaves of the same plant. Carotenoid extraction was performed essentially as described (Wurtzel et al., 2001). Around 100 mg of leaf tissue was ground in liquid N2, suspended in 1 mL methanol, and centrifuged at 9,000 rpm for 10 min at 4°C. After addition of 100 μL 60% KOH, the supernatant was heated at 65°C for 20 min. The mixture was then extracted three times in 10% (v/v) diethyl ether in hexane, the organic phase evaporated under N2 and the precipitate dissolved in 70 μL methanol. An HPLC system, model 480 (Gynkotek HPLC) with photodiode array detection, model UVD340S (Gynkotek HPLC), was used to separate samples by reverse phase chromatography on a EC 125/4.6 Nucleosil 100-5 C18 column (Macherey-Nagel) using acetonitrile:methanol:2-propanol (80:14:7, v/v/v) as a developing solvent at a flow rate of 1 mL min−1 under isocratic conditions. Substances were detected using UV absorption at 286, 440, and 550 nm, and spectra were recorded between 250 and 580 nm UV/vis. Peaks were identified by spectrophotometric profiles (as characterized by three absorption maxima and peak II/III ratios) and retention times, by comparing them to that of the norflurazon-treated plants and previously published spectral profiles of phytoene (Li et al., 1996; Wurtzel et al., 2001). ACKNOWLEDGMENTS We thank Dr. A. Pellegrineschi (Centro Internacional de Mejoramiento de Maiz y Trigo, Mexico) for providing us with seeds of Bobwhite SH 98 26 and Dr. P. Quail (University of California, Berkeley and U.S. Department of Agriculture Plant Gene Expression Center, Albany, California) for the plasmid pAHC17. Syngenta (Basel, Switzerland) is acknowledged for the PMI gene. We thank Stephi Narain and Geri Herren (Institute of Plant Biology, Zürich) for excellent technical assistance. We also thank Dr. Markus Klein and Dr. Valeria Gagliardini (Institute of Plant Biology, Zürich) for helping with the HPLC and quantitative real-time experiments, respectively. Finally, special thanks to Dr. Christoph Ringli (Institute of Plant Biology, Zürich) for useful technical advice and critical reading of the manuscript. LITERATURE CITED Allen RS, Millgate AG, Chitty JA, Thisleton J, Miller JAC, Fist AJ, Gerlach WL, Larkin PJ ( 2004 ) RNAi-mediated replacement of morphine with the non-narcotic alkaloid reticuline in opium poppy. Nat Biotechnol 22 : 1559 – 1566 Crossref Search ADS PubMed Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR ( 1999 ) EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science 284 : 2148 – 2152 Crossref Search ADS PubMed Bartley GE, Scolnik PA ( 1995 ) Plant carotenoids: pigments for photo-protection, visual attraction, and human health. Plant Cell 7 : 1027 – 1038 PubMed Baulcombe DC ( 2004 ) RNA silencing in plants. Nature 431 : 356 – 363 Crossref Search ADS PubMed Bleecker AB, Kende H ( 2000 ) Ethylene: a gaseous signal molecule in plants. Annu Rev Cell Dev Biol 16 : 1 – 18 Crossref Search ADS PubMed Böger P, Sandmann G ( 1998 ) Carotenoid biosynthesis inhibitor herbicides: mode of action and resistance mechanisms. Pestic Outlook 9 : 29 – 35 Burch-Smith TM, Anderson JC, Martin GB, Dinesh-Kumar SP ( 2004 ) Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J 39 : 734 – 746 Crossref Search ADS PubMed Carthew RW ( 2001 ) Gene silencing by double-stranded RNA. Curr Opin Cell Biol 13 : 244 – 248 Crossref Search ADS PubMed Cenci A, Somma S, Chantret N, Dubcovsky J, Blanco A ( 2004 ) PCR identification of durum wheat BAC clones containing genes coding for carotenoid biosynthesis enzymes and their chromosome localization. Genome 47 : 911 – 917 Crossref Search ADS PubMed Christensen AB, Thordal-Christensen H, Zimmermann G, Gjetting T, Lyngkjær MF, Dudler R, Schweizer P ( 2004 ) The Germinlike protein GLP4 exhibits superoxide dismutase activity and is an important component of quantitative resistance in wheat and barley. Mol Plant Microbe Interact 17 : 109 – 117 Crossref Search ADS PubMed Christensen AH, Sharrock RA, Quail PH ( 1992 ) Maize polyubiquitin genes: structure, thermal perturbation of expression and transcript splicing, and promoter activity following transfer to protoplasts by electroporation. Plant Mol Biol 18 : 675 – 689 Crossref Search ADS PubMed Chuang CF, Meyerowitz EM ( 2000 ) Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. Proc Natl Acad Sci USA 97 : 4985 – 4990 Crossref Search ADS PubMed Dinant S, Maisonneuve B, Albouy J, Chupeau Y, Chupeau M, Bellec Y, Gaudefroy F, Kusiak C, Souche S, Robaglia C, et al ( 1997 ) Coat protein gene mediated protection in Lactuca sativa against lettuce mosaic potyvirus strains. Mol Breed 3 : 75 – 86 Crossref Search ADS Djikeng A, Shi H, Tschudi C, Ullu E ( 2001 ) RNA interference in Trypanosoma brucei: cloning of small interfering RNAs provides evidence for retroposon-derived 24-26-nucleotide RNAs. RNA 7 : 1522 – 1530 PubMed Douchkov D, Nowara D, Zierold U, Schweizer P ( 2005 ) A high-throughput gene-silencing system for the functional assessment of defense-related genes in barley epidermal cells. Mol Plant Microbe Interact 18 : 755 – 761 Crossref Search ADS PubMed Feuillet C, Keller B ( 2002 ) Comparative genomics in the grass family: molecular characterization of grass genome structure and evolution. Ann Bot (Lond) 89 : 3 – 10 Crossref Search ADS Flavell RB, Bennett MD, Smith JB, Smith DB ( 1974 ) Genome size and proportion of repeated nucleotide sequence DNA in plants. Biochem Genet 12 : 257 – 269 Crossref Search ADS PubMed Fukusaki EI, Kawasaki K, Kajiyama S, An CI, Suzuki K, Tanaka Y, Kobayashi A ( 2004 ) Flower color modulations of Torenia hybrida by downregulation of chalcone synthase genes with RNA interference. J Biotechnol 111 : 229 – 240 Crossref Search ADS PubMed García-Pérez RD, Van Houdt H, Depicker A ( 2004 ) Spreading of post-transcriptional gene silencing along the target gene promotes systemic silencing. Plant J 38 : 594 – 602 Crossref Search ADS PubMed Guo HS, Fei JF, Xie Q, Chua NH ( 2003 ) A chemical-regulated inducible RNAi system in plants. Plant J 34 : 383 – 392 Crossref Search ADS PubMed Hamilton AJ, Baulcombe DC ( 1999 ) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286 : 950 – 952 Crossref Search ADS PubMed Hamilton AJ, Voinnet O, Chappell L, Baulcombe DC ( 2002 ) Two classes of short interfering RNA in RNA silencing. EMBO J 21 : 4671 – 4679 Crossref Search ADS PubMed Hein I, Barciszewska-Pacak M, Hrubikova K, Williamson S, Dinesen M, Soenderby IE, Sundar S, Jarmolowski A, Shirasu K, Lacomme C ( 2005 ) Virus-induced gene silencing-based functional characterization of genes associated with powdery mildew resistance in barley. Plant Physiol 138 : 2155 – 2164 Crossref Search ADS PubMed Helliwell C, Waterhouse P ( 2003 ) Constructs and methods for high-throughput gene silencing in plants. Methods 30 : 289 – 295 Crossref Search ADS PubMed Himber C, Dunoyer P, Moissiard G, Ritzenthaler C, Voinnet O ( 2003 ) Transitivity-dependent and -independent cell-to-cell movement of RNA silencing. EMBO J 22 : 4523 – 4533 Crossref Search ADS PubMed Holzberg S, Brosio P, Gross C, Pogue GP ( 2002 ) Barley stripe mosaic virus-induced gene silencing in a monocot plant. Plant J 30 : 315 – 327 Crossref Search ADS PubMed Huang B, Johnson JW, Box JE, Nesmith DS ( 1997 ) Root characteristics and hormone activity of wheat in response to hypoxia and ethylene. Crop Sci 37 : 812 – 818 Crossref Search ADS Ingelbrecht IL, Irvine JE, Mirkov TE ( 1999 ) Post-transcriptional gene silencing in transgenic sugarcane: dissection of homology-dependent virus resistance in a monocot that has a complex polyploid genome. Plant Physiol 119 : 1187 – 1198 Crossref Search ADS PubMed Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G, Linsley PS ( 2003 ) Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 21 : 635 – 637 Crossref Search ADS PubMed Johnson PR, Ecker JR ( 1998 ) The ethylene gas signal transduction pathway: a molecular perspective. Annu Rev Genet 32 : 227 – 254 Crossref Search ADS PubMed Jones AL, Johansen IE, Bean SJ, Bach I, Maule AJ ( 1998 ) Specificity of resistance to pea seed-borne mosaic potyvirus in transgenic peas expressing the viral replicase (Nlb) gene. J Gen Virol 79 : 3129 – 3137 Crossref Search ADS PubMed Jun SH, Han MJ, Lee S, Seo YS, Kim WT, An G ( 2004 ) OsEIN2 is a positive component in ethylene signaling in rice. Plant Cell Physiol 45 : 281 – 289 Crossref Search ADS PubMed Kerschen A, Napoli CA, Jorgensen RA, Müller AE ( 2004 ) Effectiveness of RNA interference in transgenic plants. FEBS Lett 566 : 223 – 228 Crossref Search ADS PubMed Kimbara J, Takashi R, Nasuda S ( 2004 ) Characterization of the genes encoding for MAD2 homologues in wheat. Chromosome Res 12 : 703 – 714 Crossref Search ADS PubMed Kohli A, Gahakwa D, Vain P, Laurie D, Christou P ( 1999 ) Transgene expression in rice engineered through particle bombardment: molecular factors controlling stable expression and transgene silencing. Planta 208 : 88 – 97 Crossref Search ADS Langland JO, Jin S, Jacobs BL, Roth DA ( 1995 ) Identification of a plant-encoded analog of PKR, the mammalian double-stranded RNA-dependent protein kinase. Plant Physiol 108 : 1259 – 1267 Crossref Search ADS PubMed Lawrence RJ, Pikaard CS ( 2003 ) Transgene-induced RNA interference: a strategy for overcoming gene redundancy in polyploids to generate loss-of-function mutations. Plant J 36 : 114 – 121 Crossref Search ADS PubMed Lee S, Kim J, Han JJ, Han MJ, An G ( 2004 ) Functional analyses of the flowering time gene OsMADS50, the putative SUPPRESSOR OF OVEREXPRESSION OF CO 1 / AGAMOUS-LIKE 20 (SOC1 / AGL20) ortholog in rice. Plant J 38 : 754 – 764 Crossref Search ADS PubMed Li ZH, Matthews PD, Burr B, Wurtzel ET ( 1996 ) Cloning and characterization of a maize cDNA encoding phytoene desaturase, an enzyme of the carotenoid biosynthetic pathway. Plant Mol Biol 30 : 269 – 279 Crossref Search ADS PubMed Lipardi C, Wei Q, Paterson BM ( 2001 ) RNAi as random degradative PCR: siRNA primers convert mRNA into dsRNAs that are degraded to generate new siRNAs. Cell 107 : 297 – 307 Crossref Search ADS PubMed Liu Q, Singh S, Green A ( 2000 ) Genetic modification of cotton seed oil using inverted-repeat gene-silencing techniques. Biochem Soc Trans 28 : 927 – 929 Crossref Search ADS PubMed Locke JM, Bryce JH, Morris PC ( 2000 ) Contrasting effects of ethylene perception and biosynthesis inhibitors on germination and seedling growth of barley (Hordeum vulgare L.). J Exp Bot 51 : 1843 – 1849 Crossref Search ADS PubMed Loukoianov A, Yan L, Blechl A, Sanchez A, Dubcovsky J ( 2005 ) Regulation of VRN-1 vernalization genes in normal and transgenic wheat. Plant Physiol 138 : 2364 – 2373 Crossref Search ADS PubMed Marx J ( 2000 ) Interfering with gene expression. Science 288 : 1370 – 1372 Crossref Search ADS PubMed McDonald JG, Brandle F, Gleddie S, Hermans J, Kermali I ( 1997 ) Resistance to homologous and heterologous strains of potato virus Y in transgenic tobacco carrying the PVY (N) coat protein gene. Can J Plant Sci 77 : 167 – 171 Crossref Search ADS Miki D, Itoh R, Shimamoto K ( 2005 ) RNA silencing of single and multiple members in a gene family of rice. Plant Physiol 138 : 1903 – 1913 Crossref Search ADS PubMed Mochida K, Yamazaki Y, Ogihara Y ( 2003 ) Discrimination of homoeologous gene expression in hexaploid wheat by SNP analysis of contigs grouped from a large number of expressed sequence tags. Mol Genet Genomics 270 : 371 – 377 PubMed Ogita S, Uefuji H, Morimoto M, Sano H ( 2004 ) Application of RNAi to confirm theobromine as the major intermediate for caffeine biosynthesis in coffee plants with potential for construction of decaffeinated varieties. Plant Mol Biol 54 : 931 – 941 Crossref Search ADS PubMed Page DR, Grossniklaus U ( 2002 ) The art and design of genetic screens: Arabidopsis thaliana. Nat Rev Genet 3 : 124 – 136 Crossref Search ADS PubMed Pasquer F, Isidore E, Zarn J, Keller B ( 2005 ) Specific patterns of changes in wheat gene expression after treatment with three antifungal compounds. Plant Mol Biol 57 : 693 – 707 Crossref Search ADS PubMed Pellegrineschi A, Noguera LM, Skovmand B, Brito RM, Velazquez L, Salgano MM, Hernandez R, Warburton M, Hoisington D ( 2002 ) Identification of highly transformable wheat genotypes for mass production of fertile transgenic plants. Genome 45 : 421 – 430 Crossref Search ADS PubMed Qiu S, Adema CM, Lane T ( 2005 ) A computational study of off-target effects of RNA interference. Nucleic Acids Res 33 : 1834 – 1847 Crossref Search ADS PubMed Regina A, Bird A, Topping D, Bowden S, Freeman J, Barsby T, Kosar-Hashemi B, Li Z, Rahman S, Morell M ( 2005 ) High-amylose wheat generated by RNA interference improves indices of large-bowel health in rats. Proc Natl Acad Sci USA 103 : 3546 – 3551 Scacheri PC, Rozenblatt-Rosen O, Caplen NJ, Wolfsberg TG, Umayam L, Lee JC, Hughes CM, Shanmugam KS, Bhattacharjee A, Meyerson M, et al ( 2004 ) Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proc Natl Acad Sci USA 101 : 1892 – 1897 Crossref Search ADS PubMed Schweizer P, Pokorny J, Schulze-Lefert P, Dudler R ( 2000 ) Double-stranded RNA interferes with gene function at the single-cell level in cereals. Plant J 24 : 895 – 903 Crossref Search ADS PubMed Scofield SR, Huang L, Brandt AS, Gill BS ( 2005 ) Development of a virus-induced gene-silencing system for hexaploid wheat and its use in functional analysis of the Lr21-mediated leaf rust resistance pathway. Plant Physiol 138 : 2165 – 2173 Crossref Search ADS PubMed Sears ER ( 1966 ) Nullisomic-tetrasomic combinations in hexaploid wheat. In R Riley, KR Lewis, eds, Chromosome Manipulations and Plant Genetics. Oliver and Boyd, Edinburgh, pp 29–45 Sijen T, Fleenor J, Simmer F, Thijssen KL, Parrish S, Timmons L, Plasterk RH, Fire A ( 2001 ) On the role of RNA amplification in dsRNA-triggered gene silencing. Cell 107 : 465 – 476 Crossref Search ADS PubMed Smith NA, Singh SP, Wang MB, Stoutjesdijk PA, Green AG, Waterhouse PM ( 2000 ) Total silencing by intron-spliced hairpin RNAs. Nature 407 : 319 – 320 Crossref Search ADS PubMed Stam M, deBruin R, Kenter S, van der Hoorn RAL, van Blokland R, Mol JNM, Kooter JM ( 1997 ) Post-transcriptional silencing of chalcone synthase in Petunia by inverted transgene repeats. Plant J 12 : 63 – 82 Crossref Search ADS Stein N, Feuillet C, Wicker T, Schlagenhauf E, Keller B ( 2000 ) Subgenome chromosome walking in wheat: a 450-kb physical contig in Triticum monococcum L. spans the Lr10 resistance locus in hexaploid wheat (Triticum aestivum L.). Proc Natl Acad Sci USA 97 : 13436 – 13441 Crossref Search ADS PubMed Stoger E, Williams S, Keen D, Christou P ( 1999 ) Molecular characteristics of transgenic wheat and the effect on transgene expression. Transgenic Res 7 : 463 – 471 Stoutjesdijk PA, Singh SP, Liu Q, Hurlstone CJ, Waterhouse PA, Green AG ( 2002 ) hp-RNA-mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing. Plant Physiol 129 : 1723 – 1731 Crossref Search ADS PubMed Suzuki Y, Shioi Y ( 2003 ) Identification of chlorophylls and carotenoids in major teas by high-performance liquid with photodiode array detection. J Agric Food Chem 51 : 5307 – 5314 Crossref Search ADS PubMed Tang G, Galili G ( 2004 ) Using RNAi to improve plant nutritional value: from mechanism to application. Trends Biotechnol 22 : 463 – 469 Crossref Search ADS PubMed Tang G, Reinhart BJ, Bartel DP, Zamore PD ( 2003 ) A biochemical framework for RNA silencing in plants. Genes Dev 17 : 49 – 63 Crossref Search ADS PubMed Tenllado F, Díaz-Ruíz JR ( 1999 ) Complete resistance to pepper mild mottle tobamovirus mediated by viral replicase sequences partially depends on transgene homozygosity and is based on a gene silencing mechanism. Transgenic Res 8 : 83 – 93 Crossref Search ADS Tennant P, Fermin G, Fitch MM, Manshardt RM, Slightom JL, Gonsalves D ( 2001 ) Papaya ringspot virus resistance of transgenic Rainbow and SunUp is affected by gene dosage, plant development and coat protein homology. Eur J Plant Pathol 107 : 645 – 653 Crossref Search ADS Thomas CL, Jones L, Baulcombe DC, Maule AJ ( 2001 ) Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J 25 : 417 – 425 Crossref Search ADS PubMed Thompson JD, Higgins DG, Gibson TJ ( 1994 ) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 : 4673 – 4680 Crossref Search ADS PubMed Wan J, Dunning FM, Bent AF ( 2002 ) Probing plant-pathogen interactions and downstream defense signaling using DNA microarrays. Funct Integr Genomics 2 : 259 – 273 Crossref Search ADS PubMed Wang T, Iyer LM, Pancholy R, Shi X, Hall TC ( 2005 ) Assessment of penetrance and expressivity of RNAi-mediated silencing of the Arabidopsis phytoene desaturase gene. New Phytol 167 : 751 – 760 Crossref Search ADS PubMed Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D, Stoutjesdijk PA, et al ( 2001 ) Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J 27 : 581 – 590 Crossref Search ADS PubMed Wielopolska A, Townley H, Moore I, Waterhouse P, Helliwell C ( 2005 ) A high-throughput inducible RNAi vector for plants. Plant Biotechnol J 3 : 583 – 590 Crossref Search ADS PubMed Wright M, Dawson J, Dunder E, Suttie J, Reed J, Kramer C, Chang Y, Novitzky R, Wang H, Artim-Moore L ( 2001 ) Efficient biolistic transformation of maize (Zea mays L.) and wheat (Triticum aestivum L.) using the phosphomannose isomerase gene, pmi, as the selectable marker. Plant Cell Rep 20 : 429 – 436 Crossref Search ADS PubMed Wurtzel ET, Luo R, Yatou O ( 2001 ) A simple approach to identify the first rice mutants blocked in carotenoid biosynthesis. J Exp Bot 52 : 161 – 166 Crossref Search ADS PubMed Xiong AS, Yao QH, Peng RH, Li X, Han PL, Fan HQ ( 2005 ) Different effects on ACC oxidase gene silencing triggered by RNA interference in transgenic tomato. Plant Cell Rep 23 : 639 – 646 Crossref Search ADS PubMed Xu J, Schubert J, Altpeter F ( 2001 ) Dissection of RNA-mediated ryegrass mosaic virus resistance in fertile transgenic perennial ryegrass (Lolium perenne L.). Plant J 26 : 265 – 274 Crossref Search ADS PubMed Yan L, Loukoianov A, Blechl A, Tranquilli G, Ramakrishna W, SanMiguel P, Bennetzen JL, Echenique V, Dubcovsky J ( 2004 ) The wheat VRN2 gene is a flowering repressor down-regulated by vernalization. Science 303 : 1640 – 1644 Crossref Search ADS PubMed Zamore PD, Tuschl T, Sharp PA, Bartel DP ( 2000 ) RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101 : 25 – 33 Crossref Search ADS PubMed Author notes 1 This work was supported by the Indo-Swiss Collaboration in Biotechnology. * Corresponding author; e-mail [email protected]; fax 41–44–634–82–04. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Beat Keller ([email protected]). [W] The online version of this article contains Web-only data. [OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.106.084517 © 2006 American Society of Plant Biologists © The Author(s) 2006. Published by Oxford University Press on behalf of American Society of Plant Biologists. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

Burch-Smith, Tessa M.; Schiff, Michael; Liu, Yule; Dinesh-Kumar, S.P.

doi: 10.1104/pp.106.084624pmid: 16815951

Abstract Virus-induced gene silencing (VIGS) is a plant RNA-silencing technique that uses viral vectors carrying a fragment of a gene of interest to generate double-stranded RNA, which initiates the silencing of the target gene. Several viral vectors have been developed for VIGS and they have been successfully used in reverse genetics studies of a variety of processes occurring in plants. This approach has not been widely adopted for the model dicotyledonous species Arabidopsis (Arabidopsis thaliana), possibly because, until now, there has been no easy protocol for effective VIGS in this species. Here, we show that a widely used tobacco rattle virus-based VIGS vector can be used for silencing genes in Arabidopsis ecotype Columbia-0. The protocol involves agroinfiltration of VIGS vectors carrying fragments of genes of interest into seedlings at the two- to three-leaf stage and requires minimal modification of existing protocols for VIGS with tobacco rattle virus vectors in other species like Nicotiana benthamiana and tomato (Lycopersicon esculentum). The method described here gives efficient silencing in Arabidopsis ecotype Columbia-0. We show that VIGS can be used to silence genes involved in general metabolism and defense and it is also effective at knocking down expression of highly expressed transgenes. A marker system to monitor the progress and efficiency of VIGS is also described. In the past, plant biologists relied almost exclusively on forward genetics; that is, the identification of a mutant and the subsequent cloning of the mutated gene to identify the wild-type sequence responsible for the process being investigated. The past several years have seen the complete sequencing of two plant genomes and the generation of large databases of sequence information from several other plant species. The availability of these large sets of genome sequences means that alternative approaches to traditional forward genetics can be implemented to identify the genes involved in a process of interest. An important alternative approach made possible by the availability of genome sequences is reverse genetics. Reverse genetics investigates the function of a gene or DNA sequence directly by altering the expression of the sequence of interest and then identifying the mutant phenotype that is produced. Most reverse genetics approaches described in plants to date rely on posttranscriptional gene silencing (PTGS; Watson et al., 2005). PTGS is an RNA silencing-based approach used to reduce the level of expression of a gene of interest. It is also described as quelling in fungi (Cogoni et al., 1996) and RNA interference in animals (Fire et al., 1998). The mechanism of PTGS involves the sequence-specific degradation of RNA and several different techniques have been developed to harness PTGS phenomena for investigation. One of these is virus-induced gene silencing (VIGS; Baulcombe, 1999; Dinesh-Kumar et al., 2003). The observation that plants could overcome infection by viruses and then be rendered resistant to subsequent infection by closely related viruses was the first suggestion that PTGS was an innate antiviral defense in plants (Lindbo et al., 1993; Ratcliff et al., 1997; Soosaar et al., 2005). VIGS takes advantage of this defense system to silence endogenous RNA sequences that are homologous to a sequence engineered into the viral genome, which generates the double-stranded RNA that mediates silencing. Several viral genomes have been modified to produce VIGS vectors (for review, see Burch-Smith et al., 2004). The majority of these have been based on RNA viruses that can infect several plant species used in scientific investigations. The most widely used VIGS vectors are based on the Tobacco rattle virus (TRV; Ratcliff et al., 2001; Liu et al., 2002b). TRV-based VIGS vectors have been used to silence genes in a number of Solanaceous plant species, including Nicotiana benthamiana (Ratcliff et al., 2001; Liu et al., 2002b), tomato (Liu et al., 2002a), pepper (Capsicum annuum; Chung et al., 2004), potato (Solanum tuberosum; Brigneti et al., 2004), and petunia (Petunia hybrida; Chen et al., 2005). VIGS using TRV-derived vectors is also effective in opium poppy (Papaver somniferum), a basal eudicot (Hileman et al., 2005). One distinct advantage of using TRV for VIGS is the ability of the virus to infect the meristem of its hosts (Ratcliff et al., 2001) and it has been used to study flowering in N. benthamiana (Liu et al., 2004) and petunia (Chen et al., 2004), in addition to fruit development in tomato (Fu et al., 2005). The distinct advantage of TRV-based VIGS in Solanaceous species is the ease of introduction of the VIGS vector into plants. This is usually mediated by Agrobacterium tumefaciens with the VIGS vector placed between T-DNA borders (Ratcliff et al., 2001; Liu et al., 2002b). A. tumefaciens can then be easily introduced into plant tissues by a variety of techniques, including infiltration with a needleless syringe, direct inoculation of bacterial colonies, agrodrenching, or vacuum infiltration (Lu et al., 2003b; Burch-Smith et al., 2004; Ryu et al., 2004; Hileman et al., 2005; Wang et al., 2006). In addition to RNA viruses, DNA viruses have also been adapted for use as VIGS vectors. One of the more interesting of these is derived from the bipartite Cabbage leaf curl geminivirus (CbLCV) to perform VIGS in the model plant species Arabidopsis (Arabidopsis thaliana; Turnage et al., 2002). However, this vector has seen limited use for VIGS in Arabidopsis. This may be due in part to the difficulty in introducing the VIGS vector into the plant through particle bombardment (Turnage et al., 2002), a relatively tedious process. Another reason for the CbLCV vector's restricted use may be the limited insert size accommodated by the viral genome. An insert of up to 800 bp can be used in the CbLCV vector for Arabidopsis VIGS (Muangsan and Robertson, 2004). Besides CbLCV as a VIGS vector in this model species, only TRV has been reported to be effective for transient VIGS in Arabidopsis. This is the same TRV VIGS vector described by Ratcliff and coworkers (Ratcliff et al., 2001) and used extensively for VIGS in N. benthamiana. However, the protocol used for silencing in Arabidopsis requires that the TRV vector first be introduced into N. benthamiana to produce virions and then the virions are used secondarily to infect Arabidopsis (Lu et al., 2003b). The recently described alternative approach to the technique described by Lu and coworkers uses vacuum infiltration to introduce the Agrobacterium inoculum into Arabidopsis plants (Wang et al., 2006). Both of these procedures are time consuming and tedious, especially in large-scale functional studies. In an effort to generate a more useful set of tools for VIGS in this model dicotyledonous species, we have used our TRV-based VIGS vector (Liu et al., 2002b) and optimized its delivery to and effectiveness in Arabidopsis. Here, we show that our TRV-based VIGS can be introduced into Arabidopsis ecotype Columbia-0 (Col-0) by agroinfiltration using the same technique employed with Solanaceous species. We found that the age and growth conditions of the Arabidopsis plants to be silenced were the most important factors determining the effectiveness of TRV VIGS. We demonstrate that our TRV-based VIGS method can be easily and reliably used for silencing a combination of genes, and we have also developed a silencing marker system for use in Arabidopsis. RESULTS Optimal Conditions for TRV VIGS in Arabidopsis To investigate the optimal conditions under which TRV-based VIGS in Arabidopsis ecotype Col-0 might be effective, we attempted to silence the Arabidopsis Phytoene desaturase (AtPDS) gene. The silencing of PDS has been used as a marker for the effectiveness of VIGS in several instances (Ratcliff et al., 2001; Liu et al., 2002b; Turnage et al., 2002). The silencing of PDS produces a typical white color that is the result of photobleaching, which occurs in the absence of the gene product. We first used the TRV vector alone to see what symptoms, if any, would be produced in the Arabidopsis seedlings. We observed no visible symptoms of TRV infection in these plants and they were indistinguishable from wild-type, uninfiltrated seedlings (compare Fig. 1, A and B Figure 1. Open in new tabDownload slide Silencing of the PDS gene using TRV-based VIGS. A, Wild-type Arabidopsis Col-0 plant. B, Arabidopsis Col-0 plant 12 dpi with empty vector TRV VIGS at OD600 = 1.5. The plant shows no symptoms of viral infection. C, Arabidopsis Col-0 plants 12 dpi with TRV VIGS vector carrying a PDS insert. The white patches are caused by photobleaching that occurs due to reduced PDS levels. All plants infiltrated exhibit the bleaching indicative of PDS silencing. D, Silencing in the growing points of the plant. The cauline leaves and flowers are white due to PDS silencing. Photograph taken 4 weeks after infiltration with TRV AtPDS. Figure 1. Open in new tabDownload slide Silencing of the PDS gene using TRV-based VIGS. A, Wild-type Arabidopsis Col-0 plant. B, Arabidopsis Col-0 plant 12 dpi with empty vector TRV VIGS at OD600 = 1.5. The plant shows no symptoms of viral infection. C, Arabidopsis Col-0 plants 12 dpi with TRV VIGS vector carrying a PDS insert. The white patches are caused by photobleaching that occurs due to reduced PDS levels. All plants infiltrated exhibit the bleaching indicative of PDS silencing. D, Silencing in the growing points of the plant. The cauline leaves and flowers are white due to PDS silencing. Photograph taken 4 weeks after infiltration with TRV AtPDS. ). We examined whether the growing conditions of the Arabidopsis seedlings affected TRV VIGS. We compared the number of plants showing the pds phenotype after growth under long-day (16/8-h photoperiod) to those grown under short-day (8/16-h photoperiod) conditions. For the seedlings grown in 16-h light, 90% to 100% of the plants displayed photobleaching. Only 10% of those grown under short-day conditions exhibited AtPDS VIGS. After testing seedlings of different ages, we found that silencing of AtPDS was most effective in seedlings inoculated at the two- to three-leaf stage. When we used seedlings at the four- to five-leaf stage, the number of plants displaying the pds phenotype decreased by 50%. We observed an even more drastic reduction in the number of plants displaying the pds phenotype when we used older plants that contained many rosette leaves. The number of plants showing photobleaching decreased by 90% when compared to the number of two- to three-leaf-stage plants exhibiting VIGS. Therefore, younger plants are better for TRV-based silencing in Arabidopsis. After establishing the growth conditions and the