Plant Physiology

Minorsky, Peter V.

doi: 10.1104/pp.104.900182pmid: N/A

Brassinosteroids and Nonclimacteric Fruit Ripening In contrast to climacteric fruit, where ethylene is pivotal, the hormonal control of ripening in grape (Vitis vinifera) and other nonclimacteric fruits is poorly understood. Brassinosteroids (BRs) are steroidal hormones, essential for normal plant growth and development but not previously implicated in the ripening of nonclimacteric fruit. Symons et al. (pp. 150–158) present evidence that increases in endogenous BR levels, but not indole-3-acetic acid or GA levels, are associated with ripening in grapes. The application of BRs to grape berries significantly promoted ripening, while brassinazole, an inhibitor of BR biosynthesis, significantly delayed fruit ripening. Putative grape homologs of genes encoding BR biosynthesis enzymes and the BR receptor were isolated. Expression analysis of these genes during berry development revealed transcript accumulation patterns that were consistent with a dramatic increase in endogenous BR levels at the onset of fruit ripening. These results provide evidence that changes in endogenous BR levels influence ripening in this nonclimacteric fruit. This may provide significant insights into the mechanisms controlling ripening in grapes, which has direct implications for the logistics of grape production and processing. On the Scent of a Rose Genomic approaches have led to the identification of several genes potentially involved in scent production by rose (Rosa sp.) petals. Two species of orcinol O-methyltransferases (OOMTs), encoded by two closely related genes (OOMT1 and OOMT2), catalyze the last two steps of the biosynthetic pathway leading to the production of the phenolic methyl ether 3,5-dimethoxytoluene (DMT), the major scent compound of many rose (Rosa hybrida) varieties (Fig. 1 Figure 1. Open in new tabDownload slide Not all roses smell the same. Chinese species, unlike their European counterparts, produce the phenolic methyl ether 3,5-dimethoxytoluene. The failure of European varieties to make this scent has been traced to a deficiency in functional orcinol O-methyltransferases. Figure 1. Open in new tabDownload slide Not all roses smell the same. Chinese species, unlike their European counterparts, produce the phenolic methyl ether 3,5-dimethoxytoluene. The failure of European varieties to make this scent has been traced to a deficiency in functional orcinol O-methyltransferases. ). Modern roses are descended from both European and Chinese species, the latter being producers of phenolic methyl ethers, but not the former. Scalliet et al. (pp. 18–29) have investigated why phenolic methyl ether production occurs in some but not all rose varieties. In DMT-producing varieties, OOMTs are localized specifically in the petal, predominantly in the adaxial epidermal cells. In these cells, OOMTs become increasingly associated with membranes during petal development, suggesting that the scent biosynthesis pathway catalyzed by these enzymes may be directly linked to the cells' secretory machinery. OOMT gene sequences were detected in two non-DMT-producing rose species of European origin, but no mRNA transcripts were detected and these varieties lacked both OOMT protein and enzyme activity. These data indicate that upregulation of OOMT gene expression may have been a critical step in the evolution of scent production in roses. Onset of Gravicompetency It is widely held that root gravisensing involves interactions between various cellular structures, such as statoliths, endoplasmic reticulum, actin microfilaments, and vacuoles. Many researchers favor the hypothesis that sedimenting amyloplasts exert a pressure on actin filaments that are connected to mechanosensitive ion channels in the plasma membrane, thereby leading to channel activation and a subsequent chain of events. However, much less is known about the onset of gravicompetency in seeds and whether those cellular structures that supposedly play a role in gravisensing are even present or functional at this stage of development. Ma and Hasenstein (pp. 159–166) have determined the precise inception of gravisensitivity in flax (Linum usitatissimum) roots by clinorotating germinating seeds after various periods of static orientation (gravistimulation). The onset of gravisensing was defined as the time needed to induce at least 50% of all the newly emerged roots to grow in the direction of the gravity vector. The time was measured from the onset of imbibition until the beginning of subsequent clinorotation. Gravitropic competency was established about 8 h after imbibition, 11 h prior to germination. Amyloplasts began to appear 10 to 12 h after imbibition, when the majority of the primary roots were found to be graviperceptive. After 12 h of imbibition, only the external layer of the root cap exhibited actin filaments and these were quite wispy. The actin cytoskeleton did not fully develop in the columella cells within the first 48 h after imbibition. Moreover, the microfilament inhibitor Latrunculin B did not affect the onset of gravisensitivity or germination. These results indicate that gravisensing is accompanied by the development of amyloplasts, and that the actin cytoskeleton is not required for gravisensing during seed germination. Thermotolerance Mechanism of Plant Mitochondria To gain insight into the temperature tolerance of seeds and seedlings, Stupnikova et al. (pp. 326–335) have characterized mitochondria from desiccation-tolerant seeds and from desiccation-sensitive pea (Pisum sativum) seedling epicotyls under a wide range of temperatures. The authors report that exogenous NADH is able to fuel respiration at temperatures where other substrates fail. Thus, NADH can power oxidative phosphorylation at surprisingly low temperatures around 0°C and even below in the case of seeds. Seed mitochondria exhibited remarkable temperature tolerance in response to both cold and heat stress, maintaining a well-coupled respiration between −3.5°C and 40°C (the proper functioning of seed mitochondria at −3.5°C may be the lowest recorded for any organism). In contrast, epicotyl mitochondria were inefficient below 0°C and uncoupled above 30°C. Both seed and epicotyl mitochondria exhibited an Arrhenius break temperature at 7°C, although they differed in phospholipid composition. Seed mitochondria had a lower phosphatidylethanolamine to phosphatidylcholine ratio and appeared less susceptible to lipid peroxidation. Contrary to the paradigm of homeoviscous adaptation, the extremely cold-resistant seed mitochondria had less unsaturated fatty acids. Seed mitochondria also accumulated large amounts of heat shock protein HSP22 and late embryogenesis abundant protein PsLEAm. The authors attribute the wide temperature tolerance of seed mitochondria to differences in membrane composition and to the accumulation of stress proteins involved in desiccation tolerance. Finally, the authors propose that a major physiological role for exogenous NADH oxidation is to enable oxidative phosphorylation to continue at low temperatures to maintain ATP levels. A Novel Mechanism of Lys Synthesis As in bacteria, Lys biosynthesis in plants occurs by way of a pathway that utilizes the intermediate diaminopimelic acid (DAP). However, three variants of the DAP pathway have been described in prokaryotes and it is not clear which, if any of them, occurs in plants. Hudson et al. (pp. 292–301) report the discovery of a new Lys biosynthesis pathway in Arabidopsis (Arabidopsis thaliana) that utilizes a novel transaminase that specifically catalyzes the interconversion of tetrahydrodipicolinate and ll-diaminopimelate. Because this single transaminase catalyzes the direct formation of ll-DAP from tetrahydrodipicolinate, it circumvents the DapD, DapC, and DapE steps of the acyl pathways found in prokaryotes. Indeed, the ll-DAP aminotransferase encoded by locus At4g33680 was able to complement the dapD and dapE mutants of Escherichia coli. This result in conjunction with the kinetic properties and substrate specificity of the enzyme, indicated that ll-DAP aminotransferase functions in the Lys biosynthetic direction under in vivo conditions. Orthologs of At4g33680 were identified in all the cyanobacterial species whose genomes have been sequenced. The Synechocystis sp. ortholog encoded by locus sll0480 showed the same functional properties as At4g33680. These results demonstrate that the Lys biosynthesis pathway in plants and cyanobacteria is distinct from the pathways that have so far been defined in microorganisms. This discovery adds a fourth variation to the list of DAP pathways found in nature. A Photorespiratory Mutant Mutants of the photorespiratory C2 cycle display a conditional-lethal phenotype in which they are unable to thrive at ambient conditions but grow normally under conditions, such as high CO2, that suppress photorespiration. Mitochondrial Ser hydroxymethyltransferase (SHMT) is one of the key enzymes of the photorespiratory C2 cycle. The Arabidopsis mutant shm (now designated shm1-1) is defective in mitochondrial SHMT activity and displays a lethal photorespiratory phenotype when grown at ambient CO2, but is virtually unaffected at elevated CO2. The Arabidopsis genome harbors seven putative SHM genes, two of which (SHM1 and SHM2) feature predicted mitochondrial targeting signals. Voll et al. (pp. 59–66) mapped shm1-1 to the position of the SHM1 gene (At4g37930) and determined that the mutation is due to a G→A transition at the 5′ splice site of intron 6 of SHM1, causing aberrant splicing and a premature termination of translation. Promoter β-glucuronidase analyses revealed that SHM1 is predominantly expressed in leaves while SHM2 is mainly transcribed in the shoot apical meristem and roots. The expression of wild-type SHM1 under the control of either the cauliflower mosaic virus 35S or the SHM1 promoter in shm1-1 abolished the photorespiratory phenotype of the shm mutant. Surprisingly, however, the expression of SHM2 in shm1-1 under control of either the cauliflower mosaic virus 35S or the SHM1 promoter failed to complement the photorespiratory shm phenotype, indicating that SHM2 either does not encode a fully functional SHMT protein or that the protein is not targeted to mitochondria. These findings unequivocally demonstrate that At4g37930 (AtSHM1) is crucial for plant growth in ambient air and for proper functioning of the C2 cycle. Author notes www.plantphysiol.org/cgi/doi/10.1104/pp.104.900182. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Orzaez, Diego; Mirabel, Sophie; Wieland, Willemien H.; Granell, Antonio

doi: 10.1104/pp.105.068221pmid: 16403736

Abstract Transient expression of foreign genes in plant tissues is a valuable tool for plant biotechnology. To shorten the time for gene functional analysis in fruits, we developed a transient methodology that could be applied to tomato (Solanum lycopersicum cv Micro Tom) fruits. It was found that injection of Agrobacterium cultures through the fruit stylar apex resulted in complete fruit infiltration. This infiltration method, named fruit agroinjection, rendered high levels of 35S Cauliflower mosaic virus-driven β-glucuronidase and yellow fluorescence protein transient expression in the fruit, with higher expression levels around the placenta and moderate levels in the pericarp. Usefulness of fruit agroinjection was assayed in three case studies: (1) the heat shock regulation of an Arabidopsis (Arabidopsis thaliana) promoter, (2) the production of recombinant IgA antibodies as an example of molecular farming, and (3) the virus-induced gene silencing of the carotene biosynthesis pathway. In all three instances, this technology was shown to be efficient as a tool for fast transgene expression in fruits. The generation of stably transformed transgenic plants to assess gene function is a lengthy manipulative process. As an alternative, foreign gene expression in plants is often performed by transient transformation of cells or tissues. Recently, Agrobacterium-mediated transient gene expression (agroinfiltration) in plant leaves has become the favorite choice in many gene functional analyses (Kapila et al., 1997; Yang et al., 2000; Goodin et al., 2002). When Agrobacterium cell cultures are infiltrated into the intercellular spaces of leaf parenchyma, the transfer of T-DNA into the plant cell nucleus becomes a highly efficient event. The most popular host plant for agroinfiltration is Nicotiana benthamiana; however, the power of the technique has been also described for other species like Medicago sativum (D'Aoust et al., 2004), lettuce (Lactuca sativa), tomato (Solanum lycopersicum), and Arabidopsis (Arabidopsis thaliana; Wroblewski et al., 2005) among others. Efficiency of agroinfiltration varies from host to host, some seeming recalcitrant to the technique. The reasons for the differences in efficiency are not well described, but surely topological factors are partly to blame (compactness of the tissue, innervations pattern, etc.), and bacteria-host compatibility factors cannot be discarded (Wroblewski et al., 2005). Even in the species with limited transfer efficiency, agroinfiltration is often used as delivery system for replicons that either move systemically (viral RNA genomes) or amplify locally (deconstructed Tobacco mosaic viruses; Marillonnet et al., 2005). Tomato fruit is a model for fleshy fruit development. Currently, several international efforts converge in the genomic characterization of tomato and related solanaceae species, including expressed sequence tags and genome sequencing projects (http://www.sgn.cornell.edu/). In addition, tomato fruits have been proposed as factories for the production of oral vaccines and other immunotherapeutic proteins (Sandhu et al., 2000; Jani et al., 2002; Ma et al., 2003; Walmsley et al., 2003). The lack of a high throughput transformation procedure and the length of time required to produce stable transgenic tomatoes make assessment of gene function and evaluation of xenoproteins in the tomato fruit a tedious and cumbersome process. We have developed an agroinfiltration-based system (agroinjection), which allows transient expression of foreign genes directly in fruit tissues. We tested agroinjection as an assay tool for transgene studies in three scenarios: (1) the study of promoter activity assisted by reporter genes; (2) the analysis of xenoprotein production in fruits, as exemplified by IgA antibodies; and (3) the study of gene function by virus-induced gene silencing (VIGS). RESULTS AND DISCUSSION Infiltration of Tomato Fruit Tissues with Agrobacterium The versatility of agroinfiltration in N. benthamiana leaves prompted us to test the possibility of establishing a similar approach in tomato fruits. We first tested several methods for mechanically introducing bacteria in the fruit cell apoplast. Progression of the infiltration was monitored with Agrobacterium cultures stained with methylene blue. Needle-free syringe infiltration was found ineffective as well as vacuum-assisted infiltration of intact, detached fruits (data not shown). Sliced or half-cut fruits were effectively infiltrated, but the procedure inflicted severe tissue damage and was therefore discarded. Finally, we tested the injection of infiltration media into the fruit using a syringe with needle. A similar approach for fleshy fruits described earlier in the literature produced only partial fruit infiltration, limiting the possible applications of the technique (Spolaore et al., 2001). We found that when tomato fruits (cv Micro Tom) were injected through the stylar apex with 600 μL of infiltration medium containing methylene blue-stained bacteria, the infiltration solution reached the entire fruit surface (Fig. 1 Figure 1. Open in new tabDownload slide Extent of agroinfiltration of tomato fruits using agroinjection. A, Fruit slices from tomatoes agroinjected with methylene blue-stained bacteria (left) and with an unstained culture (right). B, Close up from a tomato agroinjected with stained bacteria. Blue color reveals the tissues reached by the infiltrated culture. Figure 1. Open in new tabDownload slide Extent of agroinfiltration of tomato fruits using agroinjection. A, Fruit slices from tomatoes agroinjected with methylene blue-stained bacteria (left) and with an unstained culture (right). B, Close up from a tomato agroinjected with stained bacteria. Blue color reveals the tissues reached by the infiltrated culture. ). Upon dissection, blue staining was observed in the central lamella, placenta, and pericarp, but not in the seed and locular tissues. Blue-stained bacteria accumulated preferentially in the placenta with less intense staining in the pericarp. Fruit infiltration was possible both in attached and detached fruits, however in the latter case a more extense infiltration was obtained as the peduncle remained attached to the fruit. This prevented media leakage during the process as the excess of infiltration solution could only find a way off the apoplast through the hydathods located at the tip of the sepals. Agroinjection as a Transient Expression System Once infiltration in most fruit tissues was confirmed, we proceeded to test fruit agroinjection as a transient expression system of foreign genes using yellow fluorescence protein (YFP, a yellow version of green fluorescence protein) and β-glucuronidase (GUS) as reporter genes. Tomato fruits at mature green stage (22–25 d after anthesis) were agroinjected with a double-reporter plasmid pBIN-YFP/GUS containing YFP and GUS genes directed by the 35S promoter (Fig. 2 Figure 2. Open in new tabDownload slide Plant promoter-driven expression of reporter genes in tomato fruits. A, pBIN-YFP/GUS-agroinfiltrated tomato at 4 dpi showing YFP fluorescence in the placental tissue under UV light. B, Confocal microscope image of a similar sample showing YFP fluorescence in cells from the placenta-locule transition zone. C, Histochemical GUS staining of a pBIN-YFP/GUS-agroinfiltrated tomato. D, Close up of the seed-placenta joining region decorated with GUS staining. E, Time course of glucuronidase activity in agroinfiltrated tomatoes. Bars show the average activity (pmol methylumbelliferone × g fresh weight−1 × min−1) of four tomatoes per time point ± sd. F, Heat shock induction of GUS activity directed by Arabidopsis HSP70 promoter. pHSP70∷GUS-agroinjected tomatoes at 4 dpi were separated in two halves and incubated for 6 h at 42°C and 25°C, respectively. Graph compares GUS-specific activity (pmol methylumbelliferone × μg protein−1 × h−1) of heat-shocked pieces (gray bars) with the negligible specific activity of control pieces (black bars). Figure 2. Open in new tabDownload slide Plant promoter-driven expression of reporter genes in tomato fruits. A, pBIN-YFP/GUS-agroinfiltrated tomato at 4 dpi showing YFP fluorescence in the placental tissue under UV light. B, Confocal microscope image of a similar sample showing YFP fluorescence in cells from the placenta-locule transition zone. C, Histochemical GUS staining of a pBIN-YFP/GUS-agroinfiltrated tomato. D, Close up of the seed-placenta joining region decorated with GUS staining. E, Time course of glucuronidase activity in agroinfiltrated tomatoes. Bars show the average activity (pmol methylumbelliferone × g fresh weight−1 × min−1) of four tomatoes per time point ± sd. F, Heat shock induction of GUS activity directed by Arabidopsis HSP70 promoter. pHSP70∷GUS-agroinjected tomatoes at 4 dpi were separated in two halves and incubated for 6 h at 42°C and 25°C, respectively. Graph compares GUS-specific activity (pmol methylumbelliferone × μg protein−1 × h−1) of heat-shocked pieces (gray bars) with the negligible specific activity of control pieces (black bars). ). High levels of glucuronidase activity were detected in agroinjected fruits 4 d after agroinfiltration (Fig. 2E). GUS activity decreased thereafter until ripening. At ripen stages (9 d post injection [dpi]), measurement of GUS activity using standard techniques was unreliable probably due to endogenous activity (data not shown). Under UV light, high levels of yellow fluorescence were clearly visible around the placenta tissue of 4-dpi fruits (Fig. 2A). Confocal microscopy confirmed nucleocytoplasmic localization of plant-expressed YFP (Fig. 2B). Occasionally, strong YFP fluorescence was also observable at the inner side of the pericarp (data not shown). Histochemical GUS staining of 4-dpi fruits revealed a pattern similar to that found for YFP (Fig. 2, C and D); however, moderate levels of GUS staining were also found in the pericarp, probably due to the higher sensibility of the method (Fig. 2C). Interestingly, despite our efforts, agroinfiltration of tomato leaves with pBIN-YFP/GUS constructs rendered no YFP fluorescence and negligible levels of GUS activity (data not shown). Since the 35S promoter is known to be active in tomato leaves of stably transformed plants, this observation seems to indicate that tissue susceptibility to Agrobacterium infection plays and important role in the efficiency of agroinfiltration methodology. The capacity for modulating transgene expression using agroinjection was tested with a construct containing the Arabidopsis heat shock-regulated promoter HSP70B fused to GUS (Aparicio et al., 2005). Four pHSP70B:GUS-agroinjected tomatoes were incubated 3 dpi in the plant, and then harvested and cut in two halves, one of the pieces incubated 6 h at 42°C and the other left at 25°C for the same period of time. As shown in Figure 2F, the pHSP70B:GUS-agroinjected tomato fruits showed the capacity to activate HSP70B promoter in response to heat shock in all the samples tested. Together, these observations indicate that reporter genes can be efficiently expressed in fruit tissues via agroinjection, retaining the capacity to modulate transcription in response to environmental (temperature) factors. We found that the spatial expression patterns observed with agroinjection seem at least partially governed by constraints imposed by the fruit architecture and the ability of the bacteria to reach the different tissues in the fruit. For instance, maximum expression levels are normally observed in the placenta, probably because it constitutes a diffusion barrier in the apoplastic network of the fruit. Consequently, interpretation of the spatial expression patterns obtained by agroinjection should take these considerations into account. Xenoprotein Expression: Recombinant Antibodies Production of xenoproteins in edible fruits has important biotechnological implications particularly for the production of recombinant products with oral therapeutic activity (Walmsley and Arntzen, 2003). Despite the advantages offered by fruits, their use as production platforms is often hampered by low yields and poor protein stability. Xenoprotein production at high yields requires construct selection and optimization, preferably in the same tissue/organ in which the final production is intended, and therefore efficient transient expression systems are much needed. Technologies for fruit transient expression available so far (i.e. biolistics) fail to render sufficient yields for, for example, western evaluation. We are particularly interested in the production of IgA antibodies in fruits. IgAs are candidates for oral delivered microbicides as they play a role in the passive protection of mucosa against pathogen invasion (Corthesy, 2002). Two chicken IgA antibodies, n8 and n10, both selected from an anti-Eimeria-enriched recombinant library (Wieland et al., 2006), were chosen for fruit agroinjection. Previous expression studies in N. benthamiana leaves indicated that n8 and n10, despite sharing a common constant frame, show drastic differences in expression levels (Wieland, 2004). We used agroinjection as a method to study differential antibody stability directly in the fruit. Agrobacterium cultures carrying antibody heavy chains (HCs; HC8 or HC10) and light chains (LCs; LC8 or LC10) under the control of 35S promoter (Fig. 3A Figure 3. Open in new tabDownload slide Expression of full IgA antibodies in tomato fruits. A, Schematic structure of pBINIgL and pBINIgH constructs. Black arrows represent cloning sites for phage display-derived variable sequences. B, Western analysis of tomato fruits agroinfiltrated with IgA antibody chains. Two phage display-derived clones (n8 and n10) were assayed. Tomatoes were infiltrated with cultures containing pBIN-IgL (L8 and L10 lanes), pBIN-IgH (H8 and H10 lanes), or coinfiltrated with a combination of HCs and LCs (A8 = L8 + H8; A10 = L10 + A10). Blots were decorated with anti-chicken IgH (alpha-specific) antibody (top section), anti-chicken LC (middle section), or anti-chicken IgY whole-molecule recognizing the native structure of chicken antibody (IgY and IgA share the same IgL in chicken). Figure 3. Open in new tabDownload slide Expression of full IgA antibodies in tomato fruits. A, Schematic structure of pBINIgL and pBINIgH constructs. Black arrows represent cloning sites for phage display-derived variable sequences. B, Western analysis of tomato fruits agroinfiltrated with IgA antibody chains. Two phage display-derived clones (n8 and n10) were assayed. Tomatoes were infiltrated with cultures containing pBIN-IgL (L8 and L10 lanes), pBIN-IgH (H8 and H10 lanes), or coinfiltrated with a combination of HCs and LCs (A8 = L8 + H8; A10 = L10 + A10). Blots were decorated with anti-chicken IgH (alpha-specific) antibody (top section), anti-chicken LC (middle section), or anti-chicken IgY whole-molecule recognizing the native structure of chicken antibody (IgY and IgA share the same IgL in chicken). ) were agroinjected, either separately or in combination. In the latter case, high cotransformation rates will ensure coexpression of HCs and LCs, rendering assembled IgAs. Antibody expression in fruits was monitored by western blot detecting HCs (top section), LCs (middle section), and complexed IgAs (bottom section; Fig. 3B). Here, it can be observed that LCs do not accumulate when expressed alone (middle section, lanes L8 and L10). Conversely, HCs injected without partner LC render a single specific fragment (α1) of aproximately 55 kD (top section, lanes H8 and H10), therefore smaller than the expected 75 kD of chicken αHC. Interestingly, when HC10 and LC10 were coinfiltrated, LC10 became detectable (middle section, A10 lane), and the anti-αHC antibody detected a high molecular mass band (α2; lane A10, top section) whose mobility is compatible with a full-size chicken αHC. The presence of these two characteristic major bands (α1 and α2) was also observed in many chicken IgAs produced in N. benthamiana (Wieland, 2004). Taken together, the results indicate that chicken antibody chains require the presence of a cognate chain for stabilization. LCs are apparently not stable when expressed alone, whereas HCs are probably degraded into a proteolytic product (α1) in the absence of cognate LC. The presence of assembled IgA antibodies is shown in Figure 3B (bottom section) under nonreducing conditions. As can be observed, coexpression of HC and LC from n10 antibody rendered IgA complexes detected as high molecular mass bands (max 200 kD approximately). The complex pattern of bands found for n10 under nonreducing conditions has been described for other plant-made antibodies (Sharp and Doran, 2001) and probably reveals the presence of degradation products. No IgA complexes were detected in the case of n8 antibody (Fig. 3B, bottom section, lane A8). The simplest explanation for this is that LC8 is not stable when expressed in plants. This also will explain the absence of a full-size α2 band when HC8 and LC8 are coinfiltrated (Fig. 3B, top section, lane A8). However, other explanations involving HC8/LC8 mutual compatibility cannot be excluded. The cotransformation efficiency of the system is remarkable as demonstrated by the mutual stabilization effect found between HCs and LCs of n10 antibody. The differential idiotype stability found in the case of n8 and n10 has also been described for antibodies produced in mammalian systems (Bentley et al., 1998) and underlines the need for selection of stable antibodies prior to plant stable transformation. This is, to our knowledge, the first report of full-size antibodies being expressed in fruits. Our observations therefore confirm that agroinjection can contribute to expand the possibilities of fruit-based xenoprotein production by providing a fast and efficient in fruit selection step. Fruit VIGS VIGS has emerged as a powerful tool for functional genomics. A Tobacco rattle virus (TRV)-based system (pTRV1/2) has been proven effective in tomato plants previously (Liu et al., 2002). In the original pTRV1/2 protocol, leaves from young plants are agroinfiltrated with pTRV1 and pTRV2, simultaneously. Upon infiltration, reconstructed viruses move systemically, expanding the silencing signal through the plant. We reasoned that fruit agroinjection could represent a shortcut to whole-plant VIGS for the study of gene function in fruit-specific processes. To test the efficiency of agroinjection as a delivery system for fruit VIGS, we agroinjected fruits at different developmental stages with a combination of pTRV1 and TRV2-tPDS, the latter containing a fragment of phytoene desaturase (PDS), a key enzyme in the carotene biosynthesis route. Silencing of PDS was previously shown to induce a photobleaching phenotype in leaves (Ratcliff et al., 2001; Liu et al., 2002) due to chlorophyll degradation. In the case of tomato fruits, it is known that mutations in the carotenoid biosynthesis gene phytoene synthase produce yellow fruit coloration due to the accumulation of flavonoids (chalconaringenin) and the absence of red pigment lycopene, which is normally produced downstream in the carotenoid biosynthesis pathway (Fig. 4H Figure 4. Open in new tabDownload slide PDS silencing in tomato. A, Systemically (leaf-infiltrated) PDS-silenced plant showing photobleaching phenotype in leaves and fruits. B, Mature fruit from systemically (leaf-infiltrated) PDS-silenced plant showing red (LR) and yellow/orange (LO) sectors. C, Example of color evolution during ripening of Micro Tom fruits: G, green; B, breaker; O, yellow/orange; R, red; S, yellow/orange fruits showing different degrees of red pigmented sectors (ranging from S1 to S4). D, Fruits agroinjected with pTRV1/2-tPDS (S) or pTRV1 alone (R) showing drastic differences in red pigmentation at maturity. E, Longitudinal section of a mature tomato from a PDS-silenced plant showing internal red-yellow sectors. F, Close up of E showing viviparism in the yellow sector. G, Evolution of color in a group of 140 tomatoes agroinjected either with pTRV1/2-tPDS (left) or control pTRV1 (right) Agrobacterium cultures. Color was recorded for every tomato during 4 weeks (W1 to W4). Color categories were defined as in C. Number of tomatoes in every category is shown as a percentage of the total number of fruits. S category includes silenced fruits as well as a small number of nonsilenced fruits that were rapidly turning into red from the orange stage. H, Schematic representation of lycopene synthesis route in tomato. Figure 4. Open in new tabDownload slide PDS silencing in tomato. A, Systemically (leaf-infiltrated) PDS-silenced plant showing photobleaching phenotype in leaves and fruits. B, Mature fruit from systemically (leaf-infiltrated) PDS-silenced plant showing red (LR) and yellow/orange (LO) sectors. C, Example of color evolution during ripening of Micro Tom fruits: G, green; B, breaker; O, yellow/orange; R, red; S, yellow/orange fruits showing different degrees of red pigmented sectors (ranging from S1 to S4). D, Fruits agroinjected with pTRV1/2-tPDS (S) or pTRV1 alone (R) showing drastic differences in red pigmentation at maturity. E, Longitudinal section of a mature tomato from a PDS-silenced plant showing internal red-yellow sectors. F, Close up of E showing viviparism in the yellow sector. G, Evolution of color in a group of 140 tomatoes agroinjected either with pTRV1/2-tPDS (left) or control pTRV1 (right) Agrobacterium cultures. Color was recorded for every tomato during 4 weeks (W1 to W4). Color categories were defined as in C. Number of tomatoes in every category is shown as a percentage of the total number of fruits. S category includes silenced fruits as well as a small number of nonsilenced fruits that were rapidly turning into red from the orange stage. H, Schematic representation of lycopene synthesis route in tomato. ; Fray and Grierson, 1993). A similar yellow/orange phenotype has been reported when the isoprenoid biosynthesis route was chemically inhibited with fosmidomycin (Rodriguez-Concepcion et al., 2001). Accordingly, effective PDS silencing in tomato fruits should result in an orange fruit phenotype. We conducted two PDS-VIGS strategies. On one hand, we performed direct fruit agroinjection to assess its potential as a shortcut for functional gene analysis. In parallel, we followed systemic VIGS using standard inoculation procedures (Liu et al., 2002), aiming to compare and eventually validate the silencing phenotypes obtained with agroinjection. For systemic VIGS, cotyledons and first leaves from six 2-week-old plants were extensively agroinfiltrated with a TRV1/2-tPDS mix. Five of the plants developed silencing symptoms in the leaves. PDS silencing was also evident in fruits as white sectors in several young fruits in four of the plants (Fig. 4A). At maturity, green sectors turned temporally yellow/orange and immediately developed into red, whereas white sectors remained yellow/orange, a clear sign of impaired lycopene accumulation (Fig. 4B). In total, 66% of the fruits from the four fruit-silenced plants (roughly 44% of all fruits in the experiment) showed silencing symptoms (n = 54), with yellow/orange sectors expanding between 10% and 100% of the whole fruit surface. For local VIGS experiments, a total of 140 green fruits at different developmental stages (ranging from 7–24 DPA) were agroinjected, 71 of them with pTRV1/2-PDS mix and the remaining 69 using a control pTRV1 plasmid. Color changes were recorded, with color evolution divided in standard stages (Green, Breaker, Yellow/Orange, and Red; see Fig. 4C). An additional intermediate stage was defined in our experiments, named as S, corresponding to fruits at the yellow/orange stage showing also some red sectors. Control fruits that were scored as S developed rapidly into red, whereas most (61%) of pTRV1/2-PDS tomatoes remained arrested in S stage. The extension of red sectors in S-arrested tomatoes differed among fruits (ranging from S1 to S4 as depicted in Fig. 4C). Fruits arrested at S stage resembled those obtained with systemic PDS-VIGS (Fig. 4B), and therefore we concluded that they were locally silenced in PDS. Figure 4G shows the color evolution during the 4-week experiment. Only 4% of the TRV1/2-PDS fruits (three out of 71) developed into fully red tomatoes, in contrast with the 80% of the controls that turned red (95% if abscised fruits are excluded). Interestingly, the only three TRV1/2-PDS tomatoes that turned red were in late mature-green stage when injected and probably received the silencing signal too late to arrest lycopene accumulation. The remaining 34% of the fruits abscised prior to reaching maturation. This fraction was composed mainly by very young fruits (between 1 and 2 weeks post anthesis), which apparently could not cope with the injury/stress caused during manipulation. It is worth noticing that, excluding abscised fruits, 95% of the TRV1/2-tPDS tomatoes that remained attached to the plant until the end of the experiment (26 d) showed PDS silencing symptoms (S arrest). Occasionally, nontreated fruits growing in the same truss as agroinjected fruits developed also yellow sectors similar to those found in systemic silenced fruits, indicating systemic transmission of silencing signals from fruit to fruit (data not shown). Deleterious side effects of fruit agroinjection appeared mainly in young fruits, both silenced and controls, and consisted in growth arrest, premature ripening, and abscission. To minimize side effects, we restricted the temporal window of treatment to green fruits between 20 and 25 DPA (at the beginning of mature green stage), giving time to silencing signals to take effect on developmental processes occurring from this point (ripening) but minimizing shedding off. Under these conditions, efficiency of PDS silencing was maintained at levels ranging between 87% and 91% in two different experiments (n = 24), with fruit abscission reduced to 4% and 8%, respectively. We also observed that concentration of Agrobacterium cultures could be reduced to optical density = 0.3 without significant changes in the efficiency of silencing (data not shown). It is worth noting that PDS-silenced fruits often showed viviparous seed germination. In fruits silenced systemically, where often PDS-silenced sectors divide the fruit in two clearly defined parts, it was particularly noteworthy that premature seed germination was restricted to the yellow half of the fruit (Fig. 4, E and F). Reduced dormancy has been described before in the abscisic acid (ABA)-deficient sitiens mutant (Groot and Karssen, 1992). Since the precursors of ABA synthesis are derived from the carotene route, viviparous seeds could result from a reduction of ABA levels in PDS-silenced fruits as a consequence of the inhibition of carotene biosynthesis. Further characterization of the PDS-silenced phenotype was carried out both in agroinjected and systemically silenced fruits. PDS mRNA levels were measured by quantitative PCR in silenced and nonsilenced fruit pericarp. As shown in Figure 5A Figure 5. Open in new tabDownload slide Effect of PDS silencing in tomato fruits. A, Relative abundance of PDS mRNA in pericarp from silenced tomatoes. Samples are defined as in Figure 4: LR, red sectors of systemically silenced tomatoes; LO, yellow/orange sectors of systemically silenced tomatoes; S, pericarp from pTRV1/2-tPDS-agroinjected tomatoes arrested at S stage. Relative mRNA levels were calculating using pricarp from TRV1-agroinjected red tomatoes (R) as a reference for the calculations. B, Carotene chromatographic profiles of the same samples as in A. C, Relative levels of lycopene (black bars) and the PDS substrate phytoene (white bars) in pericarp samples. Metabolite levels are given as a percentage of the total carotenoid content in every sample. Figure 5. Open in new tabDownload slide Effect of PDS silencing in tomato fruits. A, Relative abundance of PDS mRNA in pericarp from silenced tomatoes. Samples are defined as in Figure 4: LR, red sectors of systemically silenced tomatoes; LO, yellow/orange sectors of systemically silenced tomatoes; S, pericarp from pTRV1/2-tPDS-agroinjected tomatoes arrested at S stage. Relative mRNA levels were calculating using pricarp from TRV1-agroinjected red tomatoes (R) as a reference for the calculations. B, Carotene chromatographic profiles of the same samples as in A. C, Relative levels of lycopene (black bars) and the PDS substrate phytoene (white bars) in pericarp samples. Metabolite levels are given as a percentage of the total carotenoid content in every sample. , a significant reduction on PDS mRNA levels was observed in all silenced samples when compared with control red pericarp from the same age. Yellow/orange tissue from systemic PDS-silenced fruits showed very low levels of mRNA accumulation, indicating a very effective silencing. Slightly lower inhibition levels were found in locally PDS-silenced fruits. Interestingly, red sectors in systemic PDS-silenced tomatoes also showed up to 4 times reduction in PDS mRNA when compared with nonsilenced controls, without effects in tissue color. Finally, the carotenoid profile of the different samples was also determined (Fig. 5B). As expected, PDS-silenced pericarp produced low levels of lycopene, accumulating instead the PDS substrate phytoene (Fig. 5C). Carotene profiles correlated with PDS mRNA levels except for red pericarp in systemic PDS-silenced fruits, where lycopene accumulates at similar levels than control red tissue despite the lower PDS mRNA levels. This suggests that PDS mRNA levels need to reach a certain threshold in order to trigger lycopene accumulation. Final Remarks We have analyzed here the potential of agroinjection for transient expression in tomato fruits. As with any invasive methodology, agroinjection carries certain limitations that should be kept in mind in the design of experiments. The massive presence of Agrobacterium cells in the fruit can induce side effects that should be minimized, e.g. reducing culture concentration and/or incubation times when possible. Appropriate control treatments including agroinfiltrated fruits should be included in any experimental design. With the appropriate controls in place, we have shown that agroinjection is a useful tool for fruit biology. It functions as a fast-construct testing methodology, in the study of promoter regulation, as exemplified with pHSP70B∷GUS reporter fusion, in the study xenoprotein expression and stability, as shown in the production of IgA antibodies, and, finally, as a shortcut in VIGS functional gene analysis Moreover, agroinjection may be very helpful when assaying fruit gene constructs that may interfere with plant developmental processes. While this manuscript was in preparation, Fu and collaborators published a description of virus-induced gene silencing in tomato fruits using several pTRV1/2 delivery methods, which included syringe infiltration of the fruits (Fu et al., 2005). In their report, the authors showed that local fruit infiltration (cv Lichum and cv Ailsa Craig) with VIGS vectors encoding LeEIL and LeEIN2 genes from the ethylene perception route resulted in green, ripening-impeded fruit sectors. Our results reported here on the possibility of establishing a VIGS system in tomato fruits are fully supported by the results shown by Fu et al. (2005). Interestingly, the green/red sectorization produced by the manipulation of ethylene route differed from the yellow/red sectorization reported here, beautifully indicating that accumulation of the flavonoid chalconaringenin is probably an ethylene-dependent event. A relevant contribution of our system is the total fruit infiltration obtained with agroinjection of small-sized Micro Tom fruits, which can contribute to an increase in the efficiency of the silencing. This is an important consideration because adaptation of fruit VIGS to gene functional screenings requires a strong and reliable system that maximizes both the percentage of silenced fruits and the silenced surface in each fruit, so that the requirement for silencing markers (Chen et al., 2004) can be eliminated. MATERIALS AND METHODS Agrobacterium-Based Transient Transformation Agrobacterium cultures (5 mL) were grown overnight from individual colonies at 28°C in YEB medium plus selective antibiotics, transferred to 50 mL induction medium (0.5% beef extract, 0.1% yeast extract, 0.5% Peptone, 0.5% Suc, 2 mm MgSO4, 20 μ m acetosyringone, 10 mm MES, pH 5.6) plus antibiotics, and grown again overnight. Next day, cultures were recovered by centrifugation, resuspended in infiltration medium (10 mm MgCl2, 10 mm MES, 200 μ m acetosyringone, pH 5.6; optical density = 1.0 unless stated otherwise), and incubated at room temperature with gentle agitation (20 rpm) for a minimum of 2 h. Cultures were combined when required, collected with a syringe, and injected in the fruits as described below. In methylene blue experiments, cells were incubated for 5 min in infiltration medium containing 0.05% methylene blue, recovered by centrifugation, washed twice with infiltration medium, and agroinjected. Agroinjection was performed as follows. Tomato fruits (Solanum lycopersicum cv Micro Tom) at different stages of development were infiltrated using a 1-mL syringe with a 0.5-×16-mm needle (BD Pastipak). Needle was introduced 3 to 4 mm in depth into the fruit tissue through the stylar apex, and the infiltration solution was gently injected into the fruit. The total volume of solution injected varied with the size of the fruit, with a maximum of 600 μL in mature green tomatoes. The progress of the process could be followed by a slight change in color in the infiltrated areas. Once the entire fruit surface has been infiltrated, some drops of infiltration solution begin to show running off the hydathodes at the tip of the sepals. Only completely infiltrated fruits were used in the experiments. Tomatoes at developmental stages beyond breaker did not infiltrate completely using this method and therefore were not included in the experiments. For tomato leaf agroinfiltration, needles were removed and Agrobacterium cultures were introduced in the intercellular spaces as described earlier (Liu et al., 2002). Plasmids and Bacterial Strains For reporter gene analysis, pBIN-YFP/GUS and pHSP70B∷GUS plasmids were used. pBIN-YFP/GUS is a pBIN derivative carrying 35S Cauliflower mosaic virus∷YFP and 35S Cauliflower mosaic virus∷GUS constructs in tandem. Plasmid pHSP70B∷GUS contained a 1.98-kb fragment of Arabidopsis (Arabidopsis thaliana) genomic DNA upstream of the ATG codon of the AtHSP70B gene (Sung et al., 2001), cloned in pGREEN backbone. Plasmids were transferred to Agrobacterium strains LBA4404, C58C1, and MOG101 with no significant differences observed in the levels of transient transformation between the different strains. For chicken IgA expression, two series of plasmids were used. pBIN-IgL series are pBIN derivatives containing 35S promoter and murine kappa light signal peptide, which incorporate chicken IgL chains n8 and n10 as SalI/XbaI restriction fragments selected from phage display libraries cloned in pCHICK3 phagemid vector (Wieland, 2004). In a similar fashion, pBIN-IgH series contain murine kappa light signal peptides and Cα1 to 4 constant regions from chicken IgαH, and incorporate chicken VH regions n8 and n10 as SalI/SstI restriction fragments selected from pCHICK3-phage display libraries. Agrobacterium C58C1 cultures carrying pBIN-IgL and pBIN-IgH plasmids were either infiltrated separately or coinfiltrated (ratio 1:1) in tomato fruits. For PDS silencing experiments, previously described pTRV1 and pTRV2-tPDS plasmids were agroinjected (Liu et al., 2002). The version of pTRV2-tPDS vector used here had its PDS intron sequences removed (S. Prat, personal communication). Detection of Xenoprotein Expression Histochemical detection of GUS activity was performed as described (Jefferson, 1987). Negative controls, consisting in nonagroinjected tomatoes, pTRV1-agroinjected tomatoes, and pBIN-YFP/GUS-agroinjected tomatoes collected and fixed 30 min after agroinjection, did not render significant blue staining. Quantitative glucuronidase activity assay method was adapted from Jefferson (1987). Briefly, tomato slices (approximately 100 mg) were homogenized in 100 μL GUS extraction buffer, debris cleared by centrifugation, and 10 μL of the resulting supernatant incubated with 190 μL of GUS assay buffer at 37°C. At different time intervals, 10-μL aliquots of each reaction were stopped with 90 μL of 1 m sodium carbonate. The A 550 was determined using TECAN microtiter plate spectofluorimeter. For GUS time-course analysis, homogenization step was omitted and instead tomato slices were weighted and incubated directly in GUS assay buffer. YFP expression was detected under UV light using binocular lens. Confocal images from fresh tissue were taken with a Leika DMIRE2 confocal microscopy. Fruit-expressed chicken IgAs were detected following western-blot standard procedures. Placenta and locular frozen tissues were ground in N2 (l), extracted in 1×phosphate-buffered saline 1:1 (v/w) in the presence of plant protease inhibitor cocktail (Sigma), and cleared by centrifugation. Total protein content was estimated with Bio-Rad Dc protein assay (Bio-Rad). Tomato cleared extracts (10 μg of protein per sample) were separated by SDS-PAGE. For the separation of individual Ig chains, samples were boiled in the presence of Laemmli-running buffer containing 0.1 m dithiothreitol and run in standard 12% acrylamide gels. For the detection of IgA complexes, samples were run in Bio-Rad TX 5% to 12% gradient gels without reducing agent. Gels were transferred to PVDA membranes following standard procedures. LCs and HCs were detected using goat anti-chicken LC and goat anti-chicken IgA alpha-specific antibody, respectively (Bethyl). A rabbit anti-chicken IgY whole-molecule antibody (Sigma) was also used for the detection of IgA complexes. Peroxidase-conjugated secondary antibodies were detected with ECL system (Amersham). Analysis of Fruit Affected in Carotenoid Biosynthesis Relative abundance of PDS mRNA in pericarp samples was determined by quantitative reverse transcription-PCR. RNA samples from tomato pericarp were prepared with RNAeasy plant mini kit using on-column RNAse-free DNAse Set treatment (Qiagen), and copied to cDNA with Superscript II reverse transcriptase (Invitrogen). Primers PDSF1 (TCATCAACCTTCCGTGCTTC) and PDSR1 (AACATCCCTTGCCTCCAGC) rendering a 141-bp amplicon were mixed with SYBER GREEN PCR master mix (Applied Biosystems) in appropriated proportions. A tomato actin amplicon was used as internal standard for quantifications. Samples were amplified in triplicate with ABI PRISM 7000 sequence detection system and analyzed with ABI PRISM 7000 SDS software. For carotene content analysis, tomato pericarp samples (200 mg) from silenced and nonsilenced fruits were ground in N2 (l), extracted, and analyzed as described (Fraser et al., 2000). ACKNOWLEDGMENTS We thank M.D. Gomez for her help with microscopy techniques and Dr. M.J. Rodrigo for her assistance in carotene measurements. VIGS vectors were supplied by Dr. Dinesh-Kumar (Yale University), and HSP70B:GUS construct was kindly provided by Prof. Maule (John Innes Center, UK). LITERATURE CITED Aparicio F, Thomas CL, Lederer C, Niu Y, Wang DW, Maule AJ ( 2005 ) Virus induction of heat shock protein 70 reflects a general response to protein accumulation in the plant cytosol. Plant Physiol 138 : 529 –536 Bentley KJ, Gewert R, Harris WJ ( 1998 ) Differential efficiency of expression of humanized antibodies in transient transfected mammalian cells. Hybridoma 17 : 559 –567 Chen JC, Jiang CZ, Gookin TE, Hunter DA, Clark DG, Reid MS ( 2004 ) Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Mol Biol 55 : 521 –530 Corthesy B ( 2002 ) Recombinant immunoglobulin A: powerful tools for fundamental and applied research. Trends Biotechnol 20 : 65 –71 D'Aoust MA, Lerouge P, Busse U ( 2004 ) Efficient and reliable production of pharmaceuticals in alfalfa. In R Fischer, S Schillberg, eds, Molecular Farming. Wiley-VCH Verlag GmbH & Co., Weinheim, Germany Fraser PD, Pinto MES, Holloway DE, Bramley PM ( 2000 ) Application of high-performance liquid chromatography with photodiode array detection to the metabolic profiling of plant isoprenoids. Plant J 24 : 551 –558 Fray RG, Grierson D ( 1993 ) Identification and genetic-analysis of normal and mutant phytoene synthase genes of tomato by sequencing, complementation and co-suppression. Plant Mol Biol 22 : 589 –602 Fu D-Q, Zhu B-Z, Zhu H-L, Jiang W-B, Luo Y-B ( 2005 ) Virus-induced gene silencing in tomato fruits. Plant J 31 : 299 –308 Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO ( 2002 ) pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J 31 : 375 –383 Groot SPC, Karssen CM ( 1992 ) Dormancy and germination of abscisic acid-deficient tomato seeds: studies with the sitiens mutant. Plant Physiol 99 : 952 –958 Jani D, Meena LS, Rizwan-ul-Haq QM, Singh Y, Sharma AK, Tyagi AK ( 2002 ) Expression of cholera toxin B subunit in transgenic tomato plants. Transgenic Res 11 : 447 –454 Jefferson RA ( 1987 ) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5 : 387 –405 Kapila J, DeRycke R, VanMontagu M, Angenon G ( 1997 ) An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci 122 : 101 –108 Liu YL, Schiff M, Dinesh-Kumar SP ( 2002 ) Virus-induced gene silencing in tomato. Plant J 31 : 777 –786 Ma Y, Lin SQ, Gao Y, Li M, Luo WX, Zhang J, Xia NS ( 2003 ) Expression of ORF2 partial gene of hepatitis E virus in tomatoes and immunoactivity of expression products. World J Gastroenterol 9 : 2211 –2215 Marillonnet S, Thoeringer C, Kandzia R, Klimyuk V, Gleba Y ( 2005 ) Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. Nat Biotechnol 23 : 718 –723 Ratcliff F, Martin-Hernandez AM, Baulcombe DC ( 2001 ) Tobacco rattle virus as a vector for analysis of gene function by silencing. Plant J 25 : 237 –245 Rodriguez-Concepcion M, Ahumada I, Diez-Juez E, Sauret-Gueto S, Lois LM, Gallego F, Carretero-Paulet L, Campos N, Boronat A ( 2001 ) 1-Deoxy-D-xylulose 5-phosphate reductoisomerase and plastid isoprenoid biosynthesis during tomato fruit ripening. Plant J 27 : 213 –222 Sandhu JS, Krasnyanski SF, Domier LL, Korban SS, Osadjan MD, Buetow DE ( 2000 ) Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response. Transgenic Res 9 : 127 –135 Sharp JM, Doran PM ( 2001 ) Characterization of monoclonal antibody fragments produced by plant cells. Biotechnol Bioeng 73 : 338 –346 Spolaore S, Trainotti L, Casadoro G ( 2001 ) A simple protocol for transient gene expression in ripe fleshy fruit mediated by Agrobacterium. J Exp Bot 52 : 845 –850 Sung DY, Vierling E, Guy CL ( 2001 ) Comprehensive expression profile analysis of the Arabidopsis hsp70 gene family. Plant Physiol 126 : 789 –800 Walmsley AM, Alvarez ML, Jin Y, Kirk DD, Lee SM, Pinkhasov J, Rigano MM, Arntzen CJ, Mason HS ( 2003 ) Expression of the B subunit of Escherichia coli heat-labile enterotoxin as a fusion protein in transgenic tomato. Plant Cell Rep 21 : 1020 –1026 Walmsley AM, Arntzen CJ ( 2003 ) Plant cell factories and mucosal vaccines. Curr Opin Biotechnol 14 : 145 –150 Wieland W ( 2004 ) From phage display to plant expression: fulfilling prerequisites for chicken oral immunotherapy against coccidiosis. PhD thesis. Wageningen University, Wageningen, The Netherlands Wieland W, Orzaez D, Lammers A, Schots A ( 2006 ) Display and selection of chicken IgA phage fragments. Vet Immunol Immunopathol doi/10.1016/j.vetimm.2005.09.012 (in press) Wroblewski T, Tomczak A, Michelmore R ( 2005 ) Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnol J 3 : 259 –273 Yang YN, Li RG, Qi M ( 2000 ) In vivo analysis of plant promoters and transcription factors by agroinfiltration of tobacco leaves. Plant J 22 : 543 –551 Author notes 1 This work was supported by Generalitat Valenciana (project no. GV04B–28) and the Spanish Ministry of Science and Education (Ramón y Cajal Program). * Corresponding author; e-mail [email protected]; fax 34–96–3877859. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Antonio Granell ([email protected]). www.plantphysiol.org/cgi/doi/10.1104/pp.105.068221. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Kurata, Nori; Yamazaki, Yukiko

