Plant Physiology

Saier, Milton H.

doi: 10.1104/pp.117.4.1129pmid: 9701568

During the past 3 years, we have experienced a major revolution in the biological sciences resulting from a tremendous flux of information generated by genome-sequencing efforts. Our understanding of microorganisms, the metabolic processes they catalyze, the genetic apparatuses encoding cellular proteinaceous constituents, and the pathological conditions caused by these organisms has greatly benefited from the availability of complete microbial genomic sequences. Many research institutes around the world are now devoting their efforts solely to genome sequencing and to analysis of the data produced. Dozens of international conferences have been held with the primary purpose of keeping the scientific community abreast of recent developments. In this Update I will summarize some of the exciting information reported at a recent conference on microbial genomics.1 Compared with microbe genomics, plant genomics is still in its infancy, since the sequencing of only the Arabidopsis genome is currently under way (Bevan et al., 1998). However, within a few years we can expect that the genomic sequences of at least two plants, Arabidopsis and rice (Oryza sativa), will be available. Meanwhile, as of January 1998, 12 microbial genomes have already been sequenced and published. These include genomes of representative organisms from the three domains of life: bacteria, archaea, and eukarya. The genomes of one eukaryote (the brewers' yeast Saccharomyces cerevisiae) as well as three archaea and eight bacteria have been completely sequenced. By examining what has been learned from sequencing of microbial genomes, we can get some idea about what kinds of information we can expect from plant genome-sequencing efforts. MICROBIAL GENOME SEQUENCING Most of the bacterial genomes that have been sequenced are small, of 2 Mbp or less. However, three large bacterial genomes have been sequenced: those of the prototypic gram-negative bacteriumEscherichia coli (Blattner et al., 1997); the best-characterized gram-positive bacterium, Bacillus subtilis (Kunst et al., 1997); and a representative cyanobacterium, Synechocystis PCC6803 (Kaneko et al., 1996). In addition, six microbial genomes have been completely sequenced but not yet published. Pathogens with fully sequenced genomes includeMycobacterium tuberculosis, the causative agent of tuberculosis; Treponema pallidum, the spirochete that causes syphilis; and Borrelia burgdorferi, another spirochete that causes Lyme disease. Two interesting nonpathogens that have recently been sequenced are Deinococcus radiodurans, the organism reported to be most resistant to UV irradiation, and Aquifex aeolicus, a marine hyperthermophile capable of growth at 95°C. Based on 16S RNA analyses, A. aeolicus may represent the deepest lineage within the bacterial domain, and its genome may therefore provide clues about primitive prokaryotic life- forms that existed billions of years ago. More than 50 microbial genomes are currently being sequenced. These include the genomes of virtually every major pathogen. Industrially important bacteria such as Clostridium acetobutylicum, a principal producer of organic solvents, are also being sequenced, as is the deep-sea manganese-oxidizing bacterium Shewanella putrefaciens. The sequence of the first animal genome, that of the worm Caenorhabdeitis elegans, is expected to be completed in the middle of this year (July, 1998). Although only 3% of the human genome has been sequenced, this tiny fraction of the human genome represents more DNA than that of all of the completed microbial genomes sequenced to date. Table I summarizes some of the most impressive genome-sequencing efforts completed by the end of 1997. The first organism to have its genome sequenced was Haemophilus influenzae (Fleischmann et al., 1995). It has a genome size of 1.8 Mbp encoding 1743 recognized genes. One laboratory at the Institute for Genomic Research, involving about 40 people, completed the project in 1 year. B. subtilis, with a genome of 4.2 Mbp, was sequenced by an international consortium of 46 laboratories involving about 160 people in 5 years (Kunst et al., 1997). Table I. Representative genome-sequencing efforts Organism . Genome Size . Genes . Laboratories . People . Years . Mbp H. influenzae 1.8 1743 1 40 1 B. subtilis 4.2 4100 46 160 5 S. cerevisiae 12 5900 96 640 6 E. coli 4.6 4300 1 17 10 Organism . Genome Size . Genes . Laboratories . People . Years . Mbp H. influenzae 1.8 1743 1 40 1 B. subtilis 4.2 4100 46 160 5 S. cerevisiae 12 5900 96 640 6 E. coli 4.6 4300 1 17 10 Open in new tab Table I. Representative genome-sequencing efforts Organism . Genome Size . Genes . Laboratories . People . Years . Mbp H. influenzae 1.8 1743 1 40 1 B. subtilis 4.2 4100 46 160 5 S. cerevisiae 12 5900 96 640 6 E. coli 4.6 4300 1 17 10 Organism . Genome Size . Genes . Laboratories . People . Years . Mbp H. influenzae 1.8 1743 1 40 1 B. subtilis 4.2 4100 46 160 5 S. cerevisiae 12 5900 96 640 6 E. coli 4.6 4300 1 17 10 Open in new tab S. cerevisiae possesses about 13 Mbp of DNA, and 12 Mbp of this DNA has been fully sequenced. The remaining 1 Mbp consists of repetitive rDNA (encoding rRNA molecules) representing more than 100 repeats. This repetitive DNA was not sequenced as part of the yeast-sequencing effort partly for technical reasons, and partly because it was expected to yield little