age of the seedlings that were most conducive to TRV VIGS, we investigated whether the concentration of the A. tumefaciens cultures used to introduce the VIGS vectors had any effect on the outcome of silencing. We found that the effectiveness of silencing of PDS was somewhat dependent on the concentration of the cultures used for agroinfiltration, and for all our future investigations we used cultures resuspended to OD600 = 1.5, compared to OD600 = 1.0 as described for VIGS in N. benthamiana (Liu et al., 2002b). Thus, we found that Arabidopsis seedlings inoculated at the two- to three-leaf stage and grown under 16-h light displayed the photobleaching phenotype indicative of PDS silencing in almost 100% of the cases examined (Fig. 1C). Indeed, when we allowed these seedlings to grow older, we observed photobleaching of the cauline leaves and flowers of the bolt (Fig. 1D). This is consistent with the ability of TRV to infect the growing points of its hosts (Ratcliff et al., 2001) and with the use of TRV VIGS to study flowering in petunia (Chen et al., 2004) and N. benthamiana (Liu et al., 2004). Semiquantitative reverse transcription (RT)-PCR analyses indicate that PDS transcript levels in silenced plants are reduced by 95% (Fig. 3B). VIGS of Endogenous Transgenes and Essential Genes in Arabidopsis We wanted to investigate the efficacy of TRV VIGS on silencing other Arabidopsis genes. We chose the Chlorata42 (CH42) gene because silencing produces a visible phenotype: yellow color due to inhibition of chlorophyll biosynthesis (Kjemtrup et al., 1998). It has also been used as a marker for silencing in Arabidopsis (Turnage et al., 2002) and other systems (Kjemtrup et al., 1998). A fragment of the CH42 gene was cloned into TRV RNA2 and two- to three-leaf seedlings were infiltrated with cultures containing the silencing construct. At 10 to 12 d postinfiltration (dpi), the yellow sulfur phenotype of ch42 was visible in 100% of silenced plants (Fig. 2B Figure 2. Open in new tabDownload slide Silencing of CH42, GFP, and Cullin 1 using TRV-based VIGS. A, Arabidopsis Col-0 plant 12 dpi with empty vector TRV VIGS. B, Silencing of AtCH42 results in the yellow color of the sulfur phenotype of the plants. The AtCH42 phenotype was observed in all plants tested. C, Wild-type Arabidopsis Col-0 plant gives red fluorescence under a UV light (image 1), whereas a transgenic Col-0∷GFP plant expressing GFP appears green (image 2). Col-0∷GFP plants infiltrated with empty vector TRV VIGS remain green under UV light 12 dpi (image 3, left). Infiltration of Col-0∷GFP plants with TRV-GFP leads to loss of GFP and red fluorescence under UV light 12 dpi (image 3, right, and image 4). D, Silencing of an essential gene, AtCUL1, produces chlorosis of leaves, stunting, and eventually kills the plant. Photographs were taken 4 weeks after infiltration with TRV AtCUL1. Figure 2. Open in new tabDownload slide Silencing of CH42, GFP, and Cullin 1 using TRV-based VIGS. A, Arabidopsis Col-0 plant 12 dpi with empty vector TRV VIGS. B, Silencing of AtCH42 results in the yellow color of the sulfur phenotype of the plants. The AtCH42 phenotype was observed in all plants tested. C, Wild-type Arabidopsis Col-0 plant gives red fluorescence under a UV light (image 1), whereas a transgenic Col-0∷GFP plant expressing GFP appears green (image 2). Col-0∷GFP plants infiltrated with empty vector TRV VIGS remain green under UV light 12 dpi (image 3, left). Infiltration of Col-0∷GFP plants with TRV-GFP leads to loss of GFP and red fluorescence under UV light 12 dpi (image 3, right, and image 4). D, Silencing of an essential gene, AtCUL1, produces chlorosis of leaves, stunting, and eventually kills the plant. Photographs were taken 4 weeks after infiltration with TRV AtCUL1. ). We monitored the level of silencing by semiquantitative RT-PCR and found an 89% reduction in CH42 transcript levels in yellow, silenced leaves (Fig. 3C Figure 3. Open in new tabDownload slide VIGS effect on PDS, CH42, and CUL1 transcripts. Semiquantitative RT-PCR was used to determine the degree of silencing. Lanes 1 to 6 represent PCR cycles 15, 18, 21, 24, 27, and 30, respectively. C is the no RT control and M is the size marker. PCR products on the left of the marker are the nonsilenced controls. Those on the right are from the silenced plants. EF-1α is used as an internal control (A). Reductions of transcript levels are 95% for PDS (B), 89% for CH42 (C), 92% for GFP (D), and 79% for CUL1 (E). Figure 3. Open in new tabDownload slide VIGS effect on PDS, CH42, and CUL1 transcripts. Semiquantitative RT-PCR was used to determine the degree of silencing. Lanes 1 to 6 represent PCR cycles 15, 18, 21, 24, 27, and 30, respectively. C is the no RT control and M is the size marker. PCR products on the left of the marker are the nonsilenced controls. Those on the right are from the silenced plants. EF-1α is used as an internal control (A). Reductions of transcript levels are 95% for PDS (B), 89% for CH42 (C), 92% for GFP (D), and 79% for CUL1 (E). ). The ability of TRV VIGS to silence a green fluorescent protein (GFP) transgene in Arabidopsis was also examined. Wild-type Arabidopsis plants appear red under UV light due to chlorophyll autofluorescence, whereas transgenes containing GFP appear green (compare Fig. 2C, first two sections). We agroinfiltrated seedlings with cultures containing TRV RNA2 carrying a GFP fragment. We observed the plants under UV light after 12 dpi. Plants infiltrated with the TRV VIGS vector alone retained their green color, whereas those infiltrated with TRV RNA2-GFP were mostly red, with only small patches of green fluorescence still visible at the edge of leaves (Fig. 2C). This indicates that TRV-mediated silencing of a transgene was effective in Arabidopsis. The silencing observations were confirmed by analysis of GFP transcript levels by semiquantitative RT-PCR of RNA derived from a red leaf from Figure 2C, section 4. The silenced plants showed a 92% reduction in GFP transcript levels (Fig. 3D). Thus, TRV VIGS can also be used to silence highly expressed transgenes in Arabidopsis. One of the most useful applications of VIGS is in studying genes whose traditional knockout phenotype is lethal. In Arabidopsis, one such gene is Cullin 1 (CUL1), a component of the Skp1/Cullin/F-box (SCF)-type E3 ubiquitin ligases (Shen et al., 2002). cul1 mutants are embryonic lethal with an early arrest in development that precedes division of the endosperm (Shen et al., 2002). This suggests that CUL1 has an essential role in early embryogenesis that may be due to its ability to form a variety of SCF complexes containing different F-box proteins. The availability of cul1 mutant tissue would allow an investigation of other roles of CUL1 in SCF function and in plant development. Following the approach used for silencing PDS, CH42, and GFP, we silenced AtCUL1. This produced a pleiotropic phenotype (Fig. 2D) that includes yellowing of leaves, severe stunting, and reduced bolting. We determined that the phenotypes observed coincided with a 79% reduction in AtCUL1 transcript levels (Fig. 3E). TRV VIGS as a Tool for Studying Disease Resistance We wanted to demonstrate that TRV VIGS could be used to investigate a variety of biological questions and so we chose to examine the effectiveness of silencing Arabidopsis disease resistance (R) genes. RPM1 confers resistance to Pseudomonas syringae carrying either the AvrRpm1 or AvrB effector proteins (Grant et al., 1995). Arabidopsis Col-0 leaves infected with P. syringae carrying AvrRpm1 or AvrB initiate programmed cell death (PCD) that is part of the typical R-gene-mediated response, called the hypersensitive response (HR; Fig. 4A Figure 4. Open in new tabDownload slide VIGS to study disease resistance in Arabidopsis. A, RPM1 was silenced in wild-type Col-0 plants by infiltration with TRV-RPM1. Control plants infected with P. syringae not containing AvrRPm1 do not show HR (19 of 19 plants tested), whereas HR is observed in all plants in the presence of AvrRpm1. RPM1-silenced plants do not show HR in the absence of AvrRpm1 (23 of 23 plants tested); 16 of 21 RPM1-silenced plants do not produce HR in response to AvrRpm1, indicating a loss of RPM1 function. All observations were made 14 h postinoculation (hpi). B, Silencing of RPS2 results in loss of HR to AvrRpt2 in 29 of 35 plants tested. Observations were made 22 hpi. C and D, Semiquantitative RT-PCR was used to determine the degree of RPM1 and RPS2 silencing. Lanes 1 to 6 represent PCR cycles 15, 18, 21, 24, 27, and 30, respectively. C is the no RT control and M is the size marker. PCR products on the left of the marker are the nonsilenced controls and those on the right are from the silenced plants. Actin is used as an internal control (C). Reductions of transcript levels are 92% for RPM1 (D) and 95% for RPS2 (E). Figure 4. Open in new tabDownload slide VIGS to study disease resistance in Arabidopsis. A, RPM1 was silenced in wild-type Col-0 plants by infiltration with TRV-RPM1. Control plants infected with P. syringae not containing AvrRPm1 do not show HR (19 of 19 plants tested), whereas HR is observed in all plants in the presence of AvrRpm1. RPM1-silenced plants do not show HR in the absence of AvrRpm1 (23 of 23 plants tested); 16 of 21 RPM1-silenced plants do not produce HR in response to AvrRpm1, indicating a loss of RPM1 function. All observations were made 14 h postinoculation (hpi). B, Silencing of RPS2 results in loss of HR to AvrRpt2 in 29 of 35 plants tested. Observations were made 22 hpi. C and D, Semiquantitative RT-PCR was used to determine the degree of RPM1 and RPS2 silencing. Lanes 1 to 6 represent PCR cycles 15, 18, 21, 24, 27, and 30, respectively. C is the no RT control and M is the size marker. PCR products on the left of the marker are the nonsilenced controls and those on the right are from the silenced plants. Actin is used as an internal control (C). Reductions of transcript levels are 92% for RPM1 (D) and 95% for RPS2 (E). ). We used TRV VIGS to silence RPM1 and then infected plants with P. syringae carrying AvrRpm1. In nonsilenced controls, 24 of 24 plants showed HR PCD. In contrast, 16 of 21 RPM1-silenced plants gave no HR PCD (Fig. 4A). Thus, the silenced plants show a loss of resistance to P. syringae carrying AvrRpm1. We assessed the degree of reduction of RPM1 transcript levels and found that the silenced plants have 92% lower levels of transcripts (Fig. 4D). Similarly, we examined the effect of silencing another Arabidopsis R gene, RPS2. Infection of RPS2-containing Arabidopsis with P. syringae carrying AvrRpt2 produces HR PCD (Bent et al., 1994; Mindrinos et al., 1994). Consistent with this, all plants infiltrated with TRV VIGS vector alone showed HR PCD when infected with P. syringae carrying AvrRpt2. In contrast, 29 of 35 RPS2-silenced plants failed to produce HR PCD after introduction of AvrRpt2 (Fig. 4B). We confirmed the silencing of RPS2 by semiquantitative RT-PCR and found a 95% reduction in transcript levels (Fig. 4E). Thus, TRV VIGS is effective at silencing R genes and can be used as a tool for investigating plant innate immunity. Development of a VIGS Marker System In most instances, the efficacy of silencing of a gene of interest cannot be visibly assessed. We wanted to develop a system that contained a marker that could be easily observed to indicate whether silencing had been effective and the approximate degree of silencing. For this, we generated a TRV RNA2 vector that contains a fragment of the GFP gene upstream of a multiple cloning site. This allows the insertion of sequence of a gene of interest into the plasmid to facilitate the simultaneous silencing of both genes in transgenic Arabidopsis containing the GFP transgene. To test our system, we inserted fragments of GFP and RPS2 in tandem into TRV RNA2. Two weeks after agroinoculation of seedlings, we observed the plants under UV light. As expected, we observed red fluorescence in the GFP-RPS2-silenced plants (Fig. 5A Figure 5. Open in new tabDownload slide A VIGS reporter system for Arabidopsis. The TRV VIGS reporter system couples the silencing of GFP in a transgenic Col-0∷GFP plant with the silencing of an endogenous gene of interest. A, GFP is silenced after infiltration with TRV-GFP-RPS2 and plants appear red when observed under UV light. B, The level of GFP and RPS2 transcript reduction was monitored by semiquantitative RT-PCR. Lanes 1 to 6 represent PCR cycles 15, 18, 21, 24, 27, and 30, respectively. C is the no RT control and M is the size marker. PCR products on the left of the marker are the nonsilenced controls and those on the right are from the silenced plants. Actin is used as a control. C, Fourteen of 15 plants tested did not produce an HR in response to AvrRpt2 after infiltration with TRV-GFP-RPS2 indicating silencing of RPS2. Figure 5. Open in new tabDownload slide A VIGS reporter system for Arabidopsis. The TRV VIGS reporter system couples the silencing of GFP in a transgenic Col-0∷GFP plant with the silencing of an endogenous gene of interest. A, GFP is silenced after infiltration with TRV-GFP-RPS2 and plants appear red when observed under UV light. B, The level of GFP and RPS2 transcript reduction was monitored by semiquantitative RT-PCR. Lanes 1 to 6 represent PCR cycles 15, 18, 21, 24, 27, and 30, respectively. C is the no RT control and M is the size marker. PCR products on the left of the marker are the nonsilenced controls and those on the right are from the silenced plants. Actin is used as a control. C, Fourteen of 15 plants tested did not produce an HR in response to AvrRpt2 after infiltration with TRV-GFP-RPS2 indicating silencing of RPS2. ). To confirm that silencing of the GFP transgene overlaps with silencing of the endogenous gene, RPS2, we performed quantitative RT-PCR analyses of relative GFP and RPS2 mRNA levels in the tissue showing loss of UV fluorescence. Our analyses indicate that GFP and RPS2 transcript levels are reduced by 95% compared to the control TRV vector alone in infected nonsilenced plants (Fig. 5B). These results clearly illustrate that GFP (transgene) silencing overlaps with RPS2 (endogenous) gene silencing at the molecular level. We tested the ability of the GFP-RPS2 double-silenced plants to respond to P. syringae carrying AvrRpt2. We found that 14 of 15 plants tested did not produce HR PCD in response to AvrRpt2, indicating that RPS2 function had been compromised (Fig. 5B). Thus, the marker system coupling GFP to a gene of interest allows effective silencing of the target gene of interest as well as a visible marker for silencing. DISCUSSION We have optimized a TRV-based VIGS protocol for use in the model dicotyledonous species, Arabidopsis. The availability of the genome sequence of the Col-0 ecotype of Arabidopsis has been a valuable tool for the identification and characterization of many mutants in a broad range of processes. Despite this, there are still challenges to working in this species. One problem is embryonic lethality of some mutants. As we have demonstrated for CUL1, VIGS can be used to examine the effects of loss of the product of the essential gene in adult tissues. Another problem is the possible functional redundancy of members of gene families. It is difficult and tedious to generate traditional T-DNA insertion mutants in multiple members of a gene family to tease apart the function of those genes. VIGS can be used to silence multiple members of a family by using a highly conserved region for silencing (He et al., 2004). This provides an idea of the processes in which these genes function. In addition, the directed nature of VIGS allows the targeted knock down of expression of any gene of interest. This is important when traditional knockouts of a gene of interest are unavailable due to the limitations of the kind of mutations introduced by chemical mutagenesis or the preference of T-DNA insertion sites. Thus, VIGS represents an important tool to complement traditional forward genetics tools in Arabidopsis. The previously described protocols for VIGS in Arabidopsis have been time consuming and difficult. Indeed, they have seen limited use for study of gene function. There has been a single report using the CbLCV-based VIGS vector to study plant development (Fan et al., 2005). The CbLCV VIGS vector is introduced into Arabidopsis seedlings by particle bombardment, a process that requires care in the preparation of microprojectile particles, the risk of carryover between experiments, and the somewhat unpredictable introduction of the silencing vector (Turnage et al., 2002; Muangsan and Robertson, 2004). The previously described TRV-based VIGS protocol required that the vector first be introduced into N. benthamiana to produce virions (Lu et al., 2003b). The purification of the crude N. benthamiana sap to produce the viral inoculum for Arabidopsis also involves several different steps. The other recently described TRV-based protocol uses vacuum infiltration of the whole plant that is submerged in Agrobacterium cultures (Wang et al., 2006). Not only is this process tedious, but also it requires relatively large culture volumes (100 mL) for infiltration. None of these protocols are therefore suitable for large-scale approaches to gene function analysis in Arabidopsis. In contrast, our protocol allows direct introduction of the TRV VIGS vector into Arabidopsis seedlings by simple agroinfiltration. Given the small size of seedling leaves, it takes less than a minute to inoculate a plant. With the modifications we have described here, previously published protocols for VIGS in N. benthamiana or tomato can be used for silencing in Arabidopsis (Lu et al., 2003b; Burch-Smith et al., 2004). This protocol provides an avenue for large-scale functional genomic screens in Arabidopsis, as has been performed in N. benthamiana (Lu et al., 2003a; Liu et al., 2005). Thus, TRV-based VIGS holds promise as a powerful tool for genetic analysis in this indispensable model organism. MATERIALS AND METHODS Plasmid Construction pTRV1 (pYL192) and pTRV2 (pYL156) vectors have been described in Liu et al. (2002b). The pYL170 TRV2 vector was derived by cloning a PstI-blunt-DraIII fragment of pYL156 into EcoRI-blunt-DraIII-cut pCAMBIA3301. This vector is identical to pYL156, except for a plant selection marker. To generate pTRV2-AtPDS, a cDNA fragment was PCR amplified using Arabidopsis (Arabidopsis thaliana) ecotype Col-0 cDNA and primers 5′-CGCGAATTCTGCGGCGAATTTGCCTTATCAAAACG-3′ and 5′-CGCTCTAGAAACTCTTAACCGTGCCATCGTCATTGAG-3′. The resulting PCR product was cloned into XbaI-EcoRI-cut pTRV2. To generate pTRV2-AtCH42, the Arabidopsis CH42 cDNA fragment was PCR amplified from Arabidopsis cDNA using primers 5′-CGACGACAAGACCCTGGCGTCTCTTCTTGGAACATCTTC-3′ and 5′-GAGGAGAAGAGCCCTCGCAATAACAGGAACTTGCTCTC-3′ and cloned into pTRV2. To generate pTRV2-GFP, the GFP fragment was PCR amplified from the tobacco mosaic virus-GFP plasmid using primers CGGTCTAGAGGTACCCTTGTTAATCGTATCGAG-3′ and 5′-CCGTCTAGAGCTCATCCATGCCATGTGT-3′. The resulting PCR product was cloned into XbaI-cut pYL170. To generate pTRV2-AtCUL1, the Arabidopsis Cullin1 cDNA fragment was PCR amplified from Arabidopsis cDNA using primers 5′-CGGGAATTCGAGCGCAAGACTATTGACTTGGAGC-3′ and 5′-CGGGAATTCTTGCAAACACAACCAGCAATTCATG-3′. The resulting PCR product was cloned into EcoRI-cut pTRV2. To generate pTRV2-AtRPM1, the Arabidopsis RPM1 cDNA fragment was PCR amplified using primers 5′-CGGGAATTCTGATCGCAACTGCAAGCATTGAGAAGCT-3′ and 5′-CGGGAATTCAGATGAGAGGCTCACATAGAAAGAGCC-3′. The resulting PCR product was cloned into EcoRI-cut pTRV2. To generate pTRV2-AtRPS2, the Arabidopsis RPS2 cDNA fragment was PCR amplified using primers 5′-CGGGAATTCGAACTCCTCTACTTCAATCTCCCATC-3′ and 5′-CGGGAATTCGGAACAAAGCGCGGTAAATAACAAAG-3′. The resulting PCR product was cloned into EcoRI-cut pTRV2. To generate pTRV2-GFP-AtRPS2, the RPS2 cDNA fragment was PCR amplified using primers 5′-CGACGACAAGACCCTGAACTCCTCTACTTCAATCTCCCATC-3′ and 5′-GAGGAGAAGAGCCCTGGAACAAAGCGCGGTAAATAACAAAG-3′. The resulting PCR product was cloned into pYL989, a pTRV2-GFP derivative (pTRV2-GFP). All PCR amplification was performed using Taq DNA polymerase (New England Biolabs). Plant Growth, Agroinfiltration, and GFP Imaging Wild-type Arabidopsis ecotype Col-0 and GFP-expressing transgenic Arabidopsis Col-0 plants were grown in pots at 23°C in a growth chamber under a 16/8-h photoperiod with 60% humidity. Two- to three-leaf seedlings were used for VIGS, approximately 15 to 17 d after seed germination. For the VIGS assay, pTRV1 or pTRV2 and its derivatives were introduced into Agrobacterium tumefaciens strain GV3101. A 5-mL culture was grown overnight at 28°C in 50 mg/L gentamycin and 50 mg/L kanamycin. The next day, the culture was inoculated into 50-mL of Luria-Bertani medium containing antibiotics, 10 mm MES, and 20 μ m acetosyringone. The culture was grown overnight in a 28°C shaker. A. tumefaciens cells were harvested and resuspended in infiltration media (10 mm MgCl2, 10 mm MES, and 200 μ m acetosyringone), adjusted to an OD600 of 1.5, and left at room temperature for 3 to 4 h. Agroinfiltration was performed with a needleless 1-mL syringe into two leaves of two- to three-leaf-stage plants, infiltrating the entire leaf. Plants were left covered overnight. GFP imaging was performed using UV illumination and photographs were taken using an Olympus Camedia E10 digital camera. HR Assay in Arabidopsis Plants Pseudomonas syringae DC3000 containing empty vector pVSP61, AvrRpm1, or AvrRpt2 were grown from glycerol stocks for 36 to 48 h on King's B solid medium containing 100 mg/L rifampicin and 25 mg/L kanamycin. Cells were scraped into 10 mm MgCl2 and diluted to OD600 = 0.2 and infiltrated using a 1-mL needleless syringe into the silenced and control Arabidopsis plants. RPM1-mediated and RPS2-mediated HR cell death were observed and photographed at 14 and 22 h postinfiltration of P. syringae strains, respectively. RNA Isolation and RT-PCR Analysis Total RNA was extracted from pooled tissue samples of two to three silenced and nonsilenced Arabidopsis plants using the RNeasy plant minikit, including an RNase-free DNase treatment step (Qiagen). First-strand cDNA was synthesized using 1 μg of total RNA, oligo d(T) primer, and SuperScript reverse transcriptase (Invitrogen). Semiquantitative RT-PCR was performed as described in Liu et al. (2002b). For RT-PCR, primers that anneal outside the region targeted for silencing were used to ensure that the gene of interest was silenced. The intensities of PCR-generated fragments were analyzed and quantified using Gel Doc 2000 and Quantity One, version 4.3 (Bio-Rad). ACKNOWLEDGMENTS We thank Brian Staskawicz for providing P. syringae strains and Dominique Robertson for providing GFP-expressing Arabidopsis Col-0. LITERATURE CITED Baulcombe DC ( 1999 ) Fast forward genetics based on virus-induced gene silencing. Curr Opin Plant Biol 2 : 109 – 113 Crossref Search ADS PubMed Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Giraudat J, Leung J, Staskawicz BJ ( 1994 ) RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes. Science 265 : 1856 – 1860 Crossref Search ADS PubMed Brigneti G, Martin-Hernandez AM, Jin H, Chen J, Baulcombe DC, Baker B, Jones JD ( 2004 ) Virus-induced gene silencing in Solanum species. Plant J 39 : 264 – 272 Crossref Search ADS PubMed Burch-Smith TM, Anderson JC, Martin GB, Dinesh-Kumar SP ( 2004 ) Applications and advantages of virus-induced gene silencing for gene function studies in plants. Plant J 39 : 734 – 746 Crossref Search ADS PubMed Chen JC, Jiang CZ, Gookin TE, Hunter DA, Clark DG, Reid MS ( 2004 ) Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Mol Biol 55 : 521 – 530 PubMed Chen JC, Jiang CZ, Reid MS ( 2005 ) Silencing a prohibitin alters plant development and senescence. Plant J 44 : 16 – 24 Crossref Search ADS PubMed Chung E, Seong E, Kim YC, Chung EJ, Oh SK, Lee S, Park JM, Joung YH, Choi D ( 2004 ) A method of high frequency virus-induced gene silencing in chili pepper (Capsicum annuum L. cv. Bukang). Mol Cells 17 : 377 – 380 PubMed Cogoni C, Irelan JT, Schumacher M, Schmidhauser TJ, Selker EU, Macino G ( 1996 ) Transgene silencing of the al-1 gene in vegetative cells of Neurospora is mediated by a cytoplasmic effector and does not depend on DNA-DNA interactions or DNA methylation. EMBO J 15 : 3153 – 3163 Crossref Search ADS PubMed Dinesh-Kumar SP, Anandalakshmi R, Marathe R, Schiff M, Liu Y ( 2003 ) Virus-induced gene silencing. Methods Mol Biol 236 : 287 – 294 PubMed Fan J, Quan S, Orth T, Awai C, Chory J, Hu J ( 2005 ) The Arabidopsis PEX12 gene is required for peroxisome biogenesis and is essential for development. Plant Physiol 139 : 231 – 239 Crossref Search ADS PubMed Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC ( 1998 ) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391 : 806 – 811 Crossref Search ADS PubMed Fu DQ, Zhu BZ, Zhu HL, Jiang WB, Luo YB ( 2005 ) Virus-induced gene silencing in tomato fruit. Plant J 43 : 299 – 308 Crossref Search ADS PubMed Grant MR, Godiard L, Straube E, Ashfield T, Lewald J, Sattler A, Innes RW, Dangl JL ( 1995 ) Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance. Science 269 : 843 – 846 Crossref Search ADS PubMed He X, Anderson JC, del Pozo O, Gu Y-Q, Tang X, Martin GB ( 2004 ) Silencing of subfamily I of protein phosphatase 2A catalytic subunits results in activation of plant defense responses and localized cell death. Plant J 38 : 563 – 577 Crossref Search ADS PubMed Hileman LC, Drea S, Martino G, Litt A, Irish VF ( 2005 ) Virus-induced gene silencing is an effective tool for assaying gene function in the basal eudicot species Papaver somniferum (opium poppy). Plant J 44 : 334 – 341 Crossref Search ADS PubMed Kjemtrup S, Sampson KS, Peele CG, Nguyen LV, Conkling MA ( 1998 ) Gene silencing from plant DNA carried by a geminivirus. Plant J 14 : 91 – 100 Crossref Search ADS PubMed Lindbo JA, Silva-Rosales L, Proebsting WM, Dougherty WG ( 1993 ) Induction of a highly specific antiviral state in transgenic plants: implications for regulation of gene expression and virus resistance. Plant Cell 5 : 1749 – 1759 Crossref Search ADS PubMed Liu Y, Nakayama N, Schiff M, Litt A, Irish VF, Dinesh-Kumar SP ( 2004 ) Virus induced gene silencing of a DEFICIENS ortholog in Nicotiana benthamiana. Plant Mol Biol 54 : 701 – 711 Crossref Search ADS PubMed Liu Y, Schiff M, Czymmek K, Talloczy Z, Levine B, Dinesh-Kumar SP ( 2005 ) Autophagy regulates programmed cell death during the plant innate immune response. Cell 121 : 567 – 577 Crossref Search ADS PubMed Liu Y, Schiff M, Dinesh-Kumar SP ( 2002 a) Virus-induced gene silencing in tomato. Plant J 31 : 777 – 786 Crossref Search ADS PubMed Liu Y, Schiff M, Marathe R, Dinesh-Kumar SP ( 2002 b) Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J 30 : 415 – 429 Crossref Search ADS PubMed Lu R, Malcuit I, Moffett P, Ruiz MT, Peart J, Wu AJ, Rathjen JP, Bendahmane A, Day L, Baulcombe DC ( 2003 a) High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J 22 : 5690 – 5699 Crossref Search ADS PubMed Lu R, Martin-Hernandez AM, Peart JR, Malcuit I, Baulcombe DC ( 2003 b) Virus-induced gene silencing in plants. Methods 30 : 296 – 303 Crossref Search ADS PubMed Mindrinos M, Katagiri F, Yu GL, Ausubel FM ( 1994 ) The A. thaliana disease resistance gene RPS2 encodes a protein containing a nucleotide-binding site and leucine-rich repeats. Cell 78 : 1089 – 1099 Crossref Search ADS PubMed Muangsan N, Robertson D ( 2004 ) Geminivirus vectors for transient gene silencing in plants. Methods Mol Biol 265 : 101 – 115 PubMed Ratcliff F, Harrison BD, Baulcombe DC ( 1997 ) A similarity between viral defense and gene silencing in plants. Science 276 : 1558 – 1560 Crossref Search ADS PubMed Ratcliff F, Martin-Hernandez AM, Baulcombe DC ( 2001 ) Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J 25 : 237 – 245 PubMed Ryu CM, Anand A, Kang L, Mysore KS ( 2004 ) Agrodrench: a novel and effective agroinoculation method for virus-induced gene silencing in roots and diverse Solanaceous species. Plant J 40 : 322 – 331 Crossref Search ADS PubMed Shen WH, Parmentier Y, Hellmann H, Lechner E, Dong A, Masson J, Granier F, Lepiniec L, Estelle M, Genschik P ( 2002 ) Null mutation of AtCUL1 causes arrest in early embryogenesis in Arabidopsis. Mol Biol Cell 13 : 1916 – 1928 Crossref Search ADS PubMed Soosaar JL, Burch-Smith TM, Dinesh-Kumar SP ( 2005 ) Mechanisms of plant resistance to viruses. Nat Rev Microbiol 3 : 789 – 798 Crossref Search ADS PubMed Turnage MA, Muangsan N, Peele CG, Robertson D ( 2002 ) Geminivirus-based vectors for gene silencing in Arabidopsis. Plant J 30 : 107 – 117 Crossref Search ADS PubMed Wang C, Cai X, Wang X, Zheng Z ( 2006 ) Optimisation of tobacco rattle virus-induced gene silencing in Arabidopsis. Funct Plant Biol 33 : 347 – 355 Crossref Search ADS PubMed Watson JM, Fusaro AF, Wang M, Waterhouse PM ( 2005 ) RNA silencing platforms in plants. FEBS Lett 579 : 5982 – 5987 Crossref Search ADS PubMed Author notes 1 This work was supported by a National Science Foundation Plant Genome grant (grant no. DBI–0211872). 2 These authors contributed equally to the paper. 3 Present address: Ceres Inc., Thousand Oaks, CA 91320. * Corresponding author; e-mail [email protected]; fax 203–432–6161. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: S.P. Dinesh-Kumar ([email protected]). www.plantphysiol.org/cgi/doi/10.1104/pp.106.084624 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Buseman, Christen M.; Tamura, Pamela; Sparks, Alexis A.; Baughman, Ethan J.; Maatta, Sara; Zhao, Jian; Roth, Mary R.; Esch, Steven Wynn; Shah, Jyoti; Williams, Todd D.; Welti, Ruth

doi: 10.1104/pp.106.082115

Minorsky, Peter V.; Bronstein, Natalie B.