doi: 10.1104/pp.105.063008pmid: 16403737

Abstract The aim of Oryzabase is to create a comprehensive view of rice (Oryza sativa) as a model monocot plant by integrating biological data with molecular genomic information (http://www.shigen.nig.ac.jp/rice/oryzabase/top/top.jsp). The database contains information about rice development and anatomy, rice mutants, and genetic resources, especially for wild varieties of rice. The anatomical description of rice development is unique and is the first known representation for rice. Developmental and anatomical descriptions include in situ gene expression data serving as stage and tissue markers. The systematic presentation of a large number of rice mutant and mutant trait genes is indispensable, as is description of research in wild strains, core collections, and their detailed characterization. Several genetic, physical, and expression maps with full genome and cDNA sequences are also combined with biological data in Oryzabase. These datasets, when pooled together, could provide a useful tool for gaining greater knowledge about the life cycle of rice, the relationship between phenotype and gene function, and rice genetic diversity. For exchanging community information, Oryzabase publishes the Rice Genetics Newsletter organized by the Rice Genetics Cooperative and provides a mailing service, rice-e-net/rice-net. Rice (Oryza sativa) is one of three major dietary staple foods in the world and has a highly syntenic genomic and gene structure with respect to the other two major foods, maize (Zea mays) and wheat (Triticum aestivum). The genome sequence of a japonica variety, Nipponbare, was completed in 2004 and, prior to this, considerable information relating to the genome and gene structures of rice (such as the nuclear, chloroplast and mitchondrion genome, cDNA, expressed sequence tag [EST], and protein sequences) was compiled. In addition, data has been gathered on the functional genomic resources of rice, such as Tos17 and T-DNA-tagged lines, along with their flanking sequences. Several major databases for rice genome research can be accessed through the International Rice Genome Sequencing Project Web site (http://rgp.dna.affrc.go.jp/IRGSP/index.html). A rice expression database called Rice Expression Database (http://red.dna.affrc.go.jp/RED/), a rice full-length cDNA database designated KOME (http://cdna01.dna.affrc.go.jp/cDNA/), a rice Tos17 insertion mutant database (http://tos.nias.affrc.go.jp/∼miyao/pub/tos17/), and a rice proteome database and integrated rice genome explorer INE (http://rgp.dna.affrc.go.jp/giot/INE.html) have also been established. The Institute for Genomic Research (http://www.tigr.org/tigr-scripts/tgi/T_index.cgi?species=rice, http://www.tigr.org/tdb/e2k1/osa1/), Cold Spring Harbor Laboratory (http://mccombielab.cshl.edu/external/riceweb/), and other major rice projects and institutions have constructed databases that have assembled and/or processed full genome sequences. A Chinese group has published indica rice sequences (Yu et al., 2005) and the Oryza Map Alignment Project (http://www.omap.org/), which is a wild rice (Zizania palustris) bacterial artificial chromosome (BAC) alignment project, is another major activity at Arizona University. Gramene (http://www.gramene.org/) and GrainGenes (http://wheat.pw.usda.gov/GG2/index.shtml) are databases organized for cereal comparative genomics at Cornell University. Recently there has been much effort and progress into biologically characterizing rice in terms of mutants and their genes, phenotypes, developmental features, and other events related to the ontology of rice. To date, biological characteristics for rice phenotypes, traits, habitats, and other growth and developmental information have not been described in rice databases. Therefore, the Oryzabase aims to prepare such basic biological information collected from all developmental stages, mutants, natural variants, and so on. Genomic information and genetic resources are also provided for correlating biological events and/or strains with molecular evidence. Data structures that combine biological features (such as phenotype, development, mutants, and natural variants) with molecular attributes (such as cDNA and genome sequences, gene ontology [GO] terms, and gene expression profile) will help researchers gain a more comprehensive view of rice. The data in Oryzabase are divided into 15 sections: development/anatomy, mutants, trait genes, linkage maps, physical maps, comparative maps, references, basic biological data, DNA sequence, BLAST search, chloroplast and mitochondrion, tools and protocols, strains, stock centers, and wild rice. Design, data collection, and construction of the database are organized by the Rice Genetic Resources Committee along with members of the Rice Gene Nomenclature Committee that belongs to the Rice Genetics Cooperative (RGC). Several experts in a special field are pointed to curate each section of Oryzabase. The Genetic Strains Information Laboratory in the National Institute of Genetics (NIG) in Japan is responsible for building and maintaining the database. BIOLOGICAL DATA Oryzabase is a unique rice database that shows morphological and gene expression characteristics of this organism at different developmental stages and in various mutants. The biological information in Oryzabase is both unique and basic and is composed of four sections: Development/Anatomy, Trait Genes, Mutants, and Basic Biological Information. Items in each section are not only shown by their own characters but also accompanied with in situ gene expression information, references, and other relevant data. Developmental and anatomical data have been gathered from researchers who are experts in each tissue (Itoh et al., 2005) and combined with related expression and mutant data mostly from published information. Development/Anatomy This section is the core and most distinctive part of Oryzabase (http://www.shigen.nig.ac.jp/rice/oryzabase/development/organAndStage.jsp). Rice organ development is dissected stage by stage, and the anatomical characteristics of each stage are described. The developmental stages and/or organs shown in Oryzabase, which have recently been finalized by Itoh et al. (2005), are embryo/endosperm, leaf, root, panicle, spikelet, stamen, ovule, reproductive organ, and juvenile-adult transitional stages. Most organs are divided into five to 10 developmental stages that are characterized by several items such as stage names, tissue sizes, stage-specific events, in situ gene expression information, related mutants, and β-glucuronidase-staining patterns of enhancer trap lines (Itoh et al., 2004, 2005; Kurata et al., 2005). Besides morphological descriptions, many photographic figures of distinctive stages have been incorporated. Furthermore, mutants that have been analyzed morphologically and their abnormalities assigned to specific stages or organs are also arranged in the developmental stage tables. Thus, the Development/Anatomy section enables specific rice organ developmental stages to be linked to related biological and molecular events and phenomena. To provide easy access to all organ development, we present as much data as possible in single tables linking individual items to more detailed description sources. From this, users can quickly obtain an entire view of organ development in rice and easily find necessary data about mutants, expression patterns of genes, and references. A search system using keywords is also provided. Gene expression profiles, created by microarray analysis, are the next target for including in the database. Determination of critical developmental stages and precise gene expression profiling in those stages makes it possible to unravel genetic programs in the development and gene expression networks. Trait Genes and Mutants Over the past decades, nearly 1,700 rice mutants or natural variants with visible or physiological phenotypes have been revealed. In our recent review we reported many interesting mutants and genes responsible for the phenotypes (Kurata et al., 2005). Mutant or natural variant genes are classified into seven organs or characters: vegetative organ, reproductive organ, heterochrony, coloration, seed, tolerance and resistance, and quantitative trait loci. These classes are further categorized into 38 subclasses according to their characteristic features. For instance, reproductive organ is classified into four subclasses: heading date, influorescence, spikelet, and pollination/fertilization/fertility. Information regarding 1,698 mutant genes and 136 unclassified genes is accessible in the Oryzabase section called Trait Genes at http://www.shigen.nig.ac.jp/rice/oryzabase/genes/geneClasses.jsp. A trait gene is a gene that has been identified from a mutant or natural variant and is defined by a name that describes its phenotype. Each entry is shown with a gene symbol, gene name, chromosome (location if identified), mutant class name, GO, and/or trait ontology number. From the gene symbol, users can access a short explanation for each mutant phenotype, original and related publications, and, in some cases, mutant photographs (Fig. 1 Figure 1. Open in new tabDownload slide An example of the shootless 1 mutant as described in the sections Trait Genes and Mutants. For this mutant the gene symbol is shown along with a short description of the mutant phenotype, photographs comparing the mutant with a wild-type plant, and references used for the analyses. Figure 1. Open in new tabDownload slide An example of the shootless 1 mutant as described in the sections Trait Genes and Mutants. For this mutant the gene symbol is shown along with a short description of the mutant phenotype, photographs comparing the mutant with a wild-type plant, and references used for the analyses. ). Correlation between mutant phenotypes and developmental stages is important for analyzing gene function. Therefore, we also arranged as many mutants as possible to relevant stages or organs showing their defects in the section called Development/Anatomy. A large collection of the n-methyl n-nitrosourea (MNU)-induced mutant population is also provided (http://www.shigen.nig.ac.jp/rice/oryzabase/nbrpStrains/kyushuGrc.jsp). Only 12 classes of visible phenotypes, including 49 easily identifiable phenotypes, have been used to classify these mutant lines (Table I Table I. Classification of mutants induced by MNU Class No. . Mutant Class . Phenotype . 1 Germination Germination rate 3 Growth Abnormal shoot 11 Leaf color Albino 12 Leaf color Yellow leaf 13 Leaf color Deep green leaf 14 Leaf color Pale green leaf 15 Leaf color Virescent 16 Leaf color Stripe 17 Leaf color Zebra 18 Leaf color Other leaf color 21 Leaf morphology Wide leaf 22 Leaf morphology Narrow leaf 23 Leaf morphology Long leaf 24 Leaf morphology Short leaf 25 Leaf morphology Drooping leaf 26 Leaf morphology Rolled leaf 27 Leaf morphology Spiral leaf 28 Leaf morphology Brittle 29 Leaf morphology Lamina joint 30 Leaf morphology Withering 31 Leaf morphology Other leaf morphology 41 Plant height Semi dwarf 42 Plant height Dwarf 43 Plant height Extremely dwarf 44 Plant height Long culm 51 Disease spot Spotted leaf/lesion mimic 61 Tillering High tillering 62 Tillering Low tillering 63 Tillering Lazy 65 Heading date Early heading 66 Heading date Late heading 67 Heading date Nonheading? 71 Flower Abnormal hull 72 Flower Abnormal floral organ 81 Spikelet Long panicle 82 Spikelet Short panicle 83 Spikelet Lax panicle 84 Spikelet Dense panicle 85 Spikelet Vivipary 86 Spikelet Shattering 87 Spikelet Neck leaf 88 Spikelet Abnormal panicle shape 91 Fertility Sterile 92 Fertility Low fertile 101 Grain trait Large grain 102 Grain trait Small grain 103 Grain trait Slender grain 104 Grain trait Other grain morphology Class No. . Mutant Class . Phenotype . 1 Germination Germination rate 3 Growth Abnormal shoot 11 Leaf color Albino 12 Leaf color Yellow leaf 13 Leaf color Deep green leaf 14 Leaf color Pale green leaf 15 Leaf color Virescent 16 Leaf color Stripe 17 Leaf color Zebra 18 Leaf color Other leaf color 21 Leaf morphology Wide leaf 22 Leaf morphology Narrow leaf 23 Leaf morphology Long leaf 24 Leaf morphology Short leaf 25 Leaf morphology Drooping leaf 26 Leaf morphology Rolled leaf 27 Leaf morphology Spiral leaf 28 Leaf morphology Brittle 29 Leaf morphology Lamina joint 30 Leaf morphology Withering 31 Leaf morphology Other leaf morphology 41 Plant height Semi dwarf 42 Plant height Dwarf 43 Plant height Extremely dwarf 44 Plant height Long culm 51 Disease spot Spotted leaf/lesion mimic 61 Tillering High tillering 62 Tillering Low tillering 63 Tillering Lazy 65 Heading date Early heading 66 Heading date Late heading 67 Heading date Nonheading? 71 Flower Abnormal hull 72 Flower Abnormal floral organ 81 Spikelet Long panicle 82 Spikelet Short panicle 83 Spikelet Lax panicle 84 Spikelet Dense panicle 85 Spikelet Vivipary 86 Spikelet Shattering 87 Spikelet Neck leaf 88 Spikelet Abnormal panicle shape 91 Fertility Sterile 92 Fertility Low fertile 101 Grain trait Large grain 102 Grain trait Small grain 103 Grain trait Slender grain 104 Grain trait Other grain morphology Open in new tab Table I. Classification of mutants induced by MNU Class No. . Mutant Class . Phenotype . 1 Germination Germination rate 3 Growth Abnormal shoot 11 Leaf color Albino 12 Leaf color Yellow leaf 13 Leaf color Deep green leaf 14 Leaf color Pale green leaf 15 Leaf color Virescent 16 Leaf color Stripe 17 Leaf color Zebra 18 Leaf color Other leaf color 21 Leaf morphology Wide leaf 22 Leaf morphology Narrow leaf 23 Leaf morphology Long leaf 24 Leaf morphology Short leaf 25 Leaf morphology Drooping leaf 26 Leaf morphology Rolled leaf 27 Leaf morphology Spiral leaf 28 Leaf morphology Brittle 29 Leaf morphology Lamina joint 30 Leaf morphology Withering 31 Leaf morphology Other leaf morphology 41 Plant height Semi dwarf 42 Plant height Dwarf 43 Plant height Extremely dwarf 44 Plant height Long culm 51 Disease spot Spotted leaf/lesion mimic 61 Tillering High tillering 62 Tillering Low tillering 63 Tillering Lazy 65 Heading date Early heading 66 Heading date Late heading 67 Heading date Nonheading? 71 Flower Abnormal hull 72 Flower Abnormal floral organ 81 Spikelet Long panicle 82 Spikelet Short panicle 83 Spikelet Lax panicle 84 Spikelet Dense panicle 85 Spikelet Vivipary 86 Spikelet Shattering 87 Spikelet Neck leaf 88 Spikelet Abnormal panicle shape 91 Fertility Sterile 92 Fertility Low fertile 101 Grain trait Large grain 102 Grain trait Small grain 103 Grain trait Slender grain 104 Grain trait Other grain morphology Class No. . Mutant Class . Phenotype . 1 Germination Germination rate 3 Growth Abnormal shoot 11 Leaf color Albino 12 Leaf color Yellow leaf 13 Leaf color Deep green leaf 14 Leaf color Pale green leaf 15 Leaf color Virescent 16 Leaf color Stripe 17 Leaf color Zebra 18 Leaf color Other leaf color 21 Leaf morphology Wide leaf 22 Leaf morphology Narrow leaf 23 Leaf morphology Long leaf 24 Leaf morphology Short leaf 25 Leaf morphology Drooping leaf 26 Leaf morphology Rolled leaf 27 Leaf morphology Spiral leaf 28 Leaf morphology Brittle 29 Leaf morphology Lamina joint 30 Leaf morphology Withering 31 Leaf morphology Other leaf morphology 41 Plant height Semi dwarf 42 Plant height Dwarf 43 Plant height Extremely dwarf 44 Plant height Long culm 51 Disease spot Spotted leaf/lesion mimic 61 Tillering High tillering 62 Tillering Low tillering 63 Tillering Lazy 65 Heading date Early heading 66 Heading date Late heading 67 Heading date Nonheading? 71 Flower Abnormal hull 72 Flower Abnormal floral organ 81 Spikelet Long panicle 82 Spikelet Short panicle 83 Spikelet Lax panicle 84 Spikelet Dense panicle 85 Spikelet Vivipary 86 Spikelet Shattering 87 Spikelet Neck leaf 88 Spikelet Abnormal panicle shape 91 Fertility Sterile 92 Fertility Low fertile 101 Grain trait Large grain 102 Grain trait Small grain 103 Grain trait Slender grain 104 Grain trait Other grain morphology Open in new tab ). Phenotypic classification of the MNU-induced mutants is identical to that used for Tos17-induced mutant lines. It is presumed that the Tos17 mutagenesis cannot be performed to saturation because of several types of preferential insertion sites of Tos17 (Miyao et al., 2003). Consequently, mutation-enriched, chemically induced mutants are the next promising resource for characterizing mutant genes using reverse genetic tools such as TILLING (Till et al., 2003). Basic Biological Data and References Access to several other biological datasets is available in the section called Basic Biological Data at http://www.shigen.nig.ac.jp/rice/oryzabase/basic/basicBiologicalData.jsp. This is composed of six subsections and describes basic information for wild rice, mutants, genetic maps, chromosomes and cultivation, crossing, and harvesting of rice for beginners in rice research. The content of the six subsections are as follows: (1) species and their geographical distribution of wild and cultivated strains of rice in the world; (2) organs of rice, their morphology, and names; (3) mutants of rice (collection of selected mutant phenotypes identified and characterized); (4) genetic maps of rice (RFLP and visible marker maps); (5) chromosomes of rice; and (6) cultivation of rice (cultivation manual for rice genetic experiments). GENETIC RESOURCES Oryzabase has gathered information on nearly 20,000 useful strains. Wild rice accessions, cultivars, mutant lines, chromosome substitution lines, recombinant inbred lines (RILs), marker gene lines, and other lines useful for rice research are incorporated and distributed in Oryzabase. These unique resources have been collected, generated, and maintained for several decades through many researchers in several key laboratories. Wild Rice Strains Once the genome sequencing of the cultivated rice O. sativa (AA genome) is complete, information of the wild rice genomes of AA, BB, CC, BBCC, CCDD, EE, FF, GG, and HHJJ (comprising 23 species, including two cultivated species of O. sativa and Oryza glaberrima), gathered in the Oryzabase, should become one of the most valuable genetic resources in the post sequencing era (http://www.shigen.nig.ac.jp/rice/oryzabase/wild/coreCollection.jsp). Short descriptions about biological and molecular characteristics, habitats, and the world distribution of these Oryza species appear in the Basic Biological Data section. For more than 40 years, nearly 1,700 wild rice accessions from all over the world have been collected in the NIG. The International Rice Research Institute (IRRI) in the Philippines also has about 1,900 wild rice accessions (Vaughan, 1994), including a few hundred derived from those of the NIG. To avoid user confusion, information regarding original and derivative accessions is included in both the Oryzabase (NIG) and the IRRI database. Construction of a large-scale BAC library and a BAC end-sequencing project for wild rice species carried out at the University of Arizona (Ammiraju et al., 2006; http://www.genome.arizona.edu/BAC_special_projects/#Rice) used a total of 13 accessions for 12 species from IRRI, with half of the accessions originally collected in the NIG. For convenience in accessing, we chose a core collection of 289 accessions from wild species, which were grouped into ranks 1, 2, and 3. Rank 1 contains highly desirable accessions, with two or three accessions from 18 wild species (19, if Oryza nivara is counted as a separate species). Rank 2 is the next recommended collection with 64 accessions taken from all species. Rank 3 is a supplementary collection that includes 171 accessions. These accessions are spread worldwide and cover as much genetic variation as possible. The phenotype and detailed characterization of the core collection have been recorded. Genomic DNA of the core collection accessions is available upon request. The wild rice species and accessions characterized so far can provide valuable sources for analyzing speciation and cultivation processes, where ancestor genes could have been selectively maintained, varied, or lost. Crossed Lines and Other Strains RILs of four japonica × indica crosses have been generated, and their information will be incorporated in the near future. Also, chromosome substitution lines with japonica backgrounds crossed with other AA genome species (indica of O. sativa, O. glaberrima, Oryza glumaepatula, Oryza meridionalis, Oryza rufipogon, Oryza barthii, and O. nivara) are now partially available and the remainder will be available in the near future in the section of NBRP stains. Each wild strain-crossed AA species substitution population is composed of about 40 to 80 lines that cover entire genome segments. A schematic description of the population is shown in Figure 2 Figure 2. Open in new tabDownload slide Indica IR24 genome (red block) substitution lines with a japonica Asominori (white block) background. Eighty-seven lines almost cover all the regions of the indica genome. The purple blocks indicate regions needed for discriminating between homozygosity and heterozygosity of indica genome. These lines revealed to show high performance in quantitative trait analysis of many characters. Figure 2. Open in new tabDownload slide Indica IR24 genome (red block) substitution lines with a japonica Asominori (white block) background. Eighty-seven lines almost cover all the regions of the indica genome. The purple blocks indicate regions needed for discriminating between homozygosity and heterozygosity of indica genome. These lines revealed to show high performance in quantitative trait analysis of many characters. . Information regarding another 11,724 strains includes several special mutants and useful parent lines for crossing. This information can be easily accessed and distributed between institutions and researchers for research purposes and is available in the sections called Strains (http://www.shigen.nig.ac.jp/rice/oryzabase/strains/summary.jsp) and Stock Center (http://www.shigen.nig.ac.jp/rice/oryzabase/strains/stockCenter.jsp). GENOME MAPS AND SEQUENCES Many databases of rice genomic information are available, as mentioned in the introduction. In Oryzabase, we selected and reorganized genomic and genetic information provided in the public sources to show relations among strains, phenotypes, genotypes, gene expression data, and sequences. We incorporated several genetic and physical maps together to the sequenced genome and expressed sequences. Linkage Maps A number of genetic linkage maps have been created for rice (http://www.shigen.nig.ac.jp/rice/oryzabase/maps/map.jsp). In Oryzabase, four basic linkage maps (classical linkage [CL], integrated [IT], recombinant inbred [RI], and Nipponbare-Kasalath) have been combined using common markers. The CL map has been constructed with 209 phenotypically identified genes reported originally in 1998 in a committee report for the RGC (Nagato and Yoshimura, 1998). The chromosomal locations of additional 362 phenotypic genes have also been assigned to 12 chromosomes. The IT map locates 83 RFLP markers and 40 phenotypic marker genes (Yoshimura et al., 1997). Common phenotypic and RFLP markers in CL, IT, and RI maps are used for positional references. Lines carrying marker genes are available in the section called Strains. The RI map is an RFLP framework map that has been constructed using 375 RFLP markers using RILs of a japonica strain Asominori crossed with an indica strain IR24 (Tsunematsu et al., 1996). Genotype segregation data and descendant seed sets of these RILs (beyond F7) are available in project 4 of the National Bioresource Project. The Nipponbare-Kasalath map is the densest molecular genetic map carrying 2,275 DNA markers for rice (Harushima et al., 1998). Physical Maps In the physical map section (http://www.shigen.nig.ac.jp/rice/oryzabase/genome/chromosomeList.jsp), 12 chromosome maps are being constructed by collecting publicly available DNA sequences from DNA Data Bank of Japan/EMBL/GenBank nucleotide sequence databases and their predicted coding sequences as well as full-length cDNA regions from the KOME. The genomic viewer is planned to provide a chromosome view, which displays entire chromosomes in a line, together with other views by a range of 250 K to 1 M and of 10 to 100 K. Complete maps will be available soon. Rice DNA sequence accessions (over 64,000 entries in National Center for Biotechnology Information-GenBank Release 149.0) extracted from the plant division section of the DNA data bank of Japan/EMBL/GenBank database are also available in a separate section titled DNA sequence (http://www.shigen.nig.ac.jp/rice/oryzabase/dna/sequences.jsp). Comparative Maps The Oryzabase comparative map is a map that has added barley (Hordeum vulgare) and wheat EST clones to the rice EST/cDNA linkage map (http://www.shigen.nig.ac.jp/rice/oryzabase/comparative/comparative.jsp). The EST data used for this map was obtained from a barley database (http://earth.lab.nig.ac.jp/%7Edclust/cgi-bin/barley_pub/) and the KOMUGI (http://shigen.lab.nig.ac.jp/wheat/komugi/t) wheat database. To allow sharing of clones among monocot plant researchers, EST clone names, instead of their contig numbers, are displayed on the comparative maps. An assembly viewer for each contig is currently in preparation. FUTURE DESIGN FOR PLANT, TRAIT, AND GO Enormous progress has been made, over a very short period of time, in the field of biological ontology. Indeed, ontologies are becoming indispensable for effective use of accumulated information. The section titled Development/Anatomy in Oryzabase strongly relates to the Plant Ontology Consortium (http://www.plantontology.org/) project that aims to develop, curate, and share controlled vocabularies describing plant structures and their growth and developmental stages. This will provide a semantic framework for meaningful cross-species queries across databases, despite the fact that these two tasks began independently. Oryzabase is now collaborating with the Plant Ontology Consortium and will contribute to the establishment of Plant Ontology (PO). Meanwhile, in Phenotype and Trait Ontology (PATO), a phenotype or trait is expressed with a combination of attributes and values such that a phenotypic mutant, for example, can be described with a combination of PO and PATO. Zebrafish Information Network (http://zfin.org/cgi-bin/webdriver?MIval=aa-ZDB_home.apg) leads the PATO ontology project and has established the ontologies required for describing mutant phenotype information. An integrated viewer, O3, is being developed in Oryzabase to show both the concept of ontology and the associated data. The O3 viewer was named after three-dimensional ontologies: time, space, and features, which correspond to PO developmental stage, PO plant structure, and PATO, respectively. All trait genes in Oryzabase are manually annotated by researchers and some are associated with GO-IDs. Oryzabase GO is soon to be submitted to the central GO database through the Gramene database. GOALL (Yamazaki and Jaiswal, 2005) is a GO database equipped with an original viewer and is accessible through Oryzabase (http://shigen.lab.nig.ac.jp/ontology/top.jsp). The unique feature of the GOALL viewer is that it can provide a bird's-eye view of all GO terms. In this viewer each dot represents a term, and information relating to the term can be associated with a dot object. This makes it possible to display entire terms associated only with a gene query from certain species. The viewer also allows comparative studies between two different species. Biological ontology should perform best when it is applied to databases with comprehensive viewers. Oryzabase serves as a central resource for monocot plant research, and provides up-to-date knowledge of rice science to researchers. ACTIVITIES IN RICE RESEARCH COMMUNITY Rice Genetics Newsletter The RGC began in 1984 and instigated the International Rice Genetics Symposium and the publishing of the Rice Genetics Newsletter (RGN; http://www.shigen.nig.ac.jp/rice/oryzabase/rgn/newsletter.jsp; Oka and Khush, 1984). The aim and scope of the newsletter is to promote cooperation and exchange of information and material among rice geneticists. For 20 years the RGC organized gene symbolization and nomenclature, establishment of a genetic linkage group, and a chromosome numbering system. These were published in the RGN and have been used as a base for establishing rice genetic and physical maps. All contents of the RGN from volumes 1 to 20 are available in the Oryzabase. From 2005, RGN will be published as an online journal that is uploaded twice a year. Rice-E-Net/Rice-Net The Oryzabase started to support the Rice Net interactive Web site service for Japanese rice researchers in 2001. Recently this network service has expanded to worldwide rice researchers as a Rice-E-Net (http://chanko.lab.nig.ac.jp/list-touroku/rice-e-net-touroku.html). Participation of more rice and other cereal researchers in the Oryzabase Rice-E-Net will culminate in greater interactive sharing of rice information. Thus, Oryzabase covers and compiles information from the rapidly progressing fields of biology such as genetics, physiology, and molecular biology for rice. In particular, detailed biological information from developmentally and anatomically analyzed data presents an indispensable resource for further ontology studies and functional genomics. The main objective of the database is to present ways of correlating biological information with molecular events for understanding the complex genome of rice. Oryzabase continues to collect and relate new information for improving our understanding of the genus Oryza and its effective use as an important staple food. ACKNOWLEDGMENTS We wish to thank Drs. H. Morishima and S. Iyama and Ms. T. Miyabayashi for their helpful suggestions and assistance with this work. We are grateful to many colleagues, especially to Drs. A. Yoshimura and Y. Nagato, for offering plenty of invaluable data and for supporting Oryzabase construction. LITERATURE CITED Ammiraju JSS, Luo M, Goicoechea JL, Wang W, Kudrna D, Muller C, Talag J, Kim H, Sisneros NB, Blackmon B, et al ( 2006 ) The Oryza bacterial artificial chromosome library resource: construction and analysis of 12 deep-coverage large-insert BAC libraries that represent the 10 genomes types of the genus Oryza. Genome Res (in press) Harushima Y, Yano M, Shomura A, Sato M, Shimano T, Kuboki Y, Yamamoto T, Lin SY, Antonio BA, Parco A, et al ( 1998 ) A high density rice genetic linkage map with 2275 markers using a single F2 population. Genetics 148 : 479 –494 Ito Y, Eiguchi M, Kurata N ( 2004 ) Establishment of an enhancer trap system with Ds and GUS for functional genomics in rice. Mol Genet Genomics 271 : 639 –650 Itoh JI, Nonomura KI, Ikeda K, Yamaki S, Inukai Y, Yamagishi H, Kitano H, Nagato Y ( 2005 ) Rice plant development: from zygote to spikelet. Plant Cell Physiol 46 : 23 –47 Kurata N, Miyoshi K, Nonomura K, Yamazaki Y, Ito Y ( 2005 ) Rice mutants and genes related to organ development, morphogenesis and physiological traits. Plant Cell Physiol 46 : 48 –62 Miyao A, Tanaka K, Murata K, Sawaki H, Takeda S, Abe K, Shinozuka Y, Onosato K, Hirochika H ( 2003 ) Target site specificity of the Tos17 retrotransposon shows a preference for insertion within genes and against insertion in retrotransposon-rich regions of the genome. Plant Cell 15 : 1771 –1780 Nagato Y, Yoshimura A ( 1998 ) Report of the committee on gene symbolization, nomenclature and linkagemap. Rice Genet Newsl 15 : 13 –74 Oka HI, Khush GS, editors ( 1984 ) Rice Genetics Newsletter 1. Rice Genetics Cooperative, Mishima, Japan, pp 1–91 Till BJ, Reynolds SH, Greene A, Codomo CA, Enns LC, Johnson JE, Burtner C, Odden AR, Young K, Taylor NE, et al ( 2003 ) Large-scale discovery of induced point mutations with high-throughput TILLING. Genome Res 13 : 524 –530 Tsunematsu H, Yoshimura A, Harushima Y, Nagamura Y, Kurata N, Yano M, Sasaki T, Iwata N ( 1996 ) RFLP framework map using recombinant inbred lines in rice. Breed Sci 46 : 279 –284 Vaughan DA, editor ( 1994 ) The Wild Relatives of Rice: A Genetic Resources Handbook. International Rice Research Institute, Los Baños, Philippines, pp 85–87 Yamazaki Y, Jaiswal P ( 2005 ) Biological ontologies in rice databases: an introduction to the activities in Gramene and Oryzabase. Plant Cell Physiol 46 : 63 –68 Yoshimura A, Ideta O, Iwata N ( 1997 ) Linkage map of phenotype and RFLP markers in rice. Plant Mol Biol 35 : 49 –60 Yu J, Wang J, Lin W, Li S, Li H, Zhou J, Ni P, Dong W, Hu S, Zeng C, et al ( 2005 ) The genomes of Oryza sativa: a history of duplication. PLoS Biol 3 : 1 –16 Author notes 1 This work was supported by the National Bioresource Project organized by the Ministry of Education, Culture, Sports, Science and Technology (Japan) and the Rice Genome Simulator Project (no. GS2107) organized by the Ministry of Agriculture, Forestry and Fisheries (Japan). * Corresponding author; e-mail [email protected]; fax 81–55–981–6879. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Nori Kurata ([email protected]). [OA] Open Access articles can be viewed online without a subscription. www.plantphysiol.org/cgi/doi/10.1104/pp.105.063008. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Scalliet, Gabriel; Lionnet, Claire; Le Bechec, Mickaël; Dutron, Laurence; Magnard, Jean-Louis; Baudino, Sylvie; Bergougnoux, Véronique; Jullien, Frédéric; Chambrier, Pierre; Vergne, Philippe; Dumas, Christian; Cock, J. Mark; Hugueney, Philippe

Abdulrazzak, Nawroz; Pollet, Brigitte; Ehlting, Jürgen; Larsen, Kim; Asnaghi, Carole; Ronseau, Sebastien; Proux, Caroline; Erhardt, Mathieu; Seltzer, Virginie; Renou, Jean-Pierre; Ullmann, Pascaline; Pauly, Markus; Lapierre, Catherine; Werck-Reichhart, Danièle

Harholt, Jesper; Jensen, Jacob Krüger; Sørensen, Susanne Oxenbøll; Orfila, Caroline; Pauly, Markus; Scheller, Henrik Vibe