new information. Ninety-six laboratories and 640 people completed this project in 6 years (Goffeau et al., 1997). The prototypical bacterium E. coli (4.6 Mbp) was sequenced by a single laboratory in an effort involving 17 people, but the project took about 10 years (Blattner et al., 1997). Because of recent technological advances, it is estimated that a microbial genome of about 2 Mbp can now be fully sequenced in 1 year by a single laboratory of 6 people with an expenditure of less than $1 million. GENOME SEQUENCING LEADS TO THE IDENTIFICATION OF NEW PROTEINS Tremendous benefits have resulted from the microbial genome-sequencing efforts completed to date (TableII). For example, important new proteins have been identified. Owen White at the Institute for Genomic Research reported that D. radiodurans is the first nonphotosynthetic organism to be shown to possess the light-sensing protein phytochrome. In D. radiodurans this molecule may function to regulate the synthesis of pigments that protect the organism from irradiation, and it also has a novel type of RecA protein involved in DNA repair-related recombination. Table II. Benefits of genomics New proteins identified New protein families discovered New pathways revealed Total metabolic capabilities estimated Virulence factors and mechanisms identified Potential drug targets revealed Gene transfer established New proteins identified New protein families discovered New pathways revealed Total metabolic capabilities estimated Virulence factors and mechanisms identified Potential drug targets revealed Gene transfer established Open in new tab Table II. Benefits of genomics New proteins identified New protein families discovered New pathways revealed Total metabolic capabilities estimated Virulence factors and mechanisms identified Potential drug targets revealed Gene transfer established New proteins identified New protein families discovered New pathways revealed Total metabolic capabilities estimated Virulence factors and mechanisms identified Potential drug targets revealed Gene transfer established Open in new tab Richard Roberts of New England Biolabs analyzed various genomes for DNA restriction-modification systems, enzyme systems that protect organisms from the potentially detrimental effects of foreign DNA (such as that of viruses). It was found that although B. subtilis andE. coli possess 3 to 4 such restriction-modification systems, some pathogenic bacteria have far more. Thus, H. influenzae has 7, Neisseria gonorrhoeae has 18, andHelicobacter pylori, which is a causative agent of peptic ulcers, has 23. The physiological significance attributed to the possession of large numbers of such systems in small-genome bacteria is a point of debate. Entirely new families of protein paralogs (families of proteins arising by gene duplication within a single organism) have been revealed by genome sequencing. For example, Claire Fraser, Sherwood Casjens, and Steven Norris reported that the genomes of the two pathogenic spirochetes T. pallidum and B. burgdorferi both exhibit large families of species-specific paralogs of unknown function. The same has been observed for methanogenic (methane-producing) archaea. In the case of B. subtilis, a large family of Bacillus-specific protein paralogs have been identified as “Rap” phosphatases that release phosphate from phosphorylated aspartyl residues in response to regulatory proteins. These regulatory proteins control the initiation of sporulation, a gram-positive bacterial cell-differentiation process that leads to the generation of thick-walled, metabolically inert, environmentally resistant spores (Perego et al., 1994, 1996). DISCOVERY OF NEW METABOLIC PATHWAYS Entirely new metabolic pathways have been revealed by genome sequencing. Tyrrell Conway reported the discovery of a previously unrecognized pathway in E. coli for the metabolism of the sugar acid idonate, a compound that had not been known to be a substrate for the growth of this bacterium (C. Bausch, N. Peekhaus, C. Utz, T. Blais, E. Murray, T. Lowary, and T. Conway, unpublished data). Additionally, analysis of several bacterial genomes showed that many bacteria have all of the requisite enzymes of the ribulose-monophosphate–hexulose-monophosphate pathway, a pathway for the interconversion of five- and six-carbon sugars (Reizer et al., 1997). Such a pathway had been previously demonstrated only in methanogenic bacteria. Finally, Owen White reported evidence thatD. radiodurans has a novel pathway for the efficient repair of double-stranded DNA breaks, a fact that explains the ability of this octaploid organism to repair more than 150 double-stranded DNA breaks in its genome without loss of viability (Battista, 1997). The availability of a complete genomic sequence allows one to estimate the total metabolic capability of an organism. For example, knowledge of the complete gene complement permits estimation of the nutrients that can be taken up by the cell. Such knowledge reflects the natural lifestyle of the organism, and hence, ecological deductions and inferences can be made regarding the use of the bacterium for purposes of bioremediation (Clayton et al., 1997; Paulsen et al., 1998). Based on the complement of genes encoded within microbial genomes, Peter Karp of the Pangea Corporation in Oakland, CA, and his co-workers have created “EcoCyc” for E. coli and “HinCyc” forH. influenzae, which are computerized displays of