doi: 10.1104/pp.106.086835pmid: 16957133

In plants with alternately arranged foliage, such as the coconut palm (Cocos nucifera), leaves are attached to the stem in either an ascending clockwise (left handed [L]) or counterclockwise (right handed [R]) spiral (Fig. 1 Figure 1. Open in new tabDownload slide FSD of coconut palms is easily discernible by examination of the leaf scars on the stem. If the next highest (youngest) leaf scar is approximately 140° to the left, it is an L palm (left photo); if it is approximately 140° to the right, it is an R palm (right photo). Figure 1. Open in new tabDownload slide FSD of coconut palms is easily discernible by examination of the leaf scars on the stem. If the next highest (youngest) leaf scar is approximately 140° to the left, it is an L palm (left photo); if it is approximately 140° to the right, it is an R palm (right photo). ). Foliar spiral direction (FSD) is not genetically determined in coconut palms: All crosses (R × R, R × L, L × R, L × L) yield R and L progeny in approximately equal numbers (Davis, 1962; Louis and Chidambaram, 1976; Toar et al., 1979). FSD is, thus, a classic case of morphological asymmetry in which dextral and sinistral forms are not inherited and are equally common within a species (Palmer, 2005). FSD would seem a simple stochastic process unworthy of further study if not for the observation by T.A. Davis, based on data collected from over 70,000 coconut palms in over 40 locations around the world, that the FSD of coconut palms varies with latitude: R trees predominate in the northern hemisphere and L trees predominate in the southern hemisphere (Davis and Davis, 1987). A reanalysis of Davis's data indicated that these hemispheric asymmetries in FSD are significantly better correlated with magnetic (dip) latitude than with geographic or geomagnetic (centered dipole) latitude, suggesting that latitudinal asymmetries in FSD might be associated with the temporally varying component of the Earth's magnetic field (Minorsky, 1998). Here, we report that asymmetries in FSD are also evident in populations of coconut palms on opposite sides of islands and that asymmetries between cohorts vary with an 11-year periodicity—two novel discoveries consistent with the hypothesis that geomagnetic variations underlie asymmetries in coconut palm FSD. Whereas the effects of the geomagnetic field on the orientation of magnetotactic bacteria and various animals, particularly insects and migratory birds, has been extensively studied, relatively little is known about the effects of geomagnetism on plants (Belyavskaya, 2004; Galland and Pazur, 2005). Important questions remain unanswered, such as whether or not plants perceive the geomagnetic field and, if they do, by what mechanisms and to what possible advantage, if any? At this early stage in our understanding of magnetoreception, several alternative mechanisms are being discussed by biophysicists concerning how cells might sense weak electromagnetic fields. Among the proposed modes of action are (1) torque on ferromagnetic particles; (2) modulation of biochemical reactions that involve spin-correlated radical pairs (radical-pair mechanism); (3) modulation of the transport rates and binding by ion-cyclotron resonance; and (4) quantum coherence mechanisms (for review, see Galland and Pazur, 2005). Regardless of the exact mechanisms involved in the physical reception of magnetic stimulation, considerable evidence suggests the involvement of biological membranes, in general (Balcavage et al., 1996; Volpe, 2003), and of Ca2+ fluxes, in particular (Belova and Lednev, 2001; Bauréus Koch et al., 2003; Belyavskaya, 2004; Pazur et al., 2006), in magnetoreception. Evidence does exist that the electrical potentials of trees change in parallel, even in fine detail, with earth currents induced by variations in the Earth's magnetic field. Pc1-type geomagnetic pulsations (0.2–5 Hz) of very small amplitude (0.05–0.1 nT), for example, have been recorded in oak (Quercus lobata) trees (Fraser-Smith, 1978). These extremely weak geomagnetic pulsations gave rise to electrical potential oscillations of approximately 100-μV amplitude (Fraser-Smith, 1978). These electrical signals were not artifactual: They were not found when the tree was replaced with a resistor or when a dead tree was used. Similar electrical periodicities had been measured previously in plants and correlated with 1- to 10-Hz leaf movements (Semenenko, 1972), suggesting that plants are not simply passive antennae for geomagnetic variations, but that membrane functioning may be affected (Minorsky, 2001). Conceivably, a membrane transport process that might be affected by induced currents is the polar transport of auxin, a plant hormone that determines the phyllotaxy of plants (Reinhardt et al., 2003). Plant cells use electric currents to control their physiological polarity and direction of growth (Morris, 1980; Bandurski et al., 1992; Mina and Goldsworthy, 1992). Individual plant cells generate their own polar electric currents, but the direction of these currents can be changed by a brief application of a weak external current, after which the cell's new current is in the same direction as the one that was applied (Mina and Goldsworthy, 1992). It is hypothesized that canalized physiological polarity involves the electrophoretic distribution of differently charged membrane proteins (e.g. auxin transport proteins) along the cell's electrical axis (Mina and Goldsworthy, 1992). The induced current hypothesis proposes that asymmetries in coconut palm FSD result from earth currents in trees that are induced by variations in the vertical Z component of the geomagnetic field, and that these earth currents consequently cause a rotational bias in the axial electrophoresis of morphogens (e.g. auxin transporters) in coconut palm embryos (Minorsky, 1998). The prediction that asymmetries in coconut palm FSDs of opposite sign should exist on opposite sides of islands arises from the fact that, because seawater is more electrically conductive than land, induced earth currents tend to divide and stream past an island in a pattern determined by the surrounding bathymetry. The geomagnetic island effect is characterized by a complete reversal of the vertical Z component of short-period geomagnetic field variations at observation points on opposite sides of islands (Elvers and Perkins, 1964; Sasai, 1967; Honkura, 1972; Klein, 1972; Yamaguchi et al., 1992). To examine whether coconut palm FSD varies around the circumferences of islands, data were collected on two Caribbean islands (Puerto Rico, n = 4,850; Antigua, n = 2,038), two Hawaiian islands (Hawaii, n = 3,552; Maui, n = 2,175), and two French Polynesian islands (Tahiti, n = 1,635; Moorea, n = 2,116). It should be noted that the convention we use for designating palms as L or R in this contribution is in agreement with the Descriptors for Coconut established by the International Plant Genetic Resources Institute (IPGRI, 1995) and opposite to that used previously (Davis, 1962, 1963; Davis and Davis, 1987; Minorsky, 1998). Insofar as our research is concerned, Tahiti and nearby Moorea behaved as a single island that we refer to as Tahiti/Moorea: Thus, we have five datasets. No effort was made to distinguish between different varieties of coconut palms because previous research by Davis (1962) suggested that this is not an important factor. Data were collected in a wide variety of locales, including beaches, parks, groves, resorts, plantations, and private properties: Only urban (e.g. sidewalk) populations were excluded. For each population, the degree of asymmetry for trees with easily distinguishable leaf scars was determined by calculating an asymmetry quotient (AQ) based on the formula: \[\mathrm{AQ}{=}(\mathrm{L}{-}\mathrm{R})/\mathrm{Total}.\] Asymmetries in FSD were evident on opposite sides of all five islands studied (Fig. 2, A–E Figure 2. Open in new tabDownload slide Numbers of L and R coconut palms counted around the circumferences of islands. A, Puerto Rico. B, Antigua. C, Hawaii. D, Maui. E, Tahiti/Moorea. F, Map of P z, a scaled parameter representing the Z component of the anomalous geomagnetic field that arises from the distortion of electric current flowing in the ocean around Tahiti (Fig. 2F redrawn from Yamaguchi et al., 1992). Lines that bisect the islands in Figure 2, A to E, represent lines of symmetry connecting the estimated azimuths of zero asymmetry. Figure 2. Open in new tabDownload slide Numbers of L and R coconut palms counted around the circumferences of islands. A, Puerto Rico. B, Antigua. C, Hawaii. D, Maui. E, Tahiti/Moorea. F, Map of P z, a scaled parameter representing the Z component of the anomalous geomagnetic field that arises from the distortion of electric current flowing in the ocean around Tahiti (Fig. 2F redrawn from Yamaguchi et al., 1992). Lines that bisect the islands in Figure 2, A to E, represent lines of symmetry connecting the estimated azimuths of zero asymmetry. ). The azimuths of maximal AQ varied between the three island groups: AQs were maximum at the following bearings (from geographic N): −20° in the Caribbean islands; 125° in the Hawaiian islands; and −165° in Tahiti/Moorea. Based on the facts that the trade winds in Puerto Rico are northeasterly and that the line of zero asymmetry runs along a northeast-to-southwest diagonal in Puerto Rico, one might reasonably formulate the working hypothesis that positive AQs (high left handedness) are associated with the counterclockwise flow of wind around the island, and negative AQs are associated with a clockwise flow of wind. Unfortunately, the wind hypothesis is completely dashed by our findings on Tahiti/Moorea (Fig. 2E), where the trade winds blow from the southeast and the cross-island asymmetry is completely opposite from what would be predicted by the wind hypothesis based on the case in Puerto Rico (i.e. the data from Puerto Rico and Tahiti/Moorea when considered together show an antiparallel relation to the trade winds rather than a parallel one). Thus, no correspondence exists between the cross-island asymmetries of AQ and the directions of the trade winds. The effects we report were observed most strongly in natural populations; for example, the highest X 2 value (assuming L = R) we found for any population (n = 710; X 2 = 18.95; P < 0.001) was from a natural grove in Humaçao, Puerto Rico. Thus, the activities of man (e.g. transplantation or the differential culling of trees of opposite handedness) would appear to obfuscate, rather than create, the differences seen on opposite sides of islands. It is of interest to consider whether the palm island effect described here bears any relation to the geomagnetic island effect described by geophysicists. Yamaguchi et al. (1992) have provided the most detailed map of the geomagnetic island effect for a tropical island, namely, Tahiti. In their map, which is reproduced in Figure 2F, P z is a scaled parameter representing the vertical Z component of the anomalous geomagnetic field that arises from the distortion of electric current flowing in the ocean around Tahiti. There was a strong correlation (r = 0.87; n= 1,635; P < 0.001) between the AQs of coconut palm populations on Tahiti weighted for population size and P z (Fig. 3 Figure 3. Open in new tabDownload slide A close correlation (r = 0.87) exists between the AQ of coconut palm populations around the circumference of Tahiti and P z, a scaled parameter representing the Z component of the anomalous geomagnetic field that arises from the distortion of electric current flowing in the ocean around Tahiti. Area of largest circle represents 256 trees. Figure 3. Open in new tabDownload slide A close correlation (r = 0.87) exists between the AQ of coconut palm populations around the circumference of Tahiti and P z, a scaled parameter representing the Z component of the anomalous geomagnetic field that arises from the distortion of electric current flowing in the ocean around Tahiti. Area of largest circle represents 256 trees. ). A consequence of the palm island effect is that the interpretation of about one-half of the locations in the Davis and Davis (1987) dataset, namely, all those designated as islands or island nations, is rendered ambiguous. Culling of the island data points from the Davis and Davis dataset (1987), which constituted nearly all of the southern hemisphere data and more than one-half the trees (n = 71,596 to n = 32,954), slightly improved, albeit insignificantly, the correlation coefficients between AQ and magnetic latitude (r = 0.62; P < 0.001 to r = 0.64; P < 0.005). In contrast, the respective correlations between AQ and geomagnetic (r = 0.57; P < 0.001 to r = 0.41; P = 0.097) and geographic latitude (r = 0.50; P < 0.002 to r = 0.18; P = 0.487) were rendered insignificant. This is further testament to the robustness of the correlation between FSD asymmetry and magnetic latitude. The frequencies of occurrence of many classes of geomagnetic variations change over the course of a sunspot cycle. Moreover, previous research by Sulima (1970) established a link between sunspot cycles and variations in the morphological asymmetry of cereal grains. Thus, it was of interest to determine whether asymmetry in coconut palm FSD also varies with the sunspot cycle. The age of coconut palms growing in nature, however, cannot be reliably estimated because palms, being monocots, do not produce annual growth rings. Thus, to examine the question of whether the AQs of palm cohorts vary with the sunspot cycle, it is necessary to examine data from research stations and plantations that have maintained records of the FSD and time of planting of each of their accessions. Davis (1963) published a suitable dataset concerning a population of coconut palms (n = 384 trees) growing in Kerala, India. Of these 384 trees, 375 fell into one of nine cohorts of 22 trees or more (planted at 5-year intervals from 1888–1928). There was a strong positive correlation between the AQs of the nine cohorts weighted for population size (r = 0.85; P < 0.001) and the total average monthly sunspot numbers 4 years prior to their respective years of planting (Fig. 4A Figure 4. Open in new tabDownload slide A, AQs of different-aged cohorts of coconut palms are closely correlated with the mean annual sunspot numbers 4 years before planting (r = 0.85). Area of largest circle represents 76 trees. B, Idealized version of the relationship between sunspot numbers (thick line) and AQ (thin line). Oscillations in the AQ are proposed to be coincident with oscillations in the frequency of recurrent geomagnetic storms. Figure 4. Open in new tabDownload slide A, AQs of different-aged cohorts of coconut palms are closely correlated with the mean annual sunspot numbers 4 years before planting (r = 0.85). Area of largest circle represents 76 trees. B, Idealized version of the relationship between sunspot numbers (thick line) and AQ (thin line). Oscillations in the AQ are proposed to be coincident with oscillations in the frequency of recurrent geomagnetic storms. ). Our analysis of Davis's (1963) data suggests that maximal AQ is achieved during the late descending phase of the sunspot cycle (Fig. 4B), a time in the solar cycle typically characterized by the highest frequency of recurrent geomagnetic storms (Pérez-Peraza et al., 1997). Geomagnetic storms have the largest amplitudes of any geomagnetic variation—typically more than 1,000 times larger than those of Pc1 pulsations. Natural experiments, such as those we have performed, have the inherent and well-recognized drawback that the researcher has no control over the situation being observed and, thus, there is always a possibility that some other factor is having an influence on the dependent variable. Clearly, the cause of the temporal and spatial variations in coconut palm FSD is not attributable to genetics, the hand of man, or the trade winds. Any role for the Coriolis force can also be ruled out because its strength at these dimensions would be below that of thermal noise, and any hemispheric asymmetry in FSD arising from the Coriolis force would be better correlated with geographic latitude than magnetic latitude. It is impossible to prove by natural experiments a role for geomagnetic variations in establishing asymmetries in coconut palm FSD, but by eliminating rival hypotheses, the induced current hypothesis gains in stature. The argument could be made that coconut palms are unusual in their apparent sensitivity to geomagnetic storms. It is possible that the saline soils in which they typically grow may be especially efficient conductors of earth currents. Moreover, coconut palms appear to be unusually sensitive to electromagnetic fields. Leaves growing within 30 to 60 cm of power lines typically exhibit chlorosis or necrosis at the leaf tip and can even die from this disorder. Leaves do not have to be in physical contact with the power lines for injury to occur (Broschat and Meerow, 2000). However, a recent report that geomagnetic storms affect mitosis in onion (Allium cepa) root tips (Nanush'yan and Murashev, 2003) suggests that sensitivity to geomagnetic storms is not limited solely to coconut palms. LITERATURE CITED Balcavage WX, Alvager T, Swez J, Goff CW, Fox MT, Abdullyava S, King MW ( 1996 ) A mechanism for action of extremely low frequency electromagnetic fields on biological systems. Biochem Biophys Res Commun 222 : 374 – 378 Crossref Search ADS PubMed Bandurski RS, Schulze A, Jensen P, Desrosiers M, Epel B, Kowalczyk S ( 1992 ) The mechanism by which an asymmetric distribution of plant growth hormone is attained. Adv Space Res 12 : 203 – 210 PubMed Bauréus Koch CLM, Sommarin M, Persson BRR, Salford LG, Eberhardt JL ( 2003 ) Interaction between weak low frequency magnetic fields and cell membranes. Bioelectromagnetics 24 : 395 – 402 Crossref Search ADS PubMed Belova NA, Lednev VV ( 2001 ) Effects of extremely weak alternating magnetic fields on plant gravitropism. Biofizika 46 : 122 – 125 PubMed Belyavskaya NA ( 2004 ) Biological effects due to weak magnetic fields on plants. Adv Space Res 34 : 1566 – 1574 Crossref Search ADS PubMed Broschat TK, Meerow AW ( 2000 ) Ornamental Palm Horticulture. University Press of Florida, Gainesville, FL Davis TA ( 1962 ) The non-inheritance of asymmetry in Cocos nucifera L. J Genet 58 : 42 – 50 Crossref Search ADS Davis TA ( 1963 ) The dependence of yield on asymmetry in coconut palms. J Genet 58 : 186 – 215 Crossref Search ADS Davis TA, Davis B ( 1987 ) Association of coconut foliar spirality with latitude. Math Model 8 : 730 – 733 Crossref Search ADS Elvers D, Perkins D ( 1964 ) Geomagnetic research on spatial dependence of time variations across Puerto Rico. Trans Am Geophys Union 45 : 46 Fraser-Smith AC ( 1978 ) ULF tree potentials and geomagnetic pulsations. Nature 271 : 641 – 642 Crossref Search ADS Galland P, Pazur A ( 2005 ) Magnetoreception in plants. J Plant Res 118 : 371 – 389 Crossref Search ADS PubMed Honkura Y ( 1972 ) Geomagnetic anomaly on Miyake-jima island. J Geomagn Geoelec 23 : 307 – 333 IPGRI ( 1995 ) Descriptors for Coconut (Cocos nucifera L.). International Plant Genetics Research Institute, Rome Klein DP ( 1972 ) Geomagnetic Time-Variations, The Island Effect and Electromagnetic Depth Sounding on Oceanic Islands: Results from the Analysis of Data Obtained in the Frequency Range of 0.5 to 10 Cycles per Hour on Oahu, Hawaii. Hawaii Institute of Physics Geophysics Publications, Oahu, HI, Publication 72–3 Louis HH, Chidambaram A ( 1976 ) Inheritance studies on the phyllotaxis of coconut palm. Ceylon Coconut Q 27 : 22 – 24 Mina MG, Goldsworthy A ( 1992 ) Electrical polarization of tobacco cells by Ca2+ ion channels. J Exp Bot 43 : 449 – 454 Crossref Search ADS Minorsky PV ( 1998 ) Latitudinal differences in coconut foliar spiral direction: a re-evaluation and hypothesis. Ann Bot (Lond) 82 : 133 – 140 Crossref Search ADS Minorsky PV ( 2001 ) News from the archives. Plant Physiol 126 : 928 – 929 Crossref Search ADS PubMed Morris DA ( 1980 ) The influence of small direct electric currents on the transport of auxin in intact plants. Planta 150 : 431 – 434 Crossref Search ADS PubMed Nanush'yan ER, Murashev VV ( 2003 ) Induction of multinuclear cells in the apical meristems of Allium cepa by geomagnetic outrages. Russ J Plant Physiol 50 : 522 – 526 Crossref Search ADS Palmer AR ( 2005 ) Asymmetry. In B Hallgrimmson, BK Hall, eds, Variation: A Central Concept in Biology, Academic Press, New York, pp 359–397 Pazur A, Rassadina V, Dandler J, Zoller J ( 2006 ) Growth of etiolated barley plants in weak static and 50 Hz electromagnetic fields tuned to calcium ion cyclotron resonance. BioMagn Res Tech 4 : 1 – 12 Crossref Search ADS Pérez-Peraza J, Leyva A, Libin IY, Fomichev V, Guschina RT, Yudakhin K, Jaani A ( 1997 ) Simulating the mechanism of the action of heliophysical parameters on atmospheric processes. Geofís Intl 36 : 245 – 280 Reinhardt D, Pesce ER, Stieger P, Mandel T, Baltensperger K, Bennett M, Traas J, Friml J, Kuhlemeier C ( 2003 ) Regulation of phyllotaxis by polar auxin transport. Nature 426 : 255 – 260 Crossref Search ADS PubMed Sasai Y ( 1967 ) Spatial dependence of short-period geomagnetic fluctuations on Oshima Island. Bull Earthquake Res Inst 45 : 137 – 157 Semenenko AD ( 1972 ) Electrophytogram of pulsation rhythm. Dokl Bot Sci 206 : 124 – 126 Sulima YG ( 1970 ) Biosimmetricheskie i Bioritmicheskie Iavleniia i Priznaki u Sel'skokhoziaistvennykh Rastenii. Akad. Nauk Moldavskoi SSR, Kishinev, Moldova Toar RE, Rompas TM, Sudasrip H ( 1979 ) The non-inheritance of the direction of foliar spiral in coconut. Experientia 35 : 1585 – 1587 Crossref Search ADS Volpe P ( 2003 ) Interaction of zero-frequency and oscillating magnetic fields with biostructures and biosystems. Photochem Photobiol Sci 2 : 637 – 648 Crossref Search ADS PubMed Yamaguchi S, Isezaki N, Yaskawa K ( 1992 ) Conductivity structure in the south-east Pacific inferred from the island effect on Tahiti island. J Geomagn Geoelec 44 : 43 – 54 Crossref Search ADS Author notes * Corresponding author; e-mail [email protected]; fax 914–674–7520. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Peter V. Minorsky ([email protected]). www.plantphysiol.org/cgi/doi/10.1104/pp.106.086835 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Matsubayashi, Yoshikatsu; Ogawa, Mari; Kihara, Hitomi; Niwa, Masaaki; Sakagami, Youji

doi: 10.1104/pp.106.081109pmid: 16829587

Abstract Phytosulfokine (PSK), a 5-amino acid sulfated peptide that has been identified in conditioned medium of plant cell cultures, promotes cellular growth in vitro via binding to the membrane-localized PSK receptor. Here, we report that loss-of-function and gain-of-function mutations of the Arabidopsis (Arabidopsis thaliana) PSK receptor gene (AtPSKR1) alter cellular longevity and potential for growth without interfering with basic morphogenesis of plants. Although mutant pskr1-1 plants exhibit morphologically normal growth until 3 weeks after germination, individual pskr1-1 cells gradually lose their potential to form calluses as tissues mature. Shortly after a pskr1-1 callus forms, it loses potential for growth, resulting in formation of a smaller callus than the wild type. Leaves of pskr1-1 plants exhibit premature senescence after bolting. Leaves of AtPSKR1ox plants exhibit greater longevity and significantly greater potential for callus formation than leaves of wild-type plants, irrespective of their age. Calluses derived from AtPSKR1ox plants maintain their potential for growth longer than wild-type calluses. Combined with our finding that PSK precursor genes are more strongly expressed in mature plant parts than in immature plant parts, the available evidence indicates that PSK signaling affects cellular longevity and potential for growth and thereby exerts a pleiotropic effect on cultured tissue in response to environmental hormonal conditions. Plants, due to their sessile nature, have developed a greater ability to adapt to dynamic environmental conditions than have animals. This plasticity allows plants to flexibly alter their developmental program and metabolism according to the environment. A particularly important adaptation of this type is the ability to form calluses from almost any plant tissue. However, studies suggest that a population of living cells is often required to support callus growth in vitro even if sufficient amounts of growth regulators and nutrients are supplied. This population dependence is alleviated by addition of conditioned medium in which cells have previously been grown, indicating that such cell-to-cell communication is mediated by chemical signal(s) produced by growing cells (Bellincampi and Morpurgo, 1987; Birnberg et al., 1988). Phytosulfokine (PSK), a 5-amino acid sulfated peptide that has been detected in conditioned medium of plant cell cultures, is the primary signal molecule responsible for this cell-to-cell communication (Matsubayashi and Sakagami, 1996). Addition of chemically synthesized PSK to culture medium, even at nanomolar concentrations, significantly increases the rate of callus growth even when the initial cell population is below the critical density. PSK also promotes in vitro tracheary element differentiation of mesophyll cells (Matsubayashi et al., 1999b), somatic embryogenesis (Kobayashi et al., 1999; Hanai et al., 2000; Igasaki et al., 2003), adventitious root formation (Yamakawa et al., 1998), and pollen germination (Chen et al., 2000). When PSK is applied to plant seedlings at high concentrations, it retards senescence under stress conditions (Yamakawa et al., 1999). PSK is produced from approximately 80-amino acid precursor peptides via posttranslational sulfation of Tyr residues and proteolytic processing (Yang et al., 1999, 2001). Genes encoding possible PSK precursors are redundantly distributed throughout the genome (Yang et al., 2001; Lorbiecke and Sauter, 2002) and are expressed in a variety of tissues in addition to calluses, including leaves and roots (Yang et al., 2001), suggesting that PSK plays a basic role in plant growth and development. The main difficulty in dissecting the in planta function of PSK is that PSK precursor genes are so small and redundant that the loss-of-function strategy is not applicable. PSK binds the membrane-localized PSK receptor PSKR1, which is a Leu-rich repeat receptor kinase (LRR-RK) that has been purified from solubilized carrot (Daucus carota) microsomes by ligand-based affinity chromatography (hereafter referred to as DcPSKR1; Matsubayashi et al., 2002). Expression of DcPSKR1 has been detected in the leaves, apical meristem, hypocotyl, and root of carrot seedlings, although much higher expression has been detected in cultured carrot cells. Transgenic carrot calluses overexpressing DcPSKR1 exhibit accelerated growth compared with control calluses. Studies revealing the in vitro function of PSK and the molecular basis of ligand-receptor interaction in PSK signaling have paved the way for research aimed at characterization of the in vivo role of PSK and its downstream signaling pathway in plants. The carrot PSK receptor, DcPSKR1, exhibits high-percentage amino acid identity with one LRR-RK found in the Arabidopsis (Arabidopsis thaliana) genome. Also, a database search has revealed the presence of five paralogous PSK precursor genes in the Arabidopsis genome. In this study, we analyzed the Arabidopsis PSK receptor gene using gain-of-function and loss-of-function strategies and found that PSK signaling in plants affects their potential for growth and cellular longevity. We also examined the expression patterns of all five paralogous PSK precursor genes in the Arabidopsis genome using promoter-β-glucuronidase (GUS) analysis. In this article, we discuss possible functions of PSK signaling. RESULTS Five Paralogous PSK Precursor Genes in Arabidopsis Upon analyzing the in planta role of PSK signaling, we first identified all the PSK precursor genes in Arabidopsis. In addition to two PSK precursor genes (At2g22860 and At3g49780) previously identified and confirmed to encode the functional PSK (Yang et al., 2001), we identified three paralogous genes (At1g13590, At3g44735, and At5g65870) encoding possible PSK precursors in an Arabidopsis genome database. Each predicted protein has a probable secretion signal at the N terminus and a single PSK sequence close to the C terminus. However, these proteins exhibit extreme diversity; e.g. only a small number of residues close to the C terminus are conserved (Fig. 1A Figure 1. Open in new tabDownload slide Five paralogous genes encoding PSK precursors in Arabidopsis. A, Sequence alignments of deduced amino acid sequences of AtPSKs. PSK domain is in the black box, and the predicted signal peptides are underlined. The residues conserved within all sequences are indicated by asterisks, and similar residues are indicated by dots. B, LC/MS analysis of culture medium derived from suspensions of transgenic cells expressing mutated AtPSKs designed to produce [Ser4]PSK. Data are plotted as a selected ion chromatogram for mass-to-charge ratio 831 corresponding to the [M-H]− ion of [Ser4]PSK. C, Northern-blot analysis of expression of AtPSKs in 3-week-old Arabidopsis plants and calluses. D, Comparison of expression of AtPSKs between upper young leaves and lower mature leaves of 3-week-old Arabidopsis plants. E, Wound-induced up-regulation of AtPSK4 transcripts. F, Histochemical GUS staining of 3-week-old transgenic Arabidopsis plants expressing pAtPSKs∷GUS fusions. G, Histochemical GUS staining of leaf discs derived from 3-week-old transgenic Arabidopsis plants expressing pAtPSK4∷GUS. H, Growth of AtPSK4ox seedlings. Seedlings were grown on B5 agar plate for 8 d. I, Growth of AtPSK4ox and wild-type calluses. All calluses were cultured on CIM for 4 weeks. Values are means ± sd of five calluses. Figure 1. Open in new tabDownload slide Five paralogous genes encoding PSK precursors in Arabidopsis. A, Sequence alignments of deduced amino acid sequences of AtPSKs. PSK domain is in the black box, and the predicted signal peptides are underlined. The residues conserved within all sequences are indicated by asterisks, and similar residues are indicated by dots. B, LC/MS analysis of culture medium derived from suspensions of transgenic cells expressing mutated AtPSKs designed to produce [Ser4]PSK. Data are plotted as a selected ion chromatogram for mass-to-charge ratio 831 corresponding to the [M-H]− ion of [Ser4]PSK. C, Northern-blot