doi: 10.1104/pp.105.072744pmid: 16377743

Abstract The function of a putative glycosyltransferase (At2g35100) was investigated in Arabidopsis (Arabidopsis thaliana). The protein is predicted to be a type 2 membrane protein with a signal anchor. Two independent mutant lines with T-DNA insertion in the ARABINAN DEFICIENT 1 (ARAD1) gene were analyzed. The gene was shown to be expressed in all tissues but particularly in vascular tissues of leaves and stems. Analysis of cell wall polysaccharides isolated from leaves and stems showed that arabinose content was reduced to about 75% and 46%, respectively, of wild-type levels. Immunohistochemical analysis indicated a specific decrease in arabinan with no change in other pectic domains or in glycoproteins. The cellular structure of the stem was also not altered. Isolated rhamnogalacturonan I from mutant tissues contained only about 30% of the wild-type amount of arabinose, confirming the specific deficiency in arabinan. Linkage analysis showed that the small amount of arabinan present in mutant tissue was structurally similar to that of the wild type. Transformation of mutant plants with the ARAD1 gene driven by the 35S promoter led to full complementation of the phenotype, but none of the transformants had more arabinan than the wild-type level. The data suggest that ARAD1 is an arabinan α-1,5-arabinosyltransferase. To our knowledge, the identification of other l-arabinosyltransferases has not been published. Expanding plant cells are surrounded by a primary cell wall composed of cellulose microfibrils interwoven and cross-linked with hemicellulose. The cellulose-hemicellulose network is embedded in a hydrated matrix of polysaccharides and proteins, where the major polysaccharide is pectin. Pectin consists mainly of homogalacturonan and rhamnogalacturonan I (RG I), while minor components include rhamnogalacturonan II (RG II) and xylogalacturonan (Ridley et al., 2001; Willats et al., 2001). RG I is a structurally complex molecule, consisting of a backbone of [-4-α-d-GalUAp-1,2-α-l-Rhap-1-] repeating units. The rhamnose residues often carry side chains of neutral sugars attached at the O-4 position. These side chains typically contain β-1,4-d-galactans, α-1,5-l-arabinans, or branched type I arabinogalactans (Carpita and Gibeaut, 1993; Ridley et al., 2001). Arabinans may carry substitutions at C-2 and/or C-3 consisting of single α-linked l-arabinofuranosyl residues or small arabinan oligomers. Arabinan side chains can either be directly attached to the RG I backbone or to short galactan chains. Experimental evidence suggests that RG I is covalently linked to homogalacturonan and substituted galacturonan since these polymers can be coextracted from cell walls using endopolygalacturonase treatment (Schols et al., 1995; Sørensen et al., 2000). However, the exact molecular arrangement of the different pectic molecules relative to one another is not certain (Vincken et al., 2003). The plant cell wall and its complex carbohydrate structure require intricate biochemical machinery for biosynthesis and assembly. Furthermore, the cell wall is not a static structure but develops according to developmental and environmental signals (Ridley et al., 2001). Pectin and hemicellulosic polysaccharides are synthesized from nucleotide sugars by glycosyltransferase enzymes located in the Golgi apparatus, and a large number of glycosyltransferases must be needed to catalyze the formation of all the various types of glycosidic linkage. For example, it has been proposed that at least 53 glycosyltransferases are required for the biosynthesis of pectin alone (Mohnen, 1999). Very few of the glycosyltransferases have been identified (for a recent review, see Scheible and Pauly, 2004). Assays for the measurement of some of the glycosyltransferase activities involved in pectin biosynthesis have been described, including homogalacturonan galacturonosyltransferase (Villemez et al., 1965; Doong et al., 1995), galactan galactosyltransferase (Geshi et al., 2002), and arabinan arabinosyltransferase (Nunan and Scheller, 2003). However, none of the pectin synthesizing glycosyltransferases have been isolated. Genetic approaches have led to the identification of three glycosyltransferases involved in RG II side chain biosynthesis: a putative glucuronosyltransferase (Iwai et al., 2002) and two homologous xylosyltransferases (Egelund et al., 2004). Only the xylosyltransferase activity has been confirmed biochemically using heterologously expressed enzyme (N. Geshi and P. Ulvskov, personal communication). A glycosyltransferase encoded by the Qua1 gene has been suggested to be involved in homogalacturonan biosynthesis, but mutants in this gene show many pleiotropic effects, preventing conclusive functional determination (Bouton et al., 2002; Orfila et al., 2005). Based on PSI-BLAST sequence similarities, the Carbohydrate Active Enzymes database (CAZy; http://afmb.cnrs-mrs.fr/CAZY; Coutinho and Henrissat, 1999) has been constructed dividing putative and characterized glycosyltransferases into currently 78 families, 40 of which are represented in Arabidopsis (Arabidopsis thaliana). Putative glycosyltransferases are still present outside the CAZy database (Egelund et al., 2004; Manfield et al., 2004), but we believe that the majority of all glycosyltransferases are catalogued in the database. Family 47 contains sequences with the pfam03016 motif representing the glucuronosyltransferase domain of mammalian exostosins, which have inverting transfer activities (Lind et al., 1998). Family 47 is particularly interesting because of a large number of unique plant sequences (39 in Arabidopsis) and because three enzymes involved in cell wall biosynthesis have already been identified in this family: two xyloglucan galactosyltransferases (Madson et al., 2003; Li et al., 2004; X. Li and W.-D. Reiter, personal communication) and the previously mentioned RG II glucuronosyltransferase (Iwai et al., 2002). We have used a reverse genetic approach in Arabidopsis for the functional characterization of putative glycosyltransferases from CAZy Family 47. Homozygous T-DNA insertion lines of the gene At2g35100, a member of Family 47, were obtained. Biochemical and immunochemical analysis of the walls in the T-DNA knockout lines clearly show a reduction in pectic arabinan. The cell wall changes indicate that At2g35100 encodes an arabinan α-1,5-arabinosyltransferase. RESULTS At2g35100 Encodes a Putative Glycosyltransferase The locus At2g35100 has an open reading frame made up of three exons (Fig. 1 Figure 1. Open in new tabDownload slide Schematic structure and transcript analysis of the At2g35100 locus. A, Illustration of the intron-exon structure of the At2g35100 locus. The positions of the T-DNA insertions in arad1-1 and arad1-2 are indicated (triangles), as well as the position of the primers (arrows) used for screening by PCR. B, RT-PCR analysis of transcript in tissues from the wild type (qrt and Col-0) and the two homozygous mutant lines. RNA was isolated from mature roots (rt), leaves (lv), or inflorescence stems (st) as indicated. In the mutants no transcript was detected in any of the analyzed tissues. Actin-specific primers were used as controls. Figure 1. Open in new tabDownload slide Schematic structure and transcript analysis of the At2g35100 locus. A, Illustration of the intron-exon structure of the At2g35100 locus. The positions of the T-DNA insertions in arad1-1 and arad1-2 are indicated (triangles), as well as the position of the primers (arrows) used for screening by PCR. B, RT-PCR analysis of transcript in tissues from the wild type (qrt and Col-0) and the two homozygous mutant lines. RNA was isolated from mature roots (rt), leaves (lv), or inflorescence stems (st) as indicated. In the mutants no transcript was detected in any of the analyzed tissues. Actin-specific primers were used as controls. ). The gene structure has been confirmed by isolation of full-length cDNA clones (e.g. GenBank accession BT015854.1 originating from the Salk Institute Genomic Analysis Laboratory, La Jolla, CA). The encoded protein is calculated to have a polypeptide molecular mass of 52.8 kD. The protein is predicted to be targeted to the secretory pathway and to have a single transmembrane helix near the N terminus, hence, the protein has the features expected for a type II membrane protein targeted to the Golgi vesicles. The protein has four potential sites for N-glycosylation, but one is placed in the predicted transmembrane region. The protein is predicted to be an inverting glycosyltransferase by sequence similarity to other CAZy Family 47 proteins. Inactivation of the ARABINAN DEFICIENT 1 Gene Does Not Cause a Clear Effect on Visual Phenotype Two independent lines with T-DNA insertion in At2g35100 were identified in the Syngenta SAIL collection and in the Salk collection (Fig. 1). We have designated the mutants arabinan deficient 1-1 (arad1-1) and arad1-2, respectively. Homozygous lines were identified by PCR, which yielded products of expected size. Heterozygous sister lines segregated the resistance marker in good agreement with a 3:1 ratio (for arad1-1: 65 Basta-resistant and 23 sensitive plants [χ2 test, P = 0.8]; for arad1-2: 607 kanamycin-resistant and 226 sensitive plants [χ2 test, P = 0.2]), suggesting that both lines contained only one T-DNA insertion. In the arad1-1 and arad1-2 lines, we could not detect any transcript by reverse transcription (RT)-PCR (Fig. 1). The arad1-2 parent line is reported in the Salk database (http://signal.salk.edu/cgi-bin/tdnaexpress) to contain a second T-DNA on chromosome 5 in an intron of At5g02440. We confirmed by PCR that this insertion was not present in the homozygous arad1-2 line (data not shown). The most clear phenotypic changes were related to cell wall composition (see below). During vegetative growth the mutants showed no differences compared to wild type. The mutant inflorescence would occasionally show slight differences such as thicker stems and larger cauline leaves, but often the mutant could not be distinguished from the wild type. Since radial cell expansion appeared to be increased in stem tissue under certain conditions, we decided to investigate possible modifications to the cellulose-glucan load-bearing network by growing seedlings on medium containing the herbicide isoxaben. This compound inhibits cellulose biosynthesis (Heim et al., 1990) and causes a compensatory increase in biosynthesis of noncellulosic polysaccharides, particularly pectin (Shedletzky et al., 1990; Manfield et al., 2004). Hence, a defect in noncellulosic polysaccharides can be expected to result in a stronger phenotype in the presence of isoxaben due to the inability to compensate for the loss of cellulose. However, the mutant plants did not respond differently from the wild type to isoxaben treatment (data not shown). T-DNA Insertion in ARAD1 Causes a Decrease in Cell Wall Arabinose To investigate which cell wall polymer may be affected by the mutations, cell wall monosaccharide composition analyses were carried out on alcohol insoluble residue (AIR) obtained from arad1-1, arad1-2, and wild-type leaf, inflorescence stem, and mature root tissues. AIR prepared from mutant leaves and stems showed a statistically significant reduction of 25% and 54%, respectively, in levels of Ara when compared to wild-type levels (ANOVA, P < 0.0001 for leaves and P < 0.000001 for stem; Fig. 2 Figure 2. Open in new tabDownload slide Monosaccharide composition of AIR isolated from wild type and arad1 mutants. Monosaccharide content in AIR from root (A), leaf (B), and stem (C) tissue is expressed as mol% (n = 3, ±sd). A reduction in Ara content was observed in leaf and stem. Comparable monosaccharide compositions were observed in arad1-1 and arad1-2 leaves and stems. Col-0 and qrt wild types had indistinguishable monosaccharide compositions (data not shown). Figure 2. Open in new tabDownload slide Monosaccharide composition of AIR isolated from wild type and arad1 mutants. Monosaccharide content in AIR from root (A), leaf (B), and stem (C) tissue is expressed as mol% (n = 3, ±sd). A reduction in Ara content was observed in leaf and stem. Comparable monosaccharide compositions were observed in arad1-1 and arad1-2 leaves and stems. Col-0 and qrt wild types had indistinguishable monosaccharide compositions (data not shown). ). A small reduction in Gal could also be observed in leaf AIR, but no reduction in Gal could be observed in stem AIR. No significant changes were observed in monosaccharide composition in root samples (Fig. 2). Since both homozygous mutants arad1-1 and arad1-2 showed identical (ANOVA, P > 0.3 for leaves and P > 0.9 for stems) and significant decreases in leaf and stem Ara, we conclude that these alterations are due to the mutation of the ARAD1 gene. By crossing the homozygous mutants, we confirmed that the arad1-1 and arad1-2 mutations are allelic and recessive (Table I Table I. Genetic analysis of the phenotype of arad1 mutants Monosaccharide composition of stem AIR was determined in wild-type (both Col-0 and qrt), arad1-1, arad1-2, and F1 plants of crosses between arad1-1 and wild type (qrt) and arad1-1 and arad1-2. The female parent was arad1-1 in both crosses. Genotype of the F1 plants was confirmed by PCR. The data (mean ± sd, n = 5) are expressed as mol% of Ara relative to mol% of Ara in Col-0. Numbers followed by the same letter are not significantly different at the 5% level (t test). Genotype . Relative Ara Content . Col-0 1 ± 0.04 a qrt 0.97 ± 0.09 a arad1-1/arad1-1 × qrt/qrt 0.90 ± 0.11 a arad1-1/arad1-1 selfed 0.53 ± 0.04 b arad1-2/arad1-2 selfed 0.54 ± 0.02 b arad1-1/arad1-1 × arad1-2/arad1-2 0.52 ± 0.04 b Genotype . Relative Ara Content . Col-0 1 ± 0.04 a qrt 0.97 ± 0.09 a arad1-1/arad1-1 × qrt/qrt 0.90 ± 0.11 a arad1-1/arad1-1 selfed 0.53 ± 0.04 b arad1-2/arad1-2 selfed 0.54 ± 0.02 b arad1-1/arad1-1 × arad1-2/arad1-2 0.52 ± 0.04 b Open in new tab Table I. Genetic analysis of the phenotype of arad1 mutants Monosaccharide composition of stem AIR was determined in wild-type (both Col-0 and qrt), arad1-1, arad1-2, and F1 plants of crosses between arad1-1 and wild type (qrt) and arad1-1 and arad1-2. The female parent was arad1-1 in both crosses. Genotype of the F1 plants was confirmed by PCR. The data (mean ± sd, n = 5) are expressed as mol% of Ara relative to mol% of Ara in Col-0. Numbers followed by the same letter are not significantly different at the 5% level (t test). Genotype . Relative Ara Content . Col-0 1 ± 0.04 a qrt 0.97 ± 0.09 a arad1-1/arad1-1 × qrt/qrt 0.90 ± 0.11 a arad1-1/arad1-1 selfed 0.53 ± 0.04 b arad1-2/arad1-2 selfed 0.54 ± 0.02 b arad1-1/arad1-1 × arad1-2/arad1-2 0.52 ± 0.04 b Genotype . Relative Ara Content . Col-0 1 ± 0.04 a qrt 0.97 ± 0.09 a arad1-1/arad1-1 × qrt/qrt 0.90 ± 0.11 a arad1-1/arad1-1 selfed 0.53 ± 0.04 b arad1-2/arad1-2 selfed 0.54 ± 0.02 b arad1-1/arad1-1 × arad1-2/arad1-2 0.52 ± 0.04 b Open in new tab ). Transformation with p35S∷ARAD1 Leads to Complementation of the Mutant Phenotype To further investigate the cell wall phenotype described above, the ARAD1 gene driven by the cauliflower mosaic virus (CaMV) 35S promoter was transformed into arad1-2 and wild-type plants, and the monosaccharide composition of total cell wall AIR from the inflorescence stem of the transformants was determined. In the arad1-2 background, transformation with the ARAD1 gene restored the Ara content to the wild-type level (ANOVA, P > 0.2; Fig. 3 Figure 3. Open in new tabDownload slide Complementation analysis. Monosaccharide composition of AIR from inflorescence stems is expressed in mol% (n = 5, ±sd). AIR was isolated from wild type transformed with empty vector (Col-0 pPZP221), wild type transformed with 35S∷ARAD1 (Col-0 35S∷ARAD1), arad1-2 transformed with empty vector (arad1-2 pPZP221), and arad1-2 transformed with 35S∷ARAD1 (arad1-2 35S∷ARAD1). Full complementation of the reduced Ara content in arad1-2 could be observed in arad1-2 when transformed with 35S∷ARAD1. Figure 3. Open in new tabDownload slide Complementation analysis. Monosaccharide composition of AIR from inflorescence stems is expressed in mol% (n = 5, ±sd). AIR was isolated from wild type transformed with empty vector (Col-0 pPZP221), wild type transformed with 35S∷ARAD1 (Col-0 35S∷ARAD1), arad1-2 transformed with empty vector (arad1-2 pPZP221), and arad1-2 transformed with 35S∷ARAD1 (arad1-2 35S∷ARAD1). Full complementation of the reduced Ara content in arad1-2 could be observed in arad1-2 when transformed with 35S∷ARAD1. ), whereas in the wild-type background the high expression of ARAD1 characteristic for the CaMV 35S promoter had no effect on the monosaccharide composition (ANOVA, P > 0.6). These experiments show that the ARAD1 gene can complement the arad1 T-DNA mutant phenotype. Expression Analysis of ARAD1 RT-PCR analysis of root, leaf, and stem tissue showed that the ARAD1 gene is expressed in all three tissues (Fig. 1). Expression analysis using the GENEVESTIGATOR database confirmed that At2g35100 is expressed in the whole plant at similar levels. To investigate the expression pattern at the cellular level, we fused the promoter region of ARAD1 with a gene for β-glucuronidase (GUS) and transformed plants with the PARAD1:GUS construct. In young seedlings (2 weeks old) GUS expression was observed in the stele of the root and in the vascular tissues of root and leaves (data not shown). In older seedlings (3 weeks old) the staining increased in the stele of the root and the primary leaves to eventually include all cells in these tissues (Fig. 4B Figure 4. Open in new tabDownload slide GUS staining activity of Arabidopsis plants transformed with a promoter-GUS fusion for ARAD1. Three-week-old (B) and 9-week-old (A and C–H) transformants were stained and photographed. Locations of the cross sections of the stem viewed in C and D are indicated in A by black bars, corresponding to the top bar (C) and to the lower bar (D). Figure 4. Open in new tabDownload slide GUS staining activity of Arabidopsis plants transformed with a promoter-GUS fusion for ARAD1. Three-week-old (B) and 9-week-old (A and C–H) transformants were stained and photographed. Locations of the cross sections of the stem viewed in C and D are indicated in A by black bars, corresponding to the top bar (C) and to the lower bar (D). ). As the plants matured, GUS staining was observed in all aerial parts (Fig. 4A). Older leaves would occasionally develop a patchy staining pattern with staining at the base of or the full trichome (data not shown). Cross sections of the different parts of the stem showed a process of concentrated GUS staining throughout young stem tissue (Fig. 4C), whereas the staining decreased in the more mature parts of the stem, leading to a relatively weak staining in only the vascular cambium and secondary phloem (Fig. 4D). In the flowers staining was observed in the vascular tissue of sepals, petals, and stamens and in pollen (Fig. 4, E to G). As seen in Figure 4E, GUS activity increased in the siliques as they matured starting from no staining in the early developing siliques to a strong staining in the fully elongated organ. The abscission region of seeds stained strongly, whereas the seed coat stained weakly (data not shown). Decrease in Arabinose Is Due to a Decreased Content of Pectic Arabinan Arabinose in the cell wall is found as side chains of RG I, arabinoxylan, arabinogalactan proteins, and extensins. To identify the polymer affected in arad1-1, immunochemical analysis of the leaf and inflorescence stem tissue was carried out. Hand-cut leaf and stem sections were labeled with the LM6 (anti-arabinan), LM5 (anti-galactan), and LM2 (anti-arabinogalactan protein carbohydrate) antibodies (Fig. 5 Figure 5. Open in new tabDownload slide Immunofluorescence labeling of hand sections of wild-type (qrt) and arad1-1 tissue with the LM6, LM5, and LM2 antibodies. Immunofluorescence labeling of transverse sections of mature leaf and elongating stems with the LM6 anti-α-1,5-arabinan antibody revealed a significant reduction in the α-1,5-arabinan epitope in arad1-1 leaf (D) and stem (E and F) compared to wild-type leaf (A) and stem (B and C). Pith parenchyma cell walls were particularly devoid of labeling in arad1-1 (C) compared to wild type (F), even though the cellular structure appeared to be similar in arad1-1 and wild-type tissue. Labeling with the LM5 anti-β-1,4-galactan antibody showed similar levels of the epitope in wild-type (G) and arad1-1 (J) stems. Labeling with the LM2 anti-arabinogalactan protein carbohydrate antibody showed that the epitope was of equally low abundance in both arad1-1 (K) and wild-type (H) stems, and was restricted to some cells of the pith parenchyma. In control experiments, no primary antibody was used (I and L). Scale bar = 100 μm. vb, Vascular bundle; pi, pith parenchyma. The experiment was carried out with two different batches of plants, and each time two plants were analyzed with essentially the same results. Figure 5. Open in new tabDownload slide Immunofluorescence labeling of hand sections of wild-type (qrt) and arad1-1 tissue with the LM6, LM5, and LM2 antibodies. Immunofluorescence labeling of transverse sections of mature leaf and elongating stems with the LM6 anti-α-1,5-arabinan antibody revealed a significant reduction in the α-1,5-arabinan epitope in arad1-1 leaf (D) and stem (E and F) compared to wild-type leaf (A) and stem (B and C). Pith parenchyma cell walls were particularly devoid of labeling in arad1-1 (C) compared to wild type (F), even though the cellular structure appeared to be similar in arad1-1 and wild-type tissue. Labeling with the LM5 anti-β-1,4-galactan antibody showed similar levels of the epitope in wild-type (G) and arad1-1 (J) stems. Labeling with the LM2 anti-arabinogalactan protein carbohydrate antibody showed that the epitope was of equally low abundance in both arad1-1 (K) and wild-type (H) stems, and was restricted to some cells of the pith parenchyma. In control experiments, no primary antibody was used (I and L). Scale bar = 100 μm. vb, Vascular bundle; pi, pith parenchyma. The experiment was carried out with two different batches of plants, and each time two plants were analyzed with essentially the same results. ). A clear reduction in the LM6 labeling was observed in leaf and inflorescence stem, corresponding to a reduction in the pectic α-1,5-arabinan content in these tissues. No differences were observed with the LM5 or LM2 antibodies (Fig. 5). The LM6 epitope was observed in the entire stem section, and the arad1-1 mutation caused a decrease in all cell types but particularly in pith parenchyma. Some labeling remained in the vascular bundle of arad1-1 leaves and stems. The specific loss of the LM6 epitope between the wild type and the arad1-1 mutant is in good agreement with the GUS expression pattern in the stem (Fig. 4, C and D). The LM6 antibody has previously been shown to bind to glycoproteins that can enter an SDS-PAGE gel. Immunoblot analysis was performed using protein extracted from wild-type and arad1-1 stem tissue. No differences in the abundance of LM6, LM1 (anti-extensin), or LM2 glycoprotein epitopes were observed between wild type and arad1-1, indicating that there is no change to cell wall glycoproteins in arad1-1, including the LM6 reactive glycoproteins (Supplemental Fig. 1). Since the immunochemical analysis indicated a specific effect on pectic arabinan, this component was further analyzed. RG I was prepared by treating phenol-extracted AIR obtained from inflorescence stems with pectin methyl esterase and endopolygalacturonase followed by purification by size exclusion chromatography. The sugar composition of the purified RG I was analyzed and showed a larger reduction in Ara content (68% reduction) compared to total cell wall AIR (Table II Table II. Monosaccharide composition and linkage analysis of RG I isolated from inflorescence stems from wild type (qrt) and arad1-1 Data are expressed as mol%. . qrt . arad1-1 . Monosaccharide composition     Fuc 0.4 0.8     Rha 15 19     Ara 37 12     Gal 27 36     Xyl 0.7 1.6     GalUA 20 31     Total 100 100 Linkage analysis     2-Rha 10 16     2,4-Rha 8.1 14     t-Xyl 0.6 0.5     t-Gal 7.1 12     4-Gal 18 20     3-Gal 3.2 3.7     6-Gal 2.9 3.4     3,6-Gal 4.1 5.3     t-Araf 1.6 0.9     5-Araf 25 7.3     2,5-Araf 6.0 2.0     2,3,5-Araf 4.8 1.4     4,6-Hexpa 1.7 2.8     Total 93.0 88.8 . qrt . arad1-1 . Monosaccharide composition     Fuc 0.4 0.8     Rha 15 19     Ara 37 12     Gal 27 36     Xyl 0.7 1.6     GalUA 20 31     Total 100 100 Linkage analysis     2-Rha 10 16     2,4-Rha 8.1 14     t-Xyl 0.6 0.5     t-Gal 7.1 12     4-Gal 18 20     3-Gal 3.2 3.7     6-Gal 2.9 3.4     3,6-Gal 4.1 5.3     t-Araf 1.6 0.9     5-Araf 25 7.3     2,5-Araf 6.0 2.0     2,3,5-Araf 4.8 1.4     4,6-Hexpa 1.7 2.8     Total 93.0 88.8 a The mass spectrometry fragmentation pattern indicated that this sugar is a hexose, but its identity could not be established. Open in new tab Table II. Monosaccharide composition and linkage analysis of RG I isolated from inflorescence stems from wild type (qrt) and arad1-1 Data are expressed as mol%. . qrt . arad1-1 . Monosaccharide composition     Fuc 0.4 0.8     Rha 15 19     Ara 37 12     Gal 27 36     Xyl 0.7 1.6     GalUA 20 31     Total 100 100 Linkage analysis     2-Rha 10 16     2,4-Rha 8.1 14     t-Xyl 0.6 0.5     t-Gal 7.1 12     4-Gal 18 20     3-Gal 3.2 3.7     6-Gal 2.9 3.4     3,6-Gal 4.1 5.3     t-Araf 1.6 0.9     5-Araf 25 7.3     2,5-Araf 6.0 2.0     2,3,5-Araf 4.8 1.4     4,6-Hexpa 1.7 2.8     Total 93.0 88.8 . qrt . arad1-1 . Monosaccharide composition     Fuc 0.4 0.8     Rha 15 19     Ara 37 12     Gal 27 36     Xyl 0.7 1.6     GalUA 20 31     Total 100 100 Linkage analysis     2-Rha 10 16     2,4-Rha 8.1 14     t-Xyl 0.6 0.5     t-Gal 7.1 12     4-Gal 18 20     3-Gal 3.2 3.7     6-Gal 2.9 3.4     3,6-Gal 4.1 5.3     t-Araf 1.6 0.9     5-Araf 25 7.3     2,5-Araf 6.0 2.0     2,3,5-Araf 4.8 1.4     4,6-Hexpa 1.7 2.8     Total 93.0 88.8 a The mass spectrometry fragmentation pattern indicated that this sugar is a hexose, but its identity could not be established. Open in new tab ), confirming the specific decrease in arabinan side chains of RG I. To further analyze the structure of RG I in the mutant, we performed linkage analysis of the purified RG I sample (Table II). The data confirmed a large reduction of arabinosyl species, in particular 5-linked arabinofuranose (5-Araf, 71% reduction; 2,5-Araf, 67% reduction; 2,3,5-Araf, 70% reduction). In addition, terminal Araf was reduced (t-Araf reduction by 44%), which is in agreement with the loss of 2,5-Araf and 2,3,5-Araf branch points in the arabinan. The ratio of unsubstituted rhamnose (2-Rha) to substituted rhamnose (2,4-Rha) was equal in both plant types (1: 0.8), indicating that the number of RG I side chains was not reduced. Thus, the arabinan side chains in the mutant can be considered shorter but of similar number as in the wild type. Arabinans have been reported to be involved in the opening and closing of stomata (Jones et al., 2003). We performed a dehydration experiment by placing detached leaves in a flow bench and measuring the weight loss over time and in addition investigated the opening and closing response of stomata in light and dark conditions by microscopy. However, no alterations to stomata function were observed in arad1-1 mutant tissue, suggesting that the decrease in Ara in the mutant does not affect stomata function (data not shown). No differences in autofluorescence of the guard cells could be observed either. This is supported by the promoter-GUS analysis, which showed that arad1 is not highly expressed in epidermis and stomata (data not shown). DISCUSSION Mutation in ARAD1 Causes a Specific Reduction in Arabinan Content Several lines of evidence show that the phenotype of the mutants is caused by mutation in the ARAD1 gene. First, both mutants have a T-DNA insertion in the gene and lack transcript. Second, they show identical phenotype with respect to cell wall sugar composition. Third, while it cannot be excluded that other unknown mutations are present in the genomes of arad1-1 and arad1-2, they do not appear to contain any additional T-DNA insertions. Finally, when expressing ARAD1 in the arad1-2 mutant, the cell wall sugar composition is restored to wild type. The ARAD1 protein appears to be involved in the biosynthesis of pectin and specifically in the biosynthesis of arabinan side chains of RG I. The mutation in ARAD1 does not appear to result in changes to other Ara-containing polymers, including arabinogalactan and extensin proteins. Mutations that cause a change in cell wall composition may often have pleiotropic effects. As an example, the qua1-1 mutation is associated with decreased homogalacturonan, but the tissues are highly distorted and other polymers are also affected, e.g. xylan (Bouton et al., 2002; Orfila et al., 2005). In contrast, the arad1 mutations are much more subtle and specific. Sometimes a small increment in stem width arising from increased cell size in the pith parenchyma and slightly larger cauline leaves could be observed in arad1, but apart from this we did not observe any change in the structure of the stem or leaf tissues. Furthermore, we have investigated several different polymers and found no significant changes in any polysaccharide besides arabinan. Therefore, we find it very likely that the decreased arabinan content is a direct result of the mutation. Linkage analysis of RG I isolated from the arad1-1 mutant showed the presence of small amounts of arabinan with linkage very similar to wild type. Immunolabeling of stem and leaf sections with the LM6 anti-arabinan antibody supports this observation. The mutant tissue contained some LM6 reactive glycoprotein material, which may be associated with the vascular bundle. This material was not affected by the arad1-1 mutation, suggesting that other glycosyltransferase activities may be responsible for its biosynthesis. Since the arad1-1 T-DNA insertion is in exon 2 and no transcript could be detected, it is highly unlikely that any functional ARAD1 protein is expressed in the mutant. However, the Arabidopsis genome encodes one relatively close homolog to the ARAD1 protein (At5g44930; Fig. 6 Figure 6. Open in new tabDownload slide Phylogenetic analysis of ARAD1 homologs in Arabidopsis and rice. The analysis includes subgroup B of CAZy Family 47. A multiple alignment of the protein sequences (see supplemental data) was used to construct the tree using the PHYLIP software. Figure 6. Open in new tabDownload slide Phylogenetic analysis of ARAD1 homologs in Arabidopsis and rice. The analysis includes subgroup B of CAZy Family 47. A multiple alignment of the protein sequences (see supplemental data) was used to construct the tree using the PHYLIP software. and supplemental material). The two Arabidopsis proteins are 65% identical. At5g44930 is not highly expressed in any tissue in Columbia (Col)-0 background. However, it is conceivable that the lacking biochemical phenotype observed in the roots of the arad1-1 mutant and the small amount of arabinan still present in other tissues, as indicated by the 1,5-Ara in the linkage analysis, could be due to expression of At5g44930. Also, we cannot exclude that expression of At5g44930 is up-regulated in arad1 mutants. Rice (Oryza sativa) appears to encode only one protein (accession no. BAC55656) that is a close homolog to Arabidopsis ARAD1 and At5g44930. The rice sequence is 58% identical to ARAD1. The other Arabidopsis proteins in subgroup B of Family 47 (Li et al., 2004) are more distantly related to ARAD1 with levels of identity below 40%. This comparison suggests that ARAD1 and At5g44930 represent a recent duplication. Therefore, the residual arabinan present in the absence of ARAD1 activity is likely to result from activity of somewhat redundant homologs. Future analysis of mutants in the homologous genes will be required to determine the extent of overlapping function. Complementation of the mutant phenotype was achieved by expression of ARAD1 driven by the 35S promoter, but no transgenic plants were recovered that had an elevated amount of Ara in the cell wall and transformation of the wild type with the same construct caused no detectable change in wall composition. This finding indicates that regulation of arabinan biosynthesis is not primarily at the level of transcription of the glycosyltransferase genes. Possibly, arabinan synthesis is limited by the supply of nucleotide sugar substrates or other factors are limiting, e.g. proteins interacting with the ARAD1 protein in a complex or in a metabolon, i.e. an assembly of more loosely associated proteins. ARAD1 Is a Member of Glycosyltransferase Family 47 The ARAD1 gene (At2g35100) encodes a protein ARAD1, which is predicted to be an inverting glycosyltransferase belonging to CAZy Family 47. This family encodes 39 proteins and putative proteins in Arabidopsis, including two xyloglucan galactosyltransferases (Madson et al., 2003; Li et al., 2004; X. Li and W.-D. Reiter, personal communication). Tomato (Lycopersicon esculentum) contains xyloglucan with Ara rather than Gal, and the presence of a related galactosyltransferase gene in tomato has therefore caused speculation that it might encode an arabinosyltransferase (Madson et al., 2003). Indeed, α-l-arabinosyltransferases and β-d-galactosyltransferases are expected to be inverting enzymes and the substrates UDP-β-l-Arap and UDP-α-d-Galp have the same configurations except for the C6 hydroxymethyl group in UDP-Gal. Hence, identification of an arabinosyltransferase as being one of the members in Family 47 is not unexpected. ARAD1 Is a Putative l-Arabinosyltransferase Based on the evidence presented here, we expect the ARAD1 protein to encode an arabinan α-l-arabinosyltransferase. l-Ara is abundant in plants but has furthermore been reported in the actinomycete Ampullariella digitata (Fan and Feingold, 1972), the purple sulfur bacterium Chromatium vinosum (Hurlbert et al., 1976), and in bovine brain tissue (Wardi et al., 1966; Varma et al., 1977). None of the glycosyltransferases involved in the transfer of l-Ara in the above mentioned organisms have been identified. Final confirmation of the biochemical activity will require heterologous expression of the enzyme and determination of the activity in vitro. The presence of both l-arabinosyltransferases and d-galactosyltransferases in the same protein family also indicates that these proteins may use the same basic biochemical mechanism. However, in spite of the similarity of UDP-l-arabinopyranose and UDP-d-galactopyranose, the products are quite different. In most of the polymers where Ara is found, including arabinan, it is present in the furanose ring configuration, not in the pyranose configuration. This could suggest that the substrate for arabinosyltransferases might be UDP-l-arabinofuranose, but this compound has not been found in plants. Many bacteria contain d-galactofuranose in the coat, and this sugar is incorporated from UDP-galactofuranose, which is formed from UDP-galactopyranose by a mutase. Interestingly, bacterial UDP-galactopyranose mutase has been shown to be active on UDP-l-Ara (Zhang and Liu, 2001). This would suggest a possible mechanism for incorporation of arabinofuranose into plant polymers, but unfortunately no protein in Arabidopsis appears to be even remotely similar to bacterial UDP-galactopyranose mutase. In microsomal or Golgi membranes, we have detected incorporation of arabinofuranose from UDP-arabinopyranose in both wheat (Triticum aestivum; Porchia et al., 2002) and mung bean (Vigna radiata; Nunan and Scheller, 2003). However, after solubilization we could never detect any incorporation of arabinofuranose but only of arabinopyranose and the activity was very low (Nunan and Scheller, 2003). We interpret these findings as evidence that the membranes contain a mutase activity that is closely coupled with the transferase activity. The Function of Arabinan Arabinans are part of pectin in all plants, but their amount varies between species. Few studies have been carried out that may link arabinans to any specific function. Potato (Solanum tuberosum) plants expressing a Golgi-localized arabinanase had highly reduced arabinan content (approximately 30% pectic arabinan compared to wild type) but did not show any particular phenotype (Skjøt et al., 2002). This is not surprising in view of the present finding since a similar reduction in arabinan caused a subtle phenotype that could only be scored with certainty by biochemical characterization. Arabinans have been implicated in stomatal function since treatment with arabinanase was observed to prevent proper function of stomata (Jones et al., 2003). However, in this investigation we did not find any deficiency in stomatal function. Phenolic compounds associated with pectin and especially arabinan have been suggested to be major components in the stomatal guard cell functionality (Jones et al., 2005). We did not observe any change in autofluorescence of guard cells in arad1 compared to wild type. It is possible that the homolog(s) of ARAD1 is highly expressed in stomata. Another explanation may be that the mutants studied here have made compensations that allow stomatal function to be maintained in spite of low arabinan content. Arabinans can obviously be decreased to a large extent without detrimental effects on plants grown under constant and optimal conditions. Future experiments with plants grown under more fluctuating and adverse conditions may be required to reveal the biological significance of arabinans. MATERIALS AND METHODS Plant Material Arabidopsis (Arabidopsis thaliana L. Heyn.) ecotype Col-0 was used for all experiments. Seed of T-DNA insertion line SAIL 189_F10 (arad1-1; insert placed in exon 2) and the corresponding background strain (qrt) were obtained from Syngenta. T-DNA insertion line SALK_029831 (arad1-2; insert placed 237 bp downstream of start in an intron) was obtained from the Salk Institute (Alonso et al., 2003; Fig. 1). Plants were grown in peat at an 8-h photoperiod at 100 to 120 μmol photons m−2 s−1, 20°C, 70% relative humidity and watered using tap water as necessary. Fertilizer was not used. To initiate bolting and synchronize stem growth, plants were shifted to a 16-h photoperiod at 100 to 120 μmol photons m−2 s−1 after 8 weeks growth in the 8-h photoperiod. Inflorescence stems were harvested when they were approximately 15 cm high. Secondary stems and flowers were removed before preparation of cell walls and RG I. Roots were obtained from plants grown hydroponically (Husted et al., 2002). Identification of Homozygous Plants Genomic DNA was prepared as described by Edwards et al. (1991). Homozygosity was verified by PCR using primers suggested by Syngenta for arad1-1 (gene-specific primers 5′-TATGTGTTCAGGGTGGAAAAGT-3′ and 5′-GGGAGACTTGACGCCAGATT-3′, insert-specific primer 5′-TAGCATCTGAATGTCATAACCAAT-3′) and the Salk Institute for arad1-2 (gene-specific primers 5′-GTAGTTATGCCACGGGAGGGG-3′ and 5′-GGAGTTGAGGATCGCAACACATT-3′, insert-specific primer 5′-GCGTGGACCGCTTGCTGCAACT-3′; Fig. 1). Bioinformatics Protein targeting was predicted using TargetP (Emanuelsson et al., 2000). Transmembrane helix prediction was performed using TMHMM (Sonnhammer et al., 1998). N-glycosylation sites were predicted using NetNGlyc (http://www.cbs.dtu.dk/services/NetNGlyc/). In silico expression analysis was performed using GENEVESTIGATOR (Zimmermann et al., 2004), which is based on 1,561 publicly available microarray experiments. Sequence alignments were performed using ClustalX (version 1.83) with the Gonnet series matrix, gap opening penalty of 10, gap extension penalty of 0.2, and a delay of divergent sequences of 30%. Both residue-specific and hydrophophilic residue penalties were on. Phylogenetic tree was constructed with PHYLIP (version 3.6a3; J. Felsenstein, University of Washington, http://evolution.genetics.washington.edu/phylip.html) and visualized using Treeview (version 1.6.6). Transformation of Plants with 35S∷ARAD1 The coding region of ARAD1 was amplified from the cDNA clone OAO233 (TAIR accession 2337050, originating from B. Lescure, Centre National de la Recherche Scientifique/Institut National de la Recherche Agronomique Laboratoire de Biologie Moléculaire) with primers 5′-GTCCG GAGCTCATGGCGCGTAAATCTTC-3′ (SacI) and 5′-GACAT GCATGCTTAAATGGAAGTGATAAGACCG-3′ (SphI) using Phusion polymerase (Finnzymes). The PCR product was cloned as a SacI/SphI fragment under the control of the 35S promoter and terminator in pPS48 (Kay et al., 1987), resulting in pJJ20. Insert and vector-insert junctions were sequenced, and, subsequently, the XbaI fragment of pJJ20 containing the CaMV 35S promoter, ARAD1, and the CaMV 35S terminator was transferred to pPZP221 (Hajdukiewicz et al., 1994). Col-0 and arad1-2 plants were transformed with the empty pPZP221 vector or with the vector containing the p35S∷ARAD1 cassette by Agrobacterium tumefaciens-mediated transformation using the A. tumefaciens strain PGV3850. Seeds were selected for 2 weeks on Murashige and Skoog medium containing 100 μg/mL gentamycin sulfate and subsequently transferred to soil. After 8 weeks on soil, the plants were transferred to 16 h light to induce bolting. Primary stems of five primary transformants from each transformation were harvested when 15 to 20 cm tall and used to prepare total cell wall AIR for determination of monosaccharide composition. Cell Wall Preparation AIR was prepared as described by Fry (1988) with adaptations. Tissue of interest was boiled in 96% ethanol for 30 min. The supernatant was removed after centrifugation at 10,000g for 5 min. The pellet was washed with 70% ethanol with subsequent centrifugation until it appeared free of chlorophyll. A final wash with 100% acetone was performed, and the pellet was dried under vacuum. Prior to RG I extraction, AIR was treated with enzymes for the removal of residual starch. Approximately 200 mg of AIR was suspended in 50 mL of 10 mm potassium phosphate buffer, pH 6.5, 1 mm CaCl2, 0.05% NaN3 that had been preheated to 95°C. Starch was allowed to gelatinize for 30 s before 1 unit/mL of thermostable α-amylase (Megazyme) was added and the suspension was incubated at 85°C for 15 min. After the incubation the sample was cooled to 25°C and amyloglucosidase and pullulanase (1 unit/mL of each, both from Megazyme) were added and the suspension was incubated for 16 h at 25°C, with continuous shaking at 500 rpm. The suspension was centrifuged for 10 min at 6,000g. The pellet was washed with 50 mL of 10 mm potassium phosphate, pH 6.5, 1 mm CaCl2, 0.05% NaN3, centrifuged again at 6,000g for 10 min, and finally dried under vacuum. RG I Isolation Isolation of RG I was performed by washing destarched AIR with phenol:acetic acid:water 2:1:1 (v/v/v) for 3 h (1:10 [w/v] ratio between AIR and phenol:acetic acid:water 2:1:1) at room temperature, followed by centrifugation at 6,000g for 5 min. The pellet was washed with water three times to remove phenol and extracted proteins. The pellet was incubated in buffer (50 mm cyclohexane-trans-1,2-diaminetetra-acetate, 50 mm ammonium formate, 0.05% sodium azide, pH 4.5) to a concentration of 10 mg/mL. One unit/milliliter of endopolygalacturonase (Sigma) and pectin methyl esterase (Christensen et al., 1998) was added and incubated for 16 h at room temperature. Both enzymes were homogeneous according to SDS-PAGE. After centrifugation at 6,000g for 5 min, the supernatant was collected. The pellet was resuspended in buffer and centrifuged; the supernatant was pooled with the previously obtained supernatant. The sample was dried under vacuum and resuspended in water. RG I was purified by size exclusion chromatography on a Superose 12 column (1 × 30 cm; Amersham Pharmacia) equilibrated in 0.05 m ammonium formate. Up to 1 mL of sample was applied to the column and eluted with 0.05 m ammonium formate at a flow rate of 0.8 mL/min. The eluent was monitored using a refractive index detector (model 131; Gilson). The columns were calibrated using dextran molecular mass standards (Fluka) and Glc. RG I was obtained as the high molecular mass fractions (>25 kD). High Performance Anion Exchange Chromatography with Pulsed Amperiometric Detection Samples were hydrolyzed in 2 m trifluoroacetic acid for 1 h at 120°C. Trifluoroacetic acid was removed by drying under vacuum. Monosaccharide composition was subsequently determined by high performance anion exchange chromatography with pulsed amperiometric detection of hydrolyzed material using a PA20 column (Dionex) as described previously (Øbro et al., 2004). Monosaccharide standards were from Sigma and included l-Fuc, l-Rha, l-Ara, d-Gal, d-Glc, d-Xyl, d-Man, d-GalUA, and d-GlcUA. For verification of the response factors, a standard calibration was performed before analysis of each batch of samples. Glycosidic Linkage Analysis For linkage analysis RG I samples were per-O-methylated essentially as described by Hakamori (1964) using NaOH in dimethyl sulfoxide (Anumula and Taylor, 1992). Subsequently, the permethylated glycans were further derivatized to their corresponding partially methylated alditol acetates by trifluoroacetic acid hydrolysis, reduction, O-acetylation, and extraction as described by Anumula and Taylor (1992). The mixture of derivatized monosaccharides was separated on a 30-cm × 0.25-mm SP-2380 fused-silica capillary column (Sigma-Aldrich) using gas-liquid chromatography (6890N GC system; Agilent). The temperature profile commenced from 160°C to 200°C at 20°C per min, then the temperature was held for 5 min and finally increased to 245°C at 20°C per min. The eluting gas stream was analyzed with a quadrupole mass analyzer (5973 mass analyzer; Agilent). Sugars and linkage types were determined based upon both retention time and fragmentation pattern. Immunolabeling of Stem Sections and Microscopy Transverse hand sections (approximately 0.5 mm width) of Arabidopsis stems and leaves were made using a scalpel. The sections were fixed in 4% (w/v) formaldehyde in buffer (50 mm PIPES, pH 6.9, 5 mm MgSO4, 5 mm EGTA) for 2 h at 4°C. The sections were then washed with the same buffer and labeled with anti-pectin antibodies as described by Willats et al. (2001). Antibodies used included LM5, which recognizes a short epitope of β-1,4-d-galactan (Jones et al., 1997), and LM6, which recognizes short (5–6 residues) stretches of α-1,5-arabinan (Willats et al., 1998). Labeled sections were observed with a microscope equipped with epifluorescence illumination (Olympus UK). Images were photographed using a digital camera using fixed exposure settings (Nikon UK). For investigation of stomata, epidermal strips were peeled from 8-week-old leaves and treated as in Jones et al. (2003) for functional experiments or placed in water for autofluorescence experiments. Immunochemical Analysis of Proteins in Stem Tissue Stem tissue was frozen in liquid N2 and homogenized to a fine powder. Equal volumes of tissue powder and buffer (50 mm EDTA, pH 8.0, 0.25 m NaCl, 1 mm dithiothreitol, 0.75% SDS, and complete protease inhibitors [Roche Diagnostics]) were mixed vigorously and incubated for 10 min at 68°C. The samples were centrifuged at 10,000g for 10 min and the supernatants collected. Protein content was determined using Bradford reagent (Bradford, 1976), and equal amounts of protein (20 μg) were electrophoresed on 8% to 25% gradient gels prepared according to Fling and Gregerson (1986). Immunoblotting was carried out by transferring electrophoresed proteins to nitrocellulose membranes, followed by incubation with antibodies LM1 (anti-extensin; Smallwood et al., 1995), LM2 (Smallwood et al., 1996), LM5 (Jones et al., 1997), and LM6 (Willats et al., 1998) as described by Orfila et al. (2001). Aliquots of 1 μL containing 1 μg of protein were directly assayed for antibody binding by immunodot assays as described by Willats and Knox (1999). Promoter-GUS Analysis A 403-bp fragment upstream of the predicted start codon of ARAD1 was amplified with the primers 5′-ACCGGAATTCAACAACACTCCCACATTCTAC-3′ (EcoRI) and 5′-ACATGCCATGGTGGAGATTGAAGAAGGTTAGG-3′ (NcoI) using Phusion polymerase (Finnzymes). This fragment covers the region from the stop codon of the upstream open reading frame (At2g35110) to the start codon of ARAD1. The PCR product was cloned as an EcoRI/NcoI fragment in pCAMBIA1301 (CAMBIA, Canberra, Australia). To verify the integrity of the construct, the insert and vector-insert junctions were sequenced before transformation into Arabidopsis. Primers used for sequencing were a gene-specific antisense primer 5′-GGTGAGAGATTGAACAAC-3′ and a GUS-specific antisense primer 5′-CACCAACGCTGATCAATTCCAC-3′. Plants of the Col-0 ecotype were transformed by A. tumefaciens-mediated transformation using the A. tumefaciens strain PGV3850 and selected by screening for T-DNA-encoded hygromycin resistance. Approximately 50 transformants were obtained. The transformants were selected for 2 weeks on hygromycin, transferred to soil, and grown at 20°C with 8 h light. After 6 weeks on soil, the plants were transferred to 16 h light. GUS staining was performed by overnight incubation at 37°C in GUS staining solution (50 mm sodium phosphate buffer, pH 7.0, 10 mm EDTA, 0.1% Triton X-100, 0.5 mm potassium ferricyanide, 0.5 mm potassium ferrocyanide, 1 mg/mL X-Glucuronoside). After staining the plant tissue was cleared with several washes of 96% ethanol. Older tissues were vacuum infiltrated with the GUS staining solution prior to incubation. For each developmental stage, similar staining patterns were observed for at least five individual transformants. RT-PCR Total RNA was isolated according to Logermann et al. (1987), except that guanidine hydrochloride was exchanged with phenol and Tris buffer, pH 9.0. cDNA was generated with 2 μg of RNA using Iscript (Bio-Rad). PCR was carried out using 5′-GCTCCTCCACAGTCCAAAAG-3′ as forward primer, 5′-ACGAGCTGCTACGAAAGGAA-3′ as reverse primer, and 0.25 μg of cDNA. Primers specific for actin, 5′-GGTCGTACTACCGGTATTGTGCT-3′ as forward primer and 5′-TGACAATTTCACGCTCTGCT-3′ as reverse primer, were used as control. Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AC004667. ACKNOWLEDGMENTS We thank Charlotte Sørensen, Lis Drayton Hansen, and Julia Schönfeld for excellent technical assistance. Syngenta and the Salk Institute are thanked for providing the arad1-1 and arad1-2 mutant seeds, respectively. Dr. Tove Christensen is thanked for the generous gift of pectin methyl esterase. LITERATURE CITED Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK, Zimmerman J, Barajas P, Cheuk R, et al ( 2003 ) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301 : 653 –657 Anumula KR, Taylor PB ( 1992 ) A comprehensive procedure for preparation of partially methylated alditol acetates from glycoprotein carbohydrates. Anal Biochem 203 : 101 –108 Bouton S, Leboeuf E, Mouille G, Leydecker MT, Talbotec J, Granier F, Lahaye M, Hofte H, Truong HN ( 2002 ) QUASIMODO1 encodes a putative membrane-bound glycosyltransferase required for normal pectin synthesis and cell adhesion in Arabidopsis. Plant Cell 14 : 2577 –2590 Bradford MM ( 1976 ) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72 : 248 –254 Carpita NC, Gibeaut DM ( 1993 ) Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth. Plant J 3 : 1 –30 Christensen TMIE, Nielsen JE, Kreiberg JD, Rasmussen P, Mikkelsen JD ( 1998 ) Pectin methyl esterase from orange fruit: characterization and localization by in-situ hybridization and immunohistochemistry. Planta 206 : 493 –503 Coutinho PM, Henrissat B ( 1999 ) Carbohydrate-active enzymes: an integrated database approach. In HJ Gilbert, G Davies, B Henrissat, B Svensson, eds, Recent Advances in Carbohydrate Bioengineering. The Royal Society of Chemistry, Cambridge, UK, pp 3–12 Doong RL, Liljebjelke K, Fralish G, Kumar A, Mohnen D ( 1995 ) Cell-free synthesis of pectin (identification and partial characterization of polygalacturonate 4-α-galacturonosyltransferase and its products from membrane preparations of tobacco cell-suspension cultures). Plant Physiol 109 : 141 –152 Edwards K, Johnstone C, Thompson C ( 1991 ) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res 19 : 1349 Egelund J, Skjot M, Geshi N, Ulvskov P, Petersen BL ( 2004 ) A complementary bioinformatics approach to identify potential plant cell wall glycosyltransferase-encoding genes. Plant Physiol 136 : 2609 –2620 Emanuelsson O, Nielsen H, Brunak S, von Heijne G ( 2000 ) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300 : 1005 –1016 Fan DF, Feingold DS ( 1972 ) Biosynthesis of uridine diphosphate D-xylose. V. UDP-D-glucuronate and UDP-D-galacturonate carboxy-lyase of Ampullariella digitata. Arch Biochem Biophys 148 : 576 –580 Fling SP, Gregerson DS ( 1986 ) Peptide and protein molecular weight determination by electrophoresis using a high-molarity tris buffer system without urea. Anal Biochem 55 : 83 –88 Fry SC ( 1988 ) The Growing Plant Cell Wall: Chemical and Metabolic Analysis. Longman Scientific and Technical, Essex, UK Geshi N, Pauly M, Ulvskov P ( 2002 ) Solubilization of galactosyltransferase that synthesizes 1,4-β-galactan side chains in pectic rhamnogalacturonan I. Physiol Plant 114 : 540 –548 Hajdukiewicz P, Svab Z, Maliga P ( 1994 ) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25 : 989 –994 Hakamori S ( 1964 ) A rapid permethylation of glycolipid and polysaccharide catalyzed by methylsulfinyl carbanion in dimethyl sulfoxide. J Biochem (Tokyo) 55 : 205 –208 Heim DR, Skomp JR, Tschabold EE, Larrinua IM ( 1990 ) Isoxaben inhibits the synthesis of acid insoluble cell wall materials in Arabidopsis thaliana. Plant Physiol 93 : 695 –700 Hurlbert RE, Weckesser J, Mayer H, Fromme I ( 1976 ) Isolation and characterization of the lipopolysaccharide of Chromatium vinosum. 68 : 365 –371 Husted S, Mattsson M, Möllers C, Wallbraun M, Schjørring JK ( 2002 ) Photorespiratory NH4 + production in leaves of wild-type and glutamine synthetase 2 antisense oilseed rape. Plant Physiol 130 : 989 –998 Iwai H, Masaoka N, Ishii T, Satoh S ( 2002 ) A pectin glucuronyltransferase gene is essential for intercellular attachment in the plant meristem. Proc Natl Acad Sci USA 99 : 16319 –16324 Jones L, Milne JL, Ashford D, McCann MC, McQueen-Mason SJ ( 2005 ) A conserved functional role of pectic polymers in stomatal guard cells from a range of plant species. Planta 221 : 255 –264 Jones L, Milne JL, Ashford D, McQueen-Mason SJ ( 2003 ) Cell wall arabinan is essential for guard cell function. Proc Natl Acad Sci USA 100 : 11783 –11788 Jones L, Seymour GB, Knox JP ( 1997 ) Localization of pectic galactan in tomato cell walls using a monoclonal antibody specific to (1→4)-β-d-galactan. Plant Physiol 113 : 1405 –1412 Kay R, Shan A, Daly M, McPherson J ( 1987 ) Duplication of CaMV 35S promoter sequences creates a strong enhancer for plant genes. Science 236 : 1299 –1302 Li X, Cordero I, Caplan J, Molhoj M, Reiter WD ( 2004 ) Molecular analysis of 10 coding regions from Arabidopsis that are homologous to the MUR3 xyloglucan galactosyltransferase. Plant Physiol 134 : 940 –950 Lind T, Tufaro F, McCormick C, Lindahl U, Lidholt K ( 1998 ) The putative tumor suppressors EXT1 and EXT2 are glycosyltransferases required for the biosynthesis of heparan sulfate. J Biol Chem 273 : 26265 –26268 Logermann J, Schell J, Willmitzer L ( 1987 ) Improved method for the isolation of RNA from plant tissue. Anal Biochem 163 : 16 –20 Madson M, Dunand C, Li X, Verma R, Vanzin GF, Caplan J, Shoue DA, Carpita NC, Reiter WD ( 2003 ) The MUR3 gene of Arabidopsis encodes a xyloglucan galactosyltransferase that is evolutionarily related to animal exostosins. Plant Cell 15 : 1662 –1670 Manfield IW, Orfila C, McCartney L, Harholt J, Bernal AJ, Scheller HV, Gilmartin PM, Mikkelsen JD, Knox JP, Willats WGT ( 2004 ) Novel cell wall architecture of isoxaben-habituated Arabidopsis suspension-cultured cells: global transcript profiling and cellular analysis. Plant J 40 : 260 –275 Mohnen D ( 1999 ) Biosynthesis of pectins and galactomannans. In D Barton, K Nakanishi, O Meth-Cohn, BM Pinto, eds, Comprehensive Natural Products Chemistry, Vol 3. Carbohydrates and Their Derivatives Including Tannins, Cellulose, and Related Lignins. Elsevier, Oxford, pp 497–527 Nunan KJ, Scheller HV ( 2003 ) Solubilization of an arabinan arabinosyltransferase activity from mung bean hypocotyls. Plant Physiol 132 : 331 –342 Øbro J, Harholt J, Scheller HV, Orfila C ( 2004 ) Rhamnogalacturonan I in Solanum tuberosum tubers contains complex arabinogalactan structures. Phytochemistry 65 : 1429 –1438 Orfila C, Seymour GB, Willats WGT, Huxham IM, Jarvis MC, Dover CJ, Thompson AJ, Knox JP ( 2001 ) Altered middle lamella homogalacturonan and disrupted deposition of (1→5)-α-l-arabinan in the pericarp of Cnr, a ripening mutant of tomato. Plant Physiol 126 : 210 –221 Orfila C, Sørensen SO, Harholt J, Geshi N, Crombie H, Truong H-N, Reid JSG, Knox JP, Scheller HV ( 2005 ) QUASIMODO1 is expressed in vascular tissue of Arabidopsis thaliana inflorescence stems, and affects homogalacturonan and xylan biosynthesis. Planta 222 : 613 –622 Porchia AC, Sorensen SO, Scheller HV ( 2002 ) Arabinoxylan biosynthesis in wheat. Characterization of arabinosyltransferase activity in Golgi membranes. Plant Physiol 130 : 432 –441 Ridley BL, O'Neill MA, Mohnen D ( 2001 ) Pectins: structure biosynthesis and oligogalacturonide-related signaling. Phytochemistry 57 : 929 –967 Scheible WR, Pauly M ( 2004 ) Glycosyltransferases and cell wall biosynthesis: novel players and insights. Curr Opin Plant Biol 7 : 285 –295 Schols HA, Vierhuis E, Bakx EJ, Voragen AG ( 1995 ) Different populations of pectic hairy regions occur in apple cell walls. Carbohydr Res 275 : 343 –360 Shedletzky E, Shmuel M, Delmer DP, Lamport DTA ( 1990 ) Adaptation and growth of tomato cells on the herbicide 26-dichlorobenzonitrile leads to production of unique cell-walls virtually lacking a cellulose-xyloglucan network. Plant Physiol 94 : 980 –987 Skjøt M, Pauly M, Bush MS, Borkhardt B, McCann MC, Ulvskov P ( 2002 ) Direct interference with rhamnogalacturonan I biosynthesis in Golgi vesicles. Plant Physiol 129 : 95 –102 Smallwood M, Martin H, Knox JP ( 1995 ) An epitope of rice threonine- and hydroxyproline-rich glycoprotein is common to cell wall and hydrophobic plasma-membrane glycoproteins. Planta 196 : 510 –522 Smallwood M, Yates EA, Willats WGT, Martin H, Knox JP ( 1996 ) Immunochemical comparison of membrane-associated and secreted arabinogalactan-proteins in rice and carrot. Planta 198 : 452 –459 Sonnhammer EL, von Heijne G, Krogh A ( 1998 ) A hidden Markov model for predicting transmembrane helices in protein sequences. Proc Int Conf Intell Syst Mol Biol 6 : 175 –182 Sørensen SO, Pauly M, Bush M, Skjot M, McCann MC, Borkhardt B, Ulvskov P ( 2000 ) Pectin engineering: modification of potato pectin by in vivo expression of an endo-1,4-β-D-galactanase. Proc Natl Acad Sci USA 97 : 7639 –7644 Varma R, Vercellotti JR, Varma R ( 1977 ) On arabinose as a component of brain hyaluronate. Confirmation by chromatographic, enzymatic and chemical ionization-mass spectrometric analyses. Biochim Biophys Acta 497 : 608 –614 Villemez CL, Lin T-Y, Hassid WZ ( 1965 ) Biosynthesis of the polygalacturonic acid chain of pectin by a particulate enzyme preparation from Phaseolus aureus seedlings. Proc Natl Acad Sci USA 54 : 1626 –1632 Vincken JP, Schols HA, Oomen RJ, McCann MC, Ulvskov P, Voragen AG, Visser RG ( 2003 ) If homogalacturonan were a side chain of rhamnogalacturonan I. Implications for cell wall architecture. Plant Physiol 132 : 1781 –1789 Wardi AH, Allen WS, Turner DL, Stary Z ( 1966 ) Isolation of arabinose-containing hyaluronate peptides and xylose-containing chondroitin sulfate peptides from protease-digested brain tissue. Arch Biochem Biophys 117 : 44 –53 Willats WGT, Knox JP ( 1999 ) Immunoprofiling of pectic polysaccharides. Anal Biochem 267 : 143 –146 Willats WGT, Marcus SE, Knox JP ( 1998 ) Generation of monoclonal antibody specific to (1→5)-alpha-L-arabinan. Carbohydr Res 308 : 149 –152 Willats WGT, McCartney L, Mackie W, Knox JP ( 2001 ) Pectin: cell biology and prospects for functional analysis. Plant Mol Biol 47 : 9 –27 Zhang Q, Liu HW ( 2001 ) Chemical synthesis of UDP-beta-L-arabinofuranose and its turnover to UDP-beta-L-arabinopyranose by UDP-galactopyranose mutase. Bioorg Med Chem Lett 11 : 145 –149 Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W ( 2004 ) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol 136 : 2621 –2632 Author notes 1 This work was supported in part by the European Union (fifth framework contracts BIO4 CT97–2231) and the Danish National Research Foundation. 2 Present address: School of Applied Sciences, Northumbria University, Ellison Building, Ellison Place, Newcastle Upon Tyne NE1 8ST, UK. * Corresponding author; e-mail [email protected]; fax 45–35283333. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Henrik Vibe Scheller ([email protected]). [W] The online version of this article contains Web-only data. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.072744. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Voll, Lars M.; Jamai, Aziz; Renné, Petra; Voll, Hildegard; McClung, C. Robertson; Weber, Andreas P.M.