analysis of expression of AtPSKs in 3-week-old Arabidopsis plants and calluses. D, Comparison of expression of AtPSKs between upper young leaves and lower mature leaves of 3-week-old Arabidopsis plants. E, Wound-induced up-regulation of AtPSK4 transcripts. F, Histochemical GUS staining of 3-week-old transgenic Arabidopsis plants expressing pAtPSKs∷GUS fusions. G, Histochemical GUS staining of leaf discs derived from 3-week-old transgenic Arabidopsis plants expressing pAtPSK4∷GUS. H, Growth of AtPSK4ox seedlings. Seedlings were grown on B5 agar plate for 8 d. I, Growth of AtPSK4ox and wild-type calluses. All calluses were cultured on CIM for 4 weeks. Values are means ± sd of five calluses. ). Functional expression of these novel three genes was confirmed by site-directed mutagenesis experiments in which Arabidopsis suspension cells were transformed with mutated cDNA designed to produce [Ser4]PSK. In LC/MS analysis of culture medium derived from suspensions of transgenic cells, we detected sulfated form of 5-amino acid [Ser4]PSK in addition to endogenous wild-type PSK (Fig. 1B). We therefore renamed these five PSK precursor genes as follows: AtPSK1 (At1g13590), AtPSK2 (At2g22860), AtPSK3 (At3g44735), AtPSK4 (At3g49780, formerly named AtPSK3), and AtPSK5 (At5g65870). Expression Patterns of PSK Precursor Genes in Arabidopsis Northern blotting revealed that AtPSKs are expressed in a variety of tissues including roots, leaves, stems, flowers, siliques, and calluses, with the exception of AtPSK1, which was only expressed in roots (Fig. 1C). AtPSK2, AtPSK4, and AtPSK5 were more strongly expressed in lower mature leaves than in upper young leaves (Fig. 1D), suggesting that the main in planta role of PSK is in plant homeostasis rather than morphogenesis. In addition, expression of AtPSK4 is highly up-regulated upon mechanical wounding (Fig. 1E). To further analyze expression patterns of AtPSKs, we generated transgenic Arabidopsis plants harboring AtPSK promoter-GUS reporter gene constructs. Among the above-ground plant parts assayed, the constructs pAtPSK2∷GUS, pAtPSK3∷GUS, pAtPSK4∷GUS, and pAtPSK5∷GUS were widely expressed in cotyledons and leaves and were most abundantly expressed in vascular bundles (Fig. 1F). In roots, pAtPSK3∷GUS was primarily expressed in root tips, whereas expression of pAtPSK2∷GUS, pAtPSK4∷GUS, and pAtPSK5∷GUS was mainly detected in the more mature regions of the root. Within 12 h after leaf discs were cut, expression of AtPSK4 had greatly increased at their outer edges, indicating that the AtPSK4 promoter is activated by wounding (Fig. 1G). Overexpression of PSK Precursor Gene We generated transgenic Arabidopsis plants that overexpressed AtPSK4, the most prominently expressed PSK precursor gene throughout the Arabidopsis tissues, under the control of the 35S promoter, and named these plants AtPSK4ox. AtPSK4ox plants germinated normally and developed normal cotyledons and hypocotyls phenotypically indistinguishable from wild type. Growth of AtPSK4ox seedlings, especially root growth, was somewhat faster than wild-type growth (Fig. 1H). However, the overall growth of above-ground parts of AtPSK4ox plants was indistinguishable from that of wild type (data not shown). Growth of AtPSK4ox calluses derived from the leaves of 3-week-old plants was somewhat faster than growth of wild-type calluses (Fig. 1I). Identification of PSK Receptor in Arabidopsis To analyze PSK signaling in Arabidopsis, we searched for the Arabidopsis PSK receptor, based on overall amino acid similarity to DcPSKR1, and determined that At2g02220 is most likely an ortholog of DcPSKR1. At2g02220 encodes a 1,008-amino acid LRR-RK that has 60% amino acid sequence identity to DcPSKR1 and contains 21 tandem copies of LRR, a 36-amino acid island domain between the 17th and 18th LRR, a single transmembrane domain, and a cytoplasmic kinase domain (Fig. 2A Figure 2. Open in new tabDownload slide PSK binds At2g02220 receptor kinase (AtPSKR1). A, Schematic of At2g02220 protein. The diagram shows the signal peptide (SP), extracellular LRRs, a 36-amino acid island domain, a transmembrane domain (TM), and a cytoplasmic Ser/Thr kinase domain. B, Sequence alignments of the island domain of At2g02220 and DcPSKR1. The residues conserved within both sequences are indicated by asterisks, and similar residues are indicated by dots. C, A phylogenetic tree of Arabidopsis LRR X subfamily and DcPSKR1. Amino acid sequences of the kinase domain were aligned with ClustalW, and the graphical output was produced by TreeView. D, Immunoblot analysis of proteins in microsomal fractions of Arabidopsis callus cells overexpressing At2g02220 under control of constitutive 35S promoter (OX1, middle lane), or overexpressing At2g02220 under control of its own promoter by increasing copy number (OX2, right lane). E, Scatchard plot of the specific [3H]PSK binding data for microsomal fractions of Arabidopsis cells overexpressing At2g02220 under control of its own promoter by increasing copy number (OX2). F, [3H]PSK binding to microsomal fractions of OX2 cells in the presence or absence of 100-fold unlabeled PSK analogs. G, Expression patterns of AtPSKR1 in 3-week-old Arabidopsis plants. H, Histochemical GUS staining of 3-week-old transgenic Arabidopsis plants expressing pAtPSKR1∷GUS fusions. Figure 2. Open in new tabDownload slide PSK binds At2g02220 receptor kinase (AtPSKR1). A, Schematic of At2g02220 protein. The diagram shows the signal peptide (SP), extracellular LRRs, a 36-amino acid island domain, a transmembrane domain (TM), and a cytoplasmic Ser/Thr kinase domain. B, Sequence alignments of the island domain of At2g02220 and DcPSKR1. The residues conserved within both sequences are indicated by asterisks, and similar residues are indicated by dots. C, A phylogenetic tree of Arabidopsis LRR X subfamily and DcPSKR1. Amino acid sequences of the kinase domain were aligned with ClustalW, and the graphical output was produced by TreeView. D, Immunoblot analysis of proteins in microsomal fractions of Arabidopsis callus cells overexpressing At2g02220 under control of constitutive 35S promoter (OX1, middle lane), or overexpressing At2g02220 under control of its own promoter by increasing copy number (OX2, right lane). E, Scatchard plot of the specific [3H]PSK binding data for microsomal fractions of Arabidopsis cells overexpressing At2g02220 under control of its own promoter by increasing copy number (OX2). F, [3H]PSK binding to microsomal fractions of OX2 cells in the presence or absence of 100-fold unlabeled PSK analogs. G, Expression patterns of AtPSKR1 in 3-week-old Arabidopsis plants. H, Histochemical GUS staining of 3-week-old transgenic Arabidopsis plants expressing pAtPSKR1∷GUS fusions. ). Amino acid sequences in the island domain are highly conserved between DcPSKR1 and At2g02220 (Fig. 2B). An island domain has also been found among the extracellular LRRs of the brassinosteroid receptor BRI1 and has been shown to be involved in ligand binding (Kinoshita et al., 2005). At2g02220 belongs to the LRR X subfamily (Shiu and Bleecker, 2001), which contains BRI1, BRL1, BRL2, BRL3 (Cano-Delgado et al., 2004; Zhou et al., 2004), and EXCESS MICROSPOROCYTES1/EXTRA SPOROGENOUS CELLS required for the specialization of tapetal cells (Canales et al., 2002; Zhao et al., 2002; Fig. 2C). To determine whether At2g02220 protein specifically interacts with PSK, we first overexpressed At2g02220 in Arabidopsis plants under the control of a constitutive 35S promoter and established suspension cell lines derived from these transgenic plants by inducing callus formation from leaf discs (overexpressor [OX1] cell line). We observed some increase in [3H]PSK binding activity in the membrane fractions of the transgenic calluses, but neither the transgenic plants nor the transgenic calluses exhibited specific phenotypes (data not shown). In western blotting of microsomal fractions from cells using an anti-At2g02220 antibody, two distinct bands were recognized by the antibody: a 120-kD protein and a 150-kD protein. Compared to wild-type cells, the expression level of the 120-kD protein was increased in the transgenic cells, but the expression level of the 150-kD protein was unchanged, possibly due to posttranslational regulation (Fig. 2D). We next overexpressed At2g02220 in Arabidopsis plants by increasing its copy number and established suspension cell lines derived from these plants by inducing callus formation from leaf discs (OX2 cell line). We observed a significant increase in [3H]PSK binding activity in the membrane fractions of the OX2 transgenic cells (Fig. 2E). Scatchard analysis of the binding data indicated that [3H]PSK binds At2g02220 with a dissociation constant (K d) of 7.7 ± 0.9 nm, which is similar to the K d of DcPSKR1 (Matsubayashi et al., 2002). Western blotting of microsomal fractions from OX2 transgenic cells using an anti-At2g02220 antibody revealed significant increases in levels of both the 120- and 150-kD species (Fig. 2D). We also confirmed the specificity of binding between [3H]PSK and At2g02220 by comparing relative binding affinity among several PSK analogs in competition binding assays (Fig. 2F). Binding of [3H]PSK to the membrane fraction of OX2 transgenic cells was strongly inhibited by unlabeled PSK, less strongly inhibited by the less active analog [1-4]PSK, and not inhibited at all by the inactive analog [2-5]PSK. Such high affinity and specificity for PSK strongly suggest that At2g02220 is a functional Arabidopsis PSK receptor (referred to here as AtPSKR1). This transgenic Arabidopsis plant exhibited specific phenotypes of plant growth and callus proliferation (discussed below). Northern blotting and promoter analysis showed that AtPSKR1 is weakly but widely expressed in roots, leaves, stems, and flowers of 3-week-old Arabidopsis plants as well as calluses (Fig. 2, G and H). Identification of Loss-of-Function Mutant of AtPSKR1 To examine the physiological function of AtPSKR1, we performed a database search for loss-of-function AtPSKR1 mutants and found a Ds insertion mutant (hereafter referred to as pskr1-1) at the AtPSKR1 locus in transposon-tagging lines released by the Institute of Molecular Agrobiology, the National University of Singapore (Fig. 3A Figure 3. Open in new tabDownload slide Phenotypes of pskr1-1 and AtPSKR1ox. A, Schematic map of the Ds insertion site of pskr1-1. B, Response of wild-type (WT) and pskr1-1 calluses to PSK. Hypocotyls of 7-d-old seedlings were cut into segments about 1 cm long, which were cultured in CIM for 10 d in the presence or absence of 30 nm PSK. C, Absence of AtPSKR1 protein in membrane fractions derived from pskr1-1 calluses. D, Absence of PSK binding activity in membrane fractions derived from pskr1-1 calluses. E, Growth of pskr1-1, AtPSKR1ox, and wild-type seedlings. Seedlings were grown on B5 agar plate for 10 d. F, Callus formation from leaf discs of pskr1-1, AtPSKR1ox, and wild-type plants. Leaf discs used for callus induction were cut from leaves a, b, c, and d of the 3-week-old plants, shown in the leftmost sections. All leaf discs were incubated on CIM for 2 weeks. G, Complementation of pskr1-1 homozygous plants with a wild-type 6.5-kb EcoRV/BlnI genomic fragment of AtPSKR1 or pAtPSKR1∷DcPSKR1 construct restored their callus-forming potential. H, Growth of pskr1-1, AtPSKR1ox, and wild-type calluses. All calluses were cultured on CIM for 6 weeks. Values are means ± sd of five calluses. Expression of SEN1 is indicative of senescence. Figure 3. Open in new tabDownload slide Phenotypes of pskr1-1 and AtPSKR1ox. A, Schematic map of the Ds insertion site of pskr1-1. B, Response of wild-type (WT) and pskr1-1 calluses to PSK. Hypocotyls of 7-d-old seedlings were cut into segments about 1 cm long, which were cultured in CIM for 10 d in the presence or absence of 30 nm PSK. C, Absence of AtPSKR1 protein in membrane fractions derived from pskr1-1 calluses. D, Absence of PSK binding activity in membrane fractions derived from pskr1-1 calluses. E, Growth of pskr1-1, AtPSKR1ox, and wild-type seedlings. Seedlings were grown on B5 agar plate for 10 d. F, Callus formation from leaf discs of pskr1-1, AtPSKR1ox, and wild-type plants. Leaf discs used for callus induction were cut from leaves a, b, c, and d of the 3-week-old plants, shown in the leftmost sections. All leaf discs were incubated on CIM for 2 weeks. G, Complementation of pskr1-1 homozygous plants with a wild-type 6.5-kb EcoRV/BlnI genomic fragment of AtPSKR1 or pAtPSKR1∷DcPSKR1 construct restored their callus-forming potential. H, Growth of pskr1-1, AtPSKR1ox, and wild-type calluses. All calluses were cultured on CIM for 6 weeks. Values are means ± sd of five calluses. Expression of SEN1 is indicative of senescence. ; Parinov et al., 1999). Sequencing of the Ds insertion region revealed that Ds was inserted into a site 1,303 bp downstream from the initiation codon, corresponding to the 15th LRR of the extracellular domain. Treatment of pskr1-1 hypocotyl segments with auxin/cytokinin resulted in development of apparently normal calluses. Growth of wild-type calluses was significantly promoted by 10 nm PSK, whereas pskr1-1 calluses were less sensitive to PSK (Fig. 3B). In membrane fractions derived from pskr1-1 calluses, no AtPSKR1 protein was detected (Fig. 3C), and specific [3H]PSK binding activity was significantly decreased (Fig. 3D). Phenotypes of Loss-of-Function and Gain-of-Function Mutants of AtPSKR1 We compared the phenotypes of the AtPSKR1 knockout (pskr1-1) and the AtPSKR1 OX2 line (hereafter referred to as AtPSKR1ox) with the wild-type phenotype. AtPSKR1ox and pskr1-1 seedlings grown on B5 agar plate germinated normally and developed normal cotyledons and hypocotyls phenotypically indistinguishable from wild type. Root growth of pskr1-1 seedlings was slightly reduced, whereas root growth of AtPSKR1ox was comparable to that of wild type (Fig. 3E). In the first 3 weeks of culture on B5 agar, there were no morphological differences in overall growth of above-ground plant parts between pskr1-1, AtPSKR1ox, and wild type (Fig. 3F, leftmost section). The most striking phenotype of the pskr1-1 plants was that individual cells gradually lost their potential to form calluses as the tissues matured (Fig. 3F, bottom). Leaf discs from the fully expanded leaves of pskr1-1 plants exhibited severe defects in hormone-induced callus formation. Young immature pskr1-1 leaves close to the meristem retained full callus-forming potential. Leaf discs of wild-type plants exhibited high potential for callus formation irrespective of the age of the leaves. Complementation of homozygous pskr1-1 plants with a wild-type 6.5-kb EcoRV/BlnI genomic fragment of AtPSKR1 restored their callus-forming potential, confirming that the phenotypes of homozygous pskr1-1 plants were caused by the disruption of AtPSKR1 (Fig. 3G, top). The pskr1-1 mutant can also be functionally complemented by expressing the cDNA of the carrot DcPSKR1 gene under the control of the Arabidopsis AtPSKR1 promoter, suggesting that AtPSKR1 and DcPSKR1 function in the same pathway (Fig. 3G, bottom). In contrast, leaf discs of AtPSKR1ox plants exhibited a significantly greater callus-forming potential than wild type, irrespective of the age of the leaves (Fig. 3F, top). There were also significant differences in relative growth rate of calluses between pskr1-1, AtPSKR1ox, and wild type. The pskr1-1 calluses exhibited premature senescence with browning within 3 weeks of culture, resulting in formation of a smaller callus than the wild type after 6 weeks (Fig. 3H, left). The senescence marker SEN1 transcript (Oh et al., 1996) was significantly increased in pskr1-1 calluses (Fig. 3H, bottom right). Wild-type calluses did not exhibit senescence in the first 3 weeks of culture but gradually senesced thereafter. In contrast, AtPSKR1ox calluses vigorously proliferated and did not exhibit symptoms of senescence, even after 6 weeks of culture. At 6 weeks of culture, AtPSKR1ox calluses were almost twice as large as wild-type calluses (Fig. 3H, top right). The pskr1-1 seedlings grew at almost the same rate as wild-type seedlings, flowered normally, and completed the normal life cycle, but their leaves exhibited premature senescence phenotypes 4 weeks after germination (Fig. 4A Figure 4. Open in new tabDownload slide Phenotypes of pskr1-1 and AtPSKR1ox plants after bolting. A, Plants grown on rockwool for 4 weeks. B, Leaves of plants grown on rockwool for 6 weeks. C, Comparison of leaf size measured as the length of the longest axis on the fully expanded leaves (seventh to eighth leaves) of 4-week-old plants. D, Chlorophyll content of the leaves (third to eighth leaves) of 6-week-old plants. Figure 4. Open in new tabDownload slide Phenotypes of pskr1-1 and AtPSKR1ox plants after bolting. A, Plants grown on rockwool for 4 weeks. B, Leaves of plants grown on rockwool for 6 weeks. C, Comparison of leaf size measured as the length of the longest axis on the fully expanded leaves (seventh to eighth leaves) of 4-week-old plants. D, Chlorophyll content of the leaves (third to eighth leaves) of 6-week-old plants. ). All the leaves of pskr1-1 plants were senesced 6 weeks after germination (Fig. 4, B and D). The AtPSKR1ox seedlings also grew at almost the same rate as wild-type seedlings and completed the normal life cycle, but they developed larger leaves than the wild type (Fig. 4C) and exhibited delayed senescence (Fig. 4, B and D). This enlargement of leaves was due to an increase in cell number but not an increase in cell size (data not shown). Expression patterns of AtPSKs are consistent with the greater severity of pskr1-1 phenotypes in the lower mature leaves where AtPSKs are more strongly expressed. All these results strongly suggest that PSK signaling in plants affects their potential for growth and cellular longevity. DISCUSSION Our findings indicate that the At2g02220 gene encodes a functional PSK receptor (AtPSKR1) in Arabidopsis. AtPSKR1 is a member of the LRR-RK family and is characterized by 21 tandem copies of extracellular LRR, a 36-amino acid island domain between the 17th and 18th LRR, a single transmembrane domain, and a cytoplasmic kinase domain. AtPSKR1 interacts with [3H]PSK with a K d of 7.7 ± 0.9 nm, which is similar to the K d of DcPSKR1 (4.2 ± 0.4 nm). PSK receptors are often detected on SDS-PAGE as two distinct bands with different molecular size (Matsubayashi and Sakagami, 2000; Matsubayashi et al., 2002). In this study, when AtPSKR1 was overexpressed under the control of the 35S promoter, we detected an increase in levels of the 120-kD protein but not of the 150-kD protein. In contrast, when AtPSKR1 was overexpressed by increasing its copy number, we detected significant increase in levels of both the 120- and 150-kD proteins. Although previous photoaffinity label experiments have revealed high-affinity interaction between PSK and both the 120- and 150-kD proteins (Matsubayashi and Sakagami, 2000), this analysis indicates that phenotypic alteration occurs only when the 150-kD protein is overexpressed in Arabidopsis. This finding suggests that the 150-kD protein is the functional PSK receptor, which can activate intercellular signaling upon PSK binding, and that the 120-kD protein is a partially truncated dysfunctional form of AtPSKR1. Expression of exceptionally high levels of AtPSKR1 mRNA and/or the corresponding membrane receptor protein may trigger a regulatory system by which the relative amount of functional receptor is maintained at a constant level. It has been reported that protein expression levels of LRR-RKs do not always correlate with their mRNA levels, due to posttranslational or posttranscriptional regulation (Jeong et al., 1999). In this study, although seedlings of pskr1-1 exhibited normal growth and developed rosette leaves phenotypically indistinguishable from wild type for the first 3 weeks after germination, individual pskr1-1 cells gradually lost their potential to form calluses as tissues matured. The pskr1-1 calluses derived from immature tissues also exhibited premature senescence accompanied by browning within 3 weeks of culture, resulting in formation of a smaller callus than the wild type. Premature senescence phenotypes were also observed in leaves of pskr1-1 plants at the late bolting stage. In contrast, AtPSKR1ox calluses vigorously proliferated and did not exhibit symptoms of senescence even after 6 weeks of culture, resulting in formation of calluses almost twice the size of wild type. AtPSKR1ox plants exhibited delayed senescence, and its leaves underwent prolonged expanding growth, resulting in formation of bigger leaves than the wild type. This enlarged leaf phenotype was not obvious until the bolting stage, suggesting that it is due to continuous proliferation rather than accelerated cell division. These results strongly suggest that PSK represents a new class of hormones that affect the potential for cellular growth and longevity of individual cells but are not simple mitogens or differentiation factors. Overactivation or disruption of PSK signaling did not interfere with meristem organization or subsequent plant morphogenesis, except for the changes in cellular longevity and slight differences in root and leaf growth, which is consistent with our previous observation that treatment of dispersed mesophyll cells with PSK peptide alone does not directly induce any morphological changes (Matsubayashi et al., 1999a). We speculate that PSK reactivates (or maintains) the cellular potential to proliferate and differentiate in response to endogenous or external stimuli, which gradually decreases during cellular aging, and thereby exerts a pleiotropic effect on cultured tissue in response to environmental hormonal conditions. Our biochemical experiments confirm that Arabidopsis has five paralogous genes encoding PSK precursors (AtPSKs) that are functionally secreted after posttranslational sulfation and processing. Multiple alignment of the deduced amino acid sequences revealed that, in addition to the 5-amino acid PSK domain, certain residues between amino acid positions −25 and −1 are highly conserved among the PSK precursor peptides, including multiple acidic residues, one Cys pair, several hydrophobic residues, consecutive basic residues, and one His residue. We speculate that some of these residues synergistically determine Tyr sulfation efficiency and others are involved in proteolytic processing. Expression of AtPSKs was detected in almost all plant tissues, including fully developed mature leaves. In addition, AtPSK2, AtPSK4, and AtPSK5 were more strongly expressed in the lower mature leaves than in upper young leaves. These expression patterns are consistent with our conclusion that PSK regulates potential for cellular growth and longevity of individual cells rather than directly inducing cell division or differentiation. One of the PSK precursor genes is also highly up-regulated upon wounding, suggesting that PSK is involved in wound response signaling. In contrast to the relatively obvious phenotypes of AtPSKR1ox plants, the only phenotypic alterations that we observed in Arabidopsis plants overexpressing PSK precursor gene were a slight increase in root growth at the seedling stage and a slight increase in callus proliferation in vitro. One possibility is that basal expression of endogenous AtPSKs is at a sufficiently high level to activate PSK signaling, and exogenous transgene-encoded PSK therefore does not cause any additional effects. Indeed, PSK shows a dose-response curve that reaches a plateau at PSK levels of around 10 nm (Matsubayashi and Sakagami, 1996). Another possibility is that posttranslational modification such as Tyr sulfation and processing acts as a rate-limiting step for production of mature 5-amino acid PSK peptide. How might PSK activate the potential for cellular growth and longevity of individual cells? One may speculate that PSK modulates sensitivity to endogenous plant hormones such as auxin and cytokinin, thereby indirectly causing growth alteration. However, that hypothesis is not consistent with our finding that pskr1-1 hypocotyls can respond to auxin/cytokinin and form calluses at normal auxin/cytokinin concentrations. Moreover, in the root elongation assay, pskr1-1 seedlings exhibited the same cytokinin response as wild-type seedlings (data not shown). In animals, there is much evidence indicating that cellular growth and longevity are tightly coupled to protein translation and protein turnover via TOR (target of rapamycin) protein kinase, which is an integrator molecule of nutrient availability, growth factors, and the energy status of the cells (Martin and Hall, 2005). Several recent studies of plants suggest that regulation of protein synthesis and turnover is an important determinant of cellular proliferation and senescence (Doelling et al., 2002; Hanaoka et al., 2002; Thompson et al., 2004). This possibility is indirectly supported by the finding that cellular response to PSK is affected by the nutrient status of the medium (Matsubayashi and Sakagami, 1998). The presence of ammonium ion, a ready nitrogen source, disturbs PSK-dependent promotion of cellular proliferation of dispersed asparagus (Asparagus officinalis) mesophyll cells. In contrast to the relatively clear understanding of the mechanism of maintenance of cellular homeostasis in the shoot apical meristem of plants, little is known about the molecular basis for the cellular plasticity that allows plants to flexibly alter their developmental program according to the environment. We are currently researching the downstream target of PSK signaling, using AtPSKR1ox and pskr1-1 plants. MATERIALS AND METHODS Plant Material and Growth Conditions The Arabidopsis (Arabidopsis thaliana, Landsberg erecta [Ler]) plants were grown at 22°C under continuous light, on rockwool or on B5 medium containing 1.0% Suc solidified with 0.7% agar. For callus induction, leaf discs or hypocotyl segments were excised from donor plants grown on B5 agar plate and were cultured on callus induction medium (CIM) containing B5 medium with 0.5 mg/L 2,4-dichlorophenoxyacetic acid, 0.1 mg/L kinetin, 20 g/L Glc, 0.5 g/L MES, and 2.5 g/L gellan gum, at 22°C under continuous light. Arabidopsis (Columbia) T87 cells were maintained in B5 medium containing 1.0 μ m naphthylacetic acid and 1.5% Suc by gentle agitation at 120 rpm under continuous light at 22°C. The loss-of-function mutant of AtPSKR1 (SGT5281) was found in the searchable database of Ds insertion sequences (Ler background) released by the Institute of Molecular Agrobiology, the National University of Singapore (Parinov et al., 1999). The DNA sequence flanking the left and right border of the Ds mutation was confirmed by PCR. Leaf size was measured as the length of the longest axis on the fully expanded leaves (seventh to eighth leaves) of 4-week-old plants. Chlorophyll content of leaves (third to eighth leaves) of 6-week-old plants was determined using dimethylformamide as the extraction (Moran, 1982). Plasmid Constructs and Plant Transformation cDNA clones coding for AtPSKs were obtained by RT-PCR from total RNA of Arabidopsis plants. Site-directed mutagenesis of AtPSK1, AtPSK3, and AtPSK5 cDNA was performed by PCR using the overlap extension technique. The resulting cDNAs were ligated into the binary vector pBI121 by replacing the GUS coding sequence downstream of the cauliflower mosaic virus (CaMV) 35S promoter. Arabidopsis T87 suspension cells were coincubated with Agrobacterium tumefaciens (C58C1) harboring these constructs for 2 d and further incubated on CIM plate containing 50 mg/L kanamycin and 200 mg/L carbenicillin for 4 weeks. The selected calluses were then transferred to suspension culture. The AtPSKR1 (At2g02220) full-length cDNA was obtained from the RIKEN BioResource Center (Tsukuba, Japan; Seki et al., 1998, 2002). For the overexpression of AtPSKR1 under the control of the CaMV 35S promoter, a 3.1-kb entire coding sequence of the AtPSKR1 cDNA was amplified by PCR and cloned in the binary vector pBI121 by replacing the GUS coding sequence downstream of the CaMV 35S promoter with the AtPSKR1 fragment. For the expression of AtPSKR1 under its own promoter, a 9.4-kb genomic fragment containing the AtPSKR1 gene was cloned from an Arabidopsis Ler genomic DNA library. Then, an EcoRV/BlnI fragment (6.2 kb) containing the complete AtPSKR1 gene and 2 kb of the 5′ upstream region was cloned in the binary vector pBI101-Hm (kindly provided by Dr. K. Nakamura, Nagoya University, Nagoya, Japan), which is a derivative of pBI101 and carries the hygromycin phosphotransferase gene in addition to the neomycin phosphotransferase gene as a selective marker gene. For the expression of DcPSKR1 under the control of the AtPSKR1 promoter, a 3.1-kb entire coding sequence of the DcPSKR1 cDNA and 2.0 kb of the 5′ upstream region of AtPSKR1 were amplified by PCR and cloned in the binary vector pBI101-Hm. For the overexpression of AtPSK4 under the control of the CaMV 35S promoter, a 0.3-kb entire coding sequence of the AtPSK4 cDNA was amplified by PCR and cloned in the binary vector pBI121 by replacing the GUS coding sequence downstream of the CaMV 35S promoter with the AtPSK4 fragment. Arabidopsis (Ler) was transformed with these constructs via Agrobacterium (C58C1) using the floral dip method (Clough and Bent, 1998). To study expression patterns of AtPSKR1, AtPSK2, AtPSK3, AtPSK4, and AtPSK5 in detail, we amplified the upstream 2.0-kb promoter regions of AtPSKR1 or the other AtPSKs by genomic PCR and cloned them by translational fusion in frame with the GUS coding sequence in the binary vector pBI101. Histochemical analysis of GUS gene expression in the transformed plants was performed as described elsewhere (Kosugi et al., 1990). LC/MS Analysis of [Ser4]PSK Culture medium (20 mL) derived from suspensions of transgenic T-87 cells expressing mutated AtPSKs were loaded onto a DEAE Sephadex A-25 column (5.0 × 30 mm, packed in an Econo-column [Bio-Rad]) equilibrated with 20 mm Tris-HCl, pH 7.5. The column was washed with 3.0 mL of the same buffer containing 500 mm KCl, and PSKs were eluted with 1.0 mL of the same buffer containing 2,000 mm KCl. Eluate from the DEAE Sephadex A-25 column was acidified by adding formic acid at a final concentration of 1.0%. LC/MS analysis was performed using a JASCO semimicro HPLC pump system (model PU-2085) equipped with a column switching-valve unit (model HV-2080-01). Sample (200 μL) was loaded to the first reverse-phase column (Develosil ODS-HG-5 column, 2.0 × 50 mm) using 5% acetonitrile (containing 0.1% formic acid) with a flow rate of 200 μL/min. After this cleanup and enrichment step (5.0 min), the first column was connected to the second reverse-phase analytical column (Develosil ODS-HG-5 column, 2.0 × 150 mm) in back-flush mode by means of the time-controlled switching valve, and eluted with a gradient of 5%/20%/20% acetonitrile (containing 0.1% formic acid) in 0/15/20 min at a flow rate of 200 μL/min. The HPLC eluate was introduced into an electrospray ionization ion-trap mass spectrometer (LCQ Deca XP-plus, Thermo Electron) via an electrospray ionization interface at a spray voltage of 5.0 kV. The mass spectrometer was operated in negative ion mode with a capillary temperature of 220°C, a capillary voltage of −38 V, and the tube lens offset at 30 V. The mass spectra were obtained by scanning the mass range from mass-to-charge ratio 700 to 900. Anti-AtPSKR1 Antibodies An N-terminal 100-amino acid region of AtPSKR1 (excluding the signal peptide) was expressed in Escherichia coli using the pET-24b expression vector and purified as a His6 fusion. This recombinant protein was used as the antigen to generate the antibodies in rabbits and was used for affinity purification of the antibodies using Hi-Trap NHS activated Sepharose. [3H]PSK Binding Assays Tritium-labeled PSK was prepared by tritium reduction of a PSK analog containing tetradehydro-Ile (Matsubayashi and Sakagami, 1999). The specific radioactivity of [3H]PSK was estimated to be 67 Ci/mmol. Nonlabeled PSK was prepared as described elsewhere (Matsubayashi et al., 1996). Plant microsomal fractions were prepared from Arabidopsis callus cells using a protocol described elsewhere (Matsubayashi and Sakagami, 1999). Membrane pellets were resuspended in binding buffer (20 mm HEPES-KOH, pH 7.5, 100 mm Suc) and stored at −80°C until use. Each binding assay mixture contained 500 μg of membrane proteins and 0.6 to 62.5 nm [3H]PSK with or without 32 μ m unlabeled PSK, in a total volume of 250 μL. The binding reactions were performed by incubating the mixture for 30 min on ice. The bound and free [3H]PSK were separated by layering the reaction mixture onto 900 μL of wash buffer (20 mm HEPES-KOH, pH 7.5, 500 mm Suc) and centrifuging for 10 min at 100,000g at 4°C. The radioactivity in each pellet was measured using a liquid-scintillation counter at approximately 40% counting efficiency. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession numbers NM_126282 (AtPSKR1), NM_101229 (AtPSK1), NM_127851 (AtPSK2), NM_114342 (AtPSK3), NM_114838 (AtPSK4), and NM_125984 (AtPSK5). ACKNOWLEDGMENTS We thank the Institute of Molecular Agrobiology, the National University of Singapore, for providing the seeds of the Ds mutant line, and RIKEN BioResource Center for providing the AtPSKR1 full-length cDNA. LITERATURE CITED Bellincampi D, Morpurgo G ( 1987 ) Conditioning factor affecting growth in plant cells in culture. Plant Sci 51 : 83 – 91 Crossref Search ADS Birnberg PR, Somers DA, Brenner ML ( 1988 ) Characterization of conditioning factors that increase colony formation from Black Mexican sweet corn protoplasts. J Plant Physiol 132 : 316 – 321 Crossref Search ADS Canales C, Bhatt AM, Scott R, Dickinson H ( 2002 ) EXS, a putative LRR receptor kinase, regulates male germline cell number and tapetal identity and promotes seed development in Arabidopsis. Curr Biol 12 : 1718 – 1727 Crossref Search ADS PubMed Cano-Delgado A, Yin Y, Yu C, Vafeados D, Mora-Garcia S, Cheng JC, Nam KH, Li J, Chory J ( 2004 ) BRL1 and BRL3 are novel brassinosteroid receptors that function in vascular differentiation in Arabidopsis. Development 131 : 5341 – 5351 Crossref Search ADS PubMed Chen YF, Matsubayashi Y, Sakagami Y ( 2000 ) Peptide growth factor phytosulfokine-α contributes to the pollen population effect. Planta 211 : 752 – 755 Crossref Search ADS PubMed Clough SJ, Bent AF ( 1998 ) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16 : 735 – 743 Crossref Search ADS PubMed Doelling JH, Walker JM, Friedman EM, Thompson AR, Vierstra RD ( 2002 ) The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. J Biol Chem 277 : 33105 – 33114 Crossref Search ADS PubMed Hanai H, Matsuno T, Yamamoto M, Matsubayashi Y, Kobayashi T, Kamada H, Sakagami Y ( 2000 ) A secreted peptide growth factor, phytosulfokine, acting as a stimulatory factor of carrot somatic embryo formation. Plant Cell Physiol 41 : 27 – 32 Crossref Search ADS PubMed Hanaoka H, Noda T, Shirano Y, Kato T, Hayashi H, Shibata D, Tabata S, Ohsumi Y ( 2002 ) Leaf senescence and starvation-induced chlorosis are accelerated by the disruption of an Arabidopsis autophagy gene. Plant Physiol 129 : 1181 – 1193 Crossref Search ADS PubMed Igasaki T, Akashi N, Ujino-Ihara T, Matsubayashi Y, Sakagami Y, Shinohara K ( 2003 ) Phytosulfokine stimulates somatic embryogenesis in Cryptomeria japonica. Plant Cell Physiol 44 : 1412 – 1416 Crossref Search ADS PubMed Jeong S, Trotochaud AE, Clark SE ( 1999 ) The Arabidopsis CLAVATA2 gene encodes a receptor-like protein required for the stability of the CLAVATA1 receptor-like kinase. Plant Cell 11 : 1925 – 1934 Crossref Search ADS PubMed Kinoshita T, Cano-Delgado A, Seto H, Hiranuma S, Fujioka S, Yoshida S, Chory J ( 2005 ) Binding of brassinosteroids to the extracellular domain of plant receptor kinase BRI1. Nature 433 : 167 – 171 Crossref Search ADS PubMed Kobayashi T, Eun C, Hanai H, Matsubayashi Y, Sakagami Y, Kamada H ( 1999 ) Phytosulphokine-α, a peptidyl plant growth factor, stimulates somatic embryogenesis in carrot. J Exp Bot 50 : 1123 – 1128 Kosugi S, Arai Y, Nakajima K, Ohashi Y ( 1990 ) An improved assay for β-glucuronidase (GUS) in transformed cells: methanol almost suppresses a putative endogenous GUS activity. Plant Sci 70 : 133 – 140 Crossref Search ADS Lorbiecke R, Sauter M ( 2002 ) Comparative analysis of PSK peptide growth factor precursor homologs. Plant Sci 163 : 321 – 332 Crossref Search ADS Martin DE, Hall MN ( 2005 ) The expanding TOR signaling network. Curr Opin Cell Biol 17 : 158 – 166 Crossref Search ADS PubMed Matsubayashi Y, Hanai H, Hara O, Sakagami Y ( 1996 ) Active fragments and analogs of the plant growth factor, phytosulfokine: structure-activity relationships. Biochem Biophys Res Commun 225 : 209 – 214 Crossref Search ADS PubMed Matsubayashi Y, Morita A, Matsunaga E, Furuya A, Hanai N, Sakagami Y ( 1999 a) Physiological relationships between auxin, cytokinin, and a peptide growth factor, phytosulfokine-α, in stimulation of asparagus cell proliferation. Planta 207 : 559 – 565 Crossref Search ADS Matsubayashi Y, Ogawa M, Morita A, Sakagami Y ( 2002 ) An LRR receptor kinase involved in perception of a peptide plant hormone, phytosulfokine. Science 296 : 1470 – 1472 Crossref Search ADS PubMed Matsubayashi Y, Sakagami Y ( 1996 ) Phytosulfokine, sulfated peptides that induce the proliferation of single mesophyll cells of Asparagus officinalis L. Proc Natl Acad Sci USA 93 : 7623 – 7627 Crossref Search ADS PubMed Matsubayashi Y, Sakagami Y ( 1998 ) Effects of the medium ammonium-nitrate ratio on competence for asparagus cell division induced by phytosulfokine-α. Plant Cell Rep 17 : 368 – 372 Crossref Search ADS PubMed Matsubayashi Y, Sakagami Y ( 1999 ) Characterization of specific binding sites for a mitogenic sulfated peptide, phytosulfokine-α, in the plasma-membrane fraction derived from Oryza sativa L. Eur J Biochem 262 : 666 – 671 Crossref Search ADS PubMed Matsubayashi Y, Sakagami Y ( 2000 ) 120- and 160-kDa receptors for endogenous mitogenic peptide, phytosulfokine-α, in rice plasma membranes. J Biol Chem 275 : 15520 – 15525 Crossref Search ADS PubMed Matsubayashi Y, Takagi L, Omura N, Morita A, Sakagami Y ( 1999 b) The endogenous sulfated pentapeptide phytosulfokine-α stimulates tracheary element differentiation of isolated mesophyll cells of zinnia. Plant Physiol 120 : 1043 – 1048 Crossref Search ADS PubMed Moran R ( 1982 ) Formulae for determination of chlorophyllous pigments extracted with N,N-dimethylformamide. Plant Physiol 69 : 1376 – 1381 Crossref Search ADS PubMed Oh SA, Lee SY, Chung IK, Lee CH, Nam HG ( 1996 ) A senescence-associated gene of Arabidopsis thaliana is distinctively regulated during natural and artificially induced leaf senescence. Plant Mol Biol 30 : 739 – 754 Crossref Search ADS PubMed Parinov S, Sevugan M, Ye D, Yang WC, Kumaran M, Sundaresan V ( 1999 ) Analysis of flanking sequences from dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell 11 : 2263 – 2270 Crossref Search ADS PubMed Seki M, Carninci P, Nishiyama Y, Hayashizaki Y, Shinozaki K ( 1998 ) High-efficiency cloning of Arabidopsis full-length cDNA by biotinylated CAP trapper. Plant J 15 : 707 – 720 Crossref Search ADS PubMed Seki M, Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T, Nakajima M, Enju A, Akiyama K, Oono Y, et al ( 2002 ) Functional annotation of a full-length Arabidopsis cDNA collection. Science 296 : 141 – 145 Crossref Search ADS PubMed Shiu SH, Bleecker AB ( 2001 ) Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci USA 98 : 10763 – 10768 Crossref Search ADS PubMed Thompson JE, Hopkins MT, Taylor C, Wang TW ( 2004 ) Regulation of senescence by eukaryotic translation initiation factor 5A: implications for plant growth and development. Trends Plant Sci 9 : 174 – 179 Crossref Search ADS PubMed Yamakawa S, Matsubayashi Y, Sakagami Y, Kamada H, Satoh S ( 1999 ) Promotive effects of the peptidyl plant growth factor, phytosulfokine-α, on the growth and chlorophyll content of Arabidopsis seedlings under high night-time temperature conditions. Biosci Biotechnol Biochem 63 : 2240 – 2243 Crossref Search ADS PubMed Yamakawa S, Sakuta C, Matsubayashi Y, Sakagami Y, Kamada H, Satoh S ( 1998 ) The promotive effects of a peptidyl plant growth factor, phytosulfokine-α, on the formation of adventitious roots and expression of a gene for a root-specific cystatin in cucumber hypocotyls. J Plant Res 111 : 453 – 458 Crossref Search ADS Yang H, Matsubayashi Y, Nakamura K, Sakagami Y ( 1999 ) Oryza sativa PSK gene encodes a precursor of phytosulfokine-α, a sulfated peptide growth factor found in plants. Proc Natl Acad Sci USA 96 : 13560 – 13565 Crossref Search ADS PubMed Yang H, Matsubayashi Y, Nakamura K, Sakagami Y ( 2001 ) Diversity of Arabidopsis genes encoding precursors for phytosulfokine, a peptide growth factor. Plant Physiol 127 : 842 – 851 Crossref Search ADS PubMed Zhao DZ, Wang GF, Speal B, Ma H ( 2002 ) The excess microsporocytes1 gene encodes a putative leucine-rich repeat receptor protein kinase that controls somatic and reproductive cell fates in the Arabidopsis anther. Genes Dev 16 : 2021 – 2031 Crossref Search ADS PubMed Zhou A, Wang H, Walker JC, Li J ( 2004 ) BRL1, a leucine-rich repeat receptor-like protein kinase, is functionally redundant with BRI1 in regulating Arabidopsis brassinosteroid signaling. Plant J 40 : 399 – 409 Crossref Search ADS PubMed Author notes 1 This work was supported by the 21st Century Center of Excellence Program (grant no. 14COEA02), by a Grant-in-Aid for Scientific Research for Priority Areas (grant no. 14036214), and by a Grant-in-Aid for Young Scientists (A) (grant no. 18687003). * Corresponding author; e-mail [email protected]; fax 81–52–789–4118. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Yoshikatsu Matsubayashi ([email protected]). www.plantphysiol.org/cgi/doi/10.1104/pp.106.081109 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Sakamoto, Tomoaki; Sakakibara, Hitoshi; Kojima, Mikiko; Yamamoto, Yuko; Nagasaki, Hiroshi; Inukai, Yoshiaki; Sato, Yutaka; Matsuoka, Makoto

doi: 10.1104/pp.106.085811pmid: 16861569

Abstract Some phytohormones such as gibberellins (GAs) and cytokinins (CKs) are potential targets of the KNOTTED1-like homeobox (KNOX) protein. To enhance our understanding of KNOX protein function in plant development, we identified rice (Oryza sativa) genes for adenosine phosphate isopentenyltransferase (IPT), which catalyzes the rate-limiting step of CK biosynthesis. Molecular and biochemical studies revealed that there are eight IPT genes, OsIPT1 to OsIPT8, in the rice genome, including a pseudogene, OsIPT6. Overexpression of OsIPTs in transgenic rice inhibited root development and promoted axillary bud growth, indicating that OsIPTs are functional in vivo. Phenotypes of OsIPT overexpressers resembled those of KNOX-overproducing transgenic rice, although OsIPT overexpressers did not form roots or ectopic meristems, both of which are observed in KNOX overproducers. Expression of two OsIPT genes, OsIPT2 and OsIPT3, was up-regulated in response to the induction of KNOX protein function with similar kinetics to those of down-regulation of GA 20-oxidase genes, target genes of KNOX proteins in dicots. However, expression of these two OsIPT genes was not regulated in a feedback manner. These results suggest that OsIPT2 and OsIPT3 have unique roles in the developmental process, which is controlled by KNOX proteins, rather than in the maintenance of bioactive CK levels in rice. On the basis of these findings, we concluded that KNOX protein simultaneously decreases GA biosynthesis and increases de novo CK biosynthesis through the induction of OsIPT2 and OsIPT3 expression, and the resulting high-CK and low-GA condition is required for formation and maintenance of the meristem. KNOTTED1-like homeobox (KNOX) proteins are encoded by knox genes and are preferentially accumulated in the indeterminate cells around the shoot apical meristem (SAM), but not in the determinate lateral organs (Jackson et al., 1994; Lincoln et al., 1994; Nishimura et al., 1999; Sentoku et al., 1999). Loss-of-function mutants shootmeristemless (stm) of Arabidopsis (Arabidopsis thaliana L. Heynh.) and knotted1 (kn1) of maize (Zea mays) show defects in SAM development or maintenance (Long et al., 1996; Kerstetter et al., 1997). The opposite phenotype, namely, formation of ectopic meristems on leaves, has been reported in transgenic plants overproducing KNOX proteins (Matsuoka et al., 1993; Sinha et al., 1993; Chuck et al., 1996; Nishimura et al., 2000; Sentoku et al., 2000). This evidence suggests that KNOX proteins play critical roles in SAM formation and maintenance as transcriptional regulators (Reiser et al., 2000). To understand the function of KNOX proteins in plant development, it is necessary to identify the genes targeted by them and to characterize the mechanism of the transcriptional regulation of those genes. Previous studies have revealed that KNOX proteins suppress the expression of gibberellin (GA) 20-oxidase genes in the dicots tobacco (Nicotiana tabacum), Arabidopsis, and potato (Solanum tuberosum; Sakamoto et al., 2001; Hay et al., 2002; Chen et al., 2004). Because GA 20-oxidase catalyzes the rate-limiting step of bioactive GA synthesis, these findings clearly indicate that KNOX proteins in dicots play a role in maintaining the SAM through the down-regulation of GA biosynthesis. However, the decreased level of bioactive GAs cannot completely explain the altered morphologies observed in KNOX overproducers. For example, ectopic meristem formation, which is a typical abnormal phenotype of KNOX overproducers, has never been observed in GA-deficient mutants of various plant species (Sun et al., 1992; Chiang et al., 1995; Xu et al., 1995; Spray et al., 1996; Helliwell et al., 1998; Yamaguchi et al., 1998; Itoh et al., 2001, 2004; Sasaki et al., 2002; Davidson et al., 2003; Sakamoto et al., 2004). Another candidate for regulation by KNOX proteins is cytokinin (CK) biosynthesis because production of bioactive CKs, such as trans-zeatin (tZ) and isopentenyladenine (iP), is significantly increased in KNOX overproducers (Tamaoki et al., 1997; Kusaba et al., 1998; Ori et al., 1999; Hewelt et al., 2000; Frugis et al., 2001). CKs affect many plant developmental processes, such as cell division, shoot initiation from callus, promotion of axillary bud outgrowth, direct transport of nutrients, stimulation of pigment synthesis, inhibition of root growth, and delay of senescence (Mok, 1994). The pathway for CK biosynthesis in higher plants has been established in Arabidopsis (Sakakibara, 2004, 2005). The first and rate-limiting step is prenylation of adenosine 5′ phosphates, such as ATP and ADP, at the N6-terminus with dimethylallyl diphosphate (DMAPP); this reaction is catalyzed by adenosine phosphate isopentenyltransferase (IPT). So far, plant IPT genes have been identified in dicots such as Arabidopsis (Kakimoto, 2001; Takei et al., 2001), petunia (Petunia hybrida; Zubko et al., 2002), and hop (Humulus lupulus; Sakano et al., 2004). The Arabidopsis genome encodes seven IPT genes (AtIPT1 and AtIPT3–AtIPT8; Kakimoto, 2001; Takei et al., 2001), which have different spatial expression patterns and hormone responses (Miyawaki et al., 2004; Takei et al., 2004). Recent studies demonstrated that the Arabidopsis KNOX protein STM induces expression of AtIPT7 within 2 h after induction of STM function (Jasinski et al., 2005; Yanai et al., 2005). Therefore, STM regulates expression of genes for both GA and CK biosynthesis to generate low-GA and high-CK conditions in the meristem; these conditions may be necessary to maintain meristem activity (Jasinski et al., 2005). To elucidate the functional interaction between KNOX proteins and CK biosynthesis in monocot plants, we isolated eight IPT genes from rice. We compared transgenic rice plants overproducing OsIPT and KNOX proteins. We also examined the expression level of OsIPT genes in KNOX overproducers. We discuss the function of KNOX proteins in CK biosynthesis in rice. RESULTS Isolation of IPT Genes from Rice We searched for IPT genes in all available rice DNA databases, using the predicted amino acid sequences encoded by Arabidopsis IPT genes (AtIPT1 and AtIPT3–AtIPT8; Kakimoto, 2001; Takei et al., 2001) as probes. Candidate sequences detected were used reiteratively as probes for further searches. We found 10 candidates, designated OsIPT1 to OsIPT10 (Fig. 1A Figure 1. Open in new tabDownload slide Molecular and biochemical characterization of OsIPTs. A, Amino acid sequence alignment of OsIPTs. Exact matches are boxed in black; shaded boxes indicate conservative substitutions. Asterisks show conserved DMAPP-binding motifs. Lowercase letters indicate amino acid sequence of OsIPT6 from indica cultivar Kasalath. B, Unrooted dendrogram of IPT proteins in Arabidopsis (AtIPT1–AtIPT9), petunia (Sho), and rice (OsIPT1–OsIPT10). Bar, 0.1 amino acid substitutions per site. C, IPT activity of cell extracts. Crude extract of each transformant E. coli cell line was used to measure the IPT activity by radioisotope rapid assay. The amount of each sample for assay was equivalent to one A 600 unit of cells. One A 600 unit is defined as the amount of cells obtained from 1 mL of cell culture whose A 600 value is 1. Figure 1. Open in new tabDownload slide Molecular and biochemical characterization of OsIPTs. A, Amino acid sequence alignment of OsIPTs. Exact matches are boxed in black; shaded boxes indicate conservative substitutions. Asterisks show conserved DMAPP-binding motifs. Lowercase letters indicate amino acid sequence of OsIPT6 from indica cultivar Kasalath. B, Unrooted dendrogram of IPT proteins in Arabidopsis (AtIPT1–AtIPT9), petunia (Sho), and rice (OsIPT1–OsIPT10). Bar, 0.1 amino acid substitutions per site. C, IPT activity of cell extracts. Crude extract of each transformant E. coli cell line was used to measure the IPT activity by radioisotope rapid assay. The amount of each sample for assay was equivalent to one A 600 unit of cells. One A 600 unit is defined as the amount of cells obtained from 1 mL of cell culture whose A 600 value is 1. ). The deduced open reading frames of all OsIPTs consist of one exon and no intron, with the exception of OsIPT9, which has 10 exons. The putative DMAPP-binding motif ([A, G]-X4-G-K-[S, T]) conserved in the N-terminal region of all AtIPTs was also found in all OsIPTs (Fig. 1A, asterisks). In the genome of a japonica cultivar, Nipponbare, we found that OsIPT6 has a single nucleotide substitution at Arg-236 (CGA to TGA), which generates a premature stop codon, but the indica cultivar, Kasalath, does not have this substitution. Thus, the Nipponbare OsIPT6 may be a mutant allele of the original OsIPT6 (Fig. 1A). Phylogenetic analysis grouped OsIPT1 to OsIPT8 with AtIPT1 and AtIPT3 to AtIPT8, and further divided this group into small subgroups (Fig. 1B). Each subgroup contained rice and Arabidopsis representatives. For instance, OsIPT1 to OsIPT5 were clustered with AtIPT3, AtIPT5, and AtIPT7. Similarly, OsIPT6, OsIPT7, and OsIPT8 were clustered with AtIPT1, AtIPT4, AtIPT6, and AtIPT8, and the petunia Sho. Pairing between rice and Arabidopsis IPTs in each subgroup leads us to speculate that each subgroup might have unique functions shared in monocots and dicots, but different from those in other subgroups. OsIPT9 and OsIPT10 were closely related to AtIPT2 and AtIPT9, respectively. AtIPT2 and AtIPT9 are considered to correspond, respectively, to eukaryotic and prokaryotic tRNA-IPTs, which catalyze prenylation of tRNA, but are not involved in CK biosynthesis (Kakimoto, 2001; Takei et al., 2001). Therefore, we predicted that OsIPT9 and OsIPT10 would also be involved in tRNA prenylation, but not in CK biosynthesis. Thus, we characterized eight genes (OsIPT1–OsIPT8). IPT Activity of Recombinant OsIPT Proteins To confirm the involvement of gene products in CK biosynthesis, we measured IPT activity by radioisotope rapid assay of total extract of Escherichia coli cells expressing OsIPTs. Although the activities differed among these proteins, IPT activity was detected in all cell extracts containing each recombinant OsIPT, except OsIPT6 (Fig. 1C). The result suggests that the products of OsIPTs, except OsIPT6, are involved in CK biosynthesis. The differences in IPT activity are probably due to the different efficiencies of functional protein expression, as observed in the Arabidopsis enzymes (Takei et al., 2001). Indeed, the specific activities of purified OsIPT1 and OsIPT3 (next paragraph) were 8.6 and 11.4 nmol min−1 mg−1 protein, respectively, when DMAPP and ADP were added as substrates in the reaction mixture; this indicates that the extent of IPT activity shown in Figure 1C does not always reflect the in vitro specific activity of each enzyme. To determine the kinetic parameters of OsIPTs, we purified recombinant OsIPT1 and OsIPT3 from E. coli extracts. The K m values of both for ATP, ADP, and AMP clearly indicate that these OsIPTs prefer ATP or ADP to AMP as a substrate (Table I Table I. Kinetic parametersa of OsIPT1 and OsIPT3 Protein . K m . . . . V max b . . ATPc . ADPc . AMPc . DMAPPd . . μ m nmol mg−1 min−1 OsIPT1 7.0 14.7 414 20.7 8.6 OsIPT3 5.1 29.8 147 8.7 11.4 Protein . K m . . . . V max b . . ATPc . ADPc . AMPc . DMAPPd . . μ m nmol mg−1 min−1 OsIPT1 7.0 14.7 414 20.7 8.6 OsIPT3 5.1 29.8 147 8.7 11.4 a Values are means of three independent determinations. b Measured in the presence of ADP and DMAPP. c Measured with 200 μ m DMAPP. d Measured with 200 μ m ADP. Open in new tab Table I. Kinetic parametersa of OsIPT1 and OsIPT3 Protein . K m . . . . V max b . . ATPc . ADPc . AMPc . DMAPPd . . μ m nmol mg−1 min−1 OsIPT1 7.0 14.7 414 20.7 8.6 OsIPT3 5.1 29.8 147 8.7 11.4 Protein . K m . . . . V max b . . ATPc . ADPc . AMPc . DMAPPd . . μ m nmol mg−1 min−1 OsIPT1 7.0 14.7 414 20.7 8.6 OsIPT3 5.1 29.8 147 8.7 11.4 a Values are means of three independent determinations. b Measured in the presence of ADP and DMAPP. c Measured with 200 μ m DMAPP. d Measured with 200 μ m ADP. Open in new tab ). Both OsIPTs utilized DMAPP as an isoprenoid side-chain donor (Table I), but hardly used hydroxymethylbutenyl diphosphate (data not shown), another candidate donor substrate (Krall et al., 2002; Sakakibara et al., 2005). Similar results were obtained with other semipurified OsIPTs, except OsIPT6 (data not shown). These results demonstrate that OsIPTs have similar substrate preferences to IPTs from Arabidopsis (Kakimoto, 2001; Sakakibara, 2004) and hop (Sakano et al., 2004), and suggest that substrate specificity is common among higher plant IPTs. Expression of OsIPTs in Various Organs of Wild-Type Rice Quantitative reverse transcription (qRT)-PCR analysis revealed that seven OsIPT genes (OsIPT1–OsIPT5, OsIPT7, and OsIPT8) were expressed at different levels in various organs (Fig. 2A Figure 2. Open in new tabDownload slide Expression analysis of OsIPT genes. A, Expression of OsIPT genes in various organs of wild-type rice. Total RNAs were isolated from the organs listed above each lane. Histone H3 was used as a loading control. B, Feedback regulation of OsIPT genes in iP-treated wild-type plants. The value obtained without iP treatment was arbitrarily set at 1.0. qRT-PCR was performed in triplicate and the mean values with sd are shown. Figure 2. Open in new tabDownload slide Expression analysis of OsIPT genes. A, Expression of OsIPT genes in various organs of wild-type rice. Total RNAs were isolated from the organs listed above each lane. Histone H3 was used as a loading control. B, Feedback regulation of OsIPT genes in iP-treated wild-type plants. The value obtained without iP treatment was arbitrarily set at 1.0. qRT-PCR was performed in triplicate and the mean values with sd are shown. ). Interestingly, genes grouped closely by phylogenetic analysis (Fig. 1B) showed similar expression patterns. For example, OsIPT1 transcripts were localized in the root and flower, and OsIPT2 transcripts were accumulated in the vegetative shoot apex and flower. OsIPT4 and OsIPT5 were expressed in all organs, although weakly in leaves (leaf sheath and leaf blade). OsIPT7 and OsIPT8 transcripts were broadly detected in all the organs we tested, whereas the OsIPT6 transcript was not detected in any organ. PCR without RT did not amplify any OsIPT genes (data not shown). Previous observations in Arabidopsis indicate that the expression of AtIPTs is regulated by the level of bioactive CKs (Miyawaki et al., 2004; Takei et al., 2004). Thus, we examined whether such feedback regulation also occurs in rice. qRT-PCR analysis revealed that iP treatment reduced the expression of OsIPT1, OsIPT4, OsIPT5, OsIPT7, and OsIPT8 (Fig. 2B). This result indicates that expression of these five genes is controlled by the CK level in a negative feedback manner, as in Arabidopsis. On the other hand, such a reduction was not observed in the expression of OsIPT2 or OsIPT3. This suggests that these genes are constitutively expressed or regulated by another mechanism (see below). Overexpression of OsIPT Genes in Transgenic Rice To assess the effects of overexpression of OsIPT genes and overproduction of CKs in transgenic rice, we overexpressed five OsIPT genes (OsIPT1–OsIPT4, OsIPT7) ectopically in transgenic rice under the control of the rice actin promoter (McElroy et al., 1991). All primary transformants exhibited inhibition of root formation, a typical phenotype caused by CK overproduction in mutant and transgenic dicots (Chaudhury et al., 1993; Faiss et al., 1997). The above-ground portion of primary transformants showed a range of phenotypes and some plants showed a weaker phenotype than that of a typical one (see below). Dissection of these weak phenotypes is also important to clarify the CK function on rice development. In this study, however, we focused on the typical phenotype of OsIPT transformants to simplify the discussion. Because of the phenotypic similarity of transgenic dicots overexpressing IPT and knox, we compared the typical phenotype of transgenic rice overexpressing OsIPTs and the rice knox gene, OSH1. Most OsIPT transformants formed clumps of multiple shoots and each shoot grew to about 2 mm (Fig. 3A Figure 3. Open in new tabDownload slide Phenotypes of transgenic rice plants. A and B, Typical phenotype of an OsIPT overproducer 1 month after regeneration (OsIPT3 overproducer shown). C, Wild-type rice plant 1 month after germination. lb, Leaf blade; lj, lamina joint; ls, leaf sheath. D and E, Typical phenotype of OSH1 overproducer 1 month after regeneration. F, Scanning electron micrograph of shoots of OsIPT3 overproducer. Shoots were connected at their bottoms, indicating that axillary buds were successively grown. Leaf-like organs tightly overlapped each other and ectopic meristem was not observed on their adaxial surfaces (arrowhead). G and H, Scanning electron micrographs of leaf-like organs of OSH1 overproducer. Ectopic meristems (arrows) were occasionally formed on the adaxial surfaces of leaf-like organs (arrowheads). Scale bars, 2 mm (A, B, D, and E), 5 cm (C), and 250 μm (F–H). Figure 3. Open in new tabDownload slide Phenotypes of transgenic rice plants. A and B, Typical phenotype of an OsIPT overproducer 1 month after regeneration (OsIPT3 overproducer shown). C, Wild-type rice plant 1 month after germination. lb, Leaf blade; lj, lamina joint; ls, leaf sheath. D and E, Typical phenotype of OSH1 overproducer 1 month after regeneration. F, Scanning electron micrograph of shoots of OsIPT3 overproducer. Shoots were connected at their bottoms, indicating that axillary buds were successively grown. Leaf-like organs tightly overlapped each other and ectopic meristem was not observed on their adaxial surfaces (arrowhead). G and H, Scanning electron micrographs of leaf-like organs of OSH1 overproducer. Ectopic meristems (arrows) were occasionally formed on the adaxial surfaces of leaf-like organs (arrowheads). Scale bars, 2 mm (A, B, D, and E), 5 cm (C), and 250 μm (F–H). ). Occasionally, shoots grew to about 1 cm, but they did not develop any normal leaves (Fig. 3B). The abnormal leaf-like organs of these shoots lacked the ligule, auricles, and lamina joint, which are located between the leaf blade and sheath of wild-type leaves (Fig. 3C). Most parts of the leaf-like organs seemed to derive from the leaf sheath, but we could not confirm this histologically. The typical phenotype of OSH1 transformants was similar to that of the OsIPT transformants. The above-ground portions of OSH1 transformants formed clumps of multiple shoots that grew to about 2 mm (Fig. 3D). Shoots of OSH1 transformants also occasionally grew to about 1 cm and their leaf-like organs also did not form the ligule, auricles, or lamina joint (Fig. 3E). Interestingly, OSH1 transformants developed normal roots and ectopic shoots, neither of which has been observed in OsIPT transformants. The shoot clumps of the OsIPT transformants were formed from successive development of axillary shoots, but not by ectopic shoot formation on the leaves (Fig. 3F). In addition to such successive outgrowth of axillary shoots in OSH1 transformants, ectopic shoots were formed on the adaxial surfaces of the leaf-like organs (Fig. 3, G and H). Thus, the phenotype of shoot clumps of the OSH1 transformants was caused by both successive development of axillary shoots and ectopic meristem formation on the malformed leaf-like organs. CK Content in Transgenic Rice Next, we compared the endogenous levels of 12 CK species in wild-type rice and in OsIPT3 and OSH1 transformants. As shown in Figure 4 Figure 4. Open in new tabDownload slide CK concentrations in wild-type and transgenic rice. Endogenous levels (pmol g−1 fresh weight) in wild-type (top value in each group), OsIPT3 overexpresser (middle), and OSH1 overexpresser (bottom) are shown below each product. Measurements were performed in triplicate and the mean values with sd are shown. Figure 4. Open in new tabDownload slide CK concentrations in wild-type and transgenic rice. Endogenous levels (pmol g−1 fresh weight) in wild-type (top value in each group), OsIPT3 overexpresser (middle), and OSH1 overexpresser (bottom) are shown below each product. Measurements were performed in triplicate and the mean values with sd are shown. , all 12 CK species examined were accumulated in very large amounts in the OsIPT3 transformants (Fig. 4, middle values), confirming that overexpression of OsIPT genes stimulates de novo CK biosynthesis. Similar results were obtained from OsIPT2 transformants (data not shown). On the other hand, levels of only three of the 12 CK species were increased in the OSH1 transformants (Fig. 4, bottom values). Although the levels of iP riboside-5′-monophosphate (iPRMP) and iP in the OSH1 transformants were 6.1 and 2.7 times those in the wild type, that of the nucleoside form, iP riboside (iPR), was about one-half that in the wild type. Levels of both tZ and cis-zeatin and of their nucleosides and nucleotides were decreased. This CK measurement analysis has revealed that overexpression of OSH1 does not cause a simple increase in de novo CK biosynthesis, but modifies CK homeostasis and consequently increases bioactive iP content, which may result in alteration of shoot development to a multiple shoot phenotype. It is noteworthy that the abundance of individual CKs was quite different between OSH1 and OsIPT3 transformants, and the enhanced level of iP caused by OSH1 overexpression (2.7-fold) was much lower than that caused by OsIPT3 overexpression (58-fold), even though ectopic shoot formation was observed only in the OSH1 transformants. This indicates that the severely abnormal phenotype of the OSH1 transformants is not caused only by CK overproduction. Endogenous OsIPT Expression in Transgenic Rice Because IPT catalyzes the formation of iPRMP (Fig. 4), accumulation of iPRMP in the OSH1 transformants suggests that expression of one or more OsIPTs is up-regulated by the KNOX protein. To distinguish the direct effects of KNOX proteins from the various changes observed in malformed transgenic plants, we generated an artificial inducible system of OSH15 function using the human glucocorticoid receptor (GR). The steroid-binding domain of GR inactivates the function of a neighboring domain in the chimeric protein molecule in the absence of a steroid ligand, but the function is restored in the presence of the ligand, dexamethasone (DEX), even in plants (Schena et al., 1991). Using this inducible system, we have found that inhibition of GA biosynthesis via the specific suppression of GA 20-oxidase gene expression was one of the earliest events caused by the activation of tobacco KNOX protein, NTH15 (Sakamoto et al., 2001). In this study, we produced the OSH15:GR fusion protein in transgenic rice plants under the control of the rice actin promoter (Fig. 5A Figure 5. Open in new tabDownload slide Expression of endogenous OsIPT and GA 20-oxidase genes in response to the induction of OSH15 function. A, Schematic representation of the OSH15:GR transgene. The chimeric gene consists of an in-frame fusion of the entire OSH15 cDNA and the steroid-binding domain of the human GR. This gene was driven by the rice actin promoter. B, Relative expression levels of OsIPT and GA 20-oxidase genes in 2-week-old OSH15:GR transgenic rice 24 h after 1 μ m DEX treatment. C, Changes in the expression levels of OsIPT2, OsIPT3, OsGA20ox2, and OsGA20ox4 after DEX treatment. The ratio between each gene level and the histone H3 level obtained from DEX untreated control plants was arbitrarily set at 1.0. qRT-PCR was performed in triplicate and mean values with sd are shown. Figure 5. Open in new tabDownload slide Expression of endogenous OsIPT and GA 20-oxidase genes in response to the induction of OSH15 function. A, Schematic representation of the OSH15:GR transgene. The chimeric gene consists of an in-frame fusion of the entire OSH15 cDNA and the steroid-binding domain of the human GR. This gene was driven by the rice actin promoter. B, Relative expression levels of OsIPT and GA 20-oxidase genes in 2-week-old OSH15:GR transgenic rice 24 h after 1 μ m DEX treatment. C, Changes in the expression levels of OsIPT2, OsIPT3, OsGA20ox2, and OsGA20ox4 after DEX treatment. The ratio between each gene level and the histone H3 level obtained from DEX untreated control plants was arbitrarily set at 1.0. qRT-PCR was performed in triplicate and mean values with sd are shown. ). These transformants showed DEX-dependent induction of abnormal morphology (data not shown). Using this inducible system, we first examined the expression of GA 20-oxidase genes by qRT-PCR analysis because KNOX protein directly binds to the promoter sequence of GA 20-oxidase genes and suppresses their expression in tobacco and potato (Sakamoto et al., 2001; Chen et al., 2004). Rice has four GA 20-oxidase genes, one of which, OsGA20ox3, was specifically expressed in reproductive organs (Sakamoto et al., 2004). Therefore, we examined the expression levels of the remaining three genes in OSH15:GR transgenic seedlings at 24 h after DEX treatment. Transcripts of two genes, OsGA20ox2 and OsGA20ox4, were decreased to 30% and 27%, respectively, of the levels in DEX untreated control plants, but expression of OsGA20ox1 was not changed by the treatment (Fig. 5B). Reduction of expression of OsGA20ox2 and OsGA20ox4 occurred between 3 and 6 h after treatment (Fig. 5C). These observations indicate that suppression of GA 20-oxidase gene expression is a rapid event in the KNOX protein-targeted phenomena and is conserved between monocots and dicots. Next, we examined the expression level of seven OsIPT genes in OSH15:GR transgenic seedlings 24 h after DEX treatment. Expression levels of five OsIPT genes (OsIPT1, OsIPT4, OsIPT5, OsIPT7, and OsIPT8) were slightly or greatly decreased at 24 h after treatment, whereas the levels of two genes, OsIPT2 and OsIPT3, were increased to 1.8 and 1.9 times, respectively, those in control plants (Fig. 5B). Such increased expression of both OsIPT2 and OsIPT3 occurred from 3 to 6 h after treatment, similar timing to that of the decrease in GA 20-oxidase gene expression (Fig. 5C). These observations suggest that induction of OsIPT2 and OsIPT3 is a rapid event in KNOX protein-controlled phenomena, like the down-regulation of GA 20-oxidase genes, and such IPT induction increases the endogenous CK level in KNOX overexpressers. DISCUSSION Many examples show that ectopic expression of KNOX proteins causes morphological alterations in transgenic plants, such as loss of apical dominance and adventitious meristem formation on leaves (Matsuoka et al., 1993; Sinha et al., 1993; Chuck et al., 1996; Tamaoki et al., 1997; Nishimura et al., 2000). KNOX overproducer phenotypes are similar to those of transformants expressing the bacterial ipt gene (Faiss et al., 1997) and the petunia IPT gene Sho (Zubko et al., 2002), and therefore the phenotypic similarity between CK overproducers and ectopic expressers of KNOX proteins suggests that KNOX proteins are involved in a CK-related pathway in plant development. Overexpression of knox genes in transgenic plants increases CK levels (Tamaoki et al., 1997; Kusaba et al., 1998; Ori et al., 1999; Hewelt et al., 2000; Frugis et al., 2001). Recent studies demonstrated that the Arabidopsis KNOX protein STM induces expression of AtIPT7 within 2 h after induction (Jasinski et al., 2005; Yanai et al., 2005). In our experiments, expression of two OsIPT genes, OsIPT2 and OsIPT3, was increased in response to the activation of a rice KNOX protein, OSH15, with similar kinetics to those of down-regulation of GA 20-oxidase genes, target genes of KNOX proteins in dicots (Fig. 5). Interestingly, expression patterns of OsIPT2 and OsIPT3 are unusual in comparison with those of other OsIPTs: These OsIPTs were not down-regulated by exogenous iP treatment in wild-type plants (Fig. 2B) or in the OSH1 overexpressers (data not shown), whereas expression of the other OsIPTs was regulated in a negative feedback manner. These results suggest that OsIPT2 and OsIPT3 have unique roles in the developmental process, which is controlled by KNOX proteins, rather than in the maintenance of bioactive CK levels in rice. Up-regulation of these IPT genes by KNOX proteins, whose kinetics were as rapid as the suppression of GA 20-oxidase gene expression (Fig. 5), also leads us to speculate that KNOX proteins may directly interact with their target sequences in the IPT genes to up-regulate expression of these genes because tobacco and potato KNOX proteins directly bind to the promoter sequences of GA 20-oxidase genes (Sakamoto et al., 2001; Chen et al., 2004). OsIPT2 contains a binding motif for OSH15 (TGTGAC; Nagasaki et al., 2001) in its 5′-flanking region at positions −2,460 to −2,455 (taking the translation initiation site as +1). Similarly, OsIPT3 contains preferable binding motifs for OSH15 (TGTCAC; Nagasaki et al., 2001) in its 5′-flanking region at positions −512 to −507 and −111 to −106. However, CK biosynthesis is not always increased by OSH1 expression. In fact, OSH1 overproducers normally develop roots, whereas root development was almost completely absent in the IPT overproducers (Fig. 3). Thus, KNOX protein is not a sufficient factor for enhanced expression of OsIPT2 and OsIPT3, and other factors may be essential. Increased OsIPT2 and OsIPT3 expression induces de novo CK biosynthesis in KNOX overexpressers. Interestingly, the abundance of individual CKs was quite different between OSH1 and OsIPT3 overexpressers (Fig. 4). In OsIPT3 overexpressers, all CK species were greatly accumulated. In contrast, although the level of iP, the major bioactive CK in rice, was elevated about 3-fold, the level of its nucleoside, iPR, was decreased in OSH1 overexpressers. Similarly, the level of tZ, the major bioactive CK in tobacco, was increased, but the level of its nucleoside, tZR, was decreased in transgenic tobacco plants overexpressing either OSH1 or NTH15, a tobacco OSH1 homolog (Tamaoki et al., 1997; Kusaba et al., 1998). These results imply that overexpression of knox genes not only increases de novo CK biosynthesis through the induction of IPT gene expression, but also modulates CK metabolism such as the deribosylation step of iPR (or tZR in tobacco) to form the bioactive iP (or tZ). Although activation of CK is very important in the regulation of CK activity, no genes for CK nucleosidase have been identified yet. Further studies are needed to understand how knox genes function in plant development through regulation of CK biosynthesis and metabolism. Recently, it was revealed that another type of homeodomain protein regulating stem cell fate in the SAM, WUSCHEL (WUS), directly suppresses the expression of CK-inducible type-A ARABIDOPSIS RESPONSE REGULATOR 7 (ARR7; Leibfried et al., 2005). Because type-A ARR proteins negatively regulate CK signaling (To et al., 2004), WUS and KNOX can activate CK action in different ways. However, Jasinski et al. (2005) clearly demonstrated that not only high-CK, but also low-GA, conditions are required for SAM maintenance, and KNOX protein acts as a general orchestrator by activating CK and repressing GA biosynthesis. Suppression of GA 20-oxidase gene expression by KNOX protein has been reported in various dicot plants (Sakamoto et al., 2001; Hay et al., 2002; Chen et al., 2004) and, in our experiments, expression of two GA 20-oxidase genes was rapidly down-regulated by induction of the KNOX function also in rice (Fig. 5). In addition, ectopic meristem formation was observed in KNOX overproducers, but not in OsIPT overproducers, even if they contained higher levels of bioactive CKs. These results support the possibility that rice meristems need not only high-CK, but also low-GA, conditions to maintain their activity. Interestingly, a similar function was observed in a negative regulator of GA responses, SPINDLY (SPY). A loss-of-function mutation of SPY or GA treatment of wild-type Arabidopsis plants suppressed CK responses and CK induction of ARR5, but not ARR7 expression (Greenboim-Wainberg et al., 2005). The results indicate that Arabidopsis SPY acts as both a repressor of GA responses and a positive regulator of CK signaling. Recently, the rice SPY ortholog, OsSPY, was characterized. OsSPY also suppresses GA responses and OsSPY knockdown plants accumulate bioactive brassinosteroid (BR) and show BR-overproducing phenotypes, such as increased leaf inclination (Shimada et al., 2006). These results suggests that OsSPY functions in GA signaling and BR metabolism, whereas the effects on CK signaling and meristem maintenance are uncertain. In conclusion, ectopic expression of KNOX proteins induces specific IPT gene expression and de novo CK biosynthesis, and this cascade is conserved in both monocots and dicots. It is noteworthy that another important function of KNOX proteins—repression of GA biosynthesis through suppression of GA 20-oxidase gene expression—is also conserved between monocots and dicots. These results indicate that plant meristems need high-CK and low-GA conditions to maintain their activity and that KNOX proteins act as central regulators to control these phytohormones at adequate levels, regardless of the differences in organization between monocots and dicots. MATERIALS AND METHODS Isolation of Rice IPT Genes A BLAST search using the predicted amino acid sequences encoded by Arabidopsis (Arabidopsis thaliana) IPT genes as probes was performed against the rice (Oryza sativa) DNA databases as described (Sakamoto et al., 2004). The predicted protein sequences were initially clustered with ClustalW (Thompson et al., 1994). TreeView was used to generate graphic output (Page, 1996). Accession numbers of the sequences used are indicated in Supplemental Table I. Entire coding regions for putative rice IPT genes were amplified by PCR using rice genomic DNA. Primers were designed to generate appropriate restriction sites for constructing a translational fusion with the pET-32a expression vector (Novagen). Amplified fragments were cloned into pCR II (Invitrogen) and their nucleotide sequences were determined. Enzyme Assays All OsIPT genes were translationally fused to the pET-32a expression vector (Novagen) and expressed in BL21 (DE3) Escherichia coli cells (Stratagene). Detailed conditions for OsIPT expression in E. coli and measurements of IPT activity were described previously (Takei et al., 2001). Plasmid Constructs and Plant Transformation The entire coding region of OsIPT1, OsIPT2, OsIPT3, OsIPT4, OsIPT7, or OSH1 was inserted between the rice actin promoter and the nopaline synthase polyadenylation signal of hygromycin-resistant binary vector pAct-Hm2. This vector is modified from pBI-H1 (Ohta et al., 1990) and contains a rice actin promoter. To create the OSH15:GR fusion protein, the stop codon of OSH15 was replaced with a SmaI site by PCR and fused to the steroid-binding domain of the human GR as described (Sakamoto et al., 2001). The resulting construct was introduced into Agrobacterium tumefaciens strain EHA105, and Agrobacterium-mediated transformation of rice was performed as described (Hiei et al., 1994). Transgenic plants were selected on media containing 50 mg L−1 hygromycin. Expression Analysis To determine the organ specificity of OsIPT expression, total RNA was separately prepared from various organs of wild-type rice. For feedback analysis, wild-type seeds were sown on agar medium containing 5 μ m iP and grown for a week, and total RNA was extracted from whole seedlings. OSH15:GR transgenic seeds were sown on agar medium and grown for 2 weeks and then transplanted to agar medium containing 10 μ m DEX or the same volume of ethanol. Total RNA was extracted from whole seedlings. Single-strand cDNAs were synthesized by using an Advantage RT-for-PCR kit (CLONTECH). qRT-PCR was performed with an iCycler iQ real-time PCR system (Bio-Rad Laboratories). Expression levels were normalized against the values obtained for histone H3, which was used as an internal reference gene. Primer sequences are listed in Supplemental Table II. These primers specifically amplified the target gene sequences (data not shown). Measurement of CK Concentrations Wild-type seedlings and transformants (approximately 1 g) were collected and frozen at −80°C until use. CKs were extracted and fractionated from whole plants, and the resulting CK fractions were analyzed by liquid chromatography-mass spectrometry, as described previously (Takei et al., 2004). LITERATURE CITED Chaudhury AM, Letham S, Craig S, Dennis ES ( 1993 ) amp1—a mutant with high cytokinin levels and altered embryonic pattern, faster vegetative growth, constitutive photomorphogenesis and precocious flowering. Plant J 4 : 907 – 916 Crossref Search ADS Chen H, Banerjee AK, Hannapel DJ ( 2004 ) The tandem complex of BEL and KNOX partners is required for transcriptional repression of ga20ox1. Plant J 38 : 276 – 284 Crossref Search ADS PubMed Chiang H-H, Hwang I, Goodman HM ( 1995 ) Isolation of the Arabidopsis GA4 locus. Plant Cell 7 : 195 – 201 PubMed Chuck G, Lincoln C, Hake S ( 1996 ) KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8 : 1277 – 1289 PubMed Davidson SE, Elliott RC, Helliwell CA, Poole AT, Reid JB ( 2003 ) The pea gene NA encodes ent-kaurenoic acid oxidase. Plant Physiol 131 : 335 – 344 Crossref Search ADS PubMed Faiss M, Zalubilova J, Strnad M, Schmülling T ( 1997 ) Conditional transgenic expression of the ipt gene indicates a function for cytokinins in paracrine signaling in whole tobacco plants. Plant J 12 : 401 – 415 Crossref Search ADS PubMed Frugis G, Giannino D, Mele G, Nicolodi C, Chiappetta A, Bitonti MB, Innocenti AM, Dewitte W, Van Onckelen H, Mariotti D ( 2001 ) Overexpression of KNAT1 in lettuce shifts leaf determinate growth to a shoot-like indeterminate growth associated with an accumulation of isopentenyl-type cytokinins. Plant Physiol 126 : 1370 – 1380 Crossref Search ADS PubMed Greenboim-Wainberg Y, Maymon I, Borochov R, Alvarez J, Olszewski N, Ori N, Eshed Y, Weiss D ( 2005 ) Cross talk between gibberellin and cytokinin: the Arabidopsis GA response inhibitor SPINDLY plays a positive role in cytokinin signaling. Plant Cell 17 : 92 – 102 Crossref Search ADS PubMed Hay A, Kaur H, Phillips A, Hedden P, Hake S, Tsiantis M ( 2002 ) The gibberellin pathway mediates KNOTTED1-type homeobox function in plants with different body plans. Curr Biol 12 : 1557 – 1565 Crossref Search ADS PubMed Helliwell CA, Sheldon CC, Olive MR, Walker AR, Zeevaart JAD, Reacock WJ, Dennis ES ( 1998 ) Cloning of the Arabidopsis ent-kaurene oxidase gene GA3. Proc Natl Acad Sci USA 95 : 9019 – 9024 Crossref Search ADS PubMed Hewelt A, Prinsen E, Thomas M, Onckelen HV, Meins F Jr ( 2000 ) Ectopic expression of maize knotted1 results in the cytokinin-autotrophic growth of cultured tobacco tissues. Planta 210 : 884 – 889 Crossref Search ADS PubMed Hiei Y, Ohta S, Komari T, Kumashiro T ( 1994 ) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of boundaries of the T-DNA. Plant J 6 : 271 – 282 Crossref Search ADS PubMed Itoh H, Tatsumi T, Sakamoto T, Otomo K, Toyomasu T, Kitano H, Ashikari M, Ichihara S, Matsuoka M ( 2004 ) A rice semi-dwarf gene, Tan-Ginbozu (D35), encodes the gibberellin biosynthesis enzyme, ent-kaurene oxidase. Plant Mol Biol 54 : 533 – 547 Crossref Search ADS PubMed Itoh H, Ueguchi-Tanaka M, Sentoku N, Kitano H, Matsuoka M, Kobayashi M ( 2001 ) Cloning and functional analysis of gibberellin 3β-hydroxylase genes that are differently expressed during the growth of rice. Proc Natl Acad Sci USA 98 : 8909 – 8914 Crossref Search ADS PubMed Jackson D, Veit B, Hake S ( 1994 ) Expression of maize KNOTTED1 related homeobox genes in the shoot apical meristem predicts patterns of morphogenesis in the vegetative shoot. Development 120 : 405 – 413 Crossref Search ADS Jasinski S, Piazza P, Craft J, Hay A, Woolley L, Rieu I, Phillips A, Hedden P, Tsiantis M ( 2005 ) KNOX action in Arabidopsis is mediated by coordinate regulation of cytokinin and gibberellin activities. Curr Biol 15 : 1560 – 1565 Crossref Search ADS PubMed Kakimoto T ( 2001 ) Identification of plant cytokinin biosynthetic enzymes as dimethylallyl diphosphate: ATP/ADP isopentenyltransferase. Plant Cell Physiol 42 : 677 – 685 Crossref Search ADS PubMed Kerstetter RA, Laudencia-Chingcuanco D, Smith L, Hake S ( 1997 ) Loss-of-function mutations in the maize homeobox gene, knotted1, are defective in shoot meristem maintenance. Development 124 : 3045 – 3054 Crossref Search ADS PubMed Krall L, Raschke M, Zenk MH, Baron C ( 2002 ) The Tzs protein from Agrobacterium tumefaciens C58 produces zeatin riboside 5′-phosphate from 4-hydroxy-3-methyl-2-(E)-butenyl diphosphate and AMP. FEBS Lett 527 : 315 – 318 Crossref Search ADS PubMed Kusaba S, Kano-Murakami Y, Matsuoka M, Tamaoki M, Sakamoto T, Yamaguchi I, Fukumoto M ( 1998 ) Alteration of hormone levels in transgenic tobacco plants overexpressing a rice homeobox gene OSH1. Plant Physiol 116 : 471 – 476 Crossref Search ADS PubMed Leibfried A, To JP, Busch W, Stehling S, Kehle A, Demar M, Kieber JJ, Lohmann JU ( 2005 ) WUSCHEL controls meristem function by direct regulation of cytokinin-inducible response regulators. Nature 438 : 1172 – 1175 Crossref Search ADS PubMed Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S ( 1994 ) A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6 : 1859 – 1876 PubMed Long JA, Moan EI, Medford JI, Barton MK ( 1996 ) A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature 379 : 66 – 69 Crossref Search ADS PubMed Matsuoka M, Ichikawa H, Saito A, Tada Y, Fujimura T, Kano-Murakami Y ( 1993 ) Expression of a rice homeobox gene causes altered morphology of transgenic plants. Plant Cell 5 : 1039 – 1048 PubMed McElroy D, Blowers AD, Jenes B, Wu R ( 1991 ) Construction of expression vectors based on the rice actin 1 (Act1) 5′ region for use in monocot transformation. Mol Gen Genet 231 : 150 – 160 Crossref Search ADS PubMed Miyawaki K, Matsumoto-Kitano M, Kakimoto T ( 2004 ) Expression of cytokinin biosynthetic isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin, and nitrate. Plant J 37 : 128 – 138 Crossref Search ADS PubMed Mok MC ( 1994 ) Cytokinins and plant development—an overview. In DWS Mok, MC Mok, eds, Cytokinins—Chemistry, Activity, and Function. CRC Press, Boca Raton, FL, pp 155–166 Nagasaki H, Sakamoto T, Sato Y, Matsuoka M ( 2001 ) Functional analysis of the conserved domains of a rice KNOX homeodomain protein, OSH15. Plant Cell 13 : 2085 – 2098 Crossref Search ADS PubMed Nishimura A, Tamaoki M, Sakamoto T, Matsuoka M ( 2000 ) Over-expression of tobacco knotted1-type class1 homeobox genes alters various leaf morphology. Plant Cell Physiol 41 : 583 – 590 Crossref Search ADS PubMed Nishimura A, Tamaoki M, Sato Y, Matsuoka M ( 1999 ) The expression of tobacco knotted1-type class 1 homeobox genes correspond to regions predicted by the cytohistological zonation model. Plant J 18 : 337 – 347 Crossref Search ADS PubMed Ohta S, Mita S, Hattori T, Nakamura K ( 1990 ) Construction and expression in tobacco of a β-glucuronidase (GUS) reporter gene containing an intron within the coding sequence. Plant Cell Physiol 31 : 805 – 813 Ori N, Juarez MT, Jackson D, Yamaguchi J, Banowetz GM, Hake S ( 1999 ) Leaf senescence is delayed in tobacco plants expressing the maize homeobox gene knotted1 under the control of a senescence-activated promoter. Plant Cell 11 : 1073 – 1080 Crossref Search ADS PubMed Page RD ( 1996 ) TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12 : 357 – 358 PubMed Reiser L, Sanchez-Baracaldo P, Hake S ( 2000 ) Knots in the family tree: evolutionary relationships and functions of knox homeobox genes. Plant Mol Biol 42 : 151 – 166 Crossref Search ADS PubMed Sakakibara H ( 2004 ) Cytokinin biosynthesis and metabolism. In PJ Davies, ed, Plant Hormones: Biosynthesis, Signal Transduction, Action! Springer, Dordrecht, The Netherlands, pp 95–114 Sakakibara H ( 2005 ) Cytokinin biosynthesis and regulation. Vitam Horm 72 : 271 – 287 Crossref Search ADS PubMed Sakakibara H, Kasahara H, Ueda N, Kojima M, Takei K, Hishiyama S, Asami T, Okada K, Kamiya Y, Yamaya T, et al ( 2005 ) Agrobacterium tumefaciens increases cytokinin production in plastids by modifying the biosynthetic pathway in the host plant. Proc Natl Acad Sci USA 102 : 9972 – 9977 Crossref Search ADS PubMed Sakamoto T, Kamiya N, Ueguchi-Tanaka M, Iwahori S, Matsuoka M ( 2001 ) KNOX homeodomain protein directly suppresses the expression of a gibberellin biosynthetic gene in the tobacco shoot apical meristem. Genes Dev 15 : 581 – 590 Crossref Search ADS PubMed Sakamoto T, Miura K, Itoh H, Tatsumi T, Ueguchi-Tanaka M, Ishiyama K, Kobayashi M, Agrawal GK, Takeda S, Abe K, et al ( 2004 ) An overview of gibberellin metabolism enzyme genes and their related mutants in rice. Plant Physiol 134 : 1642 – 1653 Crossref Search ADS PubMed Sakano Y, Okada Y, Matsunaga A, Suwama T, Kaneko T, Ito K, Noguchi H, Abe I ( 2004 ) Molecular cloning, expression, and characterization of adenylate isopentenyltransferase from hop (Humulus lupulus L.). Phytochemistry 65 : 2439 – 2446 Crossref Search ADS PubMed Sasaki A, Ashikari M, Ueguchi-Tanaka M, Itoh H, Nishimura A, Swapan D, Ishiyama K, Saito T, Kobayashi M, Khush GS, et al ( 2002 ) A mutant gibberellin-synthesis gene in rice. Nature 416 : 701 – 702 Crossref Search ADS PubMed Schena M, Lloyd AM, Davis RW ( 1991 ) A steroid-inducible gene expression system for plant cells. Proc Natl Acad Sci USA 88 : 10421 – 10425 Crossref Search ADS PubMed Sentoku N, Sato Y, Kurata N, Ito Y, Kitano H, Matsuoka M ( 1999 ) Regional expression of the rice KN1-type homeobox gene family during embryo, shoot, and flower development. Plant Cell 11 : 1651 – 1664 Crossref Search ADS PubMed Sentoku N, Sato Y, Matsuoka M ( 2000 ) Overexpression of rice OSH genes induces ectopic shoots on leaf sheaths of transgenic rice plants. Dev Biol 220 : 358 – 364 Crossref Search ADS PubMed Shimada A, Ueguchi-Tanaka M, Sakamoto T, Fujioka S, Takatsuto S, Yoshida S, Sazuka T, Ashikari M, Matsuoka M ( 2006 ) The rice SPINDLY gene functions as a negative regulator of gibberellin signaling by controlling the suppressive function of the DELLA protein, SLR1, and is involved in brassinosteroid synthesis. Plant J 47 : (in press) Sinha NR, Williams RE, Hake S ( 1993 ) Overexpression of the maize homeobox gene, Knotted-1, causes a switch from determinate to indeterminate cell fates. Genes Dev 7 : 787 – 795 Crossref Search ADS PubMed Spray CR, Kobayashi M, Suzuki Y, Phinney BO, Gaskin P, MacMillan J ( 1996 ) The dwarf-1 (dt) mutant of Zea mays blocks three steps in the gibberellin-biosynthetic pathway. Proc Natl Acad Sci USA 93 : 10515 – 10518 Crossref Search ADS PubMed Sun T-P, Goodman HM, Ausubel FM ( 1992 ) Cloning the Arabidopsis GA1 locus by genomic subtraction. Plant Cell 4 : 119 – 128 Crossref Search ADS PubMed Takei K, Sakakibara H, Sugiyama T ( 2001 ) Identification of genes encoding adenylate isopentenyltransferase, a cytokinin biosynthesis enzyme, in Arabidopsis thaliana. J Biol Chem 276 : 26405 – 26410 Crossref Search ADS PubMed Takei K, Ueda N, Aoki K, Kuromori T, Hirayama T, Shinozaki K, Yamaya T, Sakakibara H ( 2004 ) AtIPT3, an Arabidopsis isopentenyltransferase gene, is a key determinant of macronutrient-responsive cytokinin biosynthesis. Plant Cell Physiol 45 : 1053 – 1062 Crossref Search ADS PubMed Tamaoki M, Kusaba S, Kano-Murakami Y, Matsuoka M ( 1997 ) Ectopic expression of a tobacco homeobox gene, NTH15, dramatically alters leaf morphology and hormone levels in transgenic tobacco. Plant Cell Physiol 38 : 917 – 927 Crossref Search ADS PubMed Thompson JD, Higgins DG, Gibson TJ ( 1994 ) CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 : 4673 – 4680 Crossref Search ADS PubMed To JP, Haberer G, Ferreira FJ, Deruere J, Mason MG, Schaller GE, Alonso JM, Ecker JR, Kieber JJ ( 2004 ) Type-A Arabidopsis response regulators are partially redundant negative regulators of cytokinin signaling. Plant Cell 16 : 658 – 671 Crossref Search ADS PubMed Xu Y-L, Li L, Wu K, Peeters AJM, Gage DA, Zeevaart JAD ( 1995 ) The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. Proc Natl Acad Sci USA 92 : 6640 – 6644 Crossref Search ADS PubMed Yamaguchi S, Sun T-P, Kawaide H, Kamiya Y ( 1998 ) The GA2 locus of Arabidopsis thaliana encodes ent-kaurene synthase of gibberellin biosynthesis. Plant Physiol 116 : 1271 – 1278 Crossref Search ADS PubMed Yanai O, Shani E, Dolezal K, Tarkowski P, Sablowski R, Sandberg G, Samach A, Ori N ( 2005 ) Arabidopsis KNOXI proteins activate cytokinin biosynthesis. Curr Biol 15 : 1566 – 1571 Crossref Search ADS PubMed Zubko E, Adams CJ, Machaekova I, Malbeck J, Scollan C, Meyer P ( 2002 ) Activation tagging identifies a gene from Petunia hybrida responsible for the production of active cytokinins in plants. Plant J 29 : 797 – 808 Crossref Search ADS PubMed Author notes 1 This work was supported by the Ministry of Agriculture, Forestry, and Fisheries of Japan (Rice Genome Project IP–1010 to T.S. and Rice Genome Project IP–3003 to H.S.), by the Ministry of Education, Culture, Sports, Science and Technology of Japan (to H.S.), and by a Grant-in-Aid for the Center of Excellence from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to M.M.). * Corresponding author; e-mail [email protected]; fax 81–52–789–5226. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Makoto Matuoka ([email protected]). [W] The online version of this article contains Web-only data. www.plantphysiol.org/cgi/doi/10.1104/pp.106.085811 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Ito, Hironori; Gray, William M.