doi: 10.1104/pp.105.071399pmid: 16339799

Abstract Mitochondrial serine hydroxymethyltransferase (SHMT), combined with glycine decarboxylase, catalyzes an essential sequence of the photorespiratory C2 cycle, namely, the conversion of two molecules of glycine into one molecule each of CO2, NH4+, and serine. The Arabidopsis (Arabidopsis thaliana) mutant shm (now designated shm1-1) is defective in mitochondrial SHMT activity and displays a lethal photorespiratory phenotype when grown at ambient CO2, but is virtually unaffected at elevated CO2. The Arabidopsis genome harbors seven putative SHM genes, two of which (SHM1 and SHM2) feature predicted mitochondrial targeting signals. We have mapped shm1-1 to the position of the SHM1 gene (At4g37930). The mutation is due to a G → A transition at the 5′ splice site of intron 6 of SHM1, causing aberrant splicing and a premature termination of translation. A T-DNA insertion allele of SHM1, shm1-2, and the F1 progeny of a genetic cross between shm1-1 and shm1-2 displayed the same conditional lethal phenotype as shm1-1. Expression of wild-type SHM1 under the control of either the cauliflower mosaic virus 35S or the SHM1 promoter in shm1-1 abrogated the photorespiratory phenotype of the shm mutant, whereas overexpression of SHM2 or expression of SHM1 under the control of the SHM2 promoter did not rescue the mutant phenotype. Promoter-β-glucuronidase analyses revealed that SHM1 is predominantly expressed in leaves, whereas SHM2 is mainly transcribed in the shoot apical meristem and roots. Our findings establish SHM1 as the defective gene in the Arabidopsis shm1-1 mutant. Photorespiration is caused by the dual affinity of Rubisco for both CO2 and molecular oxygen (Bowes et al., 1971; Ogren and Bowes, 1971; Bowes and Ogren, 1972; Ogren, 1984). Whereas the carboxylation of the acceptor ribulose 1,5-bisphosphate (RuBP) leads to the production of two molecules of 3-phosphoglycerate (two C3 moieties) that can both be reconverted into RuBP by the Calvin cycle, the addition of molecular oxygen to RuBP (oxygenation) yields one molecule of 3-phosphoglycerate and one molecule of 2-phosphoglycolate (a C2 unit). The regeneration of 2-phosphoglycolate to 3-phosphoglycerate involves a reaction sequence that is known as the oxidative C2 cycle or the photorespiratory carbon cycle (termed C2 cycle hereafter). This cycle involves three organelles (chloroplasts, peroxisomes, and mitochondria) and one molecule each of CO2 and NH4+ are liberated during the conversion of two molecules of 2-phosphoglycolate into one molecule of 3-phosphoglycerate. These CO2 and NH4+ molecules have to be refixed by Rubisco and the glutamine synthase/GOGAT system, respectively. The C2 cycle was elucidated in the 1970s and the enzymatic steps involved as well as some salvage pathways are well established (Leegood et al., 1995; Douce and Neuburger, 1999; Wingler et al., 1999, 2000). Mutants in the C2 cycle have contributed much to our understanding of this important biochemical pathway (Somerville and Ogren, 1982; Leegood et al., 1995; Somerville, 2001). These photorespiratory mutants display a conditional lethal phenotype, which means they are unable to thrive at ambient conditions whereas apparently they are not affected in conditions that suppress photorespiration, such as high CO2 (Somerville and Ogren, 1982; Blackwell et al., 1988). The Arabidopsis (Arabidopsis thaliana) Ser hydroxymethyltransferase (SHMT) mutant stm was one of the first photorespiratory mutants described by Somerville and Ogren (1981) and was later renamed shm to avoid confusion with the mutant shoot meristemless (Barton and Poethig, 1993). The defective gene in shm, hereafter termed shm1-1, has not been identified until now. In the initial study of this Arabidopsis mutant, no SHMT activity could be determined in shm1-1 leaf mitochondria and foliar Gly levels under photorespiratory conditions were 40-fold higher in shm1-1 in comparison to the wild type (Somerville and Ogren, 1981). These two observations indicated that a defective mitochondrial SHMT gene accounts for the photorespiratory phenotype of the shm1-1 mutant. Together with the Gly decarboxylase complex, SHMT is involved in the reversible interconversion of Ser and Gly and both enzymes are closely associated with each other. During the operation of the C2 cycle, one molecule of Gly is first decarboxylated and subsequently deaminated in the Gly decarboxylase complex yielding CO2, NH4+, and the C1 donor, 5,10-methylene tetrahydrofolate (THF), which is used by SHMT to transfer the activated C1 unit onto another molecule of Gly (Douce and Neuburger, 1999). In leaves of C3 plants, mitochondrial SHMT is predominantly involved in the C2 cycle, as evidenced by the conditional lethal photorespiratory phenotype of shm1-1 (Somerville and Ogren, 1981). Very recently, however, a weak shm1 allele was isolated, which we will address as shm1-3 (Moreno et al., 2005). Homozygous shm1-3 mutants exhibit chlorotic lesions but are viable in ambient conditions (Moreno et al., 2005). Because of its compromised C2 cycle, shm1-3 overproduces reactive oxygen species and is thus more susceptible to salt stress and pathogens (Moreno et al., 2005). Molecular studies of the shm1-1 mutant revealed that SHM transcripts of apparently normal length accumulated in the mutant, although these transcripts were more abundant at elevated CO2 conditions in the mutant than in the wild type (Beckmann et al., 1997). In silico analyses showed that the Arabidopsis genome harbors seven SHM genes, two of which encode gene products that are predicted to be targeted to the mitochondria (McClung et al., 2000; Bauwe and Kolukisaoglu, 2003). AtSHM1 appears to encode the major SHMT isozyme in Arabidopsis leaves and its transcript accumulation is controlled by light and the circadian clock (McClung et al., 2000). Thus, AtSHM1 was considered a good candidate for the defective gene in the shm1-1 mutant (McClung et al., 2000), but this hypothesis has not been directly tested. In this study, we report on the positional cloning and the molecular characterization of the defective gene in shm1-1, on the isolation of a new allele, shm1-2, and on the complementation of the shm1-1 mutant with the wild-type SHM1 allele. In addition, we show that the gene encoding the second putatively mitochondrial-targeted SHM isozyme in Arabidopsis, SHM2, is predominantly expressed in roots and the shoot apical meristem (SAM), whereas SHM1 encodes the major isoform in leaves. Surprisingly, expression of SHM2 in shm1-1 under the control of either the 35S or the SHM1 promoter failed to complement the photorespiratory shm phenotype, indicating that either SHM2 does not encode a fully functional SHMT protein or the protein is not targeted to mitochondria. Our findings unequivocally demonstrate that At4g37930 (AtSHM1) is crucial for plant growth in ambient air and for proper function of the C2 cycle. RESULTS Positional Cloning of the Defective Gene in the shm1-1 Mutant Somerville and Ogren (1981) have demonstrated that the Arabidopsis mutant shm1-1 lacks mitochondrial SHMT activity and therefore displays a photorespiratory phenotype. The Arabidopsis genome encodes seven putative SHMT proteins, two of which (AtSHM1 and AtSHM2) are presumably localized in the mitochondrial matrix as indicated by the presence of a putative mitochondrial targeting signal (McClung et al., 2000). The subcellular localization was predicted by computer algorithms and not further supported by experimental evidence (McClung et al., 2000; Bauwe and Kolukisaoglu, 2003). In addition, conceptual translations of genes in the Arabidopsis genomes are frequently hampered by the inclusion or omission of exon sequences, thus raising the possibility that additional, unrecognized mitochondrial SHMT isozymes are encoded by the Arabidopsis genome. To narrow down the number of candidates for the defective gene in shm1-1, the mutation was mapped using a cleaved amplified polymorphic sequence (CAPS) marker approach (Konieczny and Ausubel, 1993). To this end, a mapping population was developed from a genetic cross between shm1-1, which is in the ecotype Columbia (Col-0) background, and Landsberg erecta (Ler). For F2 individuals, 186 of 837 (22.1%) displayed a photorespiratory phenotype, and these plants were selected for the mapping procedure. Using all 186 F2 individuals showing the mutant phenotype, we mapped the shm1 locus to 95 cm on chromosome IV (Fig. 1 Figure 1. Open in new tabDownload slide Cartoon depicting the map position of the shm1-1 locus on the recombinant inbred map (Lister and Dean, 1993) according to our mapping data. A total of 186 F2 individuals of a cross between the shm1-1 mutant (background Col-0) and Ler showing a photorespiratory phenotype were scored for the cosegregation of 23 CAPS markers (see Supplemental Table II) with the photorespiratory phenotype as described in “Materials and Methods.” Figure 1. Open in new tabDownload slide Cartoon depicting the map position of the shm1-1 locus on the recombinant inbred map (Lister and Dean, 1993) according to our mapping data. A total of 186 F2 individuals of a cross between the shm1-1 mutant (background Col-0) and Ler showing a photorespiratory phenotype were scored for the cosegregation of 23 CAPS markers (see Supplemental Table II) with the photorespiratory phenotype as described in “Materials and Methods.” ) of the recombinant inbred map (Lister and Dean, 1993). AtSHM1 (At4g37930) is located at this map position and a CAPS marker (F20D10) was developed for this locus. No recombination of the marker F20D10 and the shm1 locus was observed (Fig. 1), indicating that AtSHM1 is deficient in shm1-1. A Mutation in the 5′ Splice Site of Intron 6 of AtSHM1 Causes Aberrant Splicing of the SHM1 mRNA in shm1-1 Genetic mapping strongly indicated that AtSHM1 is the affected gene in shm1-1. Therefore, the SHM1 gene was sequenced in the mutant and a G → A transition was detected in the consensus sequence of the 5′ splice donor site of intron 6 in the mutant allele (Fig. 2B Figure 2. Open in new tabDownload slide Comparison between the genomic DNA (i), the mRNA (ii), and the derived protein sequence (iii) of wild-type (A) and shm1-1 mutants (B). Only the sequence between the end of exon 6 (start-ATG + 1,272 bp) and the beginning of exon 7 (start-ATG + 1,376 bp) is shown. Bold, Exon; italics, intron; bold italics, conserved splice motif. The arrows indicate the point mutation in shm1-1. Asterisk (*), Translational stop. C, RT-PCR products from wild-type and shm1-1 mRNA obtained with primers prSHM4 and prSHM9 (see Table I). D, Primers prSHM5 and prSHM6 (see Table I). Two independent RNA preparations of each line were taken for the RT-PCR reactions. From left to right, Two lanes wild-type (Col-0); two lanes shm1-1 mutant; one lane cDNA. The RT-PCR fragment sizes are indicated beside the image. Plasmid containing the SHM1 expressed sequence tag clone 148C5T7 was used as a positive control in the PCR reaction. E, Cartoon showing AtSHM1 gene structure and the shm1-2 T-DNA insertion site in the last of the 15 SHM1 exons. As a reference, the point mutation in shm1-1 is indicated by an arrowhead. Figure 2. Open in new tabDownload slide Comparison between the genomic DNA (i), the mRNA (ii), and the derived protein sequence (iii) of wild-type (A) and shm1-1 mutants (B). Only the sequence between the end of exon 6 (start-ATG + 1,272 bp) and the beginning of exon 7 (start-ATG + 1,376 bp) is shown. Bold, Exon; italics, intron; bold italics, conserved splice motif. The arrows indicate the point mutation in shm1-1. Asterisk (*), Translational stop. C, RT-PCR products from wild-type and shm1-1 mRNA obtained with primers prSHM4 and prSHM9 (see Table I). D, Primers prSHM5 and prSHM6 (see Table I). Two independent RNA preparations of each line were taken for the RT-PCR reactions. From left to right, Two lanes wild-type (Col-0); two lanes shm1-1 mutant; one lane cDNA. The RT-PCR fragment sizes are indicated beside the image. Plasmid containing the SHM1 expressed sequence tag clone 148C5T7 was used as a positive control in the PCR reaction. E, Cartoon showing AtSHM1 gene structure and the shm1-2 T-DNA insertion site in the last of the 15 SHM1 exons. As a reference, the point mutation in shm1-1 is indicated by an arrowhead. ). To check whether the mutation of the consensus splice site would cause mis-splicing of the mRNA, the corresponding mRNA from the shm1-1 mutant was amplified by reverse transcription (RT)-PCR and sequenced. Sequencing demonstrated that the mutation led to aberrant splicing of intron 6 during shm1-1 mRNA maturation (Fig. 2B), producing a slightly longer shm1-1 mRNA (Fig. 2, C and D). Although intron 6 spans 87 bp and would thus not cause a translational frameshift in the mutant, it also contains several in-frame translational stop codons (Fig. 2B). Hence, a premature termination of AtSHM1 mRNA translation is to be expected, which would account for the absence of mitochondrial SHMT activity in shm1-1. A Presumptive Loss-of-Function T-DNA Allele shm1-2 Also Exhibits a Photorespiratory Phenotype We have isolated a T-DNA insertion allele for AtSHM1 from the SALK collection (SALK_083735), hereafter termed shm1-2, which was tested for allelism with shm1-1. The T-DNA insertion in shm1-2 is located in the last of the 15 exons of the SHM1 gene (Fig. 2E). The shm1-2 T-DNA allele has recently been used for an allelism test with a third, weak shm allele (referred to as shm1-3 in this study; originally designated shmt1-1 by Moreno et al. (2005). According to Moreno et al. (2005), shm1-2 never reached maturity and exhibited a chlorotic and dwarf phenotype. In our hands, shm1-2 lines homozygous for the T-DNA insertion uniformly showed a photorespiratory phenotype of chlorosis at ambient CO2 levels that was fully rescued at 3% CO2 (Fig. 3, B and C Figure 3. Open in new tabDownload slide Phenotypes of representative Col-0 wild-type (A), shm1-2 (C), shm1-1 (D), and shm1-1 × shm1-2 F1 (E) plants after 20 d in ambient air. Plants had been grown at 3% CO2 for 1 week before they were shifted to air. B, Representative shm1-2 individual that was constantly grown at 3% CO2. Please note that all images represent the same scale. Figure 3. Open in new tabDownload slide Phenotypes of representative Col-0 wild-type (A), shm1-2 (C), shm1-1 (D), and shm1-1 × shm1-2 F1 (E) plants after 20 d in ambient air. Plants had been grown at 3% CO2 for 1 week before they were shifted to air. B, Representative shm1-2 individual that was constantly grown at 3% CO2. Please note that all images represent the same scale. ), which could also be inferred from the description by Moreno et al. (2005). SHMT activity in crude leaf extracts of both shm1-1 and shm1-2 was approximately 10% of the wild type (Table I Table I. SHMT activity in Arabidopsis leaf extracts Total SHMT activity was assayed in leaf extracts from the wild type (Col-0), the shm1-1 mutant, two independent primary shm1-1-35S:SHM1 transformants (2T1 and 3T1), homozygous shm1-2, and F1 progeny from a cross between shm1-1 and shm1-2. Results represent the means of 12 replicates ±se that were obtained in four independent experiments. Genetic Background . SHMT Activity . nmol mg−1 min−1 Col-0 1.64 ± 0.07 shm1-1 0.18 ± 0.01 2T1 1.60 ± 0.06 3T1 1.49 ± 0.08 shm1-2 0.20 ± 0.02 shm1-2 × shm1-1 0.22 ± 0.02 Genetic Background . SHMT Activity . nmol mg−1 min−1 Col-0 1.64 ± 0.07 shm1-1 0.18 ± 0.01 2T1 1.60 ± 0.06 3T1 1.49 ± 0.08 shm1-2 0.20 ± 0.02 shm1-2 × shm1-1 0.22 ± 0.02 Open in new tab Table I. SHMT activity in Arabidopsis leaf extracts Total SHMT activity was assayed in leaf extracts from the wild type (Col-0), the shm1-1 mutant, two independent primary shm1-1-35S:SHM1 transformants (2T1 and 3T1), homozygous shm1-2, and F1 progeny from a cross between shm1-1 and shm1-2. Results represent the means of 12 replicates ±se that were obtained in four independent experiments. Genetic Background . SHMT Activity . nmol mg−1 min−1 Col-0 1.64 ± 0.07 shm1-1 0.18 ± 0.01 2T1 1.60 ± 0.06 3T1 1.49 ± 0.08 shm1-2 0.20 ± 0.02 shm1-2 × shm1-1 0.22 ± 0.02 Genetic Background . SHMT Activity . nmol mg−1 min−1 Col-0 1.64 ± 0.07 shm1-1 0.18 ± 0.01 2T1 1.60 ± 0.06 3T1 1.49 ± 0.08 shm1-2 0.20 ± 0.02 shm1-2 × shm1-1 0.22 ± 0.02 Open in new tab ). This indicates that (1) AtSHM1 is the predominant SHMT isoform in leaves and (2) shm1-1 and shm1-2 are loss-of-function alleles. Homozygous shm1-2 was crossed to shm1-1 and the resulting F1 progeny uniformly exhibited a photorespiratory phenotype (Fig. 3E) and similar total SHMT activity to both mutant parental lines (Table I). A T-DNA loss-of-function mutant of SHM2 (SALK _095881) that lacked detectable SHM2 mRNA and presumably lacked SHM2 protein function did not display the conditional lethal photorespiratory phenotype at ambient conditions (data not shown), indicating that SHM2 is not functionally equivalent to SHM1, although the SHM2 gene product is predicted to be targeted to the mitochondrial matrix (McClung et al., 2000; Bauwe and Kolukisaoglu, 2003). SHM1 and SHM2 Are Not Redundant To assess whether the failure of SHM2 to complement a lack of SHM1 function in shm1-1 is due to different expression patterns of SHM1 and SHM2, we overexpressed both genes in shm1-1 under the control of the strong constitutive cauliflower mosaic virus (CaMV) 35S promoter. In addition, we performed a promoter-swap experiment. The wild-type full-length cDNAs encoded by the SHM1 (expressed sequence tag 148C5T7) and SHM2 (C104687; Arabidopsis Biological Resource Center [ABRC]), were expressed either under the control of the constitutive CaMV 35S promoter or approximately 1 kb of their own proximal promoters, or the promoter of the respective other isoform (promoter swap) in stably transformed shm1-1 mutants. Figure 4 Figure 4. Open in new tabDownload slide Complementation analysis of shm1-1 with chimeric SHM constructs and by constitutive overexpression of SHM1 and SHM2. A, Col-0 control, shm1-1 mutant plants were transformed with CaMV 35S:SHM1 (B), pSHM1:SHM1 (C), pSHM1:SHM2 (D), empty-vector pH2GW7.0 vector only (E), CaMV 35S:SHM2 (F), pSHM2:SHM1 (G), and pSHM2:SHM2 (H). Representative T2 individuals are shown after growth for 28 d in ambient air. Please note that the images in A and B are presented at 1.5× lower magnification. Figure 4. Open in new tabDownload slide Complementation analysis of shm1-1 with chimeric SHM constructs and by constitutive overexpression of SHM1 and SHM2. A, Col-0 control, shm1-1 mutant plants were transformed with CaMV 35S:SHM1 (B), pSHM1:SHM1 (C), pSHM1:SHM2 (D), empty-vector pH2GW7.0 vector only (E), CaMV 35S:SHM2 (F), pSHM2:SHM1 (G), and pSHM2:SHM2 (H). Representative T2 individuals are shown after growth for 28 d in ambient air. Please note that the images in A and B are presented at 1.5× lower magnification. shows representative individuals of all transformants (Fig. 4, B–D and F–H), as well as empty-vector (Fig. 4E) and wild-type (Fig. 4A) controls after growth for 28 d in ambient air. SHM2 expression failed to rescue the conditional lethal phenotype, regardless of the promoter employed (Fig. 4, D and F). In contrast, expression of SHM1 under the control of the constitutive CaMV 35S promoter or its endogenous promoter restored growth (Fig. 4, B and C) and total foliar SHMT activity to wild-type levels (Table I). However, transformation of shm1-1 with pSHM2:SHM1 did not complement the mutant (Fig. 4G), indicating that the expression pattern and/or strength of the SHM2 promoter are not sufficient to permit complementation of the mutant phenotype. To further test this hypothesis, the Escherichia coli uidA reporter gene, encoding β-glucuronidase (GUS), was fused to the SHM1 and SHM2 promoter fragments used in the complementation study described above and the reporter gene constructs were transformed into Arabidopsis. While pSHM1 mediated strong GUS activity in the entire shoot, including leaves (Fig. 5A Figure 5. Open in new tabDownload slide Localization of SHM1 and SHM2 promoter activity. T2 progeny of stably transformed wild-type plants carrying pSHM1:GUS (A) or pSHM2:GUS (B and C) were stained for GUS activity as described in “Materials and Methods.” Figure 5. Open in new tabDownload slide Localization of SHM1 and SHM2 promoter activity. T2 progeny of stably transformed wild-type plants carrying pSHM1:GUS (A) or pSHM2:GUS (B and C) were stained for GUS activity as described in “Materials and Methods.” ), little GUS activity was detected in the shoots of plants carrying pSHM2:GUS, in which GUS activity was restricted to the roots, the SAM, and the first true leaf (Fig. 5, B and C). GUS expression from pSHM2 was not observed in mature, fully expanded leaves. The reporter gene data are supported by AtSHM2 transcript profiles generated using the digital northern tool of GENEVESTIGATOR (Zimmermann et al., 2004), indicating that AtSHM2 is expressed only at very low levels in photosynthetic tissues (data not shown). In addition, transcript coresponse analysis using the Arabidopsis Co-Response Database (Steinhauser et al., 2004a, 2004b) showed that only AtSHM1 transcripts, but not those of other putative SHM genes in Arabidopsis, show transcriptional coresponse with genes encoding enzymes of the photorespiratory pathway, such as phosphoglycolate phosphatase or hydroxypyruvate reductase (data not shown). DISCUSSION The Arabidopsis mutant shm1-1 was isolated in the early 1980s and since then it has been clear that insufficient mitochondrial SHMT activity accounted for the photorespiratory phenotype of the mutant (Somerville and Ogren, 1981). However, the molecular identity of the shm1-1 mutation has remained elusive and it had been hypothesized that a locus required for SHMT activity rather than an SHMT structural gene was affected in shm1-1 (Beckmann et al., 1997; McClung et al., 2000). This hypothesis seemed evident, since SHM1 steady-state transcript levels were increased in the shm1-1 mutant under nonphotorespiratory conditions (Beckmann et al., 1997) and because no apparent difference in transcript size between the mutant and the wild type was observed (Beckmann et al., 1997). Furthermore, the products of at least two SHM genes, SHM1 and SHM2, were predicted to be targeted to the mitochondria (McClung et al., 2000). Thus, both genes could potentially play a role in the C2 cycle, making functional redundancy of the two mitochondrial SHMT isoforms likely. This study provides unequivocal evidence that mutation in the shm1-1 mutant indeed affects SHM1 and that a second putative mitochondrial SHMT encoded by SHM2 cannot complement loss of SHM1 function. SHM1 and SHM2 are highly similar at the nucleotide and amino acid levels (McClung et al., 2000; Bauwe and Kolukisaoglu, 2003) and are likely to represent the products of a duplication event: Arabidopsis has undergone multiple rounds of polyploidization and a recent estimate is that 27% of the gene pairs formed by polyploidization persist in the genome (Blanc and Wolfe, 2003). However, the majority of these gene pairs have undergone functional divergence (Blanc and Wolfe, 2004), as is apparently the case for SHM1 and SHM2. Whereas the conditional lethal photorespiratory phenotype of the shm1-1 mutant could be cured by expression of wild-type SHM1 under the control of either its own or the constitutive viral CaMV 35S promoter, SHM1 expression from the SHM2 promoter failed to rescue the shm1-1 mutant phenotype (Fig. 4). SHM2 expression in the mutant background was not able to rescue the mutant, regardless of the promoter used to drive SHM2 expression (Fig. 4). In addition, strong GUS activity was detected in leaves when GUS expression was driven by the SHM1 promoter, whereas GUS expression driven by the SHM2 promoter was restricted to roots, the SAM, and the first true leaves (Fig. 5). Probing SHM1 and SHM2 promoter activities provides a straightforward explanation as to why SHM1 expression driven by the SHM2 promoter could not cure the photorespiratory phenotype of shm1-1 (Fig. 4): The SHM2 promoter lacks activity in rosette leaves, where photorespiration takes place. Thus, in the case of SHM1 and SHM2, functional divergence has apparently occurred at the promoter level. It can thus be unambiguously concluded that AtSHM1 is the SHMT coding gene involved in the C2 cycle. Surprisingly, however, SHM2 was not able to complement the shm1-1 phenotype even under the control of a strong promoter. Apparently, functional divergence of SHM1 and SHM2 has also occurred at the level of enzymatic activity or subcellular targeting; either SHM2 does not encode a fully functional SHMT protein or the SHM2 gene product is not targeted to the mitochondrial matrix. Further studies on the subcellular localization and activity of the SHMT2 protein are in progress to resolve this question. Together with the recent identification of the peroxisomal Ala:glyoxylate aminotransferase (Liepman and Olsen, 2001, 2003) and d-glycerate 3-kinase (Boldt et al., 2005), the molecular identification of the defective gene in shm1-1 completes the identification of all genes encoding enzymes known to be involved in the photorespiratory C2 cycle. However, the C2 cycle also requires transporters that catalyze the transport of photorespiratory intermediates across the membranes of chloroplasts, peroxisomes, and mitochondria. With the exception of the plastidic oxoglutarate/malate and Glu/malate translocators (Weber et al., 1995; Weber and Flügge, 2002; Renné et al., 2003) none of these transporters are known (Linka and Weber, 2005). It remains a challenge for the future to identify all genes involved in the C2 cycle. MATERIALS AND METHODS Seed Material Seeds of the shm1-1 mutant (CS8010) and of the SALK T-DNA insertion line SALK_083735 (shm1-2) were obtained from the ABRC. Plant Growth Seeds were sterilized as described by Clough and Bent (1998) and germinated at room temperature in a 12-h/12-h light/dark cycle on one-half-strength Murashige and Skoog medium in 3% CO2 at a photon flux density of approximately 100 μmol m−2 s−1. Plantlets were transferred to soil after the first four primary leaves had emerged and the growth cycle was allowed to complete under the same conditions. Mapping of the shm1-1 Locus The shm1-1 mutant (Col-0) was crossed to Ler, the F1 was self-fertilized, and the resulting F2 mapping population (837 F2 individuals) was grown for 7 weeks at 1,300 μL mL−1 CO2. The population was transferred to ambient conditions, the photorespiratory phenotype was scored 4 d after the transfer, and the cosegregation of the shm1-1 phenotype with 23 CAPS markers (obtained from The Arabidopsis Information Resource [TAIR]; see also www.arabidopsis.org, unless stated otherwise; see Supplemental Table II) was determined. Constitutive Overexpression of SHM1 and SHM2 and Complementation Studies with Chimeric SHM1 and SHM2 Expression Constructs For constitutive overexpression of wild-type SHM1 in the shm1-1 mutant background, a BamHI-KpnI fragment of expressed sequence tag 148C5T7 (GenBank accession no. T75910; ABRC), encoding the full-length SHM1 cDNA, was cloned into a modified pGREENII bar vector (Hellens et al., 2000) in which the multiple cloning site was replaced by the EcoRI-HindIII fragment of the 35S promoter/nopaline synthase terminator cassette derived from pBIN-AR (Höfgen and Willmitzer, 1990). The RT-PCR product corresponding to the full-length SHM2 cDNA was cloned in pGEMT easy, the resulting EcoRI fragment was cloned in pENTR-A vector, and then moved to the modified pB7GWIWG2I destination vector. shm1-1 mutants were transformed with the construct by the floral-dip method (Clough and Bent, 1998). The T1 progeny were grown at 0.3% CO2 for 14 d before the plantlets were selected for the bar marker by spraying them with a Basta solution (0.025% [w/v] phosphinotricine, 0.1% [v/v] Tween 20) twice a week. The Basta-resistant plants were then surveyed for the absence of the photorespiratory phenotype after transfer to ambient air. Chimeric constructs were generated by Gateway technology (Invitrogen). A PstI and a NotI restriction site were added to the N and C terminus of the SHM1 cDNA; a PstI and an EcoRI site were added to the N and C terminus of the SHM2 cDNA, respectively, using the primers: SHM1PstI Fwd (5′CCATTTTGTTATTTCTGCAGTCTCTTCTCTCTCGTTCATG), SHM1NotI Rev (5′-ATATCTCGAGTGCGGCCGCCCTTAGTTCTTGTACTTCATGGTTTC), SHM2PstI Fwd (5′-AATCGCACTCACTGCAGAGAAACAGAGAAGACGATAGAT), and SHM2NotI Rev (5′-ATATCTCGAGTGCGGCCGCCCGCTACTCTTTGTATCTCATCGTCT CTTTC). Upstream regions of 925 bp from the SHM1 and 1,234 bp of the SHM2 gene were amplified by PCR on Col-0 genomic DNA using the primers: pSHM1BamHI (5′-CTTTTTTAATTGATCTGGATCCTTCACAAACATGCATGCACCATT-3′), pSHM1PstI (5′-CATGAACGAGAGAGAAGAGACTGCAGAAATAACAAAATTGG-3′), pSHM2PstI (5′-TCTTCTCTGTTTCTCTGCAGTGAGTGCGATTA-3′), and pSHM2EcoRI (5′-AATTGCTTCATTTTCGGAATTCCACAAGCTTCTTCTTTTTTTA-3′). Following restriction digestion with the appropriate endonucleases, different combinations were ligated into the pENTR vector, transformed into Escherichia coli, and transferred to the modified pH2GW7.0 gateway vector (without 35S promoter) by LR clonase reactions. Agrobacterium tumefaciens strain AGL1 was transformed with the resulting plasmids by floral dip as described above. The T1 generation was grown at 3% CO2 for 14 d during selection for hygromycin-resistant individuals and Hyg plantlets were then assessed for the presence of the transgene by PCR (as described below) and for the photorespiratory phenotype as described above. Screening of Transgenic Plant Populations by PCR Genomic DNA was extracted from Arabidopsis (Arabidopsis thaliana) leaves as described by Edwards et al. (1991) and PCR analysis of transgenic progeny was conducted according to standard protocols using appropriate primer pairs. To identify SHM1 T-DNA insertion mutants, we used the gene-specific primer Shmt1-TDNA rvs (5′-GTTACAGCTTTCATCATCCCACAC-3′) together with the T-DNA left-border-specific primer LBb1 (5′-GCGTGGACCGCTTGCTGCAACT-3′). Promoter-uidA Fusions For promoter-uidA fusions, the promoter regions (925 bp for pSHM1, 1,234 bp for pSHM2) were amplified using two-step PCR reactions: The first step was performed with specific primers containing 12 nucleotides of the attB sites (in capitals), as well as gene-specific nucleotides (lowercase): SHM1-B1guspro (5′-AAAAAGCAGGCTCCcttgatgtttcacaaacatgc-3′), SHM1-B2guspro (5′-AGAAAGCTGGGTCttttcgctaaacctctctct-3′), SHM2-B1guspro (5′-AAAAAGCAGGCTCCtcgagattaacaagcttctt-3′), and SHM2-B2guspro (5′-AGAAAGCTGGGTCttctctatctatcgtcttct-3′). In the second PCR step, the universal attB adapter primers were used to amplify the product produced in step 1. The resulting PCR products were moved into pDONR207 by BP clonase reactions (Invitrogen). The promoters were then transferred to the pBGWFS7 destination vector using the LR clonase reaction. T1 populations were selected with Basta, as described above for the chimeric constructs and bar plants were examined for the presence of the transgene as described below. Histochemical Analysis of GUS Activity Plant tissues were incubated in GUS assay solution (50 mm sodium phosphate, pH 7.2, 0.5 mm potassium ferrocyanide, 0.5 mm potassium ferricyanide, 20% methanol, and 2 mm 5-bromo-4-chloro-β-glucuronide) at 37°C for 12 to 16 h, essentially as described by Jefferson et al. (1987; Jefferson, 1989). Slight vacuum was applied to facilitate substrate infiltration. Chlorophyll-containing tissue was cleared in 70% ethanol for photographic analysis. Sequencing of Genomic DNA Genomic DNA from wild-type and shm1-1 inflorescences was isolated using a urea-based buffer (Liu et al., 1995), 20 ng of the genomic DNA preparations were subjected to PCR amplification with different sets of AtSHM1-specific primers (see Supplemental Table I) according to standard protocols and the obtained fragments were subcloned into pGEMT-Easy (Promega). Standard dye-termination sequencing reactions containing 1 μg of vector with subcloned fragments and 30 pmol of primer were resolved on an ABI Prism 3100 sequencer. Sequencing of SHM1 mRNA RNA from wild-type and shm1-1 mutant Arabidopsis leaves was isolated by the Z6 buffer method (Logemann et al., 1987) and aliquots of the RNA preparations were reverse transcribed using the ImProm reverse transcriptase kit (Promega) following the manufacturer's instructions. The SHM1 cDNAs were amplified by PCR with two different primer sets, prSHM4-prSHM9 and prSHM5-prSHM6 (see Table I) and sequenced as described previously. Assay of SHMT Activity Crude extracts were prepared by grinding approximately 400 mg of leaf tissue in 300 μL of extraction buffer (50 mm phosphate buffer, 1 mmβ-mercaptoethanol, and 2.5 mm EDTA) and the extracts were clarified by centrifugation at 20,000g for 10 min. SHMT activity was tested by following the conversion of radioactive carbon from Ser to methylene THF (Geller and Kotb, 1989). The assay was performed with 0.25 mm pyridoxal 5′ phosphate, 2 mm THF, 0.4 mm Ser [3-3H] Ser (33 Ci mmol−1), and the crude extract in a final volume of 100 μL. The enzyme assays were performed at 37°C for 20 min. Twenty-five microliters of the reaction mixture were streaked onto Whatman DE.81 paper. After drying the filter, unreacted Ser was removed by washing the filter three times for 20 min with 20 mL of water. The radioactivity associated with methylene THF was measured by liquid scintillation counting. ACKNOWLEDGMENTS The authors are grateful to Dr. Veronica Maurino (University of Cologne) for the kind provision of the modified pGREENII vector that was used for the CaMV 35S-driven overexpression of the wild-type SHM1 gene in the mutants. Momoko Minakawa is also acknowledged for assistance with plant cultures. LITERATURE CITED Barton MK, Poethig RS ( 1993 ) Formation of the shoot apical meristem in Arabidopsis thaliana—an analysis of development in the wild-type and in the shoot meristemless mutant. Development 119 : 823 –831 Bauwe H, Kolukisaoglu U ( 2003 ) Genetic manipulation of glycine decarboxylation. J Exp Bot 54 : 1523 –1535 Beckmann K, Dzuibany C, Biehler K, Fock H, Hell R, Migge A, Becker TW ( 1997 ) Photosynthesis and fluorescence quenching, and the mRNA levels of plastidic glutamine synthetase or of mitochondrial serine hydroxymethyltransferase (SHMT) in the leaves of the wild-type and of the SHMT-deficient stm mutant of Arabidopsis thaliana in relation to the rate of photorespiration. Planta 202 : 379 –386 Blackwell RD, Murray AJS, Lea PJ, Kendall AC, Hall NP, Turner JC, Wallsgrove RM ( 1988 ) The value of mutants unable to carry out photorespiration. Photosynth Res 16 : 155 –176 Blanc G, Wolfe KH ( 2003 ) A recent paleopolyploidy superimposed on older large-scale duplications in the Arabidopsis genome. Genome Res 13 : 137 –144 Blanc G, Wolfe KH ( 2004 ) Functional divergence of duplicated genes formed by polyploidy during Arabidopsis evolution. Plant Cell 16 : 1679 –1691 Boldt R, Edner C, Kolukisaoglu U, Hagemann M, Weckwerth W, Wienkoop S, Morgenthal K, Bauwe H ( 2005 ) d-Glycerate 3-kinase, the last unknown enzyme in the photorespiratory cycle in Arabidopsis, belongs to a novel kinase family. Plant Cell 17 : 2413 –2420 Bowes G, Ogren WL ( 1972 ) Oxygen inhibition and other properties of soybean ribulose 1,5-diphosphate carboxylase. J Biol Chem 247 : 2171 –2176 Bowes G, Ogren WL, Hageman RH ( 1971 ) Phosphoglycolate production catalyzed by ribulose diphosphate carboxylase. Biochem Biophys Res Commun 45 : 716 –722 Clough SJ, Bent AF ( 1998 ) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16 : 735 –743 Douce R, Neuburger M ( 1999 ) Biochemical dissection of photorespiration. Curr Opin Plant Biol 2 : 214 –222 Edwards K, Johnstone C, Thompson C ( 1991 ) A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res 19 : 1349 Geller AM, Kotb MY ( 1989 ) A binding assay for serine hydroxymethyltransferase. Anal Biochem 180 : 120 –125 Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM ( 2000 ) pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol Biol 42 : 819 –832 Höfgen R, Willmitzer L ( 1990 ) Biochemical and genetic analysis of different patatin isoforms expressed in various organs of potato (Solanum tuberosum). Plant Sci 66 : 221 –230 Jefferson RA ( 1989 ) The GUS reporter gene system. Nature 342 : 837 –838 Jefferson RA, Kavanagh TA, Bevan MW ( 1987 ) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6 : 3901 –3907 Konieczny A, Ausubel FM ( 1993 ) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based marker. Plant J 4 : 403 –410 Leegood RC, Lea PJ, Adcock MD, Häusler RE ( 1995 ) The regulation and control of photorespiration. J Exp Bot 46 : 1397 –1414 Liepman AH, Olsen LJ ( 2001 ) Peroxisomal alanine: glyoxylate aminotransferase (AGT1) is a photorespiratory enzyme with multiple substrates in Arabidopsis thaliana. Plant J 25 : 487 –498 Liepman AH, Olsen LJ ( 2003 ) Alanine aminotransferase homologs catalyze the glutamate:glyoxylate aminotransferase reaction in peroxisomes of Arabidopsis. Plant Physiol 131 : 215 –227 Linka M, Weber AP ( 2005 ) Shuffling ammonia between mitochondria and plastids during photorespiration. Trends Plant Sci 10 : 461 –465 Lister C, Dean C ( 1993 ) Recombinant inbred lines for mapping RFLP and phenotypic markers in Arabidopsis thaliana. Plant J 4 : 745 –750 Liu Y-G, Mitsukawa N, Oosumi T, Whittier RF ( 1995 ) Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 8 : 457 –463 Logemann J, Schell J, Willmitzer L ( 1987 ) Improved method for the isolation of RNA from plant tissues. Anal Biochem 163 : 16 –20 McClung CR, Hsu M, Painter JE, Gagne JM, Karlsberg SD, Salome PA ( 2000 ) Integrated temporal regulation of the photorespiratory pathway. Circadian regulation of two Arabidopsis genes encoding serine hydroxymethyltransferase. Plant Physiol 123 : 381 –391 Moreno JI, Martin R, Castresana C ( 2005 ) Arabidopsis SHMT1, a serine hydroxymethyltransferase that functions in the photorespiratory pathway influences resistance to biotic and abiotic stress. Plant J 41 : 451 –463 Ogren WL ( 1984 ) Photorespiration: pathways, regulation, and modification. Annu Rev Plant Biol 35 : 415 –442 Ogren WL, Bowes G ( 1971 ) Ribulose diphosphate carboxylase regulates soybean photorespiration. Nat New Biol 230 : 159 –160 Renné P, Dreßen U, Hebbeker U, Hille D, Flügge UI, Westhoff P, Weber APM ( 2003 ) The Arabidopsis mutant dct is deficient in the plastidic glutamate/malate translocator DiT2. Plant J 35 : 316 –331 Somerville CR ( 2001 ) An early Arabidopsis demonstration: resolving a few issues concerning photorespiration. Plant Physiol 125 : 20 –24 Somerville CR, Ogren WL ( 1981 ) Photorespiration-deficient mutants of Arabidopsis thaliana lacking mitochondrial serine transhydroxymethylase activity. Plant Physiol 67 : 666 –671 Somerville CR, Ogren WL ( 1982 ) Isolation of photorespiratory mutants in Arabidopsis thaliana. In M Edelman, RB Hallik, NH Chua, eds, Methods in Chloroplast Molecular Biology. Elsevier, Amsterdam, pp 129–138 Steinhauser D, Junker BH, Luedemann A, Selbig J, Kopka J ( 2004 a) Hypothesis-driven approach to predict transcriptional units from gene expression data. Bioinformatics 20 : 1928 –1939 Steinhauser D, Usadel B, Luedemann A, Thimm O, Kopka J ( 2004 b) CSB.DB: a comprehensive systems-biology database. Bioinformatics 20 : 3647 –3651 Weber A, Flügge UI ( 2002 ) Interaction of cytosolic and plastidic nitrogen metabolism in plants. J Exp Bot 53 : 865 –874 Weber A, Menzlaff E, Arbinger B, Gutensohn M, Eckerskorn C, Flügge UI ( 1995 ) The 2-oxoglutarate/malate translocator of chloroplast envelope membranes: molecular cloning of a transporter containing a 12-helix motif and expression of the functional protein in yeast cells. Biochemistry 34 : 2621 –2627 Wingler A, Lea PJ, Leegood RC ( 1999 ) Photorespiratory metabolism of glyoxylate and formate in glycine-accumulating mutants of barley and Amaranthus edulis. Planta 207 : 518 –526 Wingler A, Lea PJ, Quick WP, Leegood RC ( 2000 ) Photorespiration: metabolic pathways and their role in stress protection. Philos Trans R Soc Lond B Biol Sci 355 : 1517 –1529 Zimmermann P, Hirsch-Hoffmann M, Hennig L, Gruissem W ( 2004 ) GENEVESTIGATOR: Arabidopsis microarray database and analysis toolbox. Plant Physiol 136 : 2621 –2632 Author notes 1 This work was supported by the Deutsche Forschungsgemeinschaft (postdoctoral research fellowship to L.M.V. and grant no. WE2231/2–1 to A.P.M.W.), the National Science Foundation (grant no. MCB–0348074 to A.P.M.W.), and the U.S. Department of Agriculture (grant no. 2002–01392 to C.R.M.). 2 These authors contributed equally to the paper. * Corresponding author; e-mail [email protected]; fax 517–432–5294. The author responsible for distribution of materials integral to the findings presented in this article in accordance with journal policy described in the Instructions for Authors (http://www.plantphysiol.org) is: Andreas P.M. Weber ([email protected]). [W] The online version of this article contains Web-only data. [OA] Open Access articles can be viewed online without a subscription. Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.071399. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Desvoyes, Bénédicte; Ramirez-Parra, Elena; Xie, Qi; Chua, Nam-Hai; Gutierrez, Crisanto