doi: 10.1104/pp.106.084533pmid: 16877699

Abstract Arabidopsis (Arabidopsis thaliana) contains 15 genes encoding members of the pleiotropic drug resistance (PDR) family of ATP-binding cassette transporters. These proteins have been speculated to be involved in the detoxification of xenobiotics, however, little experimental support of this hypothesis has been obtained to date. Here we report our characterization of the Arabidopsis PDR9 gene. We isolated a semidominant, gain-of-function mutant, designated pdr9-1, that exhibits increased tolerance to the auxinic herbicide 2,4-dichlorophenoxyacetic acid (2,4-D). Reciprocally, loss-of-function mutations in PDR9 confer 2,4-D hypersensitivity. This altered auxin sensitivity defect of pdr9 mutants is specific for 2,4-D and closely related compounds as these mutants respond normally to the endogenous auxins indole-3-acetic acid and indole-butyric acid. We demonstrate that 2,4-D, but not indole-3-acetic acid transport is affected by mutations in pdr9, suggesting that the PDR9 transporter specifically effluxes 2,4-D out of plant cells without affecting endogenous auxin transport. The semidominant pdr9-1 mutation affects an extremely highly conserved domain present in all known plant PDR transporters. The single amino acid change results in increased PDR9 abundance and provides a novel approach for elucidating the function of plant PDR proteins. Auxin regulates numerous aspects of plant growth and development including embryogenesis, lateral root formation, vascularization, and tropic growth responses (Woodward and Bartel, 2005). While endogenous auxin plays a critical role in normal plant growth and development, the application of high doses results in phytoxicity. This observation led to the development of several synthetic auxins, including 2-4-dichlorophenoxyacetic acid (2,4-D) as the first successful selective herbicide. 2,4-D and other auxinic herbicides are largely specific to dicots, however, the mechanisms underlying this selectivity are poorly understood. Some 60 years after its discovery, 2,4-D remains the most widely used herbicide worldwide (www.epa.gov). While recent decades have seen the development of several herbicide-resistant crop varieties that have profoundly altered agricultural practices, such is not the case for 2,4-D and other auxinic herbicides. This is complicated in part by the essential role of endogenous auxin (indole-3-acetic acid [IAA]) in plant growth and development. Mutant or transgenic varieties resistant to 2,4-D also display altered response to IAA and consequently exhibit abnormal development. Insight into the mechanism underlying this phenomenon was recently provided by the demonstration that IAA and 2,4-D bind a common receptor to regulate auxin signaling (Dharmasiri et al., 2005a; Kepinski and Leyser, 2005). Common strategies to achieve herbicide tolerance through genetic and transgenic approaches are typically aimed at identifying mutant target proteins unaffected by the herbicide or the metabolic detoxification/degradation of the compound. An additional approach was recently suggested by Windsor et al. (2003) involving herbicide detoxification by efflux facilitated by plant ATP-binding cassette (ABC) transporters. These proteins, which are found in all living organisms, mediate the translocation of a wide range of structurally unrelated molecules across biological membranes (Higgins, 1992). All functional ABC transporters have a basic structural organization consisting of two hydrophobic transmembrane spanning domains (TMDs) and two hydrophilic nucleotide-binding domains (NBDs). The NBDs contain a highly conserved 200-amino acid region consisting of the Walker A and Walker B boxes (Walker et al., 1982), separated by approximately 120 amino acids containing the ABC signature motif (Bairoch, 1992). Members of ABC transporter family are categorized by the configuration of TMDs and NBDs, and are referred to as half-size or full-size transporters based on the number (one or two) of TMD/NBD modules they contain (Higgins, 1992). In Arabidopsis (Arabidopsis thaliana), approximately 130 genes encoding ABC transporters have been identified in the completed Arabidopsis genome (Sanchez-Fernandez et al., 2001; Martinoia et al., 2002; Schulz and Kolukisaoglu, 2006). Fifty four of these genes belong to the full-size category and are classified into three groups: P glycoproteins (PGPs; also referred to as multidrug resistance [MDR] transporters), MDR-associated proteins (MRPs), and pleiotropic drug resistance (PDR) transporters (Theodoulou, 2000; Sanchez-Fernandez et al., 2001; van den Brule and Smart, 2002; Crouzet et al., 2006). Arabidopsis MRP1, MRP2, and MRP3 transport glutathione conjugates of endogenous and artificial substrates into vacuoles (Lu et al., 1997, 1998; Tommasini et al., 1998), and MRP4 and MRP5 have been implicated in the complex regulation of stomatal aperture and guard cell ion flux (Gaedeke et al., 2001; Klein et al., 2003, 2004). The majority of plant PGP/MDRs characterized to date have been implicated in the transport of auxin (Multani et al., 2003; Geisler and Murphy, 2006). Recently, Arabidopsis PGP1 and PGP19 have been reported to mediate the ATP-dependent cellular efflux of natural and synthetic auxins as well as oxidative auxin breakdown products in Arabidopsis protoplasts and whole plants (Geisler et al., 2003, 2005). Additionally, Arabidopsis PGP4 has been suggested to function primarily in the uptake of redirected or newly synthesized auxin in epidermal root tip cells (Santelia et al., 2005; Terasaka et al., 2005). In contrast to the PGP class of ABC transporters, the plant PDR subfamily has received considerably less attention. Genetic studies on Arabidopsis PDR12 and its likely homologs in Nicotiana plumbaginifolia and Spirodela polyrrhiza have implicated this transporter in the efflux of sclareol, an antifungal diterpene (Jasinski et al., 2001; van den Brule et al., 2002; Campbell et al., 2003; Stukkens et al., 2005). An additional connection between PDR-type transporters and defense response is provided by recent studies of atpdr8 mutants, which exhibit increased cell death associated with the hypersensitive response following pathogen infection (Kobae et al., 2006; Stein et al., 2006). AtPDR12 has also recently been implicated in lead detoxification (Lee et al., 2005). Here we report our characterization of the Arabidopsis PDR9 transporter. We identified the semidominant pdr9-1 mutation as conferring increased 2,4-D tolerance in a genetic screen to isolate mutations enhancing the relatively weak auxin response defect conferred by the tir1-1 mutation (Gray et al., 2003; Chuang et al., 2004; Quint et al., 2005). Reciprocally, recessive loss-of-function alleles of PDR9 result in 2,4-D hypersensitivity, indicating that pdr9-1 is a gain-of-function mutation conferring increased activity to the protein. Further analysis demonstrated that PDR9 is involved in the translocation of not only 2,4-D but also other members of the phenoxyalkanoic acid family of herbicides as well as the polar auxin transport inhibitor, napthylphthalamic acid (NPA). In contrast, we find that PDR9 is not involved in the transport of the native auxin, IAA. RESULTS Identification of the eta4 Mutation We have previously described a genetic screen designed to identify mutations that enhance the relatively weak auxin resistance phenotype of tir1-1 seedlings. Several enhancer of tir1-1 auxin resistance (eta) mutants were isolated in this screen, including ETA3/SGT1b (Gray et al., 2003), ETA2/CAND1 (Chuang et al., 2004), and ETA1/AXR6/CUL1 (Quint et al., 2005), all three of which encode components of SCFTIR1 pathway. The eta4 tir1-1 M2 plant was backcrossed to Columbia (Col) and eta4 single mutants isolated by PCR-based genotyping of TIR1. When eta4/eta4 TIR1+/TIR1+ plants were backcrossed again to Col, 233/317 F2 seedlings displayed resistant root growth on 0.075 μ m 2,4-D, indicating that the eta4 mutation confers a dominant auxin-resistant phenotype (1:3; χ 2 = 0.85). The amount of 2,4-D-mediated inhibition of root growth varied considerably among the resistant progeny, and 2,4-D dose-response studies revealed that eta4 actually behaves in a semidominant fashion (Fig. 1, A and B Figure 1. Open in new tabDownload slide Characterization of the eta4 mutant. A, Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing 0.075 μ m 2,4-D and grown for an additional 4 d. Asterisks indicate the position of the root tip at the time of transfer. Genotypes were confirmed by sequencing of PCR products. Size bar = 5 mm. B, Inhibition of root elongation by increasing concentrations of 2,4-D. Data points reflect the mean of 10 seedlings. Standard deviations for all data points were ≤10% of the mean. C. Lateral root (LR) initiation was assessed in 10-d-old seedlings grown on unsupplemented nutrient medium (n = 10). D, Inhibition of root elongation by increasing concentrations of IAA and NAA. Data points represent the mean from 10 seedlings. E, Auxin-dependent GUS expression in Col and eta4 seedlings carrying the BA-GUS reporter construct. Each homozygous BA-GUS line was incubated in liquid ATS medium with or without 1 μ m auxins for 6 h and then stained for 16 h. Figure 1. Open in new tabDownload slide Characterization of the eta4 mutant. A, Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing 0.075 μ m 2,4-D and grown for an additional 4 d. Asterisks indicate the position of the root tip at the time of transfer. Genotypes were confirmed by sequencing of PCR products. Size bar = 5 mm. B, Inhibition of root elongation by increasing concentrations of 2,4-D. Data points reflect the mean of 10 seedlings. Standard deviations for all data points were ≤10% of the mean. C. Lateral root (LR) initiation was assessed in 10-d-old seedlings grown on unsupplemented nutrient medium (n = 10). D, Inhibition of root elongation by increasing concentrations of IAA and NAA. Data points represent the mean from 10 seedlings. E, Auxin-dependent GUS expression in Col and eta4 seedlings carrying the BA-GUS reporter construct. Each homozygous BA-GUS line was incubated in liquid ATS medium with or without 1 μ m auxins for 6 h and then stained for 16 h. ). Despite the finding that eta4/eta4 seedlings exhibit stronger 2,4-D resistance than tir1-1 mutants (Fig. 1B), unlike tir1-1, the eta4 mutation did not confer a reduction in lateral root development (Fig. 1C). Furthermore, eta4 mutants did not exhibit any of the auxin-related developmental defects, such as reductions in stature and apical dominance characteristic of many auxin-response mutants (Woodward and Bartel, 2005). Instead, eta4 plants appeared indistinguishable from wild-type controls at all stages of development (data not shown). The finding that the eta4 mutation conferred 2,4-D-resistant root growth but no detectable auxin-related phenotypes, suggested that the eta4 defect may be specific to the synthetic auxin, 2,4-D. While no auxin-response mutants have been described that discriminate between native and synthetic biologically active auxins, there are well-characterized differences in the transport of IAA, 2,4-D, and naphthylacetic acid (NAA; Morris et al., 2004). For example, while 2,4-D and IAA are taken up by the putative influx carrier AUX1 (Marchant et al., 1999), only IAA is an efficient substrate for the efflux carriers of the polar auxin transport system (Morris et al., 2004). We compared the effects of exogenous 2,4-D, IAA, and NAA on root growth of eta4 seedlings and found that eta4 auxin resistance was entirely 2,4-D specific (Fig. 1D). Likewise, whereas IAA and NAA promoted lateral root development equally well in eta4 and wild-type seedlings, eta4 mutants exhibited a striking reduction in 2,4-D-induced lateral root formation (data not shown). The 2,4-D-specific auxin resistance of eta4 was also examined at the level of gene expression using the auxin-responsive reporter construct, BA-β-glucuronidase (GUS; Oono et al., 1998). Homozygous Col[BA-GUS] and eta4[BA-GUS] seedlings were treated with 1 μ m auxins for 6 h. As reported in Oono et al. (1998), strong induction of GUS activity was observed in the proximal region of the root elongation zone when Col seedlings were treated with auxins (Fig. 1E). While eta4 seedlings exhibited a wild-type-like response to IAA and NAA, only faint GUS staining was detected when eta4 seedlings were treated with 2,4-D (Fig. 1E), further demonstrating the 2,4-D-specific nature of the eta4 mutant. ETA4 Encodes the PDR9 Protein A map-based cloning strategy was used to isolate the ETA4 gene. The eta4 mutation was initially mapped between nga162 and nga6 on the south end of chromosome 3. Additional mapping narrowed the location of eta4 to an approximately 200 kb interval. Inspection of candidate loci within this interval revealed the presence of two ABC-type transporter genes, one exhibiting similarity to yeast (Saccharomyces cerevisiae) PDR5 (At3g53480), and a second related to the human breast cancer resistance protein, BCRP (At3g53510). Our finding that the eta4 defect is 2,4-D specific, together with recent findings implicating ABC transporters in auxin transport (Noh et al., 2001; Geisler et al., 2005; Santelia et al., 2005), and studies in yeast demonstrating that loss of pdr5 results in 2,4-D hypersensitive growth arrest (Teixeira and Sa-Correia, 2002), led us to sequence the coding regions of these two genes from eta4 plants. We detected no sequence difference between eta4 and wild type for At3g53510, but we did identify a 1-bp substitution (G to A) in the 18th exon of At3g53480 (Fig. 2A Figure 2. Open in new tabDownload slide ETA4 encodes PDR9. A, Mutation sites of pdr9-1 and pdr9-2. Exons are indicated as boxes and introns are indicated as lines. B, RNA gel-blot analysis using total RNA prepared from Col and pdr9-2 seedlings. Ten micrograms of total RNA was loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). C, Effects of 2,4-D on the root growth in pdr9-2. Data points are averages from 10 seedlings. Standard deviations for all data points were ≤10% of the mean. D, Auxin-dependent expression of the DR5-GUS reporter in wild-type and pdr9-2 roots. Seven-day-old seedlings were transferred to auxin-containing media for 4 h and then stained for 4 h to detect GUS activity. pdr9-2 is on the left and wild type on the right in each image. Figure 2. Open in new tabDownload slide ETA4 encodes PDR9. A, Mutation sites of pdr9-1 and pdr9-2. Exons are indicated as boxes and introns are indicated as lines. B, RNA gel-blot analysis using total RNA prepared from Col and pdr9-2 seedlings. Ten micrograms of total RNA was loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). C, Effects of 2,4-D on the root growth in pdr9-2. Data points are averages from 10 seedlings. Standard deviations for all data points were ≤10% of the mean. D, Auxin-dependent expression of the DR5-GUS reporter in wild-type and pdr9-2 roots. Seven-day-old seedlings were transferred to auxin-containing media for 4 h and then stained for 4 h to detect GUS activity. pdr9-2 is on the left and wild type on the right in each image. ). At3g53480 has been designated as PDR9 among 15 PDR genes identified in Arabidopsis genome (van den Brule and Smart, 2002). Thus, we designated eta4 as pdr9-1. PDR9 contains 23 exons and encodes a 1,450-amino acid protein. A search of the SALK Institute's SIGnAL T-DNA database (Alonso et al., 2003) identified multiple lines containing a T-DNA insertion within the PDR9 locus (Fig. 2A). We confirmed the T-DNA insertion site in the third exon of SALK_050885, which we designated as pdr9-2. RNA gel-blot analysis detected a 4.5 kb transcript present in RNA prepared from wild-type seedlings and absent from homozygous pdr9-2 samples, suggesting that pdr9-2 is a likely null allele (Fig. 2B). We next examined the affect of 2,4-D on root growth of pdr9-2 seedlings. As shown in Figure 2C, pdr9-2 plants showed clear hypersensitivity to 2,4-D, with root growth almost completely inhibited at 0.01 μ m. Consistent with this finding, pdr9-2 seedlings also exhibited increased sensitivity to the 2,4-D-induced expression of the DR5-GUS (Ulmasov et al., 1997) reporter of auxin-regulated gene expression (Fig. 2D). IAA-mediated DR5-GUS expression, however, was unaffected in the pdr9-2 mutant (Fig. 2D). The contrasting 2,4-D phenotypes conferred by the semidominant pdr9-1 mutation and recessive pdr9-2 null mutation demonstrate that pdr9-1 is a gain-of-function mutation. Like the pdr9-1 mutant, however, pdr9-2 plants exhibited no detectable growth or developmental phenotype. PDR proteins are characterized by the possession of two predicted cytosolically oriented NBD domains linked to two multiple-pass hydrophobic TMDs in the arrangement NH2-NBD1-TMD1-NBD2-TMD2-COOH. A search of the ARAMEMON database predicted that PDR9 contains two sets of six-pass TMDs (Fig. 3A Figure 3. Open in new tabDownload slide The pdr9-1 mutation affects a highly conserved residue in NBD2. A, Schematic presentation illustrating PDR9 secondary structure and topology modified from the output from the ARAMENON database (see http://aramenon.botanik.uni-koeln.de) using 11 protein modeling algorithms. Double line indicates lipid bilayer. B, Amino acid alignment of the subregion of NBD2 surrounding the pdr9-1 mutation site (asterisk). The ABC signature, Walker B, and PDR signature 3 motifs (van den Brule and Smart, 2002) are overlined. Amino acid identity and similarity to AtPDR9 are indicated by black and gray shading, respectively. The second and third lines represent sequences from all 15 Arabidopsis and 22 rice PDR family members. Two dots indicate residues conserved in the majority of PDR proteins but with conservative substitutions in one or more family members. Single dots indicate residues conserved in the majority of PDR proteins but with nonconservative substitutions in one or more family members. ScPDR5 is a PDR protein from yeast. AtCER5 and AtPGP4 are two non-PDR members of the Arabidopsis family of ABC transporters. Figure 3. Open in new tabDownload slide The pdr9-1 mutation affects a highly conserved residue in NBD2. A, Schematic presentation illustrating PDR9 secondary structure and topology modified from the output from the ARAMENON database (see http://aramenon.botanik.uni-koeln.de) using 11 protein modeling algorithms. Double line indicates lipid bilayer. B, Amino acid alignment of the subregion of NBD2 surrounding the pdr9-1 mutation site (asterisk). The ABC signature, Walker B, and PDR signature 3 motifs (van den Brule and Smart, 2002) are overlined. Amino acid identity and similarity to AtPDR9 are indicated by black and gray shading, respectively. The second and third lines represent sequences from all 15 Arabidopsis and 22 rice PDR family members. Two dots indicate residues conserved in the majority of PDR proteins but with conservative substitutions in one or more family members. Single dots indicate residues conserved in the majority of PDR proteins but with nonconservative substitutions in one or more family members. ScPDR5 is a PDR protein from yeast. AtCER5 and AtPGP4 are two non-PDR members of the Arabidopsis family of ABC transporters. ). The mutation identified in pdr9-1 causes an Ala to Thr substitution at position 1,034 within the highly conserved plant PDR signature sequence adjacent to the Walker B motif of NBD2 (Fig. 3B). The Walker A and Walker B motifs, which are needed for ATP binding and hydrolysis, are highly conserved, even in distinct types of ABC transporter family members. The entire adjacent 12-amino acid PDR signature motif encompassing the Ala-1,034 residue affected in pdr9-1 (Fig. 3B) is absolutely conserved in all 15 Arabidopsis PDR proteins as well as in nearly all other plant PDR proteins present in available databases including 20 of the 23 rice PDRs. In contrast, this domain is not highly conserved between plant PDRs and other types of plant ABC transporters, or even between plant and fungal PDR proteins (Fig. 3B). This extreme sequence conservation strongly suggests that this motif plays an important role in plant PDR function. Expression Analysis of PDR9 We next analyzed PDR9 expression patterns by RNA gel-blot analysis of RNA prepared from various organs. The PDR9 mRNA was exclusively detected in roots (Fig. 4A Figure 4. Open in new tabDownload slide Expression analysis of PDR9. A, Organ-specific expression of PDR9. Ten micrograms of total RNA were loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). B, Effect of IAA, NAA, and 2,4-D on PDR9 expression. RT-PCR was performed using total RNA prepared from Col seedlings treated with or without 10 μ m IAA, NAA, or 2,4-D for 6 h. Expression of IAA5 was assessed as a positive control for the auxin treatment. ETA2 (Chuang et al., 2004) was used as a loading control. C and D, Localization of PPDR9-GUS in Arabidopsis seedlings. C, Seven-day-old seedling. Inset indicates the expression in stipules. D, Root tip of 7-d-old seedling. Figure 4. Open in new tabDownload slide Expression analysis of PDR9. A, Organ-specific expression of PDR9. Ten micrograms of total RNA were loaded per lane. Ethidium-bromide-stained RNA is shown as a loading control (rRNA). B, Effect of IAA, NAA, and 2,4-D on PDR9 expression. RT-PCR was performed using total RNA prepared from Col seedlings treated with or without 10 μ m IAA, NAA, or 2,4-D for 6 h. Expression of IAA5 was assessed as a positive control for the auxin treatment. ETA2 (Chuang et al., 2004) was used as a loading control. C and D, Localization of PPDR9-GUS in Arabidopsis seedlings. C, Seven-day-old seedling. Inset indicates the expression in stipules. D, Root tip of 7-d-old seedling. ). It has been reported that the expression of some ABC transporters, including the previously characterized Arabidopsis PDR12, is strongly induced by the application of their putative substrates (van den Brule and Smart, 2002; Lee et al., 2005). We therefore tested the possibility that PDR9 expression is induced by auxins (Fig. 4B). However, PDR9 expression was not affected by 2,4-D, IAA, or NAA treatments. The effect of auxin treatment was confirmed by the clear induction of IAA5 (Fig. 4B). We also examined the tissue-specific expression of PDR9 using transgenic plants carrying the PDR9 promoter fused with the GUS reporter. Strong GUS activity was observed throughout the root, with expression highest in the cells of the lateral root cap and epidermal cells at the root tip (Fig. 4, C and D). The only shoot expression that was detectable was in the stipules (Fig. 4C, inset). Consistent with our reverse transcription (RT)-PCR studies, exogenous auxins did not result in increased PPDR9-GUS expression (data not shown). Characterization of the PDR9 Protein To characterize the PDR9 protein, we raised polyclonal antisera against a recombinant 6xHis fusion protein containing the N-terminal 98 amino acids of PDR9. The α-PDR9 antisera detected a single band of approximately 160 kD in wild-type and pdr9-1 extracts prepared from Arabidopsis roots (Fig. 5A Figure 5. Open in new tabDownload slide Characterization of the PDR9 protein. A, Western-blot analysis of microsomal and supernatant fractions prepared from 8-d-old Arabidopsis roots. Eight micrograms of extract were loaded/lane. B, Western-blot (top) and RT-PCR (bottom) analyses of PDR9 levels. For the western blots, lanes 1 and 2 contain 8 μg of root microsomal extract, whereas lane 3 contains 4 μg. α-SEC12 was used as a loading control. For RT-PCR, 1 μg of total RNA were used to generate cDNAs in reverse transcriptase reactions. One microliter of the cDNAs were then used as template in lanes 1 and 2, while 0.5 μL was used in lane 3 (PDR9, 27 cycles; ETA2, 26 cycles). C, Aqueous two-phase fractionation of Arabidopsis microsomes prepared from wild-type roots. Crude microsomes (cMS): upper phase enriched in PMs; lower phase enriched in other membranes (OM). Figure 5. Open in new tabDownload slide Characterization of the PDR9 protein. A, Western-blot analysis of microsomal and supernatant fractions prepared from 8-d-old Arabidopsis roots. Eight micrograms of extract were loaded/lane. B, Western-blot (top) and RT-PCR (bottom) analyses of PDR9 levels. For the western blots, lanes 1 and 2 contain 8 μg of root microsomal extract, whereas lane 3 contains 4 μg. α-SEC12 was used as a loading control. For RT-PCR, 1 μg of total RNA were used to generate cDNAs in reverse transcriptase reactions. One microliter of the cDNAs were then used as template in lanes 1 and 2, while 0.5 μL was used in lane 3 (PDR9, 27 cycles; ETA2, 26 cycles). C, Aqueous two-phase fractionation of Arabidopsis microsomes prepared from wild-type roots. Crude microsomes (cMS): upper phase enriched in PMs; lower phase enriched in other membranes (OM). ). This band was completely absent in pdr9-2 microsomal extracts, confirming that the antiserum recognizes the PDR9 protein and that pdr9-2 is a likely null allele. Consistent with a predicted membrane localization, PDR9 was only detected in microsomal fractions. Interestingly, we observed a slight but consistent increase in PDR9 abundance in microsomal extracts prepared from pdr9-1 roots than from wild type (Fig. 5, A and B). Analysis of western blots of four independent sets of microsomal membrane preparations indicated that pdr9-1 roots contain approximately 1.8- ± 0.2-fold more PDR9 protein than wild-type controls. In contrast, we could detect no difference in PDR9 mRNA levels between wild type and pdr9-1 (Fig. 5B), suggesting that the mutation might confer increased protein stability, which could potentially account for its semidominant nature. To further investigate the subcellular localization of PDR9, microsomal extracts were subjected to aqueous two-phase partitioning. PDR9 fractionated almost exclusively to the plasma membrane (PM) enriched upper phase (Fig. 5C), as did the known PM protein PGP4 (Terasaka et al., 2005). In contrast, the endoplasmic reticulum-associated protein, SEC12, was highly enriched in the lower phase. We obtained identical results in two-phase fractionations with pdr9-1 microsomes, suggesting that the mutant protein is not altered in its membrane localization (data not shown). Effects of Additional Auxinic Compounds on pdr9 Mutants The finding that ETA4 encodes a PDR-type ABC transporter that localizes to the PM and affects sensitivity to 2,4-D but not the endogenous auxin IAA suggested that PDR9 might be involved in the cellular detoxification of xenobiotics. This led us to test the effects of several additional herbicides on our pdr9 mutants to further examine specificity. Because of its widespread usage in the agricultural and horticultural fields, several 2,4-D-related compounds have been developed that exhibit auxin-like activities. For example, 2,4-D, 4-chlorophenoxy-acetic acid, 4-chloro-2-methylphenoxy acetic acid, and 2,4,5-trichlorophenoxyacetic acid all share a 4-chloro-phenoxy ring, but differ in terms of the number of chloride or methyl groups present. As observed with 2,4-D, the gain-of-function and loss-of-function pdr9 alleles conferred opposing phenotypes in root growth inhibition assays with these 2,4-D-related herbicides (Fig. 6, A–C Figure 6. Open in new tabDownload slide Inhibition of root elongation by various auxin-related compounds. Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing various compounds as indicated and grown for an additional 4 d. The structures of chlorophenoxyl compounds are superimposed on graphs (A to D). Data points are averages from 10 seedlings. sds for all data points were ≤12% of the mean. Figure 6. Open in new tabDownload slide Inhibition of root elongation by various auxin-related compounds. Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing various compounds as indicated and grown for an additional 4 d. The structures of chlorophenoxyl compounds are superimposed on graphs (A to D). Data points are averages from 10 seedlings. sds for all data points were ≤12% of the mean. ). In contrast, wild-type and the pdr9 mutants exhibited similar sensitivity toward p-chlorophenoxyisobutyric acid, which has a 4-chloro-phenoxy ring with an isobutyric rather than an acetic acid group at position 1. This finding suggests that the acidic side chain may be an important determinant of specificity, however, it should be noted that the concentration of p-chlorophenoxyisobutyric acid necessary to inhibit root growth is considerably higher than these other auxins (Fig. 6D). We also examined sensitivities to the IAA derivatives indole-butyric acid, 4-Cl-IAA, and 4,5-Cl-IAA. The responsiveness to these IAA-related compounds in pdr9-2 plants was essentially the same as wild type, suggesting that PDR9 is not involved in their transport. However, while pdr9-1 plants responded normally to IAA and indole-butyric acid, they were slightly resistant to 4-Cl-IAA and even more so to 4,5-Cl-IAA (Fig. 6, E–H). These results suggest that the gain-of-function pdr9-1 mutation might affect substrate recognition and confer a broader range of substrate specificity. We also tested several concentrations of NAA, dicamba, picloram, abscisic acid, cycloheximide, Cu2+, Co2+, and Zn2+, but detected no significant differences between the pdr9 mutants and wild type (data not shown). pdr9-2 Is Hypersensitive to NPA Although neither pdr9 allele conferred any change in sensitivity to IAA or NAA, we wanted to further examine the possibility that PDR9 might be involved in auxin transport since several recent studies have implicated PGP/MDR subfamily members of ABC transporters in polar auxin flow (Geisler et al., 2003, 2005; Terasaka et al., 2005). We analyzed the gravitropic response of both pdr9 alleles by plate rotation and root curling assays, but could detect no significant changes from wild type in the gravitropism response (data not shown). However, when pdr9-2 seedlings were grown in the presence of the polar auxin transport inhibitor NPA, we observed a dramatic increase in sensitivity compared to wild type. pdr9-2 seedlings exhibited agravitropic root and hypocotyl growth on concentrations of NPA as low as 0.05 μ m, whereas wild-type and pdr9-1 seedlings were largely unaffected at this concentration (Fig. 7, A–F Figure 7. Open in new tabDownload slide pdr9-2 plants are hypersensitive to NPA treatment. A to F, Effects of NPA on seedling growth. Seedlings were grown in dark for 5 d with (B, D, and F) or without (A, C, and E) 0.05 μ m NPA. A and B, Wild type. C and D, pdr9-1. E and F, pdr9-2. Size bar = 1 cm. G, Inhibition of root elongation by NPA. Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing different concentration of NPA and grown for an additional 4 d. Data points are averages from 10 seedlings. sds for all data points were <10% of the mean. Figure 7. Open in new tabDownload slide pdr9-2 plants are hypersensitive to NPA treatment. A to F, Effects of NPA on seedling growth. Seedlings were grown in dark for 5 d with (B, D, and F) or without (A, C, and E) 0.05 μ m NPA. A and B, Wild type. C and D, pdr9-1. E and F, pdr9-2. Size bar = 1 cm. G, Inhibition of root elongation by NPA. Seedlings were grown on unsupplemented nutrient medium for 4 d and then transferred to medium containing different concentration of NPA and grown for an additional 4 d. Data points are averages from 10 seedlings. sds for all data points were <10% of the mean. ). We also examined the effect of NPA on root growth in quantitative root inhibition assays. pdr9-2 seedlings exhibited an approximately 100-fold increase in sensitivity compared to wild type and pdr9-1 (Fig. 7G). Altered 2,4-D and NPA Accumulation in pdr9 Mutants To confirm that the physiological responses observed in the pdr9 mutants were due to the altered transport of 2,4-D or NPA, we conducted accumulation assays using [14C]-2,4-D and [3H]-NPA. Based on the expression analysis of PDR9 (Fig. 4), root tips (apical 5 mm) were collected from 5-d-old seedlings and incubated in buffer containing labeled 2,4-D or NPA for 60 min. Following a brief rinse, the root tips were collected and radioactivity levels measured by liquid scintillation counting. Consistent with our physiological assays indicating that the pdr9 mutations confer altered 2,4-D sensitivity but do not affect IAA sensitivity, we observed significant hyperaccumulation and hypoaccumulation of [14C]-2,4-D in pdr9-2 and pdr9-1 roots, respectively (Fig. 8A Figure 8. Open in new tabDownload slide Altered transport of 2,4-D and NPA in pdr9 mutants. Root tips from 5-d-old Arabidopsis seedlings were excised and incubated in buffer containing radiolabeled [14C]-2,4-D (A), [3H]-IAA (B), or [3H]-NPA (C), rinsed briefly, and analyzed by scintillation counting. Values are the means from four or five independent experiments, each performed in duplicate. Figure 8. Open in new tabDownload slide Altered transport of 2,4-D and NPA in pdr9 mutants. Root tips from 5-d-old Arabidopsis seedlings were excised and incubated in buffer containing radiolabeled [14C]-2,4-D (A), [3H]-IAA (B), or [3H]-NPA (C), rinsed briefly, and analyzed by scintillation counting. Values are the means from four or five independent experiments, each performed in duplicate. ), but no difference in [3H]-IAA accumulation (Fig. 8B). When incubated with [3H]-NPA, pdr9-2 roots accumulated dramatically more label than wild-type roots (Fig. 8C). pdr9-1 root tips exhibited a slight, albeit statistically insignificant, reduction in [3H]-NPA. However, this minor difference between wild type and pdr9-1 was also seen with shorter labeling periods (15 or 30 min; data not shown), suggesting that NPA transport may also be affected by the pdr9-1 mutation. DISCUSSION Mutations in PDR9 Alter 2,4-D, But Not IAA Sensitivity In the past 20 years, numerous mutants exhibiting altered auxin sensitivity have been described. Since both IAA and the synthetic auxin 2,4-D are recognized by the same receptors, the TIR1/AFB family of F-box proteins (Dharmasiri et al., 2005a, 2005b), all auxin signaling mutants described to date exhibit altered response to both of these auxins. In contrast, several studies have demonstrated that major differences exist in the transport of IAA and 2,4-D, with the latter being a poor substrate for the polar auxin transport system (Delbarre et al., 1996; Morris et al., 2004). Our complementary findings with gain- and loss-of-function alleles of PDR9 indicate that this PDR-type ABC transporter specifically affects 2,4-D transport, resulting in altered sensitivity without affecting transport or sensitivity to the endogenous auxin, IAA. Using several physiological and molecular assays, we demonstrate that the pdr9-1 gain-of-function mutation specifically confers increased 2,4-D resistance. Reciprocally, the pdr9-2 null mutation confers 2,4-D hypersensitivity. These findings correlate precisely with [14C]-2,4-D accumulation assays that demonstrate the gain- and loss-of-function pdr9 mutants accumulate less or more 2,4-D, respectively, than wild-type controls. Given these findings, together with the likely PM localization of PDR9 suggested by our microsome fractionation studies, it is likely that PDR9 acts as a 2,4-D pump capable of effluxing 2,4-D out of plant cells. While our 2,4-D accumulation assays do not directly discriminate between 2,4-D influx and efflux, since the pdr9-2 null mutant hyperaccumulates 2,4-D resulting in increased sensitivity to the herbicide, one would need to invoke a mechanism whereby PDR9 normally negatively regulates a protein that imports 2,4-D in order for influx to be altered in the pdr9 mutants. 2,4-D can enter plant root cells via the putative auxin influx carrier AUX1 (Marchant et al., 1999). However, PDR9-mediated negative regulation of AUX1 activity seems highly unlikely given that [3H]-IAA accumulation was identical in wild type and the pdr9 mutants. We attempted to demonstrate that PDR9 can directly transport 2,4-D by expression in heterologous systems, but these experiments were unsuccessful, largely due to technical complications. First, we expressed PDR9 in yeast to try and complement the 2,4-D hypersensitivity conferred by a pdr5 mutation. However, PDR9 expression was somewhat toxic to yeast, conferring a severe slow-growth phenotype that made complementation difficult to ascertain. Additionally, membrane fractionation studies and expression of a PDR9-GFP construct both indicated that PDR9 did not localize to the PM properly in yeast. Other investigators have encountered similar difficulties in expressing plant PDR proteins in yeast (van den Brule et al., 2002; Crouzet et al., 2006). We also expressed PDR9 in Xenopus oocytes. Although we did observe a low level of PDR9 expression, we were unable to convincingly demonstrate any difference in 2,4-D efflux between injected and uninjected oocytes. Several recent findings have implicated members of the PGP/MDR subfamily of ABC transporters in polar auxin transport. However, none of our findings suggest that PDR9 plays a role in this important process. The pdr9 mutants exhibit normal IAA sensitivity, and are unaffected in auxin-mediated processes such as lateral root development and tropic growth responses. Furthermore, we show that the pdr9 mutations specifically affect the transport of 2,4-D and closely related synthetic auxins without altering IAA transport. Although the pdr9-2 mutant exhibits heightened sensitivity to the polar auxin transport inhibitor NPA, this is almost certainly due to the fact that this mutant hyperaccumulates NPA as we demonstrate in uptake assays with [3H]-NPA. This latter finding also demonstrates that plants can transport NPA and should be considered by those employing this inhibitor in auxin transport studies. What Is the Cellular Role of PDR9? A significant unresolved question from our study regards the normal cellular function of PDR9. Neither the pdr9-1 nor pdr9-2 mutants exhibit any growth or developmental phenotype. We addressed the possibility that this might be attributable to genetic redundancy by examining T-DNA insertion mutants of the most closely related Arabidopsis PDR family member, PDR5. Like the pdr9 mutants, neither pdr5 mutant (SALK_002380 and SALK_035106) exhibited a discernible growth phenotype (H. Ito and W.M. Gray, unpublished data). However, unlike pdr9-2, the pdr5 mutants did not exhibit altered sensitivity to 2,4-D or NPA. Furthermore, pdr5 pdr9-2 double mutants behaved exactly like pdr9-2 single mutants in 2,4-D dose-response assays, suggesting the two proteins are functionally distinct (H. Ito and W.M. Gray, unpublished data). Several recent findings have implicated AtPDR8, AtPDR12, and NpPDR1 in plant defense responses (Campbell et al., 2003; Stukkens et al., 2005; Kobae et al., 2006; Stein et al., 2006). These studies suggest that these transporters may extrude secondary metabolites with antimicrobial activity as part of the plant's response to pathogen infection. Most notably, atpdr8/pen3 mutants were isolated in a genetic screen for mutations conferring reduced resistance to the barley powdery mildew Blumeria graminis, while NpPDR1-silenced tobacco (Nicotiana tabacum) plants exhibit reduced resistance to Botrytis cinerea (Stukkens et al., 2005). Such studies suggest that PDR9 might also be involved in defense responses. We note that numerous cis-acting elements implicated in defense responses, including nine putative WRKY transcription factor-binding sites, are present within 650 bases of sequence upstream of the PDR9 transcription start site (W box; http://www.dna.affrc.go.jp/PLACE/). Strong expression in the lateral root cap and epidermis also suggests that PDR9 might function in communication processes between plant roots and other organisms in the rhizosphere. Additionally, PDR9 has been identified as being strongly inducible by the defense elicitor salicylic acid (https://www.genevestigator.ethz.ch; Zimmermann et al., 2004), however we were unable to verify this result in RT-PCR assays or with our PPDR9-GUS reporter lines (H. Ito and W.M. Gray, unpublished data). If the ability to act as a transporter of 2,4-D and related phenoxy acids is indicative of the endogenous substrate of PDR9, several phenolic secondary metabolites with antimicrobial activity including trans-cinnamic, ferulic, o-coumaric, and vanillic acid have all been identified in Arabidopsis root exudates following treatment with various pathogen elicitors (Walker et al., 2003). All of these compounds inhibit root growth at micromolar concentrations, however, we could detect no significant difference in response between wild type and the pdr9 mutants (H. Ito and W.M. Gray, unpublished data). Unfortunately, the root-specific expression pattern of PDR9 combined with the absence of an established quantitative assay for susceptibility to root-invading pathogens preclude us from readily examining the pdr9 mutants for altered pathogen resistance. The Gain-of-Function pdr9-1 Mutation The gain-of-function pdr9-1 mutation is highly intriguing given that it affects a domain that is extremely highly conserved in all plant PDR proteins identified to date. The proximity of this domain to the Walker motifs in the second NBD suggests that the mutation might act by increasing ATP binding or hydrolysis rates. We attempted to address this possibility using Escherichia coli expressed recombinant NBD2 in ATP hydrolysis assays as described for other ABC proteins (Jha et al., 2003). However, we could detect no activity with either the wild-type or mutant proteins. An alternative explanation was suggested by our α-PDR9 antibody studies, in which we observed a modest (approximately 1.8-fold) but consistent increase in PDR9 protein abundance in microsomal extracts prepared from pdr9-1 roots compared to wild type. Although the precise mechanism by which the pdr9-1 mutation acts requires further study, this result suggests that the mutation may confer increased protein stability. It should be noted that several ABC transporters, including the closely related yeast PDR5p, are relatively short-lived proteins subject to ubiquitin-mediated vacuolar proteolysis (Egner et al., 1995; Egner and Kuchler, 1996). Thus, an increase in PDR9 protein levels due to enhanced stability could account for the increased 2,4-D resistance observed in pdr9-1. Overexpression of AtPDR12 and its putative Spirodela ortholog, SpTUR2, in Arabidopsis confer increased resistance to the potential substrates lead and sclareol, respectively (van den Brule et al., 2002; Lee et al., 2005). We attempted to overexpress PDR9 from the cauliflower mosaic virus 35S promoter to further address this possibility but were unable to recover any transgenic lines expressing elevated levels of PDR9 (data not shown). Regardless of the mode of action of the pdr9-1 mutation, the fact that it occurs in the extremely highly conserved PDR signature sequence suggests that the gain-of-function affects might be transferable to other plant PDR transporters. If so, this could provide a novel means for engineering plants with increased xenobiotic resistance. Such an approach may be particularly effective if transporter activity can be increased to an even greater extent by more dramatic mutations of the PDR signature motif and/or in conjunction with overexpression. Recently, the ABC transporter encoded by the AtWBC19 gene was shown to confer kanamycin resistance when overexpressed in plants (Mentewab and Stewart, 2005). The authors noted that the development of AtWBC19 as a selectable marker provides an alternative to the bacterial-derived nptII gene, thus reducing the potential of horizontal transfer of resistance genes. The dominant nature of the pdr9-1 mutation suggests the potential for PDR9 to be similarly developed as a plant-derived selectable marker for 2,4-D resistance, as well as the development of crops resistant to the phenoxyalkanoic acid class of herbicides, yet which exhibit normal sensitivity to endogenous auxin. Little is known regarding the function of the vast majority of plant ABC transporters. As more is learned regarding the natural substrates of these transporters as well as their capacity to mobilize various xenobiotics, this family of proteins may develop into an important genetic resource for engineering plants with increased resistance to contaminated soils and potentially for the development of phytoremediation strategies. MATERIALS AND METHODS Plant Materials and Growth Conditions All Arabidopsis (Arabidopsis thaliana) lines used in this study are in the Col ecotype. Seedlings were grown under sterile conditions on ATS nutrient medium (Lincoln et al., 1990) under long-day lighting. Conditions for the mutagenesis and screen for eta − mutants have been previously described (Gray et al., 2003). Chemicals used in root growth assays were purchased from Sigma-Aldrich and dissolved in ethanol or dimethylsulfoxide as 1,000× stocks. For root growth assays, seedlings were grown on ATS nutrient media for 4 to 5 d, transferred to ATS media containing 2,4-D, NPA, 4-chloro-2-methylphenoxy acetic acid, etc., the position of the root tip marked, and then incubated an additional 4 d. The amount of root growth was measured and percent inhibition calculated versus growth on unsupplemented media. Map-Based Cloning of PDR9 Since the eta4/pdr9-1 mutation was semidominant, a total of 237 2,4-D-sensitive F2 seedlings from a cross between the mutant and ecotype Landsberg erecta (Ler) were used to map the eta4/pdr9-1 mutation using cleaved amplified polymorphic sequences and simple sequence length polymorphism markers. The mutation was initially mapped to an interval between markers nga162 and nga6 (http://www.arabidopsis.org). Additional markers were generated using the Cereon Arabidopsis polymorphism collection (Jander et al., 2002). Markers defining our final mapping interval were CER470292, which amplifies 144 and 135 bp fragments from Col and Ler, and CER470334, which amplifies 101 and 116 bp fragments from Col and Ler, respectively. Northern-Blot Analysis and RT-PCR Total RNA was isolated from various Arabidopsis organs as described by Chomczynski and Sacchi (1987). For RT-PCR, total RNA was extracted from seedlings using RNeasy plant kits (Qiagen) according to the manufacturer's instructions. Northern blots were performed with 10 μg total RNA/sample using standard techniques. For RT-PCR analysis, first-strand cDNA synthesis was performed using 1 μg RNA and M-MLV-RTase (Promega) following the manufacturer's instructions. Gene-specific primers were designed to allow detection of amplification products from contaminant genomic DNA using primers spanning one or more introns. The specific primers used in this study were PDR9-F4: GCGAAACTCAGAGCTTGTGA; PDR9-R1: AATGATGATTGATGAAGACT; ETA2-7F: GTGCTGTTGGTTACCGGTTTGGC; and ETA2-14R: CAGGAGGCGCATGTGATGCCAA. GUS Histochemical Staining A 2.3 kb fragment containing genomic sequence from upstream of the PDR9 locus through the first 33 bp of coding sequence was cloned in frame with the GUS coding sequence of pBI101.2 (CLONTECH). Seedlings were stained for GUS activity as previously described (Stomp, 1991). Antibodies A cDNA fragment encoding PDR9 amino acids 1 to 98 was cloned as an EcoRI-XhoI fragment into the pET30A Escherichia coli expression vector (Novagen). Expression was induced with isopropylthio-β-galactoside and the fusion protein purified on nickel-nitrilotriacetic acid agarose using standard protocols (Gray et al., 1999). The recombinant protein was eluted with imidazole and used to immunize a New Zealand white rabbit (Cocalico Biological). SEC12 and PGP4 antibodies were kindly provided by Drs. Tony Sanderfoot (University of Minnesota) and Angus Murphy (Purdue University). Microsomal Purification and Immunoblot Analysis Five hundred milligrams of root tissue from 8-d-old seedlings were homogenized on ice in 2 mL of buffer (250 mm sorbitol, 50 mm Tris-HCl, pH 8.0, 2 mm EDTA, 7 g/L polyvinylpyrrolidone, 5 mm dithiotoreitol, 0.5× proteinase inhibitor mix [Calbiochemistry], and 1 mm phenylmethylsulfonyl fluoride; Stukkens et al., 2005). The homogenate was centrifuged for 5 min at 10,000g at 4°C and the supernatant centrifuged again under the same conditions to remove cell debris. The resulting supernatant was spun 1.5 h at 20,000g at 4°C, and the final pellet suspended in 100 μL resuspension buffer (5 mm potassium phosphate buffer, pH 7.8, 330 mm Suc, 3 mm KCl, 0.5× proteinase inhibitor mix, and 1 mm phenylmethylsulfonyl fluoride). For the aqueous two-phase partitioning experiments, microsomes were prepared from 10-d-old roots (5g fresh weight) and fractionated according to Larsson et al. (1994). For immunoblotting, 5 μg of each protein sample solubilized for 15 min at 37°C in SDS sample buffer were subjected to SDS-PAGE (7.5% polyacrylamide) and transferred electrophoretically to nitrocellulose membranes (Amersham). Immunoblot procedures have been described previously (Gray et al., 1999). The antibody dilutions were 1:4,000 for α-PDR9, 1:4,000 for α-AtSEC12, and 1:3,000 for α-PGP4 antisera. Where indicated, quantification of immunoblots was performed using ImageJ with enhanced chemiluminescence exposures on preflashed autoradiography film. Labeling Assays Root tips (apical −5 mm) were excised from 5-d-old Arabidopsis seedlings and preincubated in uptake buffer (20 mm MES-KOH, pH 5.6, 10 mm Suc, 0.5 mm calcium sulfate). Then, tips were incubated in uptake buffer containing 250 nm [14C]-2,4-D, 250 nm [3H]-IAA, or 34 nm [3H]-NPA, respectively. After 60 min incubation, root tips were rinsed with same buffer and placed directly into liquid scintillation fluid. [5-3H]-IAA (20 Ci/mmol), [ring-14C (U)]-2,4-D (80 mCi/mmol), and [2,3,4,5-3H]-NPA (58 Ci/mmol) were obtained from American Radiolabeled Chemicals. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number BK001008 (PDR9). ACKNOWLEDGMENTS We thank Cereon Genomics for access to its Arabidopsis Polymorphism Collection, Dr. John Ward, the Salk Institute Genomic Analysis Laboratory, and the Arabidopsis Biological Resource Center for providing seed stocks, Drs. Anthony Sanderfoot and Angus Murphy for providing antibodies, technical advice, and thoughtful discussion. We are also grateful to Drs. Neil Olszewski, Paul Overvoorde, and John Ward for helpful comments on the manuscript. LITERATURE CITED Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al ( 2003 ) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301 : 653 – 657 Crossref Search ADS PubMed Bairoch A ( 1992 ) PROSITE: a dictionary of sites and patterns in proteins. Nucleic Acids Res 20 (Suppl): 2013 – 2018 Crossref Search ADS PubMed Campbell EJ, Schenk PM, Kazan K, Penninckx IA, Anderson JP, Maclean DJ, Cammue BP, Ebert PR, Manners JM ( 2003 ) Pathogen-responsive expression of a putative ATP-binding cassette transporter gene conferring resistance to the diterpenoid sclareol is regulated by multiple defense signaling pathways in Arabidopsis. Plant Physiol 133 : 1272 – 1284 Crossref Search ADS PubMed Chomczynski P, Sacchi N ( 1987 ) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162 : 156 – 159 PubMed Chuang HW, Zhang W, Gray WM ( 2004 ) Arabidopsis ETA2, an apparent ortholog of the human cullin-interacting protein CAND1, is required for auxin responses mediated by the SCF(TIR1) ubiquitin ligase. Plant Cell 16 : 1883 – 1897 Crossref Search ADS PubMed Crouzet J, Trombik T, Fraysse AS, Boutry M ( 2006 ) Organization and function of the plant pleiotropic drug resistance ABC transporter family. FEBS Lett 580 : 1123 – 1130 Crossref Search ADS PubMed Delbarre A, Muller P, Imhoff V, Guern J ( 1996 ) Comparison of mechanisms controlling uptake and accumulation of 2,4-dichlorophenoxy acetic acid, naphthalene-1-acetic acid, and indole-3-acetic acid in suspension-cultured tobacco cells. Planta 198 : 532 – 541 Crossref Search ADS PubMed Dharmasiri N, Dharmasiri S, Estelle M ( 2005 a) The F-box protein TIR1 is an auxin receptor. Nature 435 : 441 – 445 Crossref Search ADS PubMed Dharmasiri N, Dharmasiri S, Weijers D, Lechner E, Yamada M, Hobbie L, Ehrismann JS, Jurgens G, Estelle M ( 2005 b) Plant development is regulated by a family of auxin receptor F box proteins. Dev Cell 9 : 109 – 119 Crossref Search ADS PubMed Egner R, Kuchler K ( 1996 ) The yeast multidrug transporter Pdr5 of the plasma membrane is ubiquitinated prior to endocytosis and degradation in the vacuole. FEBS Lett 378 : 177 – 181 Crossref Search ADS PubMed Egner R, Mahe Y, Pandjaitan R, Kuchler K ( 1995 ) Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae. Mol Cell Biol 15 : 5879 – 5887 Crossref Search ADS PubMed Gaedeke N, Klein M, Kolukisaoglu U, Forestier C, Muller A, Ansorge M, Becker D, Mamnun Y, Kuchler K, Schulz B, et al ( 2001 ) The Arabidopsis thaliana ABC transporter AtMRP5 controls root development and stomata movement. EMBO J 20 : 1875 – 1887 Crossref Search ADS PubMed Geisler M, Blakeslee JJ, Bouchard R, Lee OR, Vincenzetti V, Bandyopadhyay A, Titapiwatanakun B, Peer WA, Bailly A, Richards EL, et al ( 2005 ) Cellular efflux of auxin catalyzed by the Arabidopsis MDR/PGP transporter AtPGP1. Plant J 44 : 179 – 194 Crossref Search ADS PubMed Geisler M, Kolukisaoglu HU, Bouchard R, Billion K, Berger J, Saal B, Frangne N, Koncz-Kalman Z, Koncz C, Dudler R, et al ( 2003 ) TWISTED DWARF1, a unique plasma membrane-anchored immunophilin-like protein, interacts with Arabidopsis multidrug resistance-like transporters AtPGP1 and AtPGP19. Mol Biol Cell 14 : 4238 – 4249 Crossref Search ADS PubMed Geisler M, Murphy AS ( 2006 ) The ABC of auxin transport: the role of p-glycoproteins in plant development. FEBS Lett 580 : 1094 – 1102 Crossref Search ADS PubMed Gray WM, del Pozo JC, Walker L, Hobbie L, Risseeuw E, Banks T, Crosby WL, Yang M, Ma H, Estelle M ( 1999 ) Identification of an SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana. Genes Dev 13 : 1678 – 1691 Crossref Search ADS PubMed Gray WM, Muskett PR, Chuang HW, Parker JE ( 2003 ) Arabidopsis SGT1b is required for SCF(TIR1)-mediated auxin response. Plant Cell 15 : 1310 – 1319 Crossref Search ADS PubMed Higgins CF ( 1992 ) ABC transporters: from microorganisms to man. Annu Rev Cell Biol 8 : 67 – 113 Crossref Search ADS PubMed Jander G, Norris SR, Rounsley SD, Bush DF, Levin IM, Last RL ( 2002 ) Arabidopsis map-based cloning in the post-genome era. Plant Physiol 129 : 440 – 450 Crossref Search ADS PubMed Jasinski M, Stukkens Y, Degand H, Purnelle B, Marchand-Brynaert J, Boutry M ( 2001 ) A plant plasma membrane ATP binding cassette-type transporter is involved in antifungal terpenoid secretion. Plant Cell 13 : 1095 – 1107 PubMed Jha S, Karnani N, Dhar SK, Mukhopadhayay K, Shukla S, Saini P, Mukhopadhayay G, Prasad R ( 2003 ) Purification and characterization of the N-terminal nucleotide binding domain of an ABC drug transporter of Candida albicans: uncommon cysteine 193 of Walker A is critical for ATP hydrolysis. Biochemistry 42 : 10822 – 10832 Crossref Search ADS PubMed Kepinski S, Leyser O ( 2005 ) The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435 : 446 – 451 Crossref Search ADS PubMed Klein M, Geisler M, Suh SJ, Kolukisaoglu HU, Azevedo L, Plaza S, Curtis MD, Richter A, Weder B, Schulz B, et al ( 2004 ) Disruption of AtMRP4, a guard cell plasma membrane ABCC-type ABC transporter, leads to deregulation of stomatal opening and increased drought susceptibility. Plant J 39 : 219 – 236 Crossref Search ADS PubMed Klein M, Perfus-Barbeoch L, Frelet A, Gaedeke N, Reinhardt D, Mueller-Roeber B, Martinoia E, Forestier C ( 2003 ) The plant multidrug resistance ABC transporter AtMRP5 is involved in guard cell hormonal signalling and water use. Plant J 33 : 119 – 129 Crossref Search ADS PubMed Kobae Y, Sekino T, Yoshioka H, Nakagawa T, Martinoia E, Maeshima M ( 2006 ) Loss of AtPDR8, a plasma membrane ABC transporter of Arabidopsis thaliana, causes hypersensitive cell death upon pathogen infection. Plant Cell Physiol 47 : 309 – 318 Crossref Search ADS PubMed Larsson C, Sommarin M, Widell S ( 1994 ) Isolation of highly purified plant plasma membranes and the separation of inside-out and right-side-out vesicles. Methods Enzymol 228 : 451 – 469 Crossref Search ADS Lee M, Lee K, Lee J, Noh EW, Lee Y ( 2005 ) AtPDR12 contributes to lead resistance in Arabidopsis. Plant Physiol 138 : 827 – 836 Crossref Search ADS PubMed Lincoln C, Britton JH, Estelle M ( 1990 ) Growth and development of the axr1 mutants of Arabidopsis. Plant Cell 2 : 1071 – 1080 PubMed Lu YP, Li ZS, Drozdowicz YM, Hortensteiner S, Martinoia E, Rea PA ( 1998 ) AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1. Plant Cell 10 : 267 – 282 PubMed Lu YP, Li ZS, Rea PA ( 1997 ) AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene. Proc Natl Acad Sci USA 94 : 8243 – 8248 Crossref Search ADS PubMed Marchant A, Kargul J, May ST, Muller P, Delbarre A, Perrot-Rechenmann C, Bennett MJ ( 1999 ) AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J 18 : 2066 – 2073 Crossref Search ADS PubMed Martinoia E, Klein M, Geisler M, Bovet L, Forestier C, Kolukisaoglu U, Muller-Rober B, Schulz B ( 2002 ) Multifunctionality of plant ABC transporters—more than just detoxifiers. Planta 214 : 345 – 355 Crossref Search ADS PubMed Mentewab A, Stewart CN Jr ( 2005 ) Overexpression of an Arabidopsis thaliana ABC transporter confers kanamycin resistance to transgenic plants. Nat Biotechnol 23 : 1177 – 1180 Crossref Search ADS PubMed Morris DA, Friml J, Zazimalova E ( 2004 ) Auxin transport. In PJ Davies, ed, Plant Hormones: Biosynthesis, Signal Transduction, Action! Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 437–470 Multani DS, Briggs SP, Chamberlin MA, Blakeslee JJ, Murphy AS, Johal GS ( 2003 ) Loss of an MDR transporter in compact stalks of maize br2 and sorghum dw3 mutants. Science 302 : 81 – 84 Crossref Search ADS PubMed Noh B, Murphy AS, Spalding EP ( 2001 ) Multidrug resistance-like genes of Arabidopsis required for auxin transport and auxin-mediated development. Plant Cell 13 : 2441 – 2454 PubMed Oono Y, Chen QG, Overvoorde PJ, Kohler C, Theologis A ( 1998 ) Age mutants of Arabidopsis exhibit altered auxin-regulated gene expression. Plant Cell 10 : 1649 – 1662 Crossref Search ADS PubMed Quint M, Ito H, Zhang W, Gray WM ( 2005 ) Characterization of a novel temperature-sensitive allele of the CUL1/AXR6 subunit of SCF ubiquitin-ligases. Plant J 43 : 371 – 383 Crossref Search ADS PubMed Sanchez-Fernandez R, Davies TG, Coleman JO, Rea PA ( 2001 ) The Arabidopsis thaliana ABC protein superfamily, a complete inventory. J Biol Chem 276 : 30231 – 30244 Crossref Search ADS PubMed Santelia D, Vincenzetti V, Azzarello E, Bovet L, Fukao Y, Duchtig P, Mancuso S, Martinoia E, Geisler M ( 2005 ) MDR-like ABC transporter AtPGP4 is involved in auxin-mediated lateral root and root hair development. FEBS Lett 579 : 5399 – 5406 Crossref Search ADS PubMed Schulz B, Kolukisaoglu HU ( 2006 ) Genomics of plant ABC transporters: the alphabet of photosynthetic life forms or just holes in membranes? FEBS Lett 580 : 1010 – 1016 Crossref Search ADS PubMed Stein M, Dittgen J, Sanchez-Rodriguez C, Hou BH, Molina A, Schulze-Lefert P, Lipka V, Somerville S ( 2006 ) Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration. Plant Cell 18 : 731 – 746 Crossref Search ADS PubMed Stomp A-M ( 1991 ) Histochemical localization of β-glucuronidase. In SR Gallagher, ed, GUS Protocols. Academic Press, London, pp 103–113 Stukkens Y, Bultreys A, Grec S, Trombik T, Vanham D, Boutry M ( 2005 ) NpPDR1, a pleiotropic drug resistance-type ATP-binding cassette transporter from Nicotiana plumbaginifolia, plays a major role in plant pathogen defense. Plant Physiol 139 : 341 – 352 Crossref Search ADS PubMed Teixeira MC, Sa-Correia I ( 2002 ) Saccharomyces cerevisiae resistance to chlorinated phenoxyacetic acid herbicides involves Pdr1p-mediated transcriptional activation of TPO1 and PDR5 genes. Biochem Biophys Res Commun 292 : 530 – 537 Crossref Search ADS PubMed Terasaka K, Blakeslee JJ, Titapiwatanakun B, Peer WA, Bandyopadhyay A, Makam SN, Lee OR, Richards EL, Murphy AS, Sato F, et al ( 2005 ) PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell 17 : 2922 – 2939 Crossref Search ADS PubMed Theodoulou FL ( 2000 ) Plant ABC transporters. Biochim Biophys Acta 1465 : 79 – 103 Crossref Search ADS PubMed Tommasini R, Vogt E, Fromenteau M, Hortensteiner S, Matile P, Amrhein N, Martinoia E ( 1998 ) An ABC-transporter of Arabidopsis thaliana has both glutathione-conjugate and chlorophyll catabolite transport activity. Plant J 13 : 773 – 780 Crossref Search ADS PubMed Ulmasov T, Murfett J, Hagen G, Guilfoyle TJ ( 1997 ) Aux/IAA proteins repress expression of reporter genes containing natural and highly active synthetic auxin response elements. Plant Cell 9 : 1963 – 1971 PubMed van den Brule S, Muller A, Fleming AJ, Smart CC ( 2002 ) The ABC transporter SpTUR2 confers resistance to the antifungal diterpene sclareol. Plant J 30 : 649 – 662 Crossref Search ADS PubMed van den Brule S, Smart CC ( 2002 ) The plant PDR family of ABC transporters. Planta 216 : 95 – 106 Crossref Search ADS PubMed Walker JE, Saraste M, Runswick MJ, Gay NJ ( 1982 ) Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold. EMBO J 1 : 945 – 951 Crossref Search ADS PubMed Walker TS, Bais HP, Halligan KM, Stermitz FR, Vivanco JM ( 2003 ) Metabolic profiling of root exudates of Arabidopsis thaliana. J Agric Food Chem 51 : 2548 – 2554 Crossref Search ADS PubMed Windsor B, Roux SJ, Lloyd A ( 2003 ) Multiherbicide tolerance conferred by AtPgp1 and apyrase overexpression in Arabidopsis thaliana. Nat Biotechnol 21 : 428 – 433 Crossref Search ADS PubMed Woodward AW, Bartel B ( 2005 ) Auxin: regulation, action, and interaction. Ann Bot (Lond) 95 : 707 – 735 Crossref Search ADS Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W ( 2004 ) GENEVESTIGATOR: Arabidopsis microarray database and analysis toolbox. Plant Physiol 136 : 2621 – 2632 Crossref Search ADS PubMed Author notes 1 This work was supported by the National Institutes of Health (grant no. GM067203 to W.M.G.) and a Japanese Society for the Promotion of Science Postdoctoral Fellowship for Research Abroad (to H.I.). * Corresponding authors e-mail [email protected]; fax 612–625–1738. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: William M. Gray ([email protected]). www.plantphysiol.org/cgi/doi/10.1104/pp.106.084533 © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)