doi: 10.1104/pp.105.071027pmid: 16361519

Abstract Organogenesis in plants is almost entirely a postembryonic process. This unique feature implies a strict coupling of cell proliferation and differentiation, including cell division, arrest, cell cycle reactivation, endoreplication, and differentiation. The plant retinoblastoma-related (RBR) protein modulates the activity of E2F transcription factors to restrict cell proliferation. Arabidopsis contains a single RBR gene, and its loss of function precludes gamete formation and early development. To determine the relevance of the RBR/E2F pathway during organogenesis, outside its involvement in cell division, we have used an inducible system to inactivate RBR function and release E2F activity. Here, we have focused on leaves where cell proliferation and differentiation are temporally and developmentally regulated. Our results reveal that RBR restricts cell division early during leaf development when cell proliferation predominates, while it regulates endocycle occurrence at later stages. Moreover, shortly after leaving the cell cycle, most of leaf epidermal pavement cells retain the ability to reenter the cell cycle and proliferate, but maintain epidermal cell fate. On the contrary, mesophyll cells in the inner layers do not respond in this way to RBR loss of activity. We conclude that there exists a distinct response of different cells to RBR inactivation in terms of maintaining the balance between cell division and endoreplication during Arabidopsis (Arabidopsis thaliana) leaf development. Cell division and growth depends on a series of coordinated events strictly regulated both temporally and spatially in individual cells. In addition, multicellularity imposes extra layers of regulation, most importantly on the balance between cell proliferation, arrest, and differentiation, in coordination with the ontogenic program. However, what the relevance is of pathways regulating cell proliferation for an appropriate developmental program or whether cell cycle regulators affect the appropriate differentiation pattern in a cell type-specific manner are questions still poorly understood. For example, in animals, where organogenetic processes occur embryonically, it was anticipated that key cell cycle regulators were required for embryonic development. However, recent studies have shown that, at least for some of them, this is not the case, e.g. cyclin-dependent kinase2 (Cdk2; Ortega et al., 2003), reinforcing the need to define the role of cell proliferation in the context of a developing organism. Contrary to the situation in animals, organogenesis in plants is almost entirely a postembryonic process. As a consequence, the production of new organs, e.g. roots, shoots, leaves, and flowers, relies on the continuous potential of particular sets of cells to proliferate and eventually undergo specific differentiation programs. Two plant-specific features make them remarkable. One is that such an organogenetic pattern extends over the entire life span of the organism, thus contributing to increase body architecture. Another is the ability of certain cells of yet unknown molecular characteristics to dedifferentiate, proliferate, and, in response to hormone signals or developmental cues, eventually generate a plethora of different cell types. Therefore, the investigation of links between cell cycle regulation and plant development can shed light on the importance of a strict balance between cell proliferation and differentiation during development. One key cell cycle regulatory pathway depends on the plant retinoblastoma-related (RBR) protein and the E2F/DP transcription factors (Gutierrez et al., 2002; De Veylder et al., 2003; Dewitte and Murray, 2003). Arabidopsis (Arabidopsis thaliana) contains a single RBR gene and a complex family of E2F/DP proteins (Vandepoele et al., 2002). Three E2F (named a, b, and c), homologs of human E2F1-5 (Attwooll et al., 2004), contain the typical domain organization, including DNA-binding, DP heterodimerization, transactivation, and RBR-binding domains (Shen, 2002). They heterodimerize with either of the two DP proteins (named a and b) to form an active transcription factor (Kosugi and Ohashi, 2002). E2Fa/DPa heterodimers act mainly as transcriptional activators and regulate cell proliferation and endoreplication (De Veylder et al., 2002; Kosugi and Ohashi, 2003). E2Fb, likely in cooperation with DPa, regulates the entry into S phase and mitosis and seems to be a target for transducing auxin signals into the cellular decision to proliferate or arrest and enter the endocycle program (Magyar et al., 2005). E2Fc is a transcriptional repressor abundant in arrested cells and, upon cell cycle stimulation, is rapidly targeted to the proteasome by an SCFSKP2 complex (del Pozo et al., 2002). The other three E2F (named d, e, and f), whose animal homologs are E2F7/8 (Attwooll et al., 2004), are atypical since they have a duplicated DNA-binding domain and do not heterodimerize with DP (Shen, 2002) or bind RBR (Ramirez-Parra et al., 2004). E2Fe, also known as DEL1, has been implicated in regulating the endocycle program (Vlieghe et al., 2005) and E2Ff in the control of cell growth and differentiation by regulating the expression of a subset of cell wall biogenesis genes (Ramirez-Parra et al., 2004). Genome-wide analyses have revealed that genes belonging to functional categories other than cell cycle and DNA replication control (Ramirez-Parra et al., 2003, 2004; Vlieghe et al., 2003; Vandepoele et al., 2005) are also E2F targets. RBR is required for cell proliferation arrest in tobacco (Nicotiana tabacum)-cultured cells (Gordon-Kamm et al., 2002) and during Arabidopsis gametophytic development (Ebel et al., 2004). Consistent with this, loss-of-function mutations in the RBR gene are lethal, precluding the assessment of its role in adult plants. Recently, expression of the tobacco NtRBR1 gene has been reduced using a virus-induced gene silencing approach (Park et al., 2005). These experimental conditions have allowed analyzing the effects of reducing NtRBR1 expression in organs formed above the infected leaf. Thus, the activity of the shoot apical meristem was arrested; the new leaves show growth retardation and abnormal development, and flower formation was severely retarded. Together, the data confirmed the importance of tobacco RBR in restricting cell division and also endoreplication in leaf cells (Park et al., 2005). Our aim is to define the role of Arabidopsis RBR protein during organ formation, and here we have focused on leaves to assess RBR function in the same developing organ where RBR activity is compromised. To this end, we have developed a targeted inactivation of the RBR/E2F pathway in a temporally controlled manner using an inducible system (Aoyama and Chua, 1997). Targeting RBR protein instead of AtRBR gene expression is a useful approach since RBR function depends most significantly on posttranslational modifications, one of the most relevant being phosphorylation by CDK/cyclin complexes (Nakagami et al., 1999, 2002; Boniotti and Gutierrez, 2001). This is thought to release the activity of RBR-bound E2F transcription factors (Gutierrez et al., 2002). Thus, the experimental rationale takes advantage of the use of ectopically expressing a plant DNA virus protein, the geminivirus RepA protein. RepA interacts efficiently with RBR through an LxCxE amino acid motif (Xie et al., 1995; Grafi et al., 1996; Xie et al., 1996), regulates viral DNA replication (Gutierrez, 2000), and has been used to address the role of RBR in proliferation of cultured cells (Gordon-Kamm et al., 2002). The interaction of virus RepA with RBR bypasses the normal activity of CDK/cyclin complexes that phosphorylate RBR and release E2F activity. Consequently, the system allows relieving the endogenous set of AtE2Fa/b/c from RBR repression in an inducible manner, a situation different from constitutive overexpression of single AtE2F genes previously reported (De Veylder et al., 2002; del Pozo et al., 2002; Magyar et al., 2005). Furthermore, the use of wild-type RepA and a point mutant in which RBR interaction is abolished (Xie et al., 1996) provides a useful approach to define aspects of RBR activity strictly dependent on the release of E2F factors. We have found that RBR restricts cell division during early leaf development when cell proliferation predominates. Shortly after the proliferative stage of leaf primordia, pavement cells retain their ability to proliferate but maintain their fate. On the contrary, other epidermal cell types, e.g. trichomes and stomata, do not change their proliferation state or fate specification, as it is also the case of mesophyll cells. At later stages, once the switch to the endocycle program has occurred, RBR largely restricts the progression through additional endocycles. Thus, we conclude that cells respond differently to RBR inactivation in terms of regulating their cell division and endoreplication potential during Arabidopsis leaf development. RESULTS Generation of Plants with Inducible Expression of a Geminivirus RBR-Binding Protein Geminivirus RepA is a viral protein that participates in viral DNA replication (Gutierrez, 2000; Hanley-Bowdoin et al., 2004). It binds RBR protein through a typical LxCxE amino acid motif, and mutations in this motif abolish RBR binding and efficient viral replication in cultured cells (Xie et al., 1995, 1996). It has been proposed that interaction with RBR allows the release of RBR-bound E2F activity to facilitate viral DNA replication (Gutierrez, 2000; Hanley-Bowdoin et al., 2004), based on the similarity with the interactions of animal oncoproteins and retinoblastoma protein (Lavia et al., 2003). We reasoned that a transgenic model where expression of RepA is controlled over time could be useful to target the inactivation of RBR and modulate local increases of endogenous E2F activity. In this way, we can evaluate the relevance of the RBR/E2F pathway in differentiating cells during organ development. To this end, we used a dexamethasone (Dex)-inducible system (Aoyama and Chua, 1997) to generate Arabidopsis transgenic plants that can express geminivirus RepA protein (RepAwt) in an inducible manner (Fig. 1A Figure 1. Open in new tabDownload slide Expression of the geminivirus RBR-binding RepA proteins in transgenic plants. A, Details of the constructs used to express the RepAwt and RepAE198K coding sequences in the Dex-inducible system (Aoyama and Chua, 1997). B, Western-blot analysis of RepA protein 7 h after induction with different concentrations of Dex (0–20 μm) in 10-d-old seedlings. Ten micrograms of protein were loaded in each lane. The bottom section is a region of the Coomassie-stained gel (molecular mass approximately 55 kD) used as loading control. C, Detection of RepAwt and RepAE198K after Dex treatment (20 μm, 20 h) in 10-d-old seedlings (20 μg protein per lane). The bottom section is the loading control as in B. D, Time course of RepAwt expression in 10-d-old seedlings (10 μg) after treatment with 20 μm Dex. The bottom section is the loading control as in B. Induction of RepAE198K protein followed a similar pattern. E, Stability of RepAwt protein after Dex treatment (1 μm). The bottom section is the loading control as in B. F, Detection of RepAwt in cross sections of leaves 3/4, 1 d after Dex treatment of control- and RepAwt-expressing plants to show that the viral protein accumulates in the epidermis as well as in the internal cell layers. Bars correspond to 50 μm. G, Phenotype at the rosette stage (18-d-old seedlings) of control (transformed with the empty vector) and transgenic plants expressing RepAwt or RepAE198K, 5 d after spraying with 1 μm Dex. The right sections show, from left to right, the two cotyledons and the first and second pairs of the leaves at the same magnification. Figure 1. Open in new tabDownload slide Expression of the geminivirus RBR-binding RepA proteins in transgenic plants. A, Details of the constructs used to express the RepAwt and RepAE198K coding sequences in the Dex-inducible system (Aoyama and Chua, 1997). B, Western-blot analysis of RepA protein 7 h after induction with different concentrations of Dex (0–20 μm) in 10-d-old seedlings. Ten micrograms of protein were loaded in each lane. The bottom section is a region of the Coomassie-stained gel (molecular mass approximately 55 kD) used as loading control. C, Detection of RepAwt and RepAE198K after Dex treatment (20 μm, 20 h) in 10-d-old seedlings (20 μg protein per lane). The bottom section is the loading control as in B. D, Time course of RepAwt expression in 10-d-old seedlings (10 μg) after treatment with 20 μm Dex. The bottom section is the loading control as in B. Induction of RepAE198K protein followed a similar pattern. E, Stability of RepAwt protein after Dex treatment (1 μm). The bottom section is the loading control as in B. F, Detection of RepAwt in cross sections of leaves 3/4, 1 d after Dex treatment of control- and RepAwt-expressing plants to show that the viral protein accumulates in the epidermis as well as in the internal cell layers. Bars correspond to 50 μm. G, Phenotype at the rosette stage (18-d-old seedlings) of control (transformed with the empty vector) and transgenic plants expressing RepAwt or RepAE198K, 5 d after spraying with 1 μm Dex. The right sections show, from left to right, the two cotyledons and the first and second pairs of the leaves at the same magnification. ). We also generated plants that expressed RepA containing a point mutation (E198K; RepAE198K) that almost completely abolished binding to RBR in vitro, impairing viral DNA replication (Xie et al., 1995). These constructs will allow us to determine the effects specifically associated with the RBR/E2F pathway in planta. Treatment with Dex has been shown to produce unspecific effects, especially early during development or seedling growth (Kang et al., 1999). Thus, we selected transgenic RepA plants that did not show macroscopical defects in the absence of Dex treatment. As a control we selected transgenic plants transformed with an empty vector. We evaluated the response to Dex treatment by determining the minimal Dex concentration necessary for a good induction of RepA expression. Since the protein level was not strongly dependent on the inducer concentration (Fig. 1B), we chose the lowest concentration (1 μm Dex) that repetitively gave a satisfactory induction for phenotypic studies of the transgenic plants. Figure 1C shows the results of representative lines where both wild-type and mutant RepA proteins could be readily detected in seedling extracts only after Dex treatment. This indicates that (1) any possible leakage of the induction system in the lines selected was below detectable levels, and (2) both wild-type and mutant RepA proteins accumulate after induction. Western-blotting analysis of whole-seedling extracts allowed detection of RepA as early as 7 h after induction, although the viral protein continues to accumulate at later times (Fig. 1D). We also carried out a time-course analysis of the presence of RepA after a single Dex treatment and found that high amounts of the protein were still detectable 5 d after induction (Fig. 1E). To determine the spatial distribution of RepA protein after Dex treatment, we detected the viral protein by immunofluorescence in cross sections of leaves. As shown in Figure 1F, RepA accumulates in all leaf cell layers after Dex treatment. We then analyzed the overall phenotype of the plants after induction of RepA expression, with particular emphasis on the leaves. Thirteen-day-old seedlings, containing the two cotyledons, the first pair of leaves, and the emerging second pair of leaves, were treated with Dex and analyzed 5 d afterward. Induction of RepAwt, but not RepAE198K, produced a drastic effect since leaves 3/4 in particular showed altered growth including downward curling (Fig. 1G). It is worth noting that leaves 1/2 showed some signs of senescence several days after Dex treatment. However, since these effects were not RBR dependent, as they were observed in both RepAwt- and RepAE198K-expressing plants, they were not further studied here. These data suggest that RepAwt may affect leaf development and that this effect was dependent on an intact RBR-binding motif in the viral protein, strongly suggesting that they may be mediated by the ectopic release of endogenous RBR-bound E2F activity. Targeting RBR with RepA Increases E2F Activity To test whether RepA was actually able to disrupt RBR/E2F interaction, we first addressed this possibility with a yeast three-hybrid protein approach (Egea-Cortines et al., 1999). We generated yeast cells expressing Arabidopsis RBR, fused to the GAL4 DNA-binding domain. Then, they were cotransformed with a plasmid that expressed each Arabidopsis E2F (a, b, and c) fused to the GAL activation domain (Fig. 2A Figure 2. Open in new tabDownload slide Disruption of RBR/E2F complexes in yeast and in planta. A, Effect of RepAwt and RepAE198K proteins on RBR/E2F interaction shown by yeast three-hybrid assay. Yeast cells expressing AtRBR-Gal4 DNA-binding domain (BD-RBR) were cotransformed, as indicated, with plasmids expressing the different AtE2F fused to the Gal4 activation domain (AD-E2F) or with the empty vector (AD), and with a vector (TFT) expressing RepAwt and RepAE198K proteins. All transformants grew normally in plates containing His (data not shown). The top sections show the growth of different transformants in selective medium (without His) at different dilutions. Galactosidase activity is shown in the bottom section and is expressed as Miller units. Data correspond to two independent experiments, which were carried out in triplicate. B, Detection of E2F DNA-binding activity in plant extracts by EMSA. Total protein extracts (15 μg) of the indicated transgenic plants, with or without Dex treatment, were incubated with a 32P-labeled double-stranded oligonucleotide containing a consensus E2F site (Ramirez-Parra and Gutierrez, 2000). Arrow points to E2F-DNA complexes. A 100-fold excess of the unlabeled probe was added as competitor (right section). Relative E2F DNA-binding activity (bottom section) was quantified using a GS-710 Calibrated Image densitometer (Bio-Rad). The analysis is based on three independent experiments. Bars show the sds. C, Expression levels of each of the six Arabidopsis E2F genes determined by real-time RT-PCR analysis in extracts of 10-d-old seedlings of controls (plants transformed with an empty vector) or transgenics expressing RepAwt and RepAE198K proteins. The analysis was carried out 7 h after treatment with Dex (20 μm). Values were first normalized to the amount of actin (AtACT2) and then made relative to the mRNA amount in the control. Figure 2. Open in new tabDownload slide Disruption of RBR/E2F complexes in yeast and in planta. A, Effect of RepAwt and RepAE198K proteins on RBR/E2F interaction shown by yeast three-hybrid assay. Yeast cells expressing AtRBR-Gal4 DNA-binding domain (BD-RBR) were cotransformed, as indicated, with plasmids expressing the different AtE2F fused to the Gal4 activation domain (AD-E2F) or with the empty vector (AD), and with a vector (TFT) expressing RepAwt and RepAE198K proteins. All transformants grew normally in plates containing His (data not shown). The top sections show the growth of different transformants in selective medium (without His) at different dilutions. Galactosidase activity is shown in the bottom section and is expressed as Miller units. Data correspond to two independent experiments, which were carried out in triplicate. B, Detection of E2F DNA-binding activity in plant extracts by EMSA. Total protein extracts (15 μg) of the indicated transgenic plants, with or without Dex treatment, were incubated with a 32P-labeled double-stranded oligonucleotide containing a consensus E2F site (Ramirez-Parra and Gutierrez, 2000). Arrow points to E2F-DNA complexes. A 100-fold excess of the unlabeled probe was added as competitor (right section). Relative E2F DNA-binding activity (bottom section) was quantified using a GS-710 Calibrated Image densitometer (Bio-Rad). The analysis is based on three independent experiments. Bars show the sds. C, Expression levels of each of the six Arabidopsis E2F genes determined by real-time RT-PCR analysis in extracts of 10-d-old seedlings of controls (plants transformed with an empty vector) or transgenics expressing RepAwt and RepAE198K proteins. The analysis was carried out 7 h after treatment with Dex (20 μm). Values were first normalized to the amount of actin (AtACT2) and then made relative to the mRNA amount in the control. ). These combinations allowed yeast growth in selective medium, indicating a strong and specific interaction of AtRBR and each of AtE2F. To evaluate whether RepA is able to disrupt RBR/E2F interactions, we cotransformed yeast cells with a third plasmid to express either RepAwt or RepAE198K (Fig. 2A; plasmid TFT). In the absence of E2F, neither wild-type nor mutant RepA proteins alone allowed yeast cell growth (data not shown). However, transforming the third plasmid expressing RepAwt, but not the RepAE198K, into yeast cells expressing AtRBR and each of the AtE2F largely impaired the strong growth in selective medium (Fig. 2A, top section). These data were confirmed by measuring β-galactosidase activity (Fig. 2A, bottom section). Therefore, we concluded that RepAwt, but not the point mutant impaired in RBR binding, is able to disrupt the interaction of Arabidopsis RBR and E2Fa, b, and c in yeast. To evaluate whether RepAwt could release endogenous E2F in planta, we determined E2F DNA-binding activity in extracts of control and transgenic plants with and without Dex treatment. E2F DNA-binding activity was determined by electrophoretic mobility shift assay (EMSA) using an oligonucleotide containing a consensus E2F-binding site. Induction of RepAwt, but not the RepAE198K mutant, produced a small but reproducible increase of E2F-binding activity in whole-cell extracts (Fig. 2B). Such binding activity was E2F specific, since it can be competed out with an excess of free probe (Fig. 2B) but not with a probe containing two point mutations that destroy the E2F-binding site (data not shown). Based on these data together, we conclude that RepAwt, but not the RepAE198K mutant, increases E2F DNA-binding activity in planta. To determine whether increased availability of E2F contributes to this stimulation, we determined by real-time reverse transcription (RT)-PCR the mRNA levels of the six Arabidopsis E2F genes in plants shortly after induction of the viral protein. Expression of two E2F genes, namely E2Fa and E2Fc, an activator and a repressor of cell proliferation, respectively (De Veylder et al., 2002; del Pozo et al., 2002), was up-regulated in these plants (Fig. 2C). This transcriptional activation was totally dependent on RBR inactivation, as indicated by the lack of effect observed when the RepAE198K mutant is expressed (Fig. 2C). Consequently, we conclude that the transcriptional activation of E2Fa and E2Fc expression likely contributes to the RBR inactivation-specific increase in E2F-DNA-binding activity in planta. Functional Inactivation of RBR Up-Regulates E2F Target Genes and Induces Cell Division in Differentiated Leaves We examined if the increase of E2F activity affected the expression of selected E2F target genes. Here, we focused on S-phase genes, e.g. PCNA, CDC6, CDT1, and members of the ORC (origin recognition complex), known to be regulated by E2F (Castellano et al., 2001; Egelkrout et al., 2001; Diaz-Trivino et al., 2005). We found that expression of these genes increased in the RepAwt-expressing plants but not in the plants expressing the RepAE198K mutant (Fig. 3A Figure 3. Open in new tabDownload slide Inactivation of RBR up-regulates the expression of a subset of E2F target genes and induces ectopic cell division. A, Expression level of the indicated E2F target genes determined by real-time RT-PCR analysis in extracts of 10-d-old seedlings of controls (plants transformed with an empty vector) or transgenics expressing RepAwt and RepAE198K proteins. The analysis was carried out 7 h after treatment with Dex (20 μm). Values were first normalized to the amount of Actin (AtACT2) and then made relative to the mRNA amount in the control. B to E, Control and transgenic plants were crossed with the cyclin B1;1-GUS marker lines (Colon-Carmona et al., 1999). Cyclin B1;1-GUS activity was detected 3 d after treating 16-d-old plants with Dex (1 μm) in the controls (B and D) and plants expressing RepAwt protein (C and E). The aerial parts around the shoot tip (B and C) and a region of leaves 1/2 (D and E) are shown. The inset in B shows a higher magnification of a growing leaf primordium showing scattered cyclin B1;1-GUS positive cells. Bars represent 50 μm. Figure 3. Open in new tabDownload slide Inactivation of RBR up-regulates the expression of a subset of E2F target genes and induces ectopic cell division. A, Expression level of the indicated E2F target genes determined by real-time RT-PCR analysis in extracts of 10-d-old seedlings of controls (plants transformed with an empty vector) or transgenics expressing RepAwt and RepAE198K proteins. The analysis was carried out 7 h after treatment with Dex (20 μm). Values were first normalized to the amount of Actin (AtACT2) and then made relative to the mRNA amount in the control. B to E, Control and transgenic plants were crossed with the cyclin B1;1-GUS marker lines (Colon-Carmona et al., 1999). Cyclin B1;1-GUS activity was detected 3 d after treating 16-d-old plants with Dex (1 μm) in the controls (B and D) and plants expressing RepAwt protein (C and E). The aerial parts around the shoot tip (B and C) and a region of leaves 1/2 (D and E) are shown. The inset in B shows a higher magnification of a growing leaf primordium showing scattered cyclin B1;1-GUS positive cells. Bars represent 50 μm. ). Previous studies have demonstrated the presence of E2F-binding sites in the promoter of genes belonging to various functional categories (Ramirez-Parra et al., 2003; Vlieghe et al., 2003; Vandepoele et al., 2005). We found that expression of some of these genes, in spite of containing E2F-binding sites in their promoters, was not increased by the presence of either RepAwt or RepAE198K (data not shown). Therefore, this analysis revealed that, under our experimental setting, expression of a subset of E2F target genes that play a role in cell cycle progression is up-regulated. To analyze if the increased expression of cell cycle genes affected cell division, we introduced by crossing a cell division marker into the different backgrounds. We used plants expressing a translational fusion of the β-glucuronidase (GUS) reporter gene with the destruction box of cyclin B1;1, a useful G2/M marker, since the reporter is expressed only in late G2 cells and destroyed in M phase, just as the cyclin B1;1 does (Colon-Carmona et al., 1999). GUS expression in control plants was detected in some cells of the shoot apical meristem and leaf primordia but not in mature leaves, as expected (Fig. 3, B and D). In the RepAwt background, after induction by Dex, we observed a stronger GUS expression in the leaf primordia and in the proximal zone of young leaves, indicating that more cells were entering mitosis (Fig. 3C). The increase in CYCB1;1-GUS expression was also confirmed by RT-PCR (data not shown). Moreover, scattered cells expressing GUS could also be detected in the fully differentiated first pair of leaves that had normally exited the cell proliferation program (Fig. 3E). CYCB1;1-directed GUS expression in the RepAE198K background was similar to that of the control, indicating that ectopic induction of cell division activity was dependent on RBR inactivation (data not shown). RBR-Mediated Regulation of the Endocycle Program Is Growth Stage Dependent Our data show that expression of cell cycle genes increases upon RepAwt induction, and a cell division marker is detected ectopically in fully differentiated leaves. The spatial and temporal pattern of cell division during leaf development indicates that a complex balance among leaf morphogenesis, tissue-specific patterns of cell proliferation, and cell differentiation occurs (Donnelly et al., 1999). The pattern of emergence of new leaves together with their time-dependent development offers the possibility to analyze, within the same developing seedling, the effects of altering RBR/E2F-mediated gene expression at early and late growth stages. Thus, at a given stage, e.g. 13-d-old seedlings, a significant amount of nuclei in the oldest leaves (nos. 1/2) have already undergone endocycles, whereas in leaves 3/4, at an earlier stage, cells are in the process to switch to the endocycle/differentiation program, as indicated by the small peak of 8C nuclei (Fig. 4, A and D Figure 4. Open in new tabDownload slide Inactivation of RBR induces endoreplication in late developing leaves. Nuclear DNA ploidy distribution of control, RepAwt, and RepAE198K transgenic plants before (13 das; A and D), 2 d (15 das; B and E), and 5 d (18 das; C and F) after treatment with Dex (1 μm). Flow cytometry measurements were carried out in the first (nos. 1/2; A–C) and second (nos. 3/4; D–F) pairs of leaves. The appearance of the developmental stage of representative RepAwt-expressing plants at the time of flow cytometry analysis is also included (middle sections). Figure 4. Open in new tabDownload slide Inactivation of RBR induces endoreplication in late developing leaves. Nuclear DNA ploidy distribution of control, RepAwt, and RepAE198K transgenic plants before (13 das; A and D), 2 d (15 das; B and E), and 5 d (18 das; C and F) after treatment with Dex (1 μm). Flow cytometry measurements were carried out in the first (nos. 1/2; A–C) and second (nos. 3/4; D–F) pairs of leaves. The appearance of the developmental stage of representative RepAwt-expressing plants at the time of flow cytometry analysis is also included (middle sections). ; see also Boudolf et al., 2004b; Castellano et al., 2004). We have found previously that overriding DNA replication initiation control was dependent on CDC6 and CDT1, two E2F target genes, and this has an effect on ploidy distribution in leaf nuclei (Castellano et al., 2001, 2004). Thus, we determined ploidy levels in the leaves of transgenic plants expressing either the wild-type or the mutant RepA proteins at different developmental stages. We treated 13-d-old plants with Dex and analyzed separately nuclear ploidy levels over time in leaves 1/2 and 3/4. Nuclei of leaves 1/2, already 2 d after Dex treatment, were stimulated to develop more endocycles, as indicated by the increase in the relative amount of nuclei with 16C and the appearance of a 32C nuclear population with a concomitant decrease of the 2C population (Fig. 4B). The same effect could be observed at 5 d after Dex treatment with an increase of the 32C nuclear population and the appearance of 64C nuclei (Fig. 4C). The enhancement of endoreplication required the participation of the RBR-E2F pathway since the RepAE198K mutant was not able to induce more endocycles (Fig. 4, B and C). Nuclei of leaves 3/4 showed only a slight enhancement of the endocycle program 2 d after treatment (Fig. 4E). Five days after treatment this effect could not be observed any more and the ploidy profile of RepAwt-producing plants was comparable to that of the controls (Fig. 4F). Therefore, leaf cells respond differently to RBR inactivation depending on the developmental stage. We also measured the expression level of the set of E2F target genes, shown in Figure 3A, in leaves 1/2 and 3/4 separately after RepA induction. These genes were up-regulated, although at different levels, in an LxCxE-dependent manner, in particular in leaves 1/2 (data not shown). Differences in the E2F-mediated regulation of PCNA gene expression depending on the leaf differentiation stage have been reported (Egelkrout et al., 2002). RBR Inactivation Alters Trichome Morphogenesis Early in leaf development, some cells in the primordia trigger a genetically defined morphogenetic pathway associated with the occurrence of endocycles. This is the case of trichomes, specialized leaf hairs located on the leaf surface with an enlarged and branched morphology and in which a rough correlation exists between nuclear ploidy and branch number (Hulskamp et al., 1999). In fact, trichome-forming cells undergo more endocycles and have more branches when CDC6 and CDT1 expression increases (Castellano et al., 2004). We asked whether expression of the viral RepA protein could alter trichome morphogenesis and, if so, whether such an effect was dependent on the inactivation of RBR. 4′,6-Diamino-phenylindole (DAPI) staining of trichome nuclei showed an increase in nuclear size of trichomes with more branches (see examples of three- to five-branched trichomes in Fig. 5A Figure 5. Open in new tabDownload slide Inactivation of RBR alters trichome morphology. Control, RepAwt, and RepAE198K transgenic plants were sprayed with 1 μm Dex 13 d after sowing and analyzed 5 d after treatment. A, Examples of trichomes with three to five branches under light microscopy (top sections) or fluorescence microcopy after DAPI staining (bottom sections). In the latter, the arrowheads point to the nuclei. Branch number distribution of trichomes in the first pair of leaves (nos. 1/2), n > 100 in at least eight leaves (B), and in the second pair of leaves (nos. 3/4), n > 350 in at least six leaves (C). Numbers represent the percentage of each class. Asterisks indicate statistically significant differences relative to the control (at least, P < 0.05). Figure 5. Open in new tabDownload slide Inactivation of RBR alters trichome morphology. Control, RepAwt, and RepAE198K transgenic plants were sprayed with 1 μm Dex 13 d after sowing and analyzed 5 d after treatment. A, Examples of trichomes with three to five branches under light microscopy (top sections) or fluorescence microcopy after DAPI staining (bottom sections). In the latter, the arrowheads point to the nuclei. Branch number distribution of trichomes in the first pair of leaves (nos. 1/2), n > 100 in at least eight leaves (B), and in the second pair of leaves (nos. 3/4), n > 350 in at least six leaves (C). Numbers represent the percentage of each class. Asterisks indicate statistically significant differences relative to the control (at least, P < 0.05). ). We scored the number of trichomes with different number of branches in leaves 1/2 and 3/4, 5 d after Dex treatment. We observed an increase in the amount of four- and five-branched trichomes, and this occurred exclusively upon RepAwt expression (Fig. 5, B and C), indicating that it was an RBR/E2F-mediated effect. RBR Inactivation Produces Hyperplasia in Young Leaves Constitutive overexpression of cell cycle activators (De Veylder et al., 2002; Dewitte et al., 2003) stimulate cell division in several Arabidopsis organs, including leaves. Conversely, ectopic expression of negative cell cycle regulators (De Veylder et al., 2001; del Pozo et al., 2002) reduces cell proliferation and cell number. Our results indicate that altering the E2F status by RBR inactivation might also have an effect on cell proliferation potential as revealed by the presence of cyclin B1-containing cells in differentiated leaves. Therefore, we analyzed leaves microscopically 5 d after the induction of either wild-type or mutant RepA using as controls plants transformed with an empty vector. As already mentioned, at this growth stage, leaves 1/2 have triggered the endocycle/differentiation program, whereas leaves 3/4 are switching to it (Boudolf et al., 2004b; Castellano et al., 2004; see also Fig. 4, A and D). DAPI staining of leaf nuclei of leaves 3/4 revealed the typical distribution of well-separated, relatively large nuclei in control plants as well as in those induced to express the RepAE198K protein (Fig. 6, A and C Figure 6. Open in new tabDownload slide Microscopic analysis of leaf epidermis of control, RepAwt, and RepAE198K transgenic plants. A to C, DAPI staining of the adaxial epidermis (leaf nos. 3/4). Note the large increase in the number of nuclei in the RepAwt plants. D to F, Cryo-scanning electron microscopy of the adaxial epidermis (nos. 3/4). Note the irregular surface of the leaf due to hyperplasia of the epidermis. D′ to F′, Close-up of D to F to show details of the clusters of small cells. G to I, DAPI staining of the adaxial epidermis (leaf nos. 1/2). Note that clusters of small cells do not appear. J to L, Light microscopy of the adaxial epidermis (leaf nos. 1/2). Note the absence of clusters of small cells, but instead the presence of ectopic cell wall dividing fully expanded pavement cells (arrows). Bars in all sections correspond to 50 μm. The study was carried out in the middle region of the leaf blade of 18-d-old plants 5 d after treatment with Dex (1 μm). Figure 6. Open in new tabDownload slide Microscopic analysis of leaf epidermis of control, RepAwt, and RepAE198K transgenic plants. A to C, DAPI staining of the adaxial epidermis (leaf nos. 3/4). Note the large increase in the number of nuclei in the RepAwt plants. D to F, Cryo-scanning electron microscopy of the adaxial epidermis (nos. 3/4). Note the irregular surface of the leaf due to hyperplasia of the epidermis. D′ to F′, Close-up of D to F to show details of the clusters of small cells. G to I, DAPI staining of the adaxial epidermis (leaf nos. 1/2). Note that clusters of small cells do not appear. J to L, Light microscopy of the adaxial epidermis (leaf nos. 1/2). Note the absence of clusters of small cells, but instead the presence of ectopic cell wall dividing fully expanded pavement cells (arrows). Bars in all sections correspond to 50 μm. The study was carried out in the middle region of the leaf blade of 18-d-old plants 5 d after treatment with Dex (1 μm). ). However, the leaf epidermis of plants expressing the RepAwt protein showed a large increase in the amount of small nuclei (Fig. 6B). These observations suggested that RepAwt was able to increase cell number in a RBR/E2F-dependent manner. To confirm this we analyzed, by scanning electron microscopy, leaf epidermis of plants treated in the same way. Now, it was more clearly observed that the leaf epidermis of plants expressing RepAwt contained clusters of small cells (Fig. 6, E and E′), which were not present in the controls (Fig. 6, D and D′) or in plants expressing the RepAE198K protein (Fig. 6, F and F′). We also analyzed the stomatal cells, which originate in the leaf epidermis by proliferation and further differentiation of cells of the stomatal lineage (Nadeau and Sack, 2003). Values of stomatal index are not very informative due to the large increase in nonstomatal cell number. In any case, we found that the stomatal number and morphology did not change significantly after induction of either RepAwt or RepAE198K. Altogether, these results indicate that E2F activation in leaves at the late proliferation stage has cell type-specific effects in the epidermis. Furthermore, only a subset of pavement cells can respond to ectopic activation of E2F activity leading to epidermal cell hyperplasia. The consequences of E2F activation in more differentiated leaves (nos. 1/2) were different. Clusters of small pavement cells were not observed (Fig. 6, G–I). Instead, some fully expanded pavement cells were able to divide once after RBR inactivation, as indicated by the appearance of a new cell wall (Fig. 6, J and K), an effect that was also mediated by the RBR/E2F pathway since it was not observed in plants expressing RepAE198K (Fig. 6, J and L). The appearance of this kind of division planes in fully expanded epidermal cells was also observed after constitutive overexpression of E2Fa/DPa (De Veylder et al., 2002) or GL2-directed expression of KRP1 (Weinl et al., 2005). Moreover, this appears to be a dead-end process, as the new cells do not seem to be able to divide, explaining the lack of clusters of small cells. We also examined epidermal cells of dark-grown hypocotyls that also undergo several endocycles. Again, in this case we did not observe hyperplasia after RBR inactivation (data not shown). Leaf Cell Layers Respond Differently to RBR Inactivation To ask whether RepA expression is able to induce cell division in other cell layers, we analyzed cross sections of leaves 3/4. This study confirmed that the leaf epidermis of plants after expression of RepAwt contained clusters of small cells (Fig. 7, B, B′, and B′′ Figure 7. Open in new tabDownload slide Microscopic analysis and cell distribution in the leaves of control, RepAwt, and RepAE198K transgenic plants. A to C, Cross sections of leaf number 3. Sections below (A′ to C′) are higher magnification of A to C. Arrow in B indicates anticlinal division in the adaxial epidermis. Arrowheads in B′ and B′′; indicate periclinal and anticlinal divisions, respectively. Bars correspond to 50 μm. D, Size of adaxial epidermal and mesophyll cells (leaf nos. 3/4), n > 600 cells. E, Cell density of adaxial epidermal and mesophyll cells (leaf nos. 3/4). F, Cell size distribution of adaxial epidermal cells (leaf nos. 3/4). The study was carried out in the middle region of the leaf blade of 18-d-old plants, 5 d after treatment with Dex (1 μm). Figure 7. Open in new tabDownload slide Microscopic analysis and cell distribution in the leaves of control, RepAwt, and RepAE198K transgenic plants. A to C, Cross sections of leaf number 3. Sections below (A′ to C′) are higher magnification of A to C. Arrow in B indicates anticlinal division in the adaxial epidermis. Arrowheads in B′ and B′′; indicate periclinal and anticlinal divisions, respectively. Bars correspond to 50 μm. D, Size of adaxial epidermal and mesophyll cells (leaf nos. 3/4), n > 600 cells. E, Cell density of adaxial epidermal and mesophyll cells (leaf nos. 3/4). F, Cell size distribution of adaxial epidermal cells (leaf nos. 3/4). The study was carried out in the middle region of the leaf blade of 18-d-old plants, 5 d after treatment with Dex (1 μm). ) that were not present in the controls (Fig. 7, A and A′) or in plants expressing the RepAE198K mutant (Fig. 7, C and C′). However, the morphology and number of cells in the internal cell layers did not appreciably change in any of the situations analyzed. While the average cell size of the adaxial epidermal cell layer decreased approximately 4-fold, with a concomitant increase in cell number, none of these changes was observed in the mesophyll (Fig. 7, D and E). Furthermore, the cell size distribution of leaf epidermal cells clearly indicates that a rather homogeneous population of small cells was produced in an RBR/E2F-dependent manner (Fig. 7F). We repeated these analyses, treating with Dex by watering instead of by spraying, and obtained essentially the same results (data not shown). Altogether, these data indicate that RepAwt, but not the RepAE198K mutant protein, was able to induce hyperplasia detectable even just a few days after induction and that this effect is cell layer specific. Therefore, we conclude that different cell layers respond differently to RBR inactivation. This likely reflects distinct physiological states in terms of cell division potential, as discussed below. DISCUSSION Plant organogenesis requires an appropriate balance between cell proliferation and differentiation (Gutierrez, 2005). Here, we have determined the relevance of the RBR/E2F pathway during Arabidopsis leaf development. Conditional inactivation of RBR function has been achieved using inducible expression of RepA, a geminivirus protein that interacts with RBR in an LxCxE-dependent manner (Xie et al., 1995, 1996). This increase in E2F activity occurred by relieving RBR-mediated repression of any of the three AtE2Fa to c factors with RBR-binding capacity (Gutierrez et al., 2002; Shen, 2002), which in turn activates a set of E2F target genes. Comparable studies in mice have demonstrated that retinoblastoma inactivation recapitulates all the phenotypes associated with HPV E7 oncoprotein-mediated activation of E2F (Balsitis et al., 2003). A large body of evidence points to RBR/E2F interactions as a major pathway affected by viral LxCxE-containing proteins. However, it should be kept in mind that the function of cellular RBR-binding proteins that use an LxCxE motif may also be affected. In any case, our results establish that inducible expression of the geminivirus RBR-binding RepA protein is a useful approach to evaluate the relevance of RBR inactivation during organogenesis in adult plants. Studies to address the role of RBR using an RNAi approach (W. Gruissem, personal communication) have yielded results consistent with ours. Therefore, we can conclude that the RBR/E2F pathway is a major player in regulating the balance between cell proliferation, endocycle program, and differentiation, but its relevance depends on the developmental stage, the tissue, and the cell type. Distinct Impact of the RBR/E2F Pathway during Leaf Development The increase in cell division and endoreplication are two phenotypic features of E2F activation, a consequence of transcriptional reprogramming, as suggested by an up-regulation of a set of E2F target genes. An overall role for E2Fa/DPa in controlling proliferation and endoreplication has been reported (De Veylder et al., 2002; Kosugi and Ohashi, 2003). Overexpression of upstream regulators of the pathway, e.g. cycD3;1, produces hyperplasia, reduces polyploidy, and prevents proper differentiation (Dewitte et al., 2003). Conversely, overexpression of CDK inhibitors produces hypoplasia and a reduction in endoreplication (Wang et al., 2000; De Veylder et al., 2001; Schnittger et al., 2003). However, it should be kept in mind that the effects of CDK inhibitors on endoreplication are dose dependent (Verkest et al., 2005; Weinl et al., 2005). In a different system, maize (Zea mays) endosperm, CDK inhibitors have also shown to play a role in controlling endoreplication (Coelho et al., 2005). Previous constitutive overexpression approaches preclude the identification of temporally dependent effects. With our inducible approach, we found that the relevance of the RBR/E2F pathway depends on the developmental stage. In young leaves (nos. 3/4 at 13 d after sowing [das]), when most cell proliferation is about to finish, inactivating RBR stimulates cell division and leads to epidermal hyperplasia. This is likely a consequence of the activation of E2F targets involved in G1/S and, probably, G2/M transitions. In fact, expression of a dominant negative version of CDKB1;1, an E2F target that functions in G2, suppresses the E2Fa/DPa-mediated hyperplasia (Boudolf et al., 2004b). On the contrary, in older leaves (nos. 1/2 at 13 das), when most cells have switched to the endocycle program, more endocycles are produced instead of producing hyperplasia. It has been reported recently that the endoreplication phenotype, but not the ectopic division phenotype, observed in E2Fa/DPa overexpressing plants is counteracted by overexpression of DEL1, also known as E2Fe (Vlieghe et al., 2005). Thus, it would be important to identify E2F target genes that play specific or shared roles in cell proliferation and endoreplication. Our results provide new insights into two aspects of cell division dynamics during leaf development: One refers to the proliferative potential of cells in different cell layers and another to the relevance of the RBR/E2F pathway in regulating the cell proliferation/differentiation balance. In particular, cells in the leaf epidermis follow different fates giving rise to pavement cells, trichomes, and stomata. While pavement cells and trichomes endoreplicate, cells of the stomatal lineage remain with a 2C DNA content. Most of the discussion in the previous section refers to pavement cells, and below we discuss aspects related to the other cell types. Trichomes derive from cells that early in the primordia initiate their differentiation program associated with the occurrence of several endocycles (Hulskamp et al., 1999). In our experimental setting, these cells whose fate was specified early in leaf development have already switched to the endocycle program when E2F is activated. Thus, the increase observed in trichome branching suggests that more endocycles were induced. Conversely, ectopic expression of cycB1;2 in trichomes early during fate specification and before the switch to the endocycle program leads to multicellular trichomes and trichome clusters, as a result of precursor cell division (Schnittger et al., 2002). Meristemoids, precursor cells of the stomatal lineage, retain their proliferative potential (Nadeau and Sack, 2003). However, the amount of stomata, indicative of cell division in stomatal precursor cells, does not increase in plants overexpressing constitutively E2Fa/DPa (De Veylder et al., 2002), CYCD3;1 (Dewitte et al., 2003), or under our conditions. Furthermore, the same occurs in plants overexpressing CDKB1;1, an E2F target gene required for proper stomatal development (Boudolf et al., 2004a, 2004b). We cannot exclude that the extra small cells that we observed in the epidermis are derived from stomatal precursors. Even if this were the case, we can conclude that inactivation of RBR at the developmental stage at which we have carried out the experiments prevents full differentiation of these cells into stomata. However, Park et al. (2005) have reported that abolishing tobacco NtRBR1 expression by virus-induced gene silencing leads to the appearance of stomatal clusters. In this report, RBR-specific, E2F-dependent effects cannot be separated from E2F-independent effects. Furthermore, tobacco NtRBR1 expression was abolished even before leaf primordia start to develop. The available data also suggest that restriction of cell division in stomatal precursors may be regulated by additional mechanisms. One of them may be licensing of DNA replication since constitutive AtCDC6 or AtCDT1 overexpression increases the stomatal index (Castellano et al., 2004). In any case, further restriction mechanisms, currently unknown, may operate since, under those conditions, only a doubling in the amount of stomata occurs, indicative of just one extra division to produce secondary meristemoids (Castellano et al., 2004). Previous reports of epidermis-specific effects in cell proliferation further support our proposal. Overexpression of STRUWWELPETER (SWP) produces clusters of small cells in the leaf epidermis together with scattered fully expanded pavement cells (Autran et al., 2002), a phenotype strikingly similar to that observed by us. It is tempting to speculate that the possible function of SWP in transcription (Autran et al., 2002) may be related to that of RBR/E2F complexes. Tobacco plants silenced for the NtDEK gene, a calpain homolog, exhibit extended cell proliferation capacity and reduction of cell differentiation in the epidermis, whereas the internal cells are less affected (Ahn et al., 2004). This phenotype could be, at least in part, an indirect consequence of altering the RBR/E2F pathway since a set of cell cycle genes is transcriptionally up-regulated in these plants (Ahn et al., 2004). The consequences of altering the levels of individual components of the RBR/E2F pathway have been described in several reports. Constitutive overexpression of AtCYCD3 (Dewitte et al., 2003) or of AtE2Fa/DPa (De Veylder et al., 2002) produces hyperplasia not only in epidermal but also in mesophyll cells. Likewise, overexpression of KRP2 leads to a reduction in cell number in different leaf cell layers (De Veylder et al., 2001). However, we have observed that RBR inactivation by overexpressing RepA in young leaves (nos. 3/4) stimulates cell proliferation in the epidermis but not in the mesophyll. These data are consistent with the observation that cell division potential lasts for longer in epidermal cells than in mesophyll cells (Donnelly et al., 1999). Similar effects have also been recently reported after reducing mRNA levels of RBR by virus-induced gene silencing (Park et al., 2005). This indicates that overexpressing single components of the pathway is substantially different from RBR inactivation. In this case, the endogenous amounts of RBR-bound E2F activity are released, and the effects are likely the consequence of the balanced action of several E2F. The possibility that other RBR-specific but E2F-independent pathways also occur cannot presently be ruled out. Implications for Geminivirus Replication Geminivirus DNA replication and infection require a number of cellular functions that are subverted by viral proteins (Gutierrez, 2000; Hanley-Bowdoin et al., 2004). One of them is the interference with the RBR/E2F pathway. In one geminivirus genus (Mastrevirus), this is mediated by the RepA protein through an LxCxE RBR-interaction motif (Xie et al., 1995, 1996). In the other geminivirus genera, which do not encode a homolog RepA, it is mediated by a different amino acid motif in another protein, Rep (Kong et al., 2000). These mechanisms are responsible for the up-regulation of cellular genes required for viral DNA replication, most of which are E2F targets (Hanley-Bowdoin et al., 2004). Geminivirus infection also induces nuclear DNA replication (Nagar et al., 2002), but this does not lead to activation of the cell division program. This implies that, with the exception of members of the genus Curtovirus, which encode the C4 protein able to induce local hyperplasia (Latham et al., 1997), progression through G2 and M is restricted in the infected leaf cell. The interaction of viral Rep protein with a kinesin-like motor protein (Kong and Hanley-Bowdoin, 2002) may serve to prevent progression through M and favor the occurrence of endocycles, as suggested by the increase in nuclear volume (Bass et al., 2000). Our data shed light onto this aspect since RepA induces endoreplication or cell division in an RBR-dependent manner, but depending on the developmental stage and the cell type. Future refinement of the approach used here will allow addressing some of these possibilities by the temporally controlled expression of different combinations of viral proteins. MATERIALS AND METHODS Plant Material and Transgenic Lines To generate transgenic plants, the coding regions of RepAwt and RepAE198K in plasmids pBWRepA and pBWRepAE198K (Xie et al., 1995) were inserted in the pTA7002 vector (Aoyama and Chua, 1997). The constructs were introduced into Agrobacterium tumefaciens (C58C1 strain). Arabidopsis plants (Arabidopsis thaliana ecotype Landsberg erecta) were transformed by the floral dip method (Clough and Bent, 1998). Plants transformed with an empty vector were used as controls. Selection of transgenic plants was achieved by plating on Murashige and Skoog agar plates containing 25 μg/mL hygromycine. Homozygous plants were selected and the T4 was used for analysis. For phenotype analysis, seeds of control, RepAwt, and RepAE198K were grown directly in soil and maintained in a growth chamber at 22°C with a 16-h photoperiod. At day 13, plants were sprayed with a solution of 1 μm Dex (Sigma) to induce the expression of the transgene. Application of Dex was repeated 2 d later. Antibodies and Western-Blot Assay Antibodies against RepA protein were produced in rabbit using 50 μg of glutathione S-transferase-RepA mixed with complete Freund adjuvant. For analysis of RepA expression, homozygous plants were grown in Murashige and Skoog agar plate for 10 d and then transferred to Murashige and Skoog liquid medium containing Dex (1–20 μm during 0–20 h, as indicated). Total proteins were extracted in 50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 5 mm MgCl2, 0.2% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride. RepA protein was detected by immunoblotting using a chemiluminescent procedure (ECLplus western-blot detection system; Amersham Bioscience). Real-Time PCR Analysis Total RNA was extracted using Trizol reagent (Invitrogen) and RT-PCR was carried out with the ThermoScript RT system (Invitrogen) using 500 ng of RNA as template and polydT primers. The LightCycler System with the FastStart DNA Master Green I (Roche) was used. The amount of actin (AtACT2) mRNA was determined to normalize for differences of total RNA amount. The data were generated from duplicate of three independent experiments. Primer sequences will be provided upon request. Protein Interaction and EMSA Plasmids pGBT-AtRBR, pGAD-AtE2Fa, b, and c were generated by cloning the full-length AtRBR (At3g12280), AtE2Fa (At2g31060), AtE2Fb (At5g22220), and AtE2Fc (At1g47870) coding sequences in-frame into the pGBT8 and pACT2 vectors (CLONTECH), respectively. Plasmids were transformed in the yeast HF7c strain, and the assays were carried out as described (Ramirez-Parra and Gutierrez, 2000). To express the third protein, the RepAwt and RepAE198K coding sequences were cloned into the pTFT1 vector (Egea-Cortines et al., 1999). Quantification of β-galactosidase assay was done in liquid culture using o-nitrophenyl-β-d-galactopyranoside (Sigma) as substrate, as described (Miller, 1972). Protein extracts for EMSA were prepared as described (Hurford et al., 1997) in a buffer containing 20 mm HEPES, pH 7.6, 0.5 m KCl, 1.5 mm MgCl2, 0.2 mm EDTA, 1 mm dithiothreitol, 20% glycerol, 0.2% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, and protease and phosphatase inhibitors. Then they were dialyzed against EMSA buffer (20 mm Tris-HCl, pH 7.5, 50 mm KCl, 1 mm EDTA, 1 mm MgCl2, 1 mm dithiothreitol, and 12% glycerol). EMSA was carried out with 15 μg of total protein as described previously (Ramirez-Parra and Gutierrez, 2000). Flow-Cytometry Analysis The first (nos. 1/2) and second (nos. 3/4) pairs of leaves were harvested at 13, 15, and 18 das and chopped with a razor blade in 400 μL of nuclear isolation buffer (Galbraith et al., 1991). The suspension was filtered over 100 μm and a 30 μm nylon mesh, treated with RNaseA (200 μg/mL), and stained with propidium iodine (50 μg/mL). The nuclear DNA content was analyzed with a FACScalibur flow cytometer (BD Biosciences). Microscopic Analysis Tissues were placed in a solution of chloralhydrate, phenol, and lactic acid (2:1:1, w/w/w) and mounted for light microscopy observation. Samples were observed with an Axioskop2 Plus microscope (Zeiss), and the images were processed with the ImageJ software for cell size measurement. For nuclear visualization the leaves were destained overnight in ethanol, stained with DAPI (0.1 mg/mL) for 2 h, and mounted in phosphate-buffered saline (PBS)-glycerol 50% for observation. For histological observation of leaf sections, tissues were vacuum infiltrated and fixed overnight in a solution of PBS, pH 7.4, 4% paraformaldehyde, 2.5% glutaraldehyde, 0.1% Tween 20, 0.1% Triton X-100. After washing, samples were dehydrated and embedded in an Epoxy resin (TAAB 812). Semithin sections (1–2 μm) were stained with toluidine blue and observed as above. For immunofluorescence analysis, leaves were vacuum infiltrated with PBS, pH 7.4, 4% paraformaldehyde, 0.2% glutaraldehyde, 0.1% Tween 20, 0.1% Triton X-100, and then fixed overnight in a solution of PBS 4% paraformaldehyde. Tissues were then washed with PBS, soaked during 3 d in a solution of PBS-Suc 30%, and embedded in O.C.T. medium (Tissue-Tek). Cryostat sections (30 μm) were labeled with anti-RepA antibodies and anti rabbit-fluorescein isothiocyanate (Invitrogen). Observations were performed with a confocal Microradiance microscope (Zeiss). Cryo-scanning electron microscopy was carried on fresh leaves frozen in liquid nitrogen (CryoTrans Oxford CT1500). ACKNOWLEDGMENTS Authors are indebted to M.B. Boniotti for developing RepA antisera, Sergio Llorens-Berzosa for technical assistance, M.T. Rejas for cross sections for microscopical analysis, and C. Ascaso and F. Pinto for help with the scanning electron microscopy. We also thank H. Sommer for the TFT plasmids, P. Doerner for the cycB1-GUS marker line, and M.B. Boniotti and E. Martinez-Salas for insightful comments on the manuscript. LITERATURE CITED Ahn JW, Kim M, Lim JH, Kim GT, Pai HS ( 2004 ) Phytocalpain controls the proliferation and differentiation fates of cells in plant organ development. Plant J 38 : 969 –981 Aoyama T, Chua NH ( 1997 ) A glucocorticoid-mediated transcriptional induction system in transgenic plants. Plant J 11 : 605 –612 Attwooll C, Denchi EL, Helin K ( 2004 ) The E2F family: specific functions and overlapping interests. EMBO J 23 : 4709 –4716 Autran D, Jonak C, Belcram K, Beemster GT, Kronenberger J, Grandjean O, Inze D, Traas J ( 2002 ) Cell numbers and leaf development in Arabidopsis: a functional analysis of the STRUWWELPETER gene. EMBO J 21 : 6036 –6049 Balsitis SJ, Sage J, Duensing S, Munger K, Jacks T, Lambert PF ( 2003 ) Recapitulation of the effects of the human papillomavirus type 16 E7 oncogene on mouse epithelium by somatic Rb deletion and detection of pRb-independent effects of E7 in vivo. Mol Cell Biol 23 : 9094 –9103 Bass HW, Nagar S, Hanley-Bowdoin L, Robertson D ( 2000 ) Chromosome condensation induced by geminivirus infection of mature plant cells. J Cell Sci 113 : 1149 –1160 Boniotti MB, Gutierrez C ( 2001 ) A cell-cycle-regulated kinase activity phosphorylates plant retinoblastoma protein and contains, in Arabidopsis, a CDKA/cyclin D complex. Plant J 28 : 341 –350 Boudolf V, Barroco R, Engler Jde A, Verkest A, Beeckman T, Naudts M, Inze D, De Veylder L ( 2004 a) B1-type cyclin-dependent kinases are essential for the formation of stomatal complexes in Arabidopsis thaliana. Plant Cell 16 : 945 –955 Boudolf V, Vlieghe K, Beemster GT, Magyar Z, Acosta JA, Maes S, Van Der Schueren E, Inze D, De Veylder L ( 2004 b) The plant-specific cyclin-dependent kinase CDKB1;1 and transcription factor E2Fa-DPa control the balance of mitotically dividing and endoreduplicating cells in Arabidopsis. Plant Cell 16 : 2683 –2692 Castellano MM, Boniotti MB, Caro E, Schnittger A, Gutierrez C ( 2004 ) DNA replication licensing affects cell proliferation or endoreplication in a cell type-specific manner. Plant Cell 16 : 2380 –2393 Castellano MM, del Pozo JC, Ramirez-Parra E, Brown S, Gutierrez C ( 2001 ) Expression and stability of Arabidopsis CDC6 are associated with endoreplication. Plant Cell 13 : 2671 –2686 Clough SJ, Bent AF ( 1998 ) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16 : 735 –743 Coelho CM, Dante RA, Sabelli PA, Sun Y, Dilkes BP, Gordon-Kamm WJ, Larkins BA ( 2005 ) Cyclin-dependent kinase inhibitors in maize endosperm and their potential role in endoreduplication. Plant Physiol 138 : 2323 –2336 Colon-Carmona A, You R, Haimovitch-Gal T, Doerner P ( 1999 ) Technical advance: spatio-temporal analysis of mitotic activity with a labile cyclin-GUS fusion protein. Plant J 20 : 503 –508 De Veylder L, Beeckman T, Beemster GT, de Almeida Engler J, Ormenese S, Maes S, Naudts M, Van Der Schueren E, Jacqmard A, Engler G, et al ( 2002 ) Control of proliferation, endoreduplication and differentiation by the Arabidopsis E2Fa-DPa transcription factor. EMBO J 21 : 1360 –1368 De Veylder L, Beeckman T, Beemster GT, Krols L, Terras F, Landrieu I, van der Schueren E, Maes S, Naudts M, Inze D ( 2001 ) Functional analysis of cyclin-dependent kinase inhibitors of Arabidopsis. Plant Cell 13 : 1653 –1668 De Veylder L, Joubes J, Inze D ( 2003 ) Plant cell cycle transitions. Curr Opin Plant Biol 6 : 536 –543 del Pozo JC, Boniotti MB, Gutierrez C ( 2002 ) Arabidopsis E2Fc functions in cell division and is degraded by the ubiquitin-SCF(AtSKP2) pathway in response to light. Plant Cell 14 : 3057 –3071 Dewitte W, Murray JA ( 2003 ) The plant cell cycle. Annu Rev Plant Biol 54 : 235 –264 Dewitte W, Riou-Khamlichi C, Scofield S, Healy JM, Jacqmard A, Kilby NJ, Murray JA ( 2003 ) Altered cell cycle distribution, hyperplasia, and inhibited differentiation in Arabidopsis caused by the D-type cyclin CYCD3. Plant Cell 15 : 79 –92 Diaz-Trivino S, Castellano MM, Sanchez MP, Ramirez-Parra E, Desvoyes B, Gutierrez C ( 2005 ) The genes encoding Arabidopsis ORC subunits are E2F targets and the two ORC1 genes are differently expressed in proliferating and endoreplicating cells. Nucleic Acids Res 33 : 5404 –5414 Donnelly PM, Bonetta D, Tsukaya H, Dengler RE, Dengler NG ( 1999 ) Cell cycling and cell enlargement in developing leaves of Arabidopsis. Dev Biol 215 : 407 –419 Ebel C, Mariconti L, Gruissem W ( 2004 ) Plant retinoblastoma homologues control nuclear proliferation in the female gametophyte. Nature 429 : 776 –780 Egea-Cortines M, Saedler H, Sommer H ( 1999 ) Ternary complex formation between the MADS-box proteins SQUAMOSA, DEFICIENS and GLOBOSA is involved in the control of floral architecture in Antirrhinum majus. EMBO J 18 : 5370 –5379 Egelkrout EM, Mariconti L, Settlage SB, Cella R, Robertson D, Hanley-Bowdoin L ( 2002 ) Two E2F elements regulate the proliferating cell nuclear antigen promoter differently during leaf development. Plant Cell 14 : 3225 –3236 Egelkrout EM, Robertson D, Hanley-Bowdoin L ( 2001 ) Proliferating cell nuclear antigen transcription is repressed through an E2F consensus element and activated by geminivirus infection in mature leaves. Plant Cell 13 : 1437 –1452 Galbraith DW, Harkins KR, Knapp S ( 1991 ) Systemic endopolyploidy in Arabidopsis thaliana. Plant Physiol 96 : 985 –989 Gordon-Kamm W, Dilkes BP, Lowe K, Hoerster G, Sun X, Ross M, Church L, Bunde C, Farrell J, Hill P, Maddock S, et al ( 2002 ) Stimulation of the cell cycle and maize transformation by disruption of the plant retinoblastoma pathway. Proc Natl Acad Sci USA 99 : 11975 –11980 Grafi G, Burnett RJ, Helentjaris T, Larkins BA, DeCaprio JA, Sellers WR, Kaelin WG Jr ( 1996 ) A maize cDNA encoding a member of the retinoblastoma protein family: involvement in endoreduplication. Proc Natl Acad Sci USA 93 : 8962 –8967 Gutierrez C ( 2000 ) Geminiviruses and the plant cell cycle. Plant Mol Biol 43 : 763 –772 Gutierrez C ( 2005 ) Coupling cell proliferation and development in plants. Nat Cell Biol 7 : 535 –541 Gutierrez C, Ramirez-Parra E, Castellano MM, del Pozo JC ( 2002 ) G(1) to S transition: more than a cell cycle engine switch. Curr Opin Plant Biol 5 : 480 –486 Hanley-Bowdoin L, Settlage SB, Robertson D ( 2004 ) Reprogramming plant gene expression: a prerequisite to geminivirus DNA replication. Mol Plant Pathol 5 : 149 –156 Hulskamp M, Schnittger A, Folkers U ( 1999 ) Pattern formation and cell differentiation: trichomes in Arabidopsis as a genetic model system. Int Rev Cytol 186 : 147 –178 Hurford RK Jr, Cobrinik D, Lee MH, Dyson N ( 1997 ) pRB and p107/p130 are required for the regulated expression of different sets of E2F responsive genes. Genes Dev 11 : 1447 –1463 Kang HG, Fang Y, Singh KB ( 1999 ) A glucocorticoid-inducible transcription system causes severe growth defects in Arabidopsis and induces defense-related genes. Plant J 20 : 127 –133 Kong LJ, Hanley-Bowdoin L ( 2002 ) A geminivirus replication protein interacts with a protein kinase and a motor protein that display different expression patterns during plant development and infection. Plant Cell 14 : 1817 –1832 Kong LJ, Orozco BM, Roe JL, Nagar S, Ou S, Feiler HS, Durfee T, Miller AB, Gruissem W, Robertson D, et al ( 2000 ) A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J 19 : 3485 –3495 Kosugi S, Ohashi Y ( 2002 ) Interaction of the Arabidopsis E2F and DP proteins confers their concomitant nuclear translocation and transactivation. Plant Physiol 128 : 833 –843 Kosugi S, Ohashi Y ( 2003 ) Constitutive E2F expression in tobacco plants exhibits altered cell cycle control and morphological change in a cell type-specific manner. Plant Physiol 132 : 2012 –2022 Latham JR, Saunders K, Pinner MS, Stanley J ( 1997 ) Induction of plant cell division by beet curly top virus gene C4. Plant J 6 : 1273 –1283 Lavia P, Mileo AM, Giordano A, Paggi MG ( 2003 ) Emerging roles of DNA tumor viruses in cell proliferation: new insights into genomic instability. Oncogene 22 : 6508 –6516 Magyar Z, De Veylder L, Atanassova A, Bako L, Inze D, Bogre L ( 2005 ) The role of the Arabidopsis E2FB transcription factor in regulating auxin-dependent cell division. Plant Cell 17 : 2527 –2541 Miller JH ( 1972 ) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Nadeau JA, Sack FD ( 2003 ) Stomatal development: cross talk puts mouths in place. Trends Plant Sci 8 : 294 –299 Nagar S, Hanley-Bowdoin L, Robertson D ( 2002 ) Host DNA replication is induced by geminivirus infection of differentiated plant cells. Plant Cell 14 : 2995 –3007 Nakagami H, Kawamura K, Sugisaka K, Sekine M, Shinmyo A ( 2002 ) Phosphorylation of retinoblastoma-related protein by the cyclin D/cyclin-dependent kinase complex is activated at the G1/S-phase transition in tobacco. Plant Cell 14 : 1847 –1857 Nakagami H, Sekine M, Murakami H, Shinmyo A ( 1999 ) Tobacco retinoblastoma-related protein phosphorylated by a distinct cyclin-dependent kinase complex with Cdc2/cyclin D in vitro. Plant J 18 : 243 –252 Ortega S, Prieto I, Odajima J, Martin A, Dubus P, Sotillo R, Barbero JL, Malumbres M, Barbacid M ( 2003 ) Cyclin-dependent kinase 2 is essential for meiosis but not for mitotic cell division in mice. Nat Genet 35 : 25 –31 Park JA, Ahn JW, Kim YK, Kim SJ, Kim JK, Kim WT, Pai HS ( 2005 ) Retinoblastoma protein regulates cell proliferation, differentiation, and endoreduplication in plants. Plant J 42 : 153 –163 Ramirez-Parra E, Frundt C, Gutierrez C ( 2003 ) A genome-wide identification of E2F-regulated genes in Arabidopsis. Plant J 33 : 801 –811 Ramirez-Parra E, Gutierrez C ( 2000 ) Characterization of wheat DP, a heterodimerization partner of the plant E2F transcription factor which stimulates E2F-DNA binding. FEBS Lett 486 : 73 –78 Ramirez-Parra E, Lopez-Matas MA, Frundt C, Gutierrez C ( 2004 ) Role of an atypical E2F transcription factor in the control of Arabidopsis cell growth and differentiation. Plant Cell 16 : 2350 –2363 Schnittger A, Schobinger U, Stierhof YD, Hulskamp M ( 2002 ) Ectopic B-type cyclin expression induces mitotic cycles in endoreduplicating Arabidopsis trichomes. Curr Biol 12 : 415 –420 Schnittger A, Weinl C, Bouyer D, Schobinger U, Hulskamp M ( 2003 ) Misexpression of the cyclin-dependent kinase inhibitor ICK1/KRP1 in single-celled Arabidopsis trichomes reduces endoreduplication and cell size and induces cell death. Plant Cell 15 : 303 –315 Shen WH ( 2002 ) The plant E2F-Rb pathway and epigenetic control. Trends Plant Sci 7 : 505 –511 Vandepoele K, Raes J, De Veylder L, Rouze P, Rombauts S, Inze D ( 2002 ) Genome-wide analysis of core cell cycle genes in Arabidopsis. Plant Cell 14 : 903 –916 Vandepoele K, Vlieghe K, Florquin K, Hennig L, Beemster GT, Gruissem W, Van de Peer Y, Inze D, De Veylder L ( 2005 ) Genome-wide identification of potential plant E2F target genes. Plant Physiol 139 : 316 –328 Verkest A, Manes CL, Vercruysse S, Maes S, Van Der Schueren E, Beeckman T, Genschik P, Kuiper M, Inze D, De Veylder L ( 2005 ) The cyclin-dependent kinase inhibitor KRP2 controls the onset of the endoreduplication cycle during Arabidopsis leaf development through inhibition of mitotic CDKA;1 kinase complexes. Plant Cell 17 : 1723 –1736 Vlieghe K, Boudolf V, Beemster GT, Maes S, Magyar Z, Atanassova A, de Almeida Engler J, De Groodt R, Inze D, De Veylder L ( 2005 ) The DP-E2F-like gene DEL1 controls the endocycle in Arabidopsis thaliana. Curr Biol 15 : 59 –63 Vlieghe K, Vuylsteke M, Florquin K, Rombauts S, Maes S, Ormenese S, Van Hummelen P, Van de Peer Y, Inze D, De Veylder L ( 2003 ) Microarray analysis of E2Fa-DPa-overexpressing plants uncovers a cross-talking genetic network between DNA replication and nitrogen assimilation. J Cell Sci 116 : 4249 –4259 Wang H, Zhou Y, Gilmer S, Whitwill S, Fowke LC ( 2000 ) Expression of the plant cyclin-dependent kinase inhibitor ICK1 affects cell division, plant growth and morphology. Plant J 24 : 613 –623 Weinl C, Marquardt S, Kuijt SJ, Nowack MK, Jakoby MJ, Hulskamp M, Schnittger A ( 2005 ) Novel functions of plant cyclin-dependent kinase inhibitors, ICK1/KRP1, can act non-cell-autonomously and inhibit entry into mitosis. Plant Cell 17 : 1704 –1722 Xie Q, Sanz-Burgos AP, Hannon GJ, Gutierrez C ( 1996 ) Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins. EMBO J 15 : 4900 –4908 Xie Q, Suarez-Lopez P, Gutierrez C ( 1995 ) Identification and analysis of a retinoblastoma binding motif in the replication protein of a plant DNA virus: requirement for efficient viral DNA replication. EMBO J 14 : 4073 –4082 Author notes 1 This work was supported by the Spanish Ministry of Science and Technology (grant no. BMC2003–2131), by the Comunidad Autonoma de Madrid (grant no. 07B-53–2002), and by an institutional grant from Fundación Ramón Areces. 2 Present address: Laboratory of Plant Molecular Signaling, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Anding Menwai, Beijing 100101, China. * Corresponding author; e-mail [email protected]; fax 34–91–497–4799. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Crisanto Gutierrez ([email protected]). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.071027. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Gouget, Anne; Senchou, Virginie; Govers, Francine; Sanson, Arnaud; Barre, Annick; Rougé, Pierre; Pont-Lezica, Rafael; Canut, Hervé

doi: 10.1104/pp.105.066464pmid: 16361528

Abstract Interactions between plant cell walls and plasma membranes are essential for cells to function properly, but the molecules that mediate the structural continuity between wall and membrane are unknown. Some of these interactions, which are visualized upon tissue plasmolysis in Arabidopsis (Arabidopsis thaliana), are disrupted by the RGD (arginine-glycine-aspartic acid) tripeptide sequence, a characteristic cell adhesion motif in mammals. In planta induced-O (IPI-O) is an RGD-containing protein from the plant pathogen Phytophthora infestans that can disrupt cell wall-plasma membrane adhesions through its RGD motif. To identify peptide sequences that specifically bind the RGD motif of the IPI-O protein and potentially play a role in receptor recognition, we screened a heptamer peptide library displayed in a filamentous phage and selected two peptides acting as inhibitors of the plasma membrane RGD-binding activity of Arabidopsis. Moreover, the two peptides also disrupted cell wall-plasma membrane adhesions. Sequence comparison of the RGD-binding peptides with the Arabidopsis proteome revealed 12 proteins containing amino acid sequences in their extracellular domains common with the two RGD-binding peptides. Eight belong to the receptor-like kinase family, four of which have a lectin-like extracellular domain. The lectin domain of one of these, At5g60300, recognized the RGD motif both in peptides and proteins. These results imply that lectin receptor kinases are involved in protein-protein interactions with RGD-containing proteins as potential ligands, and play a structural and signaling role at the plant cell surfaces. In plants, proteins connecting the cell wall, the plasma membrane, and the cytoskeleton are believed to participate in a monitoring system that is required for the perception and transduction of environmental and developmental signals (Wyatt and Carpita, 1993). The continuum between wall, membrane, and cytoplasm is important not only for cell growth (Schindler et al., 1989) and cell differentiation (Roberts and Haigler, 1989) but also during abiotic and biotic stress (Levitt, 1983; Zhu et al., 1993), when the continuum has to function properly. During pathogen attack, for example, disruption of cell wall-plasma membrane adhesions may lead to a reduction of cell wall-associated defense responses, thereby making the plant more susceptible to disease (Lee-Stadelmann et al., 1984; Mellersh and Heath, 2001). The cell wall also may transmit chemical signals that direct specific developmental pathways, and some of these signals are thought to arise from the wall itself (Berger et al., 1994; McCabe et al., 1997). Other cues that are mechanical in origin, such as relaxation of the cell wall, can influence cell behavior (Lintilhac and Vesecky, 1984; Fleming et al., 1997). In all events, the cell wall and the plasma membrane act as the functional interface for chemical and mechanical signal exchange. A variety of proteins have the potential to mediate wall-membrane interactions. Examples are arabinogalactan proteins, cellulose synthases, and endo-1-4-β-d-glucanases (Kohorn, 2000). Also, the wall-associated kinases (WAKs) have been described to physically link the plasma membrane to the plant cell wall. The WAK extracellular domain is variable between the five isoforms found in Arabidopsis (Arabidopsis thaliana), but all contain at least two epidermal growth factor repeats and a cytoplasmic kinase. This suggests that the plasma membrane-cell wall interacting molecules not only have a structural role through their extracellular domains but also a signaling role through their cytoplasmic domains, and can thus act in the communication between the apoplasm and the cytoplasm (Kohorn, 2001). However, evidence for a role of these proteins in the physical continuum between the cell wall and the plasma membrane is still lacking. Adhesions between the cell wall and the plasma membrane during plasmolysis of Arabidopsis suspension cells were described previously (Canut et al., 1998). The cytoplasm and plasma membrane remained attached to the cell wall at some points, resulting in concave pockets. Such adhesions could be disrupted by the application of synthetic peptides containing the RGD (Arg-Gly-Asp) tripeptide motif, a cell adhesion motif present in several mammalian extracellular matrix proteins. Recently, we showed that plants have proteins with RGD-binding activity (Senchou et al., 2004). We found an 80-kD Arabidopsis plasma membrane protein that specifically binds to RGD-containing peptides and, in addition, shows high affinity binding to in planta induced-O (IPI-O), an RGD-containing protein secreted by the oomycete plant pathogen Phytophthora infestans. The 80-kD Arabidopsis plasma membrane protein recognizes IPI-O via its RGD motif, and, similar to RGD-peptides, IPI-O is able to disrupt plasma membrane-cell wall adhesions. The aim of this study was to identify RGD-binding proteins in plants. As a first step, we used phage display as a tool to select peptides capable of interacting with the RGD tripeptide motif of the IPI-O protein. Combinatorial phage display peptide libraries provide powerful molecular tools to study protein-protein interactions, and they have been used extensively to discover bioactive peptides and ligands for receptors and to characterize enzymes (Bernal and Willats, 2004). The phage library we used here displayed a large repertoire of randomized heptapeptides expressed at the surface of M13 bacteriophages in the context of a coat protein. Two RGD-binding peptides were identified, and their sequence led to the identification of 12 proteins that were considered as candidates for natural RGD-binding proteins. Eight of these belong to the large family of receptor-like kinases (RLKs) in Arabidopsis. In this study, we show that the lectin receptor kinase (LecRK) encoded by At5g60300 is a potential interacting molecule involved in plasma membrane-cell wall adhesions. The possibility that RGD-containing proteins act as ligands for LecRK in plants is discussed. RESULTS Screening a Phage Library for Peptides Binding to IPI-O To find peptides capable of interacting with the RGD tripeptide motif in IPI-O protein, we screened a combinatorial phage display peptide library. Recombinant maltose-binding protein (MBP)-IPI-O protein was immobilized by adsorption onto microtiter plates saturated with bovine serum albumin (BSA). A suspension of the phage library was preincubated with BSA to eliminate phages expressing BSA-binding peptides and subsequently incubated in the coated microtiter plates (Fig. 1A Figure 1. Open in new tabDownload slide Selection of phages displaying random heptamer peptides that interact with the RGD sequence of the IPI-O protein. A, The library of phage-displayed peptides preincubated with BSA was incubated into microtiter plates coated with the IPI-O protein (lobster claw; first step). B, After extensive washing to remove unbound phages, competition with an RGD-containing peptide (broken square) was carried out to release a specific subset of the bound phages (second step). C, After a single round of bio-panning selection, 36 phages were randomly picked and the inserts were sequenced. The three different heptapeptides obtained are shown with their frequency. Figure 1. Open in new tabDownload slide Selection of phages displaying random heptamer peptides that interact with the RGD sequence of the IPI-O protein. A, The library of phage-displayed peptides preincubated with BSA was incubated into microtiter plates coated with the IPI-O protein (lobster claw; first step). B, After extensive washing to remove unbound phages, competition with an RGD-containing peptide (broken square) was carried out to release a specific subset of the bound phages (second step). C, After a single round of bio-panning selection, 36 phages were randomly picked and the inserts were sequenced. The three different heptapeptides obtained are shown with their frequency. ). Given the relatively large size of the MBP-IPI-O fusion protein and the expected high number of potential peptide-binding sites in the protein for random peptides, we performed an elution with the RGDS peptide to specifically select phages that bind to the RGD tripeptide motif in IPI-O (Fig. 1B). Only a single round of selection was performed. Of the 36 phage plaques that were selected for sequence analysis, the majority, i.e. 28, expressed the peptide IHQASYY, seven the peptide AAQPHPR, and only one TPILTTD (Fig. 1C). These three peptides were used for further analysis. Two Peptides Act as Inhibitors of RGD-Binding Activity in Arabidopsis The three peptides, selected from the phage display library, were assayed for their ability to interfere with RGD binding to Arabidopsis plasma membrane proteins. In a previous study, we used photoaffinity cross-linking of RGD-containing peptides to demonstrate that an 80-kD plasma membrane protein in Arabidopsis has RGD-binding activity (Senchou et al., 2004). If we assume that the sequences of the peptides expressed by the selected phages occur in plasma membrane proteins and as such participate in the recognition of an RGD motif, then these peptides should inhibit the binding of an RGD-containing photoaffinity probe to its target, i.e. the 80-kD plasma membrane protein. Therefore, we synthesized the IHQASYY, AAQPHPR, and TPILTTD peptides and tested them using photoaffinity assays (Fig. 2A Figure 2. Open in new tabDownload slide Photoaffinity labeling of plasma membrane proteins from Arabidopsis with an azido RGD heptapeptide derivative, and effect of the RGD-binding heptapeptides selected by phage display. Plasma membrane proteins were separated in SDS-11% polyacrylamide gels after photolysis of the radioiodinated RGD-photoaffinity probe as described in “Materials and Methods.” Autoradiography revealed label associated with a protein of 80 kD. To quantify cross-linking, gel slices corresponding to the 80-kD polypeptide were excised and γ counted. The values of remaining label are indicated below each band as percentages of the control that was set at 100% in each independent experiment. Fifty micrograms of protein were deposited in each lane. A, Competition by isolated RGD-binding heptapeptides (IHQASYY, TPILTTD, AAQPHPR), a c-myc peptide with unrelated sequence (EQKLISEEDL; each peptide was applied at the concentration of 100 μm), and wild-type and mutated (-D56A, -D56E) MBP-IPI-O proteins (each protein was applied at the concentration of 0.3 μm). B, Competition by the two active RGD-binding heptapeptides (AAQPHPR and IHQASYY) and derived tetrapeptides. Each peptide was applied at the concentration of 100 μm. Figure 2. Open in new tabDownload slide Photoaffinity labeling of plasma membrane proteins from Arabidopsis with an azido RGD heptapeptide derivative, and effect of the RGD-binding heptapeptides selected by phage display. Plasma membrane proteins were separated in SDS-11% polyacrylamide gels after photolysis of the radioiodinated RGD-photoaffinity probe as described in “Materials and Methods.” Autoradiography revealed label associated with a protein of 80 kD. To quantify cross-linking, gel slices corresponding to the 80-kD polypeptide were excised and γ counted. The values of remaining label are indicated below each band as percentages of the control that was set at 100% in each independent experiment. Fifty micrograms of protein were deposited in each lane. A, Competition by isolated RGD-binding heptapeptides (IHQASYY, TPILTTD, AAQPHPR), a c-myc peptide with unrelated sequence (EQKLISEEDL; each peptide was applied at the concentration of 100 μm), and wild-type and mutated (-D56A, -D56E) MBP-IPI-O proteins (each protein was applied at the concentration of 0.3 μm). B, Competition by the two active RGD-binding heptapeptides (AAQPHPR and IHQASYY) and derived tetrapeptides. Each peptide was applied at the concentration of 100 μm. ). The IHQASYY and AAQPHPR peptides clearly blocked cross-linking of an iodinated azido-RGD heptapeptide to the 80-kD polypeptide: Less than one-quarter of the label (24% and 22%, respectively) was linked to the 80-kD plasma membrane protein, and this inhibitory activity was in the same range as that of the recombinant MBP-IPI-O protein (29%). In contrast, the mutated MBP-IPI-O-D56A and -D56E proteins, as well as the TPILTTD peptide, did not inhibit cross-linking of the RGD heptapeptide. It should be noted that the two inhibitory peptides were those found with the highest frequency in the phage display selection and it is therefore likely that these two peptides, IHQASYY and AAQPHPR, have RGD-binding properties. Comparison of the RGD-Binding Peptides with Arabidopsis Protein Sequences The sequences of the two RGD-binding peptides, IHQASYY and AAQPHPR, were compared to protein sequences present in the Arabidopsis genome database. First, we selected Arabidopsis proteins containing at least one transmembrane domain and a signal peptide, i.e. plasma membrane proteins, and looked for the presence of the RGD-binding sequences in their extracellular domains. When searching with the full-length heptapeptide sequences, or partial hexa- and pentapeptide sequences, no hit was obtained. Only with tetrapeptides was a number of proteins with matching sequences found (in total 14 hits corresponding to 12 proteins, of which eight belong to the large family of RLKs in Arabidopsis; Shiu and Bleecker, 2001). The results are summarized in Table I Table I. Arabidopsis plasma membrane proteins sharing amino acid sequences found in the RGD-binding peptides The sequence source was the Munich Information Center for Protein Sequences Arabidopsis thaliana Genome Database. PSORT and TMHMM programs were used for the prediction of signal peptides and transmembrane domains. Identification of protein families and domains was performed using the Plant Receptor Kinase Resource (Shiu and Bleecker, 2001), and the Pfam and InterPro databases (Mulder et al., 2003; Bateman et al., 2004). The amino acids identical to those found in the phage sequence are shown in bold. Proteins . Sequences . Proteins selected from the IHQASYY sequence     At1g07550 RLK (LRR) AVKNI QASYGLNRI     At5g39000 RLK (CrRLK1L) ASFTA QASYQESGV     At1g16380 putative cation-proton exchanger, CPA2 subfamily (AtCHX1) LQKDS ASYYIFFSF     At3g21630 RLK (LysM) CPLAL ASYYLENGT     At3g45330 RLK (L-Lectin) VESAS ASYYSDKEG     At3g45390 RLK (L-Lectin) VVSAS ASYYSDREG     At5g60300 RLK (L-Lectin) VAIAS ASYYSDMKG     At5g60310 RLK (L-Lectin) VGTAS ASYYSDIKG Proteins selected from the AAQPHPR sequence     At5g06050 unknown function GYFVW AAQPVYKHE     At1g10540 putative permease (AtNAT8) KQEDL QPHPVKDQL     At5g10290 RLK (LRR) NCGGR QPHPCVSAV     At1g73810 unknown function WSRRG PHPRKYTTR     At5g60300 RLK (L-Lectin) KLPEV PHPRAPHKK     At5g60310 RLK (L-Lectin) RLPEV PHPRAEHKN Proteins . Sequences . Proteins selected from the IHQASYY sequence     At1g07550 RLK (LRR) AVKNI QASYGLNRI     At5g39000 RLK (CrRLK1L) ASFTA QASYQESGV     At1g16380 putative cation-proton exchanger, CPA2 subfamily (AtCHX1) LQKDS ASYYIFFSF     At3g21630 RLK (LysM) CPLAL ASYYLENGT     At3g45330 RLK (L-Lectin) VESAS ASYYSDKEG     At3g45390 RLK (L-Lectin) VVSAS ASYYSDREG     At5g60300 RLK (L-Lectin) VAIAS ASYYSDMKG     At5g60310 RLK (L-Lectin) VGTAS ASYYSDIKG Proteins selected from the AAQPHPR sequence     At5g06050 unknown function GYFVW AAQPVYKHE     At1g10540 putative permease (AtNAT8) KQEDL QPHPVKDQL     At5g10290 RLK (LRR) NCGGR QPHPCVSAV     At1g73810 unknown function WSRRG PHPRKYTTR     At5g60300 RLK (L-Lectin) KLPEV PHPRAPHKK     At5g60310 RLK (L-Lectin) RLPEV PHPRAEHKN Open in new tab Table I. Arabidopsis plasma membrane proteins sharing amino acid sequences found in the RGD-binding peptides The sequence source was the Munich Information Center for Protein Sequences Arabidopsis thaliana Genome Database. PSORT and TMHMM programs were used for the prediction of signal peptides and transmembrane domains. Identification of protein families and domains was performed using the Plant Receptor Kinase Resource (Shiu and Bleecker, 2001), and the Pfam and InterPro databases (Mulder et al., 2003; Bateman et al., 2004). The amino acids identical to those found in the phage sequence are shown in bold. Proteins . Sequences . Proteins selected from the IHQASYY sequence     At1g07550 RLK (LRR) AVKNI QASYGLNRI     At5g39000 RLK (CrRLK1L) ASFTA QASYQESGV     At1g16380 putative cation-proton exchanger, CPA2 subfamily (AtCHX1) LQKDS ASYYIFFSF     At3g21630 RLK (LysM) CPLAL ASYYLENGT     At3g45330 RLK (L-Lectin) VESAS ASYYSDKEG     At3g45390 RLK (L-Lectin) VVSAS ASYYSDREG     At5g60300 RLK (L-Lectin) VAIAS ASYYSDMKG     At5g60310 RLK (L-Lectin) VGTAS ASYYSDIKG Proteins selected from the AAQPHPR sequence     At5g06050 unknown function GYFVW AAQPVYKHE     At1g10540 putative permease (AtNAT8) KQEDL QPHPVKDQL     At5g10290 RLK (LRR) NCGGR QPHPCVSAV     At1g73810 unknown function WSRRG PHPRKYTTR     At5g60300 RLK (L-Lectin) KLPEV PHPRAPHKK     At5g60310 RLK (L-Lectin) RLPEV PHPRAEHKN Proteins . Sequences . Proteins selected from the IHQASYY sequence     At1g07550 RLK (LRR) AVKNI QASYGLNRI     At5g39000 RLK (CrRLK1L) ASFTA QASYQESGV     At1g16380 putative cation-proton exchanger, CPA2 subfamily (AtCHX1) LQKDS ASYYIFFSF     At3g21630 RLK (LysM) CPLAL ASYYLENGT     At3g45330 RLK (L-Lectin) VESAS ASYYSDKEG     At3g45390 RLK (L-Lectin) VVSAS ASYYSDREG     At5g60300 RLK (L-Lectin) VAIAS ASYYSDMKG     At5g60310 RLK (L-Lectin) VGTAS ASYYSDIKG Proteins selected from the AAQPHPR sequence     At5g06050 unknown function GYFVW AAQPVYKHE     At1g10540 putative permease (AtNAT8) KQEDL QPHPVKDQL     At5g10290 RLK (LRR) NCGGR QPHPCVSAV     At1g73810 unknown function WSRRG PHPRKYTTR     At5g60300 RLK (L-Lectin) KLPEV PHPRAPHKK     At5g60310 RLK (L-Lectin) RLPEV PHPRAEHKN Open in new tab . The 12 proteins are all suitable candidates able to recognize and bind RGD tripeptide motifs in proteins, especially the RGD motif in IPI-O. To further investigate the significance of these proteins, we selected one candidate for further studies. We choose At5g60300 for several reasons: first, because it is a member of the RLK family that comprises the majority the candidates (eight out of 12); and, second, because At5g60300 contains not only the ASYY motif, the most represented sequence that was selected in the phage display, but also the second most represented sequence, PHPR. Each of these tetrapeptides could bind the RGD motif of IPI-O independently in the phage display experiment, and their inhibitory activity of these tetrapeptides was confirmed by photoaffinity assays (Fig. 2B). The ASYY and PHPR tetrapeptides blocked cross-linking of an RGD-containing photoaffinity probe to the 80-kD plasma membrane protein: The inhibition was 67% and 27%, respectively. In contrast, the IHQA and AAQP tetrapeptides had no effect. The third reason is that the UNIGENE database at National Center for Biotechnology Information (www.ncbi.nlm.nih.gov) reported several full-length mRNAs and expressed sequence tags isolated from different plant tissues for At5g60300. In contrast, no expressed sequence tag was found for At5g60310, the RLK family member that also contains both motifs. Finally, the extracellular domain of At5g60300 appeared to be a legume-type lectin. Because of already known structures of legume lectins, a structural characterization of At5g60300 by molecular modeling was feasible. At5g60300 Is a RLK with a Legume-Type Lectin Extracellular Domain As deduced from its amino acid sequence, At5g60300 obviously belongs to the class of Ser/Thr-kinase receptors with a legume-type lectin extracellular domain. The extracellular lectin domain and the intracellular kinase domain are connected to a central hydrophobic transmembrane helix by two linker regions (Fig. 3A Figure 3. Open in new tabDownload slide Schematic representations of the lectin-like receptor kinase encoded by At5g60300. A, The NH2-terminal signal peptide is displayed as a gray box: It is presumably absent in the mature protein. The legume lectin domain is composed of 13 β-strands (black boxes) that form antiparallel β-sheets. The transmembrane domain is shown as a gray box (TM). The 12 subdomains of the kinase region are numbered in Roman numerals (I–XI). The amino acid sequences found in the isolated phage-displayed peptides are given above. B, Ribbon diagram of the modeled lectin-like domain of At5g60300 showing the overall β-sandwich fold organized in a flattened back face of a six-stranded β-sheet connected by turns and loops to a curved front face of a seven-stranded β-sheet. β-Strands are represented by yellow arrows, and coil structures are colored green. The additional extended loop (open star) contains a short α-helical stretch (colored red). Residues Ser-152, Tyr-153, and Tyr-154 (magenta ball-and-sticks) involved in the recognition of the RGD motif of IPI-O are located in an exposed loop connecting strand β8 to β9. The location of the putative carbohydrate-binding site is indicated (★). Strand β1 could participate in the dimerization of the lectin-like domain of At5g60300. C, Ribbon diagram of the modeled Ser/Thr-kinase domain of At5g30600 built up from a small β-rich N-terminal lobe (top part) connected to a large α-helical C-terminal lobe (bottom part). ATP (magenta CPK, Corey-Pauling-Koltun) is docked into the catalytic cavity located at the interface of the two lobes. D, Sagital view of the modeled lectin-like domain showing the location of the Asn residues belonging to the possibly glycosylated putative N-glycosylation sites. E, Molecular surface of the modeled lectin-like domain showing the location of the RGD-binding site S-Y-Y (colored magenta), the putative N-glycosylation sites (colored blue), and the apparently inactive carbohydrate-binding cavity (★). The lectin-like domain is similarly oriented in D and E. Figure 3. Open in new tabDownload slide Schematic representations of the lectin-like receptor kinase encoded by At5g60300. A, The NH2-terminal signal peptide is displayed as a gray box: It is presumably absent in the mature protein. The legume lectin domain is composed of 13 β-strands (black boxes) that form antiparallel β-sheets. The transmembrane domain is shown as a gray box (TM). The 12 subdomains of the kinase region are numbered in Roman numerals (I–XI). The amino acid sequences found in the isolated phage-displayed peptides are given above. B, Ribbon diagram of the modeled lectin-like domain of At5g60300 showing the overall β-sandwich fold organized in a flattened back face of a six-stranded β-sheet connected by turns and loops to a curved front face of a seven-stranded β-sheet. β-Strands are represented by yellow arrows, and coil structures are colored green. The additional extended loop (open star) contains a short α-helical stretch (colored red). Residues Ser-152, Tyr-153, and Tyr-154 (magenta ball-and-sticks) involved in the recognition of the RGD motif of IPI-O are located in an exposed loop connecting strand β8 to β9. The location of the putative carbohydrate-binding site is indicated (★). Strand β1 could participate in the dimerization of the lectin-like domain of At5g60300. C, Ribbon diagram of the modeled Ser/Thr-kinase domain of At5g30600 built up from a small β-rich N-terminal lobe (top part) connected to a large α-helical C-terminal lobe (bottom part). ATP (magenta CPK, Corey-Pauling-Koltun) is docked into the catalytic cavity located at the interface of the two lobes. D, Sagital view of the modeled lectin-like domain showing the location of the Asn residues belonging to the possibly glycosylated putative N-glycosylation sites. E, Molecular surface of the modeled lectin-like domain showing the location of the RGD-binding site S-Y-Y (colored magenta), the putative N-glycosylation sites (colored blue), and the apparently inactive carbohydrate-binding cavity (★). The lectin-like domain is similarly oriented in D and E. ). The modeled lectin domain of At5g60300 exhibits the typical β-sandwich fold of the legume lectins, which consists of a flattened six-stranded β-sheet (back face) connected by turns and loops to an incurved seven-stranded β-sheet (front face; Fig. 3B). The lectin domain differs from the canonical legume lectin three-dimensional scaffold by the occurrence of an additional extended loop of 17 amino acid residues and a higher degree of N-glycosylation. Seven putative N-glycosylation sites, Asn-36-Ala-Ser, Asn-104-Ala-Ser, Asn-108-Gly-Ser, Asn-161-Glu-Ser, Asn-184-Val-Ser, Asn-205-Leu-Thr, and Asn-212-Arg-Ser, occur along the amino acid sequence of the lectin-like domain (Fig. 3D). With the exception of the buried Asn-184-Val-Ser and Asn-212-Arg-Ser, all other putative N-glycosylation sites are nicely exposed to the solvent and are expected to be glycosylated. Even though Asn-161-Glu-Ser does not occur in a loop region but is located at the beginning of strand β9, it is sufficiently exposed to be glycosylated (Fig. 3D). Accordingly, the exposed N-glycan chains should significantly restrict the accessibility of a large portion of the molecular surface of the lectin domain. The Ala-151-Ser-Tyr-Tyr (ASYY) sequence stretch involved in the interaction with the RGD motif of IPI-O is located in the exposed loop connecting strand β8 to β9 (Fig. 3B) and occupies a shallow depression on the surface of the lectin-like domain (Fig. 3E). Ser-152 and the two Tyr-153 and Tyr-154 residues are readily exposed to interact with the RGD motif, most probably via hydrogen bonds. The N-glycan chains supposed to cover the lectin domain are too far from the RGD-binding residues to hamper the RGD recognition process. Also, interference with the putative carbohydrate-binding site of the lectin-like domain located in the vicinity of the RGD-binding residues seems unlikely (Fig. 3E). The putative carbohydrate-binding site is apparently devoid of any activity as predicted from docking experiments performed with simple sugars (data not shown). The invariant Asp-81 key residue responsible for the sugar recognition process of the canonical legume lectins is replaced by a His-79 residue in At5g60300. This prevents the formation of two hydrogen bonds with O3 and O6 of the pyranose ring upon anchoring a hexose into the carbohydrate-binding cavity. The lectin-like domain of At5g60300 is thereby suspected to be devoid of any significant monosaccharide-binding activity. The three-dimensional model built for the Ser/Thr-kinase domain of At5g60300 exhibits the 12 subdomains characteristic of the catalytic kinase domain arranged in a small β-rich N-terminal lobe connected to a large α-helical C-terminal lobe (Fig. 3C). The catalytic loop connecting strand β6 to β7 contains the conserved Asp-448, Lys-450, and Asn-453 triad involved in both the ATP-binding and catalytic mechanism. The Gly-rich loop connecting strand β1 to β2, which participates in the binding of ATP, and the activation T-loop lying between strand β9 and α-helix F are also conserved. Accordingly, the kinase domain readily accommodates ATP in docking experiments (Fig. 3C) and is therefore suspected to be fully active. The Lectin Domain of At5g60300 Binds RGD/RGE-Containing Peptides To verify that the lectin domain of At5g60300 can potentially recognize and bind RGD, we produced a recombinant protein in Escherichia coli consisting of intein and the lectin domain and tested this fusion protein with the photoactivatable RGD peptide (Fig. 4 Figure 4. Open in new tabDownload slide Specificity of the photoaffinity labeling of crude extracts obtained from an E. coli strain expressing the lectin domain of At5g60300. A, Lanes 1 and 2 are electrophoregrams obtained from total proteins of E. coli containing either an empty pTYB12 vector (lane 1) or a pTYB12 vector with a partial open reading frame of At5g60300 encoding the extracellular lectin domain as insert (lane 2): The recombinant protein appeared as a major band at a molecular mass of 85 kD (arrowhead). Lane 3 is the labeling pattern observed after autoradiography when the radioiodinated RGD-photoaffinity probe was photolysed as described in “Materials and Methods.” Ten micrograms were deposited in lanes 1 and 2, 0.8 μg of protein in lane 3. B, Labeling patterns and competition by RGD-binding peptides: Each peptide was applied at the concentration of 200 μm. A total of 0.8 μg of recombinant protein was deposited in each lane. C, Labeling patterns and competition by peptides containing a full or modified RGD motif: Each peptide was applied at the concentration of 200 μm. A total of 0.8 μg of protein was deposited in each lane. D, Labeling patterns and competition by the wild-type and mutant MBP-IPI-O proteins: Each protein was applied at the concentration of 0.3 μm. A total of 0.8 μg of protein was deposited in each lane. Figure 4. Open in new tabDownload slide Specificity of the photoaffinity labeling of crude extracts obtained from an E. coli strain expressing the lectin domain of At5g60300. A, Lanes 1 and 2 are electrophoregrams obtained from total proteins of E. coli containing either an empty pTYB12 vector (lane 1) or a pTYB12 vector with a partial open reading frame of At5g60300 encoding the extracellular lectin domain as insert (lane 2): The recombinant protein appeared as a major band at a molecular mass of 85 kD (arrowhead). Lane 3 is the labeling pattern observed after autoradiography when the radioiodinated RGD-photoaffinity probe was photolysed as described in “Materials and Methods.” Ten micrograms were deposited in lanes 1 and 2, 0.8 μg of protein in lane 3. B, Labeling patterns and competition by RGD-binding peptides: Each peptide was applied at the concentration of 200 μm. A total of 0.8 μg of recombinant protein was deposited in each lane. C, Labeling patterns and competition by peptides containing a full or modified RGD motif: Each peptide was applied at the concentration of 200 μm. A total of 0.8 μg of protein was deposited in each lane. D, Labeling patterns and competition by the wild-type and mutant MBP-IPI-O proteins: Each protein was applied at the concentration of 0.3 μm. A total of 0.8 μg of protein was deposited in each lane. ). The lectin domain indeed bound the RGD sequence (Fig. 4A, lane 3). Most of the label was associated with the recombinant protein of 85 kD. The label migrating at the front of the gel represents a free photoaffinity probe, which is released upon electrophoresis. The three heptapeptides selected from the phage library were then assayed as competitors (Fig. 4B): The IHQASYY and AAQPHPR peptides were strong inhibitors, whereas the TPILTTD peptide had no effect. The specificity of inhibition among the peptides is similar to that shown in Figure 2A for the 80-kD plasma membrane protein. When testing the specificity toward the RGD motif, however, a marked difference between the 80-kD plasma membrane protein and the lectin domain of At5g60300 was observed. Both the YGRGDSP and YGRGESP peptides blocked cross-linking to the lectin domain (Fig. 4C), whereas on the plasma membrane protein only RGD-containing peptides were effective (Fig. 2). This difference in specificity between the 80-kD plasma membrane protein and the lectin domain of At5g60300 was confirmed when using MBP-IPI-O and the mutated MBP-IPI-O proteins as competitors for binding to the lectin domain of At5g60300 (Fig. 4D). Both the MBP-IPI-O and the mutated MBP-IPI-O-D56E inhibited cross-linking to the recombinant lectin domain by 61% and 83%, respectively, while the mutated MBP-IPI-O-D56A had no effect. These results indicate that the recombinant lectin domain recognizes not only the RGD tripeptide motif but also the RGE motif. Effect of the RGD-Binding Peptides on Plasma Membrane-Cell Wall Adhesions In earlier studies we demonstrated that RGD-containing peptides and the MBP-IPI-O protein promote the disruption of plasma membrane-cell wall adhesions (Senchou et al., 2004). Since the RGD-binding peptides that were selected from the phage library compete with the 80-kD plasma membrane protein for binding to RGD-containing peptides, we were urged to assay the capacity of the RGD-binding peptides to interfere in vivo with the plasma membrane-cell wall adhesions. Upon plasmolysis of etiolated hypocotyls of Arabidopsis, the plasma membrane readily separated from the cell wall, but at some points adhesions between cell wall and plasma membrane were maintained, resulting in pockets that are concave with respect to cells (Fig. 5, A and C Figure 5. Open in new tabDownload slide Plasma membrane-cell wall adhesions in Arabidopsis hypocotyls. Hypocotyls from 8-d-old etiolated seedlings were prepared and stained with neutral red as described in “Materials and Methods.” Upon addition of 0.4 m CaCl2, time courses of plasmolysis were observed for 10 min. Plasmolysis was induced in the absence of additives. A and B show a portion of entire hypocotyls. A, Control series without additives: The plasmolysed cells revealed plasma membrane-cell wall adhesions (arrows) and concave forms of plasmolysis (triangles). B, RGD-binding peptides (1 mm IHQASYY and AAQPHPR) were added to the plasmolysed hypocotyls: The plasma membrane quickly separates from the wall to make spherical protoplasts and convex forms of plasmolysis. C and D are enlarged images to show wall-to-membrane adhesions and concave forms of plasmolysis (C), as well as convex forms of plasmolysis in the presence of IHQASYY and AAQPHPR peptides (D). Figure 5. Open in new tabDownload slide Plasma membrane-cell wall adhesions in Arabidopsis hypocotyls. Hypocotyls from 8-d-old etiolated seedlings were prepared and stained with neutral red as described in “Materials and Methods.” Upon addition of 0.4 m CaCl2, time courses of plasmolysis were observed for 10 min. Plasmolysis was induced in the absence of additives. A and B show a portion of entire hypocotyls. A, Control series without additives: The plasmolysed cells revealed plasma membrane-cell wall adhesions (arrows) and concave forms of plasmolysis (triangles). B, RGD-binding peptides (1 mm IHQASYY and AAQPHPR) were added to the plasmolysed hypocotyls: The plasma membrane quickly separates from the wall to make spherical protoplasts and convex forms of plasmolysis. C and D are enlarged images to show wall-to-membrane adhesions and concave forms of plasmolysis (C), as well as convex forms of plasmolysis in the presence of IHQASYY and AAQPHPR peptides (D). ). This pattern of plasmolysis occurred in all the hypocotyl cells and remained stable for at least 10 min. An identical pattern of plasmolysis was observed in the presence of the TPILTTD peptide (1 mm). However, in the presence of the IHQASYY and AAQPHPR peptides, the hypocotyl cells showed convex forms of plasmolysis: The plasma membrane quickly separated from the wall to make spherical protoplasts (Fig. 5, B and D). This pattern of plasmolysis is similar to what we observed previously when adding RGD-containing peptides or IPI-O protein to cell suspensions (Canut et al., 1998; Senchou et al., 2004), suggesting that RGD-containing peptides and RGD-binding peptides disrupt similar types of plasma membrane-cell wall adhesions in vivo. DISCUSSION The aim of this study was to obtain a molecular characterization of the plasma membrane-cell wall adhesions in Arabidopsis and, in particular, to identify proteins having an RGD-binding activity at the plasma membrane. A phage display approach allowed us to select 12 proteins as candidates to be RGD-binding proteins, and among them was the LecRK At5g60300. The latter contains in its extracellular lectin domain both the ASYY and PHPR sequences, which were able to interact with an RGD sequence. While ASYY strongly inhibited the RGD-binding activity located at the plasma membrane of Arabidopsis, inhibition by PHPR was less strong. It is very well possible that the ASYY sequence is the major determinant of the RGD-binding properties of the extracellular domain of At5g60300, with PHPR playing a less significant role. The PHPR sequence is predicted to be located at the emerging part of the molecule, close to the membrane lipid bilayer. On the other hand, three-dimensional modeling of the lectin domain of At5g60300 revealed that the ASYY sequence is located in a loop at the surface of the molecule, in a position to recognize ligands. Consistently, the lectin domain of At5g60300, obtained as a recombinant protein, showed an RGD-binding activity in vitro. LecRKs are members of the large family of the RLKs and, based on the identity of the extracellular domains, belong to a gene subfamily with at least 46 members (Shiu and Bleecker, 2001; Barre et al., 2002). From the compiled Arabidopsis Genome Initiative (2000), homologs to At5g60300 define an even smaller family of 11 members clustered in chromosomes 3 and 5. The ASYY or PHPR sequences are also found in At5g60310, At3g45330, and At3g45390 (Table I). Others exhibit an ASYF, AAYF, or PSYF sequence (At3g45410, At3g45420, At3g45430, At3g45440, At5g60270, At5g60280, At5g60320), while the PHPR sequence is less conserved. Identity or strong similarity to these sequences was also found in LecRKs from Medicago truncatula and Oryza sativa. The biological function of LecRKs remains a pending question (Van Damme et al., 1998). LecRKs are most likely plasma membrane proteins (Hervé et al., 1999; Navarro-Gochicoa et al., 2003). The structural homology they share with genuine sugar-binding legume lectins suggests they are involved in the recognition of oligosaccharide or lipochitooligosaccharide signals (Barre et al., 2002; Navarro-Gochicoa et al., 2003). Docking experiments performed with simple sugars indicated that the carbohydrate-binding cavity of the modeled lectin-like domain of At5g60300 is apparently nonfunctional. However, since other soluble legume lectin-like proteins occur in Arabidopsis, one cannot exclude that the lectin-like domain of LecRKs might recruit another lectin domain via hydrogen bonds and Van der Waals interactions between strands β1 to form the homodimeric 12-stranded β-sandwich structure commonly found in typical legume lectins, e.g. in pea (Pisum sativum) or lentil (Lens culinaris) lectins (Van Damme et al., 1998). This association could restore a functional homodimer with an active carbohydrate-binding site susceptible to specifically interact with simple or complex sugars. The occurrence of a highly conserved hydrophobic cavity in both the typical legume lectins and the LecRKs similarly suggests a possible recognition of hormone ligands, such as auxins or cytokinins, by the lectin-like domain of LecRKs (Barre et al., 2002). The results shown in this study on the specific interaction of the lectin domain with the RGD/RGE motif of IPI-O show that, in addition to possible involvement in the specific recognition of small ligand molecules, the lectin-like domain of At5g60300 functions as a protein-protein interaction domain. Until now, such a function of protein recognition has rather been devoted to proteins of the RLK family containing Leu-rich repeat (LRR) domains (Torii, 2000). We have previously shown that the RGD motif in synthetic peptides or in the IPI-O protein from the plant pathogen P. infestans disrupted the plasma membrane-cell wall adhesions of Arabidopsis (Canut et al., 1998; Senchou et al., 2004). Similar observations were reported for the brown alga Pelvetia (Henry et al., 1996), onion (Allium cepa; Canut et al., 1998), and tobacco (Nicotiana tabacum; Zhu et al., 1993). Other observations suggest the existence of multiple plasma membrane-cell wall interacting molecules involved in different functions in plants (Mellersh and Heath, 2001). Indeed, when the rust fungus Uromyces vignae attacked cowpea (Vigna unguiculata), its natural host, RGD-containing peptides disrupted the plasma membrane-cell wall adhesions. However, in nonhost pea cells, the plasma membrane remained attached to the cell wall during the pathogen attack. Also, when powdery mildew (Erysiphe polygoni) fungi attacked host or nonhost cowpea plants, the plasma membrane-cell wall adhesions appeared to be stronger than in noninfected plants. An increase in adhesions has also been reported for powdery mildew-barley (Hordeum vulgare) interactions (Lee-Stadelmann et al., 1984). Consistent with these observations, a variety of RGD-binding proteins may exist in plants, and they may differ in their specificity profiles. In this study, we selected 12 candidates from Arabidopsis, including the At5g60300 LecRK, that contain sequences covered by IHQASYY and/or AAQPHPR (Table I), and we expect more to show up when other plant genome sequencing projects are completed. Also, other LecRKs homologous to At5g60300 may be able to bind the RGD motif. We showed previously that the photolabeled 80-kD plasma membrane protein exhibited a strict specificity toward the RGD motif and not toward RGE. In contrast, the lectin domain of At5g60300 recognized both the RGD and RGE motifs. Since previous studies showed that peptides containing the RGE motif were unable to compete for the plasma membrane RGD-binding activity (Canut et al., 1998), the RGE binding of the lectin domain of At5g60300 may not be representative for the in vivo situation. The lack of specificity for RGD may be due to the fact that the lectin domain is a recombinant protein produced in a heterologous expression system (E. coli) that differs in structure with the corresponding native protein. In this study, we showed that the peptides selected from the phage library are active in disrupting plasma membrane-cell wall adhesions in Arabidopsis. Since At5g60300 is expressed in hypocotyl tissues as determined by RT-PCR experiments (data not shown) and since its lectin domain contains the RGD-binding sequences, our microscopic observations indicate that the At5g60300 lectin domain may be an RGD-interacting partner in the plasma membrane-cell wall adhesions. To find further evidence that At5g60300 acts as a RGD-binding protein in planta, we also tested the recombinant lectin domain for its ability to disrupt plasma membrane-cell wall adhesions. Unfortunately, we did not observe any changes as compared to the control (data not shown). The recombinant lectin domain is 85 kD in size, and it is questionable whether such a large molecule can reach the membrane-wall interface to find its targets. Future experiments involving, for example, At5g60300-overexpressing lines, knockout mutants, and tagged versions of At5g60300 should clarify the in vivo role of this LecRK in RGD binding. Interestingly, both LecRKs and WAKs, which are also putative linkers between the plasma membrane and the cell wall, have a kinase domain. It suggests that adhesions are part of signal transduction cascades in plant cells. The nature of the linkage between the cell wall and the plasma membrane is not known. The ligands of WAKs have been described, namely, pectins and secreted Gly-rich proteins (Kohorn, 2001). The ligands of LecRKs are not known. Our results indicate protein-protein interactions through a lectin domain, and based on that we hypothesize that RGD-containing proteins present either in the cell wall or in the plasma membrane are potential ligands for the At5g60300 LecRK. RGD-containing proteins in the cell wall can serve as a direct link between the cell wall and the plasma membrane, whereas RGD-containing proteins present in the plasma membrane can participate in membrane complexes with At5g60300 LecRK, which through such interactions gain the potential to recognize cell wall components or to activate downstream signaling pathways. Such an RGD-mediated interaction between membrane proteins was already described for RGD-binding proteins in mammals, i.e. the integrins (Papadopoulos et al., 1998; Erb et al., 2001). In plants, the application of RGD synthetic peptides led to numerous effects in very different physiological processes: The multiplicity of RGD-binding proteins and their potential interactions may explain that. Determining the partners of the LecRK lectin domains will help to unravel the structural and signaling role of such proteins at the plant cell surfaces. MATERIALS AND METHODS Phage Display Screening The ipiO1 open reading frame from Phytophthora infestans (GenBank accession no. L23939), encoding the RGD-containing IPI-O protein without the putative signal sequence, was cloned into the pMALc vector in fusion with MBP (Senchou et al., 2004). Within the ipiO1 open reading frame, two individual mutations in the RGD tripeptide motif were obtained using PCR-mediated mutagenesis. The recombinant MBP-IPI-O fusion protein as well as the recombinant mutated proteins MBP-IPI-O-D56A and MBP-IPI-O-D56-E were expressed in Escherichia coli, extracted, and purified as described previously (Senchou et al., 2004). Phage display screening was carried out using the Ph.D.-7 phage display library kit (New England Biolabs). The library consists of 2.8 × 109 electroporated sequences amplified once to yield an average of 70 copies of each sequence in 10 μL of the supplied phage suspension. The random 7-mer peptides were expressed in the context of the minor coat protein of M13 phage. The affinity selection of phages on the recombinant MBP-IPI-O protein was done as described by Koivunen et al. (1993) with the following modifications. A 10-μL portion of the library (2 × 1011 transducing units) was first incubated for 2 h at 4°C in a 1.5-cm-diameter well coated with BSA in 500 μL of Tris-buffered saline (TBS). The phages unbound to BSA were transferred to a similar well that had been coated with 100 μg/mL recombinant MBP-IPI-O protein and saturated with BSA. After incubation for 1 h at 4°C, the unbound phages were removed by washing 10 times with TBS buffer containing 0.1% Tween 20. The bound phages were specifically eluted with 0.5 mm RGDS peptide (Bachem) in TBS buffer. A single round of bio-panning selection was performed, and the affinity-purified phages were isolated on Luria-Bertani agar plate supplemented with Xgal/IPTG using the E. coli strain ER2738. From blue plaques, randomly picked phages were individually amplified and prepared for DNA sequencing. Production of a Recombinant Lectin Domain The open reading frame of At5g60300, encoding the extracellular lectin domain without the putative signal sequence (amino acids 14–275), was cloned from the F15L12 bacterial artificial chromosome provided by the Arabidopsis Biological Resource Center (Ohio State University). It was cloned into the XhoI-SmaI sites of the pTYB12 vector (New England Biolabs), which produced a fusion protein with intein containing a chitin-binding domain. The ligation products were introduced into E. coli strain ER2566. Plasmid DNA was isolated and checked by sequencing. Expression of the pTYB12-based plasmid was induced by activating the lac promoter with IPTG (0.5 mm) for 3 h 30 min at 37°C. Cells were harvested and resuspended in lysis buffer (20 mm Tris, pH 7.4 [HCl], 500 mm NaCl, 1 mm EDTA, 0.1% Triton X-100). Level of protein expression, isolation of the protein, and amino acid sequence were confirmed by SDS-PAGE, western-blot analysis, and mass spectrometry, respectively. Plant Material and Purification of Plasma Membrane Etiolated seedlings of Arabidopsis (Arabidopsis thaliana) ecotype Columbia were grown in 1-L Erlenmeyer flask containing 150 mL of Murashige and Skoog basal medium with the addition of Suc to 10 g L−1 (Bardy et al., 1998). They were harvested after 2 weeks of culture, leading to 20 to 30 g (fresh weight) of plant material. The purified plasma membrane vesicles were isolated from microsomes of Arabidopsis seedlings by preparative free-flow electrophoresis. The purity was assessed both by the determination of marker enzyme activities and by the reactivity of immunological probes. Based on the measurement of ATPase latency, the plasma membrane fraction appeared to consist essentially of cytoplasmic side-in vesicles (Bardy et al., 1998). Peptides and Photoaffinity Assays The synthesis of four peptides, AGRGDSP, YGRGDSP, YGRGESP, and YGDGRSP, was done automatically by stepwise Fmoc-t-butyl solid phase synthesis in a Synergy Applied Biosystems peptide synthesizer (Senchou et al., 2004). They were purified by reverse-phase HPLC. The RGDS peptide was purchased from Bachem. Other peptides were synthesized by the MilleGen Company. The synthesis of the photoaffinity probe, N-(4-azido-salicylyl) AGRGDSP heptapeptide, started with the addition of the photoreactive heterobifunctional reagent N-hydroxysuccinimidyl-4-azido-salicylic acid (Pierce) to the NH2 group of the Ala residue of the AGRGDSP peptide. The photoaffinity probe was radioiodinated as described, to yield the mono-iodinated N-(4-azido-salicylyl) AGRGDSP peptide with a specific radioactivity of 78.6 TBq mmol−1. The iodinated peptide was purified by reverse-phase HPLC. Its integrity was confirmed by mass spectrometry and amino acid analysis (Senchou et al., 2004). The photolabeling of the recombinant lectin domain with the mono-iodinated N-(4-azido-salicylyl) AGRGDSP heptapeptide was carried out in 50 mm MES, pH 5.5 (HCl), as follows. Incubation mixtures contained crude bacterial extracts (0.8 μg of protein) and 125I-labeled N-(4-azidosalicylyl) peptide (28 kBq, 0.35 pmol) in a total volume of 0.1 mL. The samples were incubated for 5 min on ice and then photoilluminated for 30 s on ice with high UV intensity light (312 nm) from a 176 W Spectroline lamp (Spectronics), situated 15 cm away from the sample. When additives were present, as indicated in the legends of the figures, the samples were preincubated for 10 min on ice. Laemmli sample buffer was added to the samples, and after SDS-PAGE the 11% acrylamide gels were dried under vacuum at 70°C for 2 h. Radioactivity in the protein bands was detected with a PhosphorImager (Molecular Dynamics). A similar procedure was used for the photolabeling of plasma membrane vesicles (Senchou et al., 2004). Microscopy Hypocotyls were separated from cotyledons and roots from 8-d-old seedlings, and were allowed to float on 50 mm Tris, pH 8.0 (HCl), for at least 1 h at room temperature. After a rinse in distilled water, hypocotyls were transferred to a solution of 0.05% neutral red for 5 min. After a new rinse in distilled water, hypocotyls were placed on a microscope slide into 100 μL of CaCl2 0.4 m to plasmolyze the cells. The observation was without coverslip. Directly under the microscope, stock solutions of peptides (50 mm) were applied to the hypocotyls as a drop with a pipette to a final concentration of 1 mm. Hypocotyls were observed with a Leitz DB-IRBE inverted microscope in bright field. Images were acquired with a Color Coolview CCD camera (Photonic Science) and analyzed with the Image-Pro Plus image analysis software (Media Cybernetics). Molecular Modeling and Docking Experiments Homology modeling of both the lectin and kinase domains of At5g60300 was performed on a Silicon Graphics O2 10000 workstation, using InsightII, Homology, and Discover3 programs (Accelrys). The atomic coordinates of the legume lectin LoLI of Lathyrus ochrus (PDB code 1LOB; Bourne et al., 1990a) and the kinase from Zea mays (PDB code 1LR4) were taken from the RCSB Protein Data Bank (Berman et al., 2000) and used to build the three-dimensional models. The amino acid sequence alignment was performed with ClustalX (Thompson et al., 1997), and the structurally conserved regions were inferred from the comparison of the HCA plots (Gaboriaud et al., 1987) generated with the program drawhca (http://smi.snv.jussieu.fr/hca/hca-form.html). Steric conflicts resulting from the replacement or the deletion of some residues in the modeled proteins were corrected during the model building using the rotamer library (Ponder and Richards, 1987) and the search algorithm (Mas et al., 1992) of Homology to maintain proper side chain orientation. Energy minimization and relaxation of the loop regions were carried out by several cycles of steepest descent. After correction of the geometry of the loops using the minimize option of TurboFrodo (Roussel and Cambillau, 1989), a final energy minimization step was performed by 50 cycles of conjugate gradient using Discover3. PROCHECK (Laskowski et al., 1993) was used to check the stereochemical quality of the three-dimensional models. Cartoons were drawn with PyMOL (“The PyMOL Molecular Graphics System”; DeLano Scientific LLC, http://www.pymol.org). Docking of simple sugars into the carbohydrate-binding site of the lectin-like domain of At5g60300 was performed with InsightII. The lowest apparent binding energy (Ebind expressed in kcal mol−1) compatible with the Van der Waals interactions and hydrogen bonds found in the L. ochrus lectin/sugar complex (PDB code 1LOE; Bourne et al., 1990b) was calculated using the forcefield of Discover3. The position of the sugar observed in the lectin/sugar complex was used as a starting position to anchor the sugars into the binding site of the modeled At5g60300 lectin domain. Anchoring of ATP in the kinase domain of At5g60300 was similarly checked using the Z. mays kinase/ATP complex (PDB code 1LR4; Van Damme et al., 1998) as a template. Sequence data from this article can be found in the GenBank/EMBL data libraries under IPI-O accession L23939 and the RLK accession numbers in Table I. LITERATURE CITED Arabidopsis Genome Initiative ( 2000 ) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408 : 796 –815 Bardy N, Carrasco A, Galaud JP, Pont-Lezica R, Canut H ( 1998 ) Free-flow electrophoresis for fractionation of Arabidopsis membranes. Electrophoresis 19 : 1145 –1153 Barre A, Hervé C, Lescure B, Rougé P ( 2002 ) Lectin receptor kinases in plants. CRC Crit Rev Plant Sci 21 : 379 –399 Bateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths-Jones S, Khanna A, Marshall M, Moxon S, Sonnhammer EL, et al ( 2004 ) The Pfam protein families database. Nucleic Acids Res 32 : D138 –D141 Berger F, Taylor A, Brownlee C ( 1994 ) Cell fate determination by the cell wall in early Fucus development. Science 263 : 1421 –1423 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE ( 2000 ) The Protein Data Bank. Nucleic Acids Res 28 : 235 –242 Bernal AJ, Willats WGT ( 2004 ) Plant science in the age of phage. Trends Plant Sci 9 : 465 –468 Bourne Y, Abergel C, Cambillau C, Frey M, Rougé P, Fontecilla-Camps JC ( 1990 a) X-ray crystal structure determination and refinement at 1.9 A resolution of isolectin I from the seeds of Lathyrus ochrus. J Mol Biol 214 : 571 –584 Bourne Y, Roussel A, Frey M, Rougé P, Fontecilla-Camps JC, Cambillau C ( 1990 b) Three-dimensional structures of complexes of Lathyrus ochrus isolectin I with glucose and mannose: fine specificity of the monosaccharide-binding site. Proteins 8 : 365 –376 Canut H, Carrasco A, Galaud JP, Cassan C, Bouyssou H, Vita N, Ferrara P, Pont-Lezica R ( 1998 ) High affinity RGD-binding sites at the plasma membrane of Arabidopsis thaliana links the cell wall. Plant J 16 : 63 –71 Erb L, Liu J, Ockerhausen J, Kong Q, Garrad RC, Griffin K, Neal C, Krugh B, Santagio-Perez LI, Gonzalez FA, et al ( 2001 ) An RGD sequence in the P2Y(2) receptor interacts with alpha(V)beta(3) integrins and is required for G(o)-mediated signal transduction. J Cell Biol 153 : 491 –501 Fleming AJ, Mc Queen-Mason S, Mandel T, Kuhlemeier C ( 1997 ) Induction of leaf primordia by the cell wall protein expansin. Science 276 : 1415 –1420 Gaboriaud C, Bissery V, Benchetrit T, Mornon JP ( 1987 ) Hydrophobic cluster analysis: an efficient new way to compare and analyse amino acid sequences. FEBS Lett 224 : 149 –155 Henry CA, Jordan JR, Kropf DL ( 1996 ) Localized membrane-wall adhesions in Pelvetia zygotes. Protoplasma 190 : 39 –52 Hervé C, Serres J, Dabos P, Canut H, Barre A, Rougé P, Lescure B ( 1999 ) Characterization of the Arabidopsis lecRK-a genes: members of a superfamily encoding putative receptors with an extracellular domain homologous to legume lectins. Plant Mol Biol 39 : 671 –682 Kohorn BD ( 2000 ) Plasma membrane-cell wall contacts. Plant Physiol 124 : 31 –38 Kohorn BD ( 2001 ) WAKs; cell wall associated kinases. Curr Opin Cell Biol 13 : 529 –533 Koivunen E, Gay DA, Ruoslahti E ( 1993 ) Selection of peptides binding to the alpha 5 beta 1 integrin from phage display library. J Biol Chem 268 : 20205 –20210 Laskowski RA, MacArthur MW, Moss DS, Thornton JM ( 1993 ) PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Crystallogr 26 : 283 –291 Lee-Stadelmann OY, Bushnell WR, Stadelmann EJ ( 1984 ) Changes in plasmolysis form in epidermal cells of Hordeum vulgare infected by Erysiphe graminis: evidence for increased membrane-wall adhesion. Can J Bot 62 : 1714 –1723 Levitt J ( 1983 ) Plasmolysis shape in relation to freeze hardening of cabbage plants and to the effect of penetrating solutes. Plant Cell Environ 6 : 465 –470 Lintilhac PM, Vesecky TB ( 1984 ) Stress-induced alignment of division plane in plant tissues grown in vitro. Nature 307 : 363 –364 Mas MT, Smith KC, Yarmush DL, Aisaka K, Fine RM ( 1992 ) Modeling the anti-CEA antibody combining site by homology and conformational search. Proteins Struct Func Genet 14 : 483 –498 Mc Cabe PF, Valentine TA, Forsberg LS, Pennell RI ( 1997 ) Soluble signals from cells identified at the cell wall establish a developmental pathway in carrot. Plant Cell 9 : 2225 –2241 Mellersh DG, Heath MC ( 2001 ) Plasma membrane-cell wall adhesion is required for expression of plant defense responses during fungal penetration. Plant Cell 13 : 413 –424 Mulder NJ, Apweiler R, Attwood TK, Bairoch A, Barrell D, Bateman A, Binns D, Biswas M, Bradley P, Bork P, et al ( 2003 ) The InterPro Database, 2003 brings increased coverage and new features. Nucleic Acids Res 31 : 315 –318 Navarro-Gochicoa MT, Camut S, Timmers CJ, Niebel A, Hervé C, Boutet E, Bono JJ, Imberty A, Cullimore JV ( 2003 ) Characterization of four lectin-like receptor kinases expressed in roots of Medicago truncatula. Structure, location, regulation of expression, and potential role in the symbiosis with Sinorhizobium meliloti. Plant Physiol 133 : 1893 –1910 Papadopoulos GK, Ouzounis C, Eliopoulos E ( 1998 ) RGD sequences in several receptor proteins: novel cell adhesion function of receptors? Int J Biol Macromol 22 : 51 –57 Ponder JW, Richards FM ( 1987 ) Tertiary templates for proteins. Use of packing criteria in the enumeration of allowed sequences for different structural classes. J Mol Biol 193 : 775 –791 Roberts AW, Haigler CH ( 1989 ) Rise in chlorotetracycline fluorescence accompanies tracheary element differentiation in suspension cultures of Zinnia. Protoplasma 152 : 37 –45 Roussel A, Cambillau C ( 1989 ) TURBO-FRODO. Silicon Graphics Geometry Partners Directory (Committee, S.G., Ed.). Silicon Graphics, Mountain View, CA Schindler M, Meiners S, Cheresh DA ( 1989 ) RGD-dependent linkage between plant cell wall and plasma membrane: consequences for growth. J Cell Biol 108 : 1955 –1965 Senchou V, Weide R, Carrasco A, Bouyssou H, Pont-Lezica R, Govers F, Canut H ( 2004 ) High affinity recognition of a Phytophthora protein by Arabidopsis via an RGD motif. Cell Mol Life Sci 61 : 502 –509 Shiu SH, Bleecker AB ( 2001 ) Receptor-like kinases from Arabidopsis form a monophyletic gene family related to animal receptor kinases. Proc Natl Acad Sci USA 98 : 10763 –10768 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DJ ( 1997 ) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 15 : 4876 –4882 Torii KU ( 2000 ) Receptor kinase activation and signal transduction in plants: an emerging picture. Curr Opin Plant Biol 3 : 361 –367 Van Damme EJM, Peumans WJ, Barre A, Rougé P ( 1998 ) Plant lectins: a composite of several distinct families of structurally and evolutionary related proteins with diverse biological roles. CRC Crit Rev Plant Sci 17 : 575 –692 Wyatt SE, Carpita NC ( 1993 ) The plant cytoskeleton-cell-wall continuum. Trends Cell Biol 3 : 413 –417 Zhu JK, Shi J, Singh U, Wyatt SE, Bressan RA, Hasegawa PM, Carpita NC ( 1993 ) Enrichment of vitronectin- and fibronectin-like proteins in NaCl-adapted plant cells and evidence for their involvement in plasma membrane-cell wall adhesion. Plant J 3 : 637 –646 Author notes 1 This work was supported by the Université Paul Sabatier, Toulouse; by the Centre National de la Recherche Scientifique; by GABI/Génoplante (contract no. AF–2001091); and by the Netherlands-French bilateral exchange program Van Gogh (NWO-VGP 85–343). 2 These authors contributed equally to the paper. * Corresponding author; e-mail [email protected]; fax 33–562–19–35–02. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Rafael Pont-Lezica ([email protected]). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.066464. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Wang, Xin; Xu, Yunyuan; Han, Ye; Bao, Shilai; Du, Jizhou; Yuan, Ming; Xu, Zhihong; Chong, Kang

doi: 10.1104/pp.105.071670pmid: 16361516

Abstract Ran is an evolutionarily conserved eukaryotic GTPase. We previously identified a cDNA of TaRAN1, a novel Ran GTPase homologous gene in wheat (Triticum aestivum) and demonstrated that TaRAN1 is associated with regulation of genome integrity and cell division in yeast (Saccharomyces cerevisiae) systems. However, much less is known about the function of RAN in plant development. To analyze the possible biological roles of Ran GTPase, we overexpressed TaRAN1 in transgenic Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa). TaRAN1 overexpression increased the proportion of cells in the G2 phase of the cell cycle, which resulted in an elevated mitotic index and prolonged life cycle. Furthermore, it led to increased primordial tissue, reduced number of lateral roots, and stimulated hypersensitivity to exogenous auxin. The results suggest that Ran protein was involved in the regulation of mitotic progress, either in the shoot apical meristem or the root meristem zone in plants, where auxin signaling is involved. This article determines the function of RAN in plant development mediated by the cell cycle and its novel role in meristem initiation mediated by auxin signaling. Ran is one of the important small G-protein families in organisms. In animals and yeast (Saccharomyces cerevisiae), it functions in many aspects, including nuclear transport, cell cycle control, postmitotic nuclear assembly, and spindle assembly (for review, see Dasso, 2001). The core biochemistry of Ran is similar to that of many Ras-related GTPases (for review, see Görlich and Kutay, 1999; Sazer and Dasso, 2000). Ran's intrinsic rates of nucleotide exchange and hydrolysis are slow. In vivo, these reactions require a nucleotide exchange factor (RCC1) and a GTPase-activating protein (RanGAP1) to achieve physiological rates. The Ran binding protein 1 (RanBP1) binds to RanGTP with high affinity and acts as an essential accessory factor to increase RanGAP1-mediated nucleotide hydrolysis (Sazer and Dasso, 2000). During interphase, RCC1 is a chromatin-associated nuclear protein, while RanBP1 and RanGAP1 are largely cytosolic. The asymmetric distribution of nucleotide exchange and hydrolysis enzymes across the nuclear envelope suggests that RanGTP should be largely nuclear and RanGDP largely cytosolic. This distribution plays a key role in determining the directionality of nuclear transport (Dasso, 2001). The requirement for Ran in nuclear transport has been extensively studied in animals (for review, see Görlich and Kutay, 1999). Established functions of Ran have been reported in transport of RNA and proteins across the nuclear pore (Görlich and Kutay, 1999), mitotic spindle organization (Hetzer et al., 2002), and nuclear envelope assembly (Zhang and Clarke, 2000). In plants, although Ran's function has been identified, it has not been elucidated broadly (Yang, 2002). The tomato (Lycopersicon esculentum) Ran protein was functionally homologous with a yeast Ran-like protein in suppressing the effects of a mutation in a yeast homolog of RCC1 in mitosis (Ach and Gruissem, 1994). A RanBP1 homolog in Arabidopsis (Arabidopsis thaliana) alters the cell cycle progression in yeast (Xia et al., 1996). Haizel et al. (1997) isolated RanBP genes in Arabidopsis, characterized their binding specificity to Ran, and demonstrated the expression pattern of its transcripts. Recent intriguing findings have shown that the N terminus of RanGAPs is responsible for its targeting to the plant nuclear rim, and RanBP transgenic Arabidopsis is hypersensitive to auxin and shows mitotic progress arrested at metaphase (Kim et al., 2001; Rose and Meier, 2001). The basic mechanism and logic of cell cycle control are highly conserved in eukaryotes and so are the key genes that mediate cell cycle progression (Nasmyth, 1996; Novak et al., 1998). Compared with what is known about mitosis in animals or yeast, our molecular-level knowledge of mitosis in higher plants is still in its infancy (Criqui and Genschik, 2002). During the past decade, the key molecules associated with cell proliferation have been identified experimentally in plants (Potuschak and Doerner, 2001). Most of these molecules are homologs of or contain domains that are homologous to yeast and animal genes known to have a role in the regulation of cell division. But the function of Ran in the plant cell cycle has not been elucidated (Potuschak and Doerner, 2001). Wheat (Triticum aestivum) is an important crop characterized to date as having a large genome size (approximately 17,000 Mb). Until now, the technique of gene transformation and plantlet regeneration in wheat has been difficult for use in functional genomics, thus challenging researchers in creating successful transgenic wheat and analyzing gene function (Chong et al., 1998; Vasil and Vasil, 1999). To investigate the function of genes in wheat, investigators use tractable model systems, Arabidopsis and rice (Oryza sativa), to analyze the possible biological roles. In this article, we also took this strategy to identify the function of wheat RAN1 (TaRAN1), a wheat Ran GTPase. Our previous result has shown that TaRAN1 was associated with regulation of genome integrity and cell division in yeast systems (Wang et al., 2004). Much less is known about the process Ran is involved in. Here we show that overexpressed TaRAN1 in transgenic Arabidopsis and rice increased the proportion of cells in the G2 phase of the cell cycle and resulted in elevation of the mitotic index and prolongation of the life cycle. Furthermore, overexpression of TaRAN1 led to an increased amount of primordial meristem, a decreased number of lateral roots, and stimulated hypersensitivity to exogenous auxin. This article indicates that Ran protein is involved in regulation of the mitotic progress in the shoot apical meristem or root meristem zone in plants. RESULTS Molecular Characterization of TaRAN1-Overexpressed Transgenic Lines To analyze the role of TaRAN1 in plants, we overexpressed TaRAN1 in transgenic Arabidopsis and rice under the control of a constitutive cauliflower mosaic virus (CaMV) 35S promoter and a ubiquitin promoter of maize (Zea mays), respectively. Transformed lines of rice were confirmed by Southern blotting (Fig. 1A Figure 1. Open in new tabDownload slide Molecular characterization of TaRAN1 transgenic plants of rice and Arabidopsis. A, Southern-blot assay for rice transgenic plants. Genomic DNA isolated from the transformed line or wild type (WT) was digested either with EcoRI (E) or HindIII (H). The blot was hybridized with the encoded region of the GUS gene labeled with 32P-dCTP and washed as described in “Materials and Methods.” B, Identification of independent transformed Arabidopsis lines by tissue PCR analysis. Total DNAs were isolated from WT or transgenic Arabidopsis plants. Transgene of TaRAN1 driven by the CaMV 35S promoter was examined by tissue PCR analysis as described in “Materials and Methods.” C and D, An examination of different transgenic plant lines of rice and Arabidopsis by semiquantitative RT-PCR. The specific primers (a) and the common primers (b) were used for RT-PCR. Tubulin RT-PCR was included as a loading control. The experiment was repeated five times. TaRAN1 expression in rice (C) and Arabidopsis (D). Figure 1. Open in new tabDownload slide Molecular characterization of TaRAN1 transgenic plants of rice and Arabidopsis. A, Southern-blot assay for rice transgenic plants. Genomic DNA isolated from the transformed line or wild type (WT) was digested either with EcoRI (E) or HindIII (H). The blot was hybridized with the encoded region of the GUS gene labeled with 32P-dCTP and washed as described in “Materials and Methods.” B, Identification of independent transformed Arabidopsis lines by tissue PCR analysis. Total DNAs were isolated from WT or transgenic Arabidopsis plants. Transgene of TaRAN1 driven by the CaMV 35S promoter was examined by tissue PCR analysis as described in “Materials and Methods.” C and D, An examination of different transgenic plant lines of rice and Arabidopsis by semiquantitative RT-PCR. The specific primers (a) and the common primers (b) were used for RT-PCR. Tubulin RT-PCR was included as a loading control. The experiment was repeated five times. TaRAN1 expression in rice (C) and Arabidopsis (D). ). The specific sequence of the reporter β-glucuronidase (GUS) gene revealed a single band on digestion with either HindIII or EcoRI in transgenic rice lines and different lines showed diverse hybridization maps. In the wild type, however, no signals occurred under the same conditions (Fig. 1A). Therefore, the transgenic lines of rice could be independent. In Arabidopsis, the 5′-end specific primer of the 35S promoter and the 3′-end specific primer of TaRAN1 were used to check the existence of TaRAN1 driven by a CaMV 35S promoter in genomes of transgenic Arabidopsis lines. PCR product was detected in the independent transformed lines, but not in wild-type Arabidopsis under the same conditions (Fig. 1B). Thus, TaRAN1 was integrated into the genome of transformed plants and highly expressed in transgenic rice and Arabidopsis. To examine the expression of exogenous TaRAN1 in transgenic lines, we performed semiquantitative reverse transcription (RT)-PCR with either the specific primers, which could detect TaRAN1 (Fig. 1, Ca and Da), or the common primers, which could amplify the conserved domain of the Ran family (Fig. 1, Cb and Db). TaRAN1 was highly expressed at the transcriptional level in transgenic plants in both rice and Arabidopsis (Fig. 1, C and D), but not at all expressed in wild-type plants (Fig. 1, Ca and Da). Overexpression of RAN1 Increased Primordia, Later Flowering, and Reduced Apical Dominancy Transgenic plants of Arabidopsis produced seedlings with a range of phenotypes. Compared with the wild type, transgenic Arabidopsis showed distinct phenotypes, such as increased tiller number, weak apical dominance, abnormal root development, excess rosette leaves, and wider siliques (Fig. 2, A–F Figure 2. Open in new tabDownload slide The phenotypes of the T2 generation of different lines of overexpressed TaRAN1 transgenic Arabidopsis. A, Rosette leaves of wild-type Arabidopsis grown for 3 weeks. B, Increased rosette leaves of transgenic Arabidopsis grown for 3 weeks. C, Normal phenotype of wild-type Arabidopsis. D, Two branches with rosette leaves in a transgenic plant. E, More tillery number and more buds in a transgenic plant. F, Mature silique morphology. Left, Transgenic plant; right, wild type. G, Apical inflorescence of wild-type Arabidopsis. H, Apical inflorescence including partial abortion of transgenic Arabidopsis. I, Normal floral apical dominance of wild-type Arabidopsis. J, Transgenic Arabidopsis with reduced apical dominance. K, Time curve of development of rosette leaves in transgenic Arabidopsis plants. Time of flowering is marked with arrows. Data are presented as mean ± se from three experiments (n = 15). WT, Wild type. L, Normal shoot apical point region of wild-type Arabidopsis on scanning electron microscopy. M, Additional new organ primordia around the shoot apical point of transgenic Arabidopsis. N, Axillary cells of wild type. O, Axillary cells of transgenic plants. Some hyperplastic cells and new primordial meristems emerged on the side of axillary cells of transgenic plants. The new primordia are marked with arrows. Arrows in M and O indicate the new primordia. Bar = 60 μm. Figure 2. Open in new tabDownload slide The phenotypes of the T2 generation of different lines of overexpressed TaRAN1 transgenic Arabidopsis. A, Rosette leaves of wild-type Arabidopsis grown for 3 weeks. B, Increased rosette leaves of transgenic Arabidopsis grown for 3 weeks. C, Normal phenotype of wild-type Arabidopsis. D, Two branches with rosette leaves in a transgenic plant. E, More tillery number and more buds in a transgenic plant. F, Mature silique morphology. Left, Transgenic plant; right, wild type. G, Apical inflorescence of wild-type Arabidopsis. H, Apical inflorescence including partial abortion of transgenic Arabidopsis. I, Normal floral apical dominance of wild-type Arabidopsis. J, Transgenic Arabidopsis with reduced apical dominance. K, Time curve of development of rosette leaves in transgenic Arabidopsis plants. Time of flowering is marked with arrows. Data are presented as mean ± se from three experiments (n = 15). WT, Wild type. L, Normal shoot apical point region of wild-type Arabidopsis on scanning electron microscopy. M, Additional new organ primordia around the shoot apical point of transgenic Arabidopsis. N, Axillary cells of wild type. O, Axillary cells of transgenic plants. Some hyperplastic cells and new primordial meristems emerged on the side of axillary cells of transgenic plants. The new primordia are marked with arrows. Arrows in M and O indicate the new primordia. Bar = 60 μm. ). The flower stalk emerged about 10 d later in RAN1-overexpressed plants than in wild-type plants under long-day conditions (Fig. 2K). The floral stalk of TaRAN1-overexpressed Arabidopsis plants was shorter and had more lateral floral branches than wild-type plants. In other words, the apical dominance of transgenic Arabidopsis was reduced (Fig. 2, G–J). Similarly, in transgenic rice plants, the tiller number reached 14.8 per plant on average. In contrast, wild-type rice had fewer tillers, about 5.6 per plant (Table I Table I. Increased tillery number in 35S-sense TaRAN1 transgenic mature rice se of the mean is based on 10 mature plants. Rice Plant Line . Tillery No. . Plant Height . cm Wild type 5.56 ± 1.64 55.6 ± 2.43 Transgenic line 20 14.8 ± 5.22a 44.8 ± 3.67a Transgenic line 25 13.5 ± 4.3a 43.7 ± 4.69a Transgenic line 29 13.5 ± 2.12a 41.9 ± 3.42a Rice Plant Line . Tillery No. . Plant Height . cm Wild type 5.56 ± 1.64 55.6 ± 2.43 Transgenic line 20 14.8 ± 5.22a 44.8 ± 3.67a Transgenic line 25 13.5 ± 4.3a 43.7 ± 4.69a Transgenic line 29 13.5 ± 2.12a 41.9 ± 3.42a a Significant differences, P < 0.01. Open in new tab Table I. Increased tillery number in 35S-sense TaRAN1 transgenic mature rice se of the mean is based on 10 mature plants. Rice Plant Line . Tillery No. . Plant Height . cm Wild type 5.56 ± 1.64 55.6 ± 2.43 Transgenic line 20 14.8 ± 5.22a 44.8 ± 3.67a Transgenic line 25 13.5 ± 4.3a 43.7 ± 4.69a Transgenic line 29 13.5 ± 2.12a 41.9 ± 3.42a Rice Plant Line . Tillery No. . Plant Height . cm Wild type 5.56 ± 1.64 55.6 ± 2.43 Transgenic line 20 14.8 ± 5.22a 44.8 ± 3.67a Transgenic line 25 13.5 ± 4.3a 43.7 ± 4.69a Transgenic line 29 13.5 ± 2.12a 41.9 ± 3.42a a Significant differences, P < 0.01. Open in new tab ). These results suggest that TaRAN1 expression affected rosette leaf or tiller initiation in the meristematic region and subsequent growth. Previous results suggested that expression of TaRAN1 at the transcriptional level was higher in young stems and inflorescences in wheat (Wang et al., 2004). To investigate a possible role for TaRAN1 in the control of cell division and differentiation, we examined its effects on the shoot apex in transgenic Arabidopsis. In the wild type, the shoot apex contains the meristem itself, which consists of a central zone with fewer rapidly dividing stem cells and a surrounding peripheral region where new organ primordia are initiated. The growth of primordia is driven initially by cell division, and further rosette leaf and tiller development resulted from a combination of cell division and cell expansion accompanied by progressive differentiation. Compared with the wild type, transgenic Arabidopsis showed additional new organ primordia around the shoot apical point. Furthermore, some hyperplastic cells and new primordia also emerged at the axil of transgenic Arabidopsis (Fig. 2, L–O). Therefore, TaRAN1 protein might be involved in the regulation of cell division (Wang et al., 2004). Transgenic Lines Displayed Inhibition of Primary Root Growth and Reduced Lateral Root Initiation The striking and common phenotypes among TaRAN1 transgenic Arabidopsis seedlings were observed in root development (Fig. 3, A and B Figure 3. Open in new tabDownload slide Root development of T2 generation of transgenic Arabidopsis. A, Wild-type Arabidopsis. B, Transgenic Arabidopsis. C, Length of primary roots in transgenic Arabidopsis lines. D, Number of lateral roots in transgenic Arabidopsis lines. C and D, Plants were allowed to grow for 10 d to determine the root length and lateral root production from the primary root after vernalization. The number of transgenic plants and wild type is more than 12 in each experiment. Results are presented as average values ± se from three experiments. Asterisk (*), Significant difference, P < 0.01. Figure 3. Open in new tabDownload slide Root development of T2 generation of transgenic Arabidopsis. A, Wild-type Arabidopsis. B, Transgenic Arabidopsis. C, Length of primary roots in transgenic Arabidopsis lines. D, Number of lateral roots in transgenic Arabidopsis lines. C and D, Plants were allowed to grow for 10 d to determine the root length and lateral root production from the primary root after vernalization. The number of transgenic plants and wild type is more than 12 in each experiment. Results are presented as average values ± se from three experiments. Asterisk (*), Significant difference, P < 0.01. ). Various lines of transgenic seedlings showed a similar phenotype, whereby the number of lateral roots was reduced and the growth of primary roots was suppressed (Fig. 3, C and D). The number of lateral roots was only 1.3 per plant on average in the transgenic seedlings. In contrast, the wild type showed eight per plant under the same conditions (Fig. 3, C and D). Roots of transgenic Arabidopsis showed no difference in cell size at both the elongation and maturation zones compared with those of wild-type Arabidopsis (Fig. 4C Figure 4. Open in new tabDownload slide Comparison of cell numbers between transgenic plants and wild-type Arabidopsis and rice. Cells of the meristem zone of primary roots of wild-type (A) and transgenic (B) Arabidopsis stained with PI. The number of transgenic Arabidopsis cells in the meristem was greatly increased over those in the wild type. Bar = 30 μm. C, Cell number of primary roots of Arabidopsis at the meristem, elongation, and maturation zones. Results are presented as mean ± se from three experiments (n = 10). Cells of the meristem zone of primary roots of wild-type (D) and transgenic (E) rice stained with PI. The number of transgenic rice cells in the meristem was greatly increased over those in the wild type. Bar = 30 μm. F, Cell number in primary roots of rice at the meristem, elongation, and maturation zones. Results are presented as mean ± se from three experiments (n = 10). Figure 4. Open in new tabDownload slide Comparison of cell numbers between transgenic plants and wild-type Arabidopsis and rice. Cells of the meristem zone of primary roots of wild-type (A) and transgenic (B) Arabidopsis stained with PI. The number of transgenic Arabidopsis cells in the meristem was greatly increased over those in the wild type. Bar = 30 μm. C, Cell number of primary roots of Arabidopsis at the meristem, elongation, and maturation zones. Results are presented as mean ± se from three experiments (n = 10). Cells of the meristem zone of primary roots of wild-type (D) and transgenic (E) rice stained with PI. The number of transgenic rice cells in the meristem was greatly increased over those in the wild type. Bar = 30 μm. F, Cell number in primary roots of rice at the meristem, elongation, and maturation zones. Results are presented as mean ± se from three experiments (n = 10). ), but the number of cells in the meristem was greatly increased over that in the wild type (Fig. 4, A–C). The meristem cells of transgenic Arabidopsis were smaller and more tightly arrayed than those of the wild type. In transgenic plants of rice, all smaller and tightly arrayed cells were totally reemerged in the meristem zone (Fig. 4, D–F). The results suggest that TaRAN1 was involved in meristem cell proliferation in root development. Hypersensitive Response to Indoleacetic Acid for Induction of Lateral Root Initiation Multiple root and shoot phenotypes are commonly associated with many auxin-related mutants, and parallel phenotypes are often observed among different classes of auxin-related mutants (Berleth et al., 2000; Rogg and Bartel, 2001). To test whether root development was affected by auxin in transgenic plants, wheat seedlings were treated with 10−7m indoleacetic acid (IAA) and showed substantial increase in TaRAN1 expression 24 h after treatment (Fig. 5A Figure 5. Open in new tabDownload slide Transcriptional response of TaRAN1 to IAA treatment in wheat and effect of auxin on root development in transgenic Arabidopsis plants. A, RNA gel-blot analysis of 10−7m/L IAA-responsive expression of TaRAN1 in wheat. The bars represent the relative amount of the normalized expression of TaRAN1 after IAA treatment for different times. B, Effect of IAA (10−10 or 10−7m) on growth of primary roots in transgenic plants of Arabidopsis. The transgenic plants treated with IAA showed suppressed primary root growth as compared with wild-type plants. C, Effect of IAA (10−10 or 10−7m) on lateral root numbers in transgenic Arabidopsis plants. The number of lateral roots of transgenic plants was increased compared with wild-type plants after IAA (10−10 or 10−7m) treatment. B and C, All plates were allowed to grow for 10 d to determine the effect of various concentrations of auxin on root length and lateral root production after vernalization. Results are presented as average values ± se from three experiments. More than 12 roots were used in each experiment. Asterisk (*), Significant difference, P < 0.01. Figure 5. Open in new tabDownload slide Transcriptional response of TaRAN1 to IAA treatment in wheat and effect of auxin on root development in transgenic Arabidopsis plants. A, RNA gel-blot analysis of 10−7m/L IAA-responsive expression of TaRAN1 in wheat. The bars represent the relative amount of the normalized expression of TaRAN1 after IAA treatment for different times. B, Effect of IAA (10−10 or 10−7m) on growth of primary roots in transgenic plants of Arabidopsis. The transgenic plants treated with IAA showed suppressed primary root growth as compared with wild-type plants. C, Effect of IAA (10−10 or 10−7m) on lateral root numbers in transgenic Arabidopsis plants. The number of lateral roots of transgenic plants was increased compared with wild-type plants after IAA (10−10 or 10−7m) treatment. B and C, All plates were allowed to grow for 10 d to determine the effect of various concentrations of auxin on root length and lateral root production after vernalization. Results are presented as average values ± se from three experiments. More than 12 roots were used in each experiment. Asterisk (*), Significant difference, P < 0.01. ). Transgenic plants of Arabidopsis treated with 10−10m IAA showed stimulated lateral root formation as compared with wild-type plants, which showed no lateral root formation (Fig. 5, B and C). The data suggest that sensitivity to auxin was increased in transgenic Arabidopsis compared with the wild type. Transgenic Lines Increased the Proportion of the G2 Phase in the Cell Cycle in Yeast and Rice Fluorescence-activated cell sorter (FACS) was used to determine whether the DNA had replicated in the arrest cells of yeast by measuring rather than sorting (Liang et al., 1999). Fission yeast (Schizosaccharomyces pombe) cells transformed with sense or antisense TaRAN1, which has been shown previously to express foreign TaRAN1 or suppress the expression of yeast RAN1 (Wang et al., 2004), were grown overnight at 30°C. The cells were collected after subculture at 0, 3, 6, and 9 h, respectively. Cells were exposed to a fluorescent dye (propidium iodide [PI]) that binds to DNA so that the amount of fluorescence was directly proportional to the amount of DNA in each cell. Then the DNA content was analyzed by flow cytometry. In mammals and yeast, the G1 phase of the cell cycle is the major period of cellular growth (Neufeld and Edgar, 1998; Polymenis and Schmidt, 1999), but in fission yeast the G2 phase is the major period of cellular growth (Forsburg, 2001). Wild-type cells transformed with an empty expression vector displayed the normal distribution of cells in the G2, M, G1, and S phases. At all times, however, the average G2-phase populations were increased significantly (61.9% to 90.5%) in TaRAN1-transformed cells compared with wild-type cells (65.9% to 67.4%; Fig. 6A Figure 6. Open in new tabDownload slide Effect of TaRAN1 transgene on the cell cycle phases of yeast and rice cells. A, Yeast cells transformed with pESPM-TaRAN1 analyzed by FACS at 0, 3, 6, and 9 h after subculture. The number of cells in the G2 phase was calculated as a proportion of the total cell population. Results are mean ± se from different lines analyzed in three independent experiments. B, Examination of the cell cycle phases of the nuclei of primary root cells by fluorescence microscopy in rice. Microtubules are stained green and chromosomes are stained blue with 4,6-diamidino-2-phenylindole. Bar = 4 μm. C, Proportion of cells in the G2 phase in wild-type (WT) and transgenic rice. D, Mitotic index in tips of primary roots of wild-type (WT) and transgenic rice. Results are presented as mean ± se from three experiments (n = 10). Asterisk (*), P < 0.01. Figure 6. Open in new tabDownload slide Effect of TaRAN1 transgene on the cell cycle phases of yeast and rice cells. A, Yeast cells transformed with pESPM-TaRAN1 analyzed by FACS at 0, 3, 6, and 9 h after subculture. The number of cells in the G2 phase was calculated as a proportion of the total cell population. Results are mean ± se from different lines analyzed in three independent experiments. B, Examination of the cell cycle phases of the nuclei of primary root cells by fluorescence microscopy in rice. Microtubules are stained green and chromosomes are stained blue with 4,6-diamidino-2-phenylindole. Bar = 4 μm. C, Proportion of cells in the G2 phase in wild-type (WT) and transgenic rice. D, Mitotic index in tips of primary roots of wild-type (WT) and transgenic rice. Results are presented as mean ± se from three experiments (n = 10). Asterisk (*), P < 0.01. ). TaRAN1-transformed cells were long or round large cells with duplicated DNA. Many cells showed a lag in their G2 phase, which is consistent with the abnormal chromosome segregation observed previously (Wang et al., 2004). No changes in the proportion of another phase were observed. These results suggest that the TaRAN1 transgenic cells are defective in the G2-to-mitosis transition. We examined the distribution of nuclei in transgenic rice root tips using fluorescence microscopy. At some points in the G2 phase, the cortical microtubules rearranged to form a band that encircles the cell, just below the plasma membrane (Fig. 6B). This preprophase band (PPB) of microtubules can be a marker of the G2 phase of the cell (Hoshino et al., 2003). A total of 4.8% of transgenic cells were in preprophase as compared with 1.3% of the wild type. Immunofluorescence observations of rice root-tip cells also showed an increased PPB of microtubules in the G2 phase. A striking increase of 3.6% in the proportion of G2 nuclei was observed in transgenic plants as compared with the wild type (Fig. 6C). These results suggest that the G2 phase of the transgenic root cells was delayed and the number of root cells in the G2 phase was increased. These results are consistent with the effects of the TaRAN1 protein seen in the yeast cell cycle (Wang et al., 2004) and suggest that TaRAN1 had a primary effect of increasing the tendency of cells to exit from the G1 phase, resulting in their accumulation in the G2 phase, and promoting the G2-M transition. The mitotic index in the primary roots of transgenic plants increased greatly as compared with that of wild-type plants (Fig. 6D). The proportion of mitotic cells in the transgenic roots were metaphase, 43%; anaphase, 23%; and telophase, 34%; whereas those in wild-type primary roots had a more even phase distribution (metaphase, 37%; anaphase, 25%; and telophase, 37%). The number of mitotic cells at the metaphase of transgenic plants was increased slightly. Indeed, the effect of TaRAN1 expression on cell phase distribution in the root tip suggested that TaRAN1 possibly plays a primary role in cell cycle progression. DISCUSSION Overexpression of TaRAN1 in Arabidopsis Increases Primordial Meristem Number In the past years, three roles of Ran have been identified in animals: RNA and protein nuclear transportation (Görlich and Kutay, 1999), nuclear envelope reconstitution at the mitosis-to-interphase transition (Zhang and Clarke, 2000; Hetzer et al., 2002), and aster and spindle formation in mitosis (Zhang and Clarke, 2000). The RanGTP/RanGDP gradient controls the trafficking of molecules exceeding the diffusion limit of the nuclear pore across the envelope in animal cells. Molecular genetic evidence suggests cross talk between the organization of actin cytoskeleton and Ran-mediated nuclear transport in Drosphila (Minakhina et al., 2005). In Xenopus egg extracts, RanGTP induces aster and spindle assembly even in the absence of centrosome and DNA (Carazo-Salas et al., 1999; Kalab et al., 1999; Wilde and Zheng, 1999; Zhang and Clarke, 2000). Overexpression of plant Ran cDNA suppresses the phenotype of the pim46-1 cell cycle mutant in yeast. RanBPs interacted with the GTP-bound forms of the Ran1, Ran2, and Ran3 proteins of Arabidopsis. Both the AtRan and the AtRanBP genes are expressed coordinately and predominantly in meristematic tissues (Haizel et al., 1997). Overexpression of TaRAN1 causes increased primordial number, reduced apical dominancy and delayed flowering in Arabidopsis (Fig. 2), and increased tiller number in rice (Table I). This evidence supports a hypothesis that Ran protein may be involved in the regulation of shoot apical meristem and apical dominancy in plants. Functional Analysis of TaRAN1 Reveals a Role in the Cell Cycle Regulation of Meristematic Root Cells The cell cycle consists of alternating phases of DNA replication (S phase) and mitosis (M phase) that result in the formation of two daughter cells. These phases are usually separated by gaps: G1 and G2, which represent the interval between the M and S phases and between the S and M phases, respectively. To ensure that each daughter cell receives the correct hereditary material, controls must operate during the G1-S and G2-M transitions. Cyclin-dependent kinases (CDKs) play a central role in mediating cell cycle progression (Potuschak and Doerner, 2001; Inzé, 2005). In higher eukaryotes, the CDKs have evolved into gene families whose individual members have specialized functions during cell cycle progression. In contrast to animals, plants have two different classes of CDKs (A-type and B-type CDKs) that both seem to be involved in mitotic entry and progression. A-type CDKs are involved in both the G1-S and G2-M transitions (Hemerly et al., 1995). Expressing a dominant-negative mutant version of B-type CDK kinase protein in transgenic tobacco (Nicotiana tabacum) plants delays the G2-M transition (Mironov et al., 1999). Microinjection of affinity-purified active mitotic CDK complexes into stamen hair cells significantly accelerated chromosome condensation and the progression of prophase, and produced a rapid destabilization of the PPB in plant cells (Huch et al., 1996). Furthermore, a member of the A-type CDK class and a B1-type cyclin have been reported to bind to chromosomes (Mews et al., 1997; Stals et al., 1997). During interphase, the B1-type cyclins are found predominantly in the cytoplasm. During G2-M, these cyclins move to the nucleus, where they accumulate on nuclear material. Interestingly, these cyclins also accumulate around the nuclear envelope, which suggests that they may be involved in the breakdown of the nuclear envelope (Mews et al., 1997). Subcellular localization of active TaRAN1 protein is nuclear predominant (Wang et al., 2004). The overexpression of TaRAN1 in transgenic plants may result in a disturbed rate of delivery of proteins required for mitotic cell cycle progression to the nucleus and abnormal cell cycle completion. So we hypothesized that plant Ran protein may be involved in the transportation of these key proteins involved in the mitotic cell cycle across the nuclear envelope and regulate the cell cycle events and nuclear envelope assembly. Revealing both conserved and plant-specific peculiarities in comparison with the mammalian system, the players and functions of the core machinery of the plant cell cycle are beginning to be clarified. Detailed knowledge of particular processes during cell cycle progression, however, is still missing, and many questions still remain to be answered (Rossi and Varotto, 2002). In mammals and yeast, the G1 phase of the cell cycle is the major period of cellular growth, and commitment to division during the G1 phase generally is subject to cell size control (Neufeld and Edgar, 1998; Polymenis and Schmidt, 1999). Plant meristematic cells do not undergo cell expansion and are relatively uniform in size. The meristematic cells of the primary root tip were reduced in average cell size in our TaRAN1-overexpressed plants. We speculate that TaRAN1 may promote precocious G1 exit and increase the number of G2-phase cells. So, cells in the root-tip meristem of TaRAN1-overexpressed plants are smaller than those in the wild type. Thus, TaRAN1 expression overrides the normal size control for cell division and results in a shift in the cell cycle distribution of meristem cells in the G1-to-G2 phase. For increased mitotic index in TaRAN1-overexpressed plants, the total number of the meristematic cells was also increased. TaRAN1 Is Involved in Auxin Signal Transduction, and Overexpressed TaRAN1 Renders Arabidopsis Hypersensitive to Auxin Heterotrimeric G proteins and Ras-related small GTPases in animals and yeast are prominent signaling molecules that mediate a wide variety of external stimuli to intracellular signaling pathways (Bourne et al., 1991; Bar-Sagi and Hall, 2000; Hur and Kim, 2002). Previous biochemical studies have suggested the involvement of GTP-binding proteins in the transduction of the auxin signal in rice coleoptiles (Zaina et al., 1990) and wheat mesophyll protoplasts (Bossen et al., 1991). Recent genetic analysis of a heterotrimeric G-protein mutants in Arabidopsis has suggested a role for this protein in modulating several hormonal signals, including auxin (Ullah et al., 2001; Wang et al., 2001; Assmann, 2002). Ran GTPases are emerging as important molecular switches that regulate the signaling of diverse cellular processes in plants. The results presented here show that Ran GTPases, in particular the wheat TaRAN1, play a pivotal role in auxin signaling. These results are consistent in part with previous findings that antisense expression of AtRanBP1c renders transgenic roots hypersensitive to auxin (Kim et al., 2001), which provides compelling evidence that these small GTPases play important roles in auxin-modulated signaling transduction. In higher plants, where organogenesis occurs continuously, most cells maintain their ability to reenter and regulate the cell cycle in response to molecular signals. The mitotic cyclins comprise the A- and B-type cyclins involved in the regulation of the cell cycle from the S-to-M phases. The cycA2;2, a gene of alfalfa A2-type cyclin, is regulated by auxin and is involved in meristem formation. In the case of cycA2;2, auxin affects the spatial expression pattern of this cyclin by shifting the cycA2;2 expression from the phloem to the xylem poles where lateral roots initiate (Roudier et al., 2003). The G1-to-S checkpoint was also suggested to be a target for auxin-mediated lateral root initiation. In addition, a CDK-inhibitory protein (KRP2) was shown to be regulated transcriptionally by auxin and to prevent lateral root initiation by blocking the G1-to-S transition (Himanen et al., 2002). Exogenous IAA (10−9m) typically promotes the growth of lateral roots in wild-type Arabidopsis (Knee and Hangarter, 1996). If the concentration of exogenous IAA is lower than 10−9m, the growth of lateral roots will not be promoted. In contrast, this response is induced at 10−10m IAA in TaRAN1 transgenic plants. The roots of transgenic plants are hypersensitive to IAA on lateral root initiation. RanBP transgenic Arabidopsis is hypersensitive to auxin and arrests mitotic progress at the metaphase (Kim et al., 2001; Rose and Meier, 2001). Roots in transgenic plants accumulate higher levels of endogenous IAA (data not shown) and thus may require less exogenous IAA to respond (Kim et al., 2001). So, transgenic roots were hypersensitive to auxin. In both the suppression and induction of auxin responses, suppressors of auxin action must be delivered to the nucleus to block the expression of auxin-induced genes (Ulmasov et al., 1999). Overexpression of TaRAN1 protein might result in an abnormal or reduced rate of delivery of these key modulated proteins to the nucleus; in other words, they might cause diverse changes similar to the observed effects of TaRAN1 on regulation of cell cycle, gene expression, growth, and development and might provide an alternative explanation that the hypersensitivity to auxin is caused by abnormal distribution of auxin suppressors. The evidence that RanBP is predominantly expressed in meristerms and transgenic Arabidopsis (Kim et al., 2001; Rose and Meier, 2001) and that RAN1-overexpressed transgenic plants are hypersensitive to auxin supports a hypothesis that Ran is regulated by auxin and is involved in auxin-mediated modulation of the meristem. The relation between Ran and cyclins is worthy of investigation for understanding the molecular mechanism of the cell cycle in the meristem. Ran GTPases in animals and yeast relay multiple signals to elicit multiple downstream responses (Dasso, 2001). Plant Ran and RanBP/RanGAP are known to be predominantly expressed in meristems and involved broadly in various cellular and developmental processes (Kim et al., 2001; Rose and Meier, 2001). Ran protein may participate in multiple signaling pathways. Our overexpression of RAN1 causes greatly increased primordial meristems, tillering, and number of cells in the meristem zone of roots, which is a novel function in the Ran family. Overexpressed Ran transgenic lines increased the proportion of cells in the G2 phase. We propose that TaRAN1, like several other RanBP/RanGAPs, also signals cellular activities that regulate cell division and auxin responses (Kim et al., 2001; Rose and Meier, 2001) and suggest that TaRAN1 is involved in auxin signaling pathways. Further work will be needed to reveal the participation of these signaling molecules as a class or as individual GTPases, such as RAN1, in mediating stimuli during plant growth and development. MATERIALS AND METHODS Plant Material Overexpression of TaRAN1 was in Arabidopsis (Arabidopsis thaliana ecotype C24) and rice (Oryza sativa L. cv Zhonghua 10). Generation of TaRAN1-Overexpressing Transgenic Plants Transgenic Arabidopsis Plants TaRAN1 was amplified for construction of the overexpressed vector with oligonucleotide 5′-GCTCTAGAATGGCGCTGCCGA-3′ and 5′-CGAGCTCCTCGATCAGATCG-3′ as primers. The PCR fragment was cloned into the pBI121 vector. The RAN1 gene was driven by the CaMV 35S promoter. This construct was verified by sequencing and electroporated into the Agrobacterium tumefaciens GV3101 and used for Arabidopsis transformation as described (Clough and Bent, 1998). For plant transformation, Arabidopsis plants were grown in a greenhouse under long-day conditions (16-h light/8-h dark) for 4 weeks before a floral-dip procedure (Clough and Bent, 1998). Briefly, Agrobacterium cells were grown in Luria-Bertani broth for 24 h at 30°C. The cells were collected by centrifugation and resuspended in infiltration medium (one-half-strength Murashige Skoog medium, 5% Suc, 1× Gamborg's vitamins, 0.044 μm benzylaminopurine, and 0.04% Silwet L77) to an OD600 of 1.5 to 2.0. Plants were dipped into this suspension for 10 min and transferred to a greenhouse. Seeds from plants treated by Agrobacterium were harvested and screened on selection medium (one-half-strength Murashige and Skoog medium, 1× Gamborg's vitamins, and 50 μg/mL kanamycin) for transformants. The putative transformants (defined as T1) were rescued from plates and grown in a greenhouse under long-day conditions (16-h light/8-h dark). The T3 generation was used for further experiments. Transgenic Rice Plants The digestion product TaRAN1 from pTripEX2-TaRAN1 was directionally cloned into the KpnI-SacI sites of a UN1301 vector to create UN1301-TaRAN1, which carried a gene of GUS as a marker. The coding sequence of TaRAN1 in the construct was verified by sequencing. The UN1301-TaRAN1 was used to transform the A. tumefaciens EHA105. Rice embryonic calli were induced on scutella from germinated seeds and transformed with A. tumefaciens EHA105 containing the desired binary vector, as described (Ge et al., 2004; Xu et al., 2005). Transgenic plants were selected in one-half-strength Murashige and Skoog medium containing 75 mg/L hygromycin (Sigma). Hygromycin-resistant plants from calli, defined as transgenic plants of the T0 generation, were transplanted into soil and grown in a greenhouse at 28°C. For analysis of root phenotypes of transgenic plants, seeds of the T1 generation were germinated in one-half-strength Murashige and Skoog medium containing 75 mg/L hygromycin and confirmed by GUS staining. RNA Gel Blots and RT-PCR for Gene Expression Analysis Winter wheat (T. aestivum L. cv Jingdong No. 1) seeds were sown on culture plates after being surface sterilized in 2% (v/v) NaOCl for 0.5 h. The plumules excised from seeds were collected and stored in liquid N2 for isolation of total RNA. Total RNA of rice and Arabidopsis leaves was isolated by use of the Qiagen RNeasy plant mini kit (Qiagen). Total RNA of 15 μg was loaded on each lane for electrophoresis. RNA transfer and cross-linking onto a nylon membrane (Hybrid N+; Amersham) was as described (Sambrook et al., 1989; Ge et al., 2000). The probe of TaRAN1 cDNA was labeled with [32P]dCTP (China Isotope). After hybridization for 20 h at 68°C, the membrane was washed once with 2× SSC plus 0.1% SDS at 68°C for 20 min, then washed with 1× SSC plus 0.1% SDS at 37°C for 30 min. The membrane was exposed to x-ray film (Eastman-Kodak) at −70°C for 3 to 7 d. RT-PCR was performed according to the manual of the RT-PCR kit (TaKaRa). The conserved region of Ran family primers was 5′-GAGAACATCCCCATTGTCC-3′ and 5′-CAAACAGTTTGCAGCCCACCA-3′. To ensure TaRAN1 gene-specific amplification, PCR primers were designed according to the sequence of no conservative untranslated regions of the 3′ terminus. TaRAN1 primers were 5′-TGCCAAGAGCAACTACAA-3′ and 5′-ATGATCCACATATTGAGCC-3′. Tubulin primers were 5′-TCAGATGCCCAGTGACAGGA-3′ and 5′-TTGGTGATCTCGGCAACAGA-3′ from the tubulin gene sequence. RT-PCR reactions were repeated five times. Electron Microscopy of Shoot Apex Cells Shoot apexes were immediately fixed in formaldehyde acetic acid solution (3.7% formaldehyde, 50% ethanol, and 5% acetic acid) for 12 h and dehydrated in a graded ethanol series. The dehydrated materials were critical-point dried in liquid CO2 and mounted on metallic stubs. The mounted material was shadowed with gold before scanning electron microscopy (Hitachi S-800). Imaging of Root Cell Size To examine cell arrangement and size, root tips were stained with 100 μg/mL PI solution and observed under a confocal laser scanning microscope (Zeiss) with an argon laser. Flow Cytometric Analysis The fission yeast (Schizosaccharomyces pombe) Leu− strain SPQ-01 was used. Expression vectors with the sense and the antisense TaRAN1 were constructed in pESPM. The transcriptional expression and phenotype analysis of TaRAN1 in fission yeast was as described (Wang et al., 2004). Transgenic sense and antisense TaRAN1 cells were grown overnight in minimal medium containing thiamine at 30°C. The cells were washed three times with the minimal medium without thiamine to derepress the NMT1 promoter and then diluted to 2 × 106 cells/mL in Edinburgh minimal medium. The cells were incubated at 30°C and samples were taken at 0, 3, 6, and 9 h. The DNA content of individual transgenic cells was determined by flow cytometry. Cells were prepared for the FACS by staining with PI (Sazer and Sherwood, 1990). Briefly, cells were fixed in ethanol overnight at 4°C, washed, and resuspended in 0.5 mL of 50 mm sodium citrate, pH 7.0, containing 0.1 mg/mL RNase A for 2 h at 37°C followed by incubation in 4 μg/mL PI (final concentration). Each sample was analyzed with use of a FACS caliber cytometer (B-D Corporation). Immunolabeling of Root Cells Excised 1- to 2-mm-long root tips were fixed for 1 h in PEM buffer (50 mm PIPES, pH 6.9, 5 mm MgSO4, 5 mm EGTA) containing 4% formaldehyde, then washed in PEM (3 × 10 min). Cell walls were digested (50 min, 28°C) with 1% (w/v) cellulase “Onozuka” R-10 and 0.1% pectolyase Y23 (Yakult) in PEM. Root tips were washed in PEM (3 × 10 min), and then squashed with use of a pencil eraser between two multiwell slides (ICN) coated with 0.1% polyethyleneimine (Sigma). Cells were treated at −20°C (5 min), dried at room temperature for 2 min, then extracted with 1% Triton X-100 at room temperature for 30 min. Cells were washed in phosphate-buffered saline (PBS; 131 mm NaCl, 5.1 mm Na2HPO4, 1.56 mm KH2PO4, pH 7.2) for 10 min three times before being blocked in incubation buffer (PBS containing 1% bovine serum albumin, 20 min). Incubations of primary and secondary antibodies, diluted in incubation buffer, were for either 1 h at 20°C or overnight at 4°C, with antibodies in multiple labeling experiments applied concurrently. Washes with PBS (3 × 10 min) were run after each antibody incubation. Cells were stained with 0.1 μg/mL 4,6-diamidino-2-phenylindole (Sigma) in PBS (5 min), rinsed briefly in PBS, and mounted with 1,4-diazabicyclo[2,2,2]octane (triethylenediamine; Sigma). Coverslips were sealed with nail polish. Slides were viewed under a Zeiss epifluorescence microscope. For each root tip, all mitotic figures and total numbers of cells in the meristematic zone were counted. Mitotic indices were calculated with use of the following formula: number of cells in mitosis/total number of cells. Analyses of Auxin Effects Seeds were surface sterilized in 70% ethanol for 1 min, then in 50% (v/v) NaClO solution for 8 min, and rinsed in sterile water. Seeds were then placed on plates and vernalized for 72 h to synchronize germination. After vernalization, all plates were placed in the same growth chamber and allowed to grow for 10 d to determine the effect of various concentrations of auxin (IAA) on root length and lateral root production (Kim et al., 2001). Sequence data from this article can be found in the GenBank/EMBL data libraries under accession number AF488730. ACKNOWLEDGMENTS We thank Yuan Cheng for assisting with microscope techniques and Huili Liu for assistance with the constructs. LITERATURE CITED Ach RA, Gruissem W ( 1994 ) A small nuclear GTP-binding protein from tomato suppresses a Schizosaccharomyces pombe cell-cycle mutant. Proc Natl Acad Sci USA 91 : 5863 –5867 Assmann SM ( 2002 ) Heterotrimeric and unconventional GTP binding proteins in plant cell signaling. Plant Cell (Suppl) 14 : S355 –S373 Bar-Sagi D, Hall A ( 2000 ) Ras and Rho GTPases: a family reunion. Cell 103 : 227 –235 Berleth T, Mattsson J, Hardtke CS ( 2000 ) Vascular continuity and auxin signals. Trends Plant Sci 5 : 387 –393 Bossen M, Tretyn A, Kendrick RE, Vredenberg WJ ( 1991 ) Comparison between swelling of etiolated wheat (Triticum aestivum L.) protoplasts induced by phytochrome and α-naphthal-leneacetic acid, benzylaminopurine, gibberellic acid, abscisic acid and acetylcholine. J Plant Physiol 137 : 706 –710 Bourne HR, Sanders DA, McCormick F ( 1991 ) The GTPase superfamily: conserved structure and molecular mechanisms. Nature 349 : 117 –127 Carazo-Salas RE, Guarguaglini G, Gruss OJ, Segref A, Karsenti E, Mattaj IW ( 1999 ) Generation of GTP-bound Ran by RCC1 is required for chromatin-induced mitotic spindle formation. Nature 400 : 178 –181 Chong K, Bao S, Xu T, Liang T, Huang H, Zeng J, Xu J, Xu Z ( 1998 ) Functional analysis of ver gene using antisense transgenic wheat plant. Physiol Plant 102 : 87 –92 Clough SJ, Bent AF ( 1998 ) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16 : 735 –743 Criqui MC, Genschik P ( 2002 ) Mitosis in plants: how far we have come at the molecular level? Curr Opin Plant Biol 5 : 487 –493 Dasso M ( 2001 ) Running on Ran: nuclear transport and the mitotic spindle. Cell 104 : 321 –324 Forsburg SL ( 2001 ) Fission yeast. In SL Forsburg, ed, 2002 Yearbook of Science and Technology. McGraw-Hill, New York, pp 108–110 Ge L, Chen H, Jiang J, Zhao Y, Xu M, Xu Y, Tan K, Xu Z, Chong K ( 2004 ) Overexpression of OsRAA1 causes pleiotropic phenotypes in transgenic rice plants, including altered leaf, flower, and root development and root response to gravity. Plant Physiol 135 : 1502 –1513 Ge L, Liu JZ, Wong WS, Hsiao WLW, Chong K, Xu ZK, Yang SF, Kung SD, Li N ( 2000 ) Identification of a novel multiple environmental factor-responsive 1-aminocyclopropane-1-carboxylate synthase gene, NT-ACS2, from tobacco. Plant Cell Environ 23 : 1169 –1182 Görlich D, Kutay U ( 1999 ) Transport between the cell nucleus and the cytoplasm. Annu Rev Cell Dev Biol 15 : 607 –660 Haizel T, Merkle T, Pay A, Fejes E, Nagy F ( 1997 ) Characterization of proteins that interact with the GTP-bound form of the regulatory GTPase Ran in Arabidopsis. Plant J 11 : 93 –103 Hemerly A, Engler Jde A, Bergounioux C, Van Montagu M, Engler G, Inze D, Ferreira P ( 1995 ) Dominant negative mutants of the Cdc2 kinase uncouple cell division from iterative plant development. EMBO J 14 : 3925 –3936 Hetzer M, Gruss OJ, Mattaj IW ( 2002 ) The Ran GTPase as a marker of chromosome position in spindle formation and nuclear envelope assembly. Nat Cell Biol 4 : E177 –E184 Himanen K, Boucheron E, Vanneste S, de Almeida Engler J, Inze D, Beeckman T ( 2002 ) Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14 : 2339 –2351 Hoshino H, Yoneda A, Kumagai F, Hasezawa S ( 2003 ) Roles of actin-depleted zone and preprophase band in determining the division site of higher-plant cells, a tobacco BY-2 cell line expressing GFP-tubulin. Protoplasma 222 : 157 –165 Huch J, Wu L, John PCL, Hepler LH, Hepler PK ( 1996 ) Plant mitosis promoting factor disassembles the microtubule preprophase band and accelerates prophase progression in Tradescantia. Cell Biol Int 20 : 275 –287 Hur EM, Kim KT ( 2002 ) G protein-coupled receptor signaling and cross-talk: achieving rapidity and specificity. Cell Signal 14 : 397 –405 Inzé D ( 2005 ) Green light for the cell cycle. EMBO J 24 : 657 –662 Kalab P, Pu RT, Dasso M ( 1999 ) The ran GTPase regulates mitotic spindle assembly. Curr Biol 9 : 481 –484 Kim SH, Arnold D, Lloyd A, Roux SJ ( 2001 ) Antisense expression of an Arabidopsis Ran binding protein renders transgenic roots hypersensitive to auxin and alters auxin-induced root growth and development by arresting mitotic progress. Plant Cell 13 : 2619 –2630 Knee EM, Hangarter RP ( 1996 ) Differential IAA dose response of the axr1 and axr2 mutants of Arabidopsis. Physiol Plant 98 : 320 –324 Liang DT, Hodson JA, Forsburg SL ( 1999 ) Reduced dosage of a single fission yeast MCM protein causes genetic instability and S phase delay. J Cell Sci 112 : 559 –567 Mews M, Sek FJ, Moore R, Volkmann D, Gunning BES, John PCL ( 1997 ) Mitotic cyclin distribution during maize cell division: implications for the sequence diversity and function of cyclins in plants. Protoplasma 200 : 128 –145 Minakhina S, Myers R, Druzhinina M, Steward R ( 2005 ) Crosstalk between the actin cytoskeleton and Ran-mediated nuclear transport. BMC Cell Biol 6 : 32 Mironov V, De Veylder L, Van Montagu M, Inze D ( 1999 ) Cyclin-dependent kinases and cell division in plants—the nexus. Plant Cell 11 : 509 –522 Nasmyth K ( 1996 ) At the heart of the budding yeast cell cycle. Trends Genet 12 : 405 –412 Neufeld P, Edgar BA ( 1998 ) Connections between growth and the cell cycle. Curr Opin Cell Biol 10 : 784 –790 Novak B, Csikasz-Nagy A, Gyorffy B, Nasmyth K, Tyson J ( 1998 ) Model scenarios for evolution of the eukaryotic cell cycle. Philos Trans R Soc Lond B Biol Sci 353 : 2063 –2076 Polymenis M, Schmidt EV ( 1999 ) Coordination of cell growth with cell division. Curr Opin Genet Dev 9 : 76 –80 Potuschak T, Doerner P ( 2001 ) Cell cycle controls: genome-wide analysis in Arabidopsis. Curr Opin Plant Biol 4 : 501 –506 Rogg LE, Bartel B ( 2001 ) Auxin signaling: derepression through regulated proteolysis. Dev Cell 1 : 595 –604 Rose A, Meier I ( 2001 ) A domain unique to plant RanGAP is responsible for its targeting to the plant nuclear rim. Proc Natl Acad Sci USA 98 : 15377 –15382 Rossi V, Varotto S ( 2002 ) Insights into the G1/S transition in plants. Planta 215 : 345 –356 Roudier F, Fedorova E, Lebris M, Lecomte P, Gyorgyey J, Vaubert D, Horvath G, Abad P, Kondorosi A, Kondorosi E ( 2003 ) The Medicago species A2-type cyclin is auxin regulated and involved in meristem formation but dispensable for endoreduplication-associated developmental programs. Plant Physiol 131 : 1091 –1103 Sambrook J, Fritsch EF, Maniatis T ( 1989 ) Molecular Cloning: A Laboratory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Sazer S, Dasso M ( 2000 ) The ran decathlon: multiple roles of Ran. J Cell Sci 113 : 1111 –1118 Sazer S, Sherwood SW ( 1990 ) Mitochondrial growth and DNA synthesis occur in the absence of nuclear DNA replication in fission yeast. J Cell Sci 97 : 509 –516 Stals H, Bauwens S, Traas J, Van Montagu M, Engler G, Inze D ( 1997 ) Plant CDC2 is not only targeted to the pre-prophase band, but also co-localizes with the spindle, phragmoplast, and chromosomes. FEBS Lett 418 : 229 –234 Ullah H, Chen JG, Young JC, Im K-H, Sussman MR, Jones AM ( 2001 ) Modulation of cell proliferation by heterotrimeric G protein in Arabidopsis. Science 292 : 2066 –2069 Ulmasov T, Hagen G, Guilfoyle TJ ( 1999 ) Activation and repression of transcription by auxin-response factors. Proc Natl Acad Sci USA 96 : 5844 –5849 Vasil IK, Vasil V ( 1999 ) Transgenic cereals: Triticum aestivum (wheat). In IK Vasil, ed, Molecular Improvement of Cereal Crops. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 137–147 Wang X, Xu W, Xu Y, Chong K, Xu Z, Xia G ( 2004 ) Wheat RAN1, a nuclear small G protein, is involved in regulation of cell division in yeast. Plant Sci 167 : 1183 –1190 Wang X-Q, Ullah H, Jones AM, Assmann SM ( 2001 ) G protein regulation of ion channels and abscisic acid signaling in Arabidopsis guard cells. Science 292 : 2070 –2072 Wilde A, Zheng Y ( 1999 ) Stimulation of microtubule aster formation and spindle assembly by the small GTPase Ran. Science 284 : 1359 –1362 Xia G, Ramachandran S, Hong Y, Chan YS, Simanis V, Chua NH ( 1996 ) Identification of plant cytoskeletal, cell cycle-related and polarity-related proteins using Schizosaccharomyces pombe. Plant J 10 : 761 –769 Xu ML, Jiang JF, Ge L, Xu YY, Chen H, Zhao Y, Bi YR, Wen JQ, Chong K ( 2005 ) FPF1 transgene leads to altered flowering time and root development in rice. Plant Cell Rep 24 : 79 –85 Yang Z ( 2002 ) Small GTPases: versatile signaling switches in plants. Plant Cell (Suppl) 14 : S375 –S388 Zaina S, Reggiani R, Bertani A ( 1990 ) Preliminary evidence for involvement of GTP-binding protein(s) in auxin signal transduction in rice (Oryza sativa L.) coleoptile. J Plant Physiol 136 : 653 –658 Zhang C, Clarke PR ( 2000 ) Chromatin-independent nuclear envelope assembly induced by Ran GTPase in Xenopus egg extracts. Science 288 : 1429 –1432 Author notes 1 This work was supported by the Major State Basic Research Program of the People's Republic of China (2005CB120806), the National Natural Science Foundation of China (30470157 and 30470167), and the Innovation Grant of the Chinese Academy of Sciences. * Corresponding author; e-mail [email protected]; fax 86–10–82594821. The author responsible for distribution of materials integral to the findings presented in this article in accordance with the policy described in the Instructions for Authors (www.plantphysiol.org) is: Kang Chong ([email protected]). Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.105.071670. © 2006 American Society of Plant Biologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)