the complete metabolic pathways of these two closely related organisms (Karp et al., 1996). “EcoCyc,” which is available on the World Wide Web, is now being expanded to include transport and regulatory information as well as metabolic reactions. Results reported at the Microbial Genomics II conference clearly suggested that many obligate prokaryotic human parasites have condensed and streamlined their genomes, with the loss of regulatory functions and biosynthetic capabilities. Moreover, although strict human pathogens such as Mycoplasma genitalium, T. pallidum, and B. burgdorferi have adapted to an anaerobic life style using glycolytic sugar metabolism for their primary source of energy, as reported by Claire Fraser,Chlamydia (a common sexually transmitted disease agent [Peeling and Brunham, 1996]) and Rickettsia (the causative agent of Rocky Mountain spotted fever [Andersson and Andersson, 1997]) have adapted to a strictly aerobic life style. These two bacteria have lost their glycolytic enzymes and satisfy their energy needs by metabolizing organic acids via the Krebs cycle and electron flow, as reported by Richard Stephens and Siv Andersson, respectively (unpublished results). COMPARATIVE GENOMICS YIELDS NEW CLUES ABOUT PATHOGENESIS AND HORIZONTAL GENE TRANSFER Virulence factors and novel mechanisms of pathogenesis have been revealed as a result of the development of the new discipline of comparative genomics. Thus, Fred Blattner, who recently sequenced a pathogenic E. coli strain and compared it with the nonpathogenic E. coli K12 strain commonly used for laboratory research, reported that the former bacterium possesses 1.2 Mbp more DNA than the latter, an approximately 20% increase in genomic size. This additional genetic material codes for virulence factor-bearing prophage, a virulence plasmid, and a “pathogenicity island” that allows the bacteria to secrete toxic proteins directly from the bacterial cytoplasm into that of the host animal cell (seeGroisman and Ochman, 1996). In addition, three new tRNAs, a eukaryotic-type Ser/Thr protein kinase, and a novel iron-transport system, all possibly important for pathogenicity, were revealed. Potential drug targets were identified and studied. Lynn Miesel reported on studies characterizing the targets of the antituberculosis drug isoniazid. This drug appears to inhibit the growth of M. tuberculosis by blocking the function of a biosynthetic enzyme that makes a cell-surface fatty acid called mycolic acid. Isoniazid thereby disrupts the outer protective layer of this fastidious bacterium, rendering it sensitive to host defense mechanisms. Horizontal gene transfer between related gram-negative bacteria could be established using the comparative genomics approach. Pathogenicity islands, encoding virulence factor genes and the apparatus for their transfer to host cells, have now been identified in many bacteria (Groisman and Ochman, 1996). Fred Blattner noted that 30% of the new DNA present in pathogenic E. coli, but lacking in nonpathogenic E. coli, is shared by Yersinia pestis, the causative agent of plague. GENOMICS, PROTEOMICS, AND BIOINFORMATICS Tremendous technological advances are being made in the related fields of genomics, proteomics, and bioinformatics (Tables III-V). In the area of genomics (the study of an organism's gene complement; Table III), novel chips bearing oligonucleotide probes for analysis of the expression of the complete complement of genes encoded within the genome of an organism have already been used and the results published (DeRisi et al., 1997;Wodicka et al., 1997). Such a chip costs about $200 and is good for a single information-rich experiment. However, the machine that reads the chip costs about $150,000. Table III. Technological advances in genomics Chips bearing probes for analysis of complete organismal gene complements Vectors for gene expression Gene knockouts and reporter-gene fusions Novel chips for sequencing Chips bearing probes for analysis of complete organismal gene complements Vectors for gene expression Gene knockouts and reporter-gene fusions Novel chips for sequencing Open in new tab Table III. Technological advances in genomics Chips bearing probes for analysis of complete organismal gene complements Vectors for gene expression Gene knockouts and reporter-gene fusions Novel chips for sequencing Chips bearing probes for analysis of complete organismal gene complements Vectors for gene expression Gene knockouts and reporter-gene fusions Novel chips for sequencing Open in new tab Expression vectors, gene knockouts, and reporter-gene constructs for all of the genes in an organism will soon be available for at least two major experimental organisms, the yeast S. cerevisiae, and the sporulating, gram-positive bacterium B. subtilis. Our laboratory has recently taken advantage of such technology to identify and characterize a protein kinase that controls catabolite repression and carbon metabolism in B. subtilis (Reizer et al., 1998). In earlier studies we had purified the protein and determined an N-terminal amino acid sequence, but the availability of this sequence was insufficient to allow us to clone the gene. When the complete genome of B. subtilis became available, its identification became almost automatic. Thus, when expression vectors, knockouts, and fusion constructs become available commercially, the academic molecular biologist will be largely obsolete. In proteomics (the study of an organism's proteins; TableIV), technological advances are beginning to have an effect on basic research. Tremendous advances have been made in coupling two-dimensional gel analysis of the total protein complement of an organism to analysis by MS or to N-terminal sequence analysis. Chips are being developed for pico-quantity protein purification based on hydrophobic and ion-exchange chromatography as well as adsorption chromatography. Table IV. Technological advances in proteomics Two-dimensional gel analysis coupled to MS Chips for full proteome protein purification Protein-protein interaction studies Protein-ligand interaction studies Two-dimensional gel analysis coupled to MS Chips for full proteome protein purification Protein-protein interaction studies Protein-ligand interaction studies Open in new tab Table IV. Technological advances in proteomics Two-dimensional gel analysis coupled to MS Chips for full proteome protein purification Protein-protein interaction studies Protein-ligand interaction studies Two-dimensional gel analysis coupled to MS Chips for full proteome protein purification Protein-protein interaction studies Protein-ligand interaction studies Open in new tab Rapid procedures for studying protein-protein interactions are being developed. For example, a yeast two-hybrid system has recently been developed for the assay of whole libraries of genes to determine which of the encoded proteins interact with high affinity with a specific test protein (Williams et al., 1998). Additionally, novel chips for studying protein-ligand interactions are being developed. Finally, in the area of bioinformatics (the computational analysis of genetic and biochemical data; Table V), novel software is being developed for more refined homology searches of the databases, for protein and nucleic acid secondary and tertiary structural predictions, and for protein and DNA motif identification. Many of the programs used routinely in academic laboratories for characterizing families of proteins have been or are now being automated. Such advances will be required to keep up with the exponentially increased volume of sequence data that will be available in the near future. Table V. Technological advances in informatics Novel software for  More refined homology searches  Three-dimensional structural predictions  Motif identification  Repetitive sequence analysis Automation for  Data searching  Multiple alignment generation  Phylogenetic-tree construction  Averaging similarity, hydropathy, amphipathicity Novel software for  More refined homology searches  Three-dimensional structural predictions  Motif identification  Repetitive sequence analysis Automation for  Data searching  Multiple alignment generation  Phylogenetic-tree construction  Averaging similarity, hydropathy, amphipathicity Open in new tab Table V. Technological advances in informatics Novel software for  More refined homology searches  Three-dimensional structural predictions  Motif identification  Repetitive sequence analysis Automation for  Data searching  Multiple alignment generation  Phylogenetic-tree construction  Averaging similarity, hydropathy, amphipathicity Novel software for  More refined homology searches  Three-dimensional structural predictions  Motif identification  Repetitive sequence analysis Automation for  Data searching  Multiple alignment generation  Phylogenetic-tree construction  Averaging similarity, hydropathy, amphipathicity Open in new tab Genome-sequence analyses have revealed that most of the proteins encoded within the genome of a living organism belong to families of homologous proteins that share a common evolutionary origin and are present in many dissimilar organisms. Some of these families are very large, with hundreds of currently sequenced members (Pao et al., 1998). Other families are small, with only a few currently sequenced members (Saier, 1998). By constructing dendrograms (which show approximate relationships of the proteins to each other without providing numerical values for the relative phylogenetic distances that separate them), or instead by constructing phylogenetic trees (which not only cluster the proteins according to their relative degrees of sequence similarity, but also provide quantitative measures of their degrees of relatedness), one can estimate the probability that any two members of a protein family will prove to serve the same function. Phylogenetic trees thus indicate relative degrees of sequence similarity and provide a reliable guide to biochemical function. WHERE IS GENOMICS GOING? Where is the new discipline of genomics taking us? Directly into an exciting and ever-expanding new century of scientific discovery. The current sequencing explosion will lead to the development of novel disciplines such as “comparative genomics” and “molecular archaeology” (Table VI). Because about 20% to 30% of each newly sequenced genome consists of genes encoding proteins with no recognizable homologs in the current databases (Koonin et al., 1997), a tremendous effort must be devoted to the functional identification of these “orphan” proteins. Novel regulatory constraints and virulence mechanisms will be revealed (Ewald, 1996). New kingdoms of currently unculturable microbes (Bloomfield et al., 1998) are likely to be revealed. Discoveries leading to tremendous expansion of industrial applications will be made, and additional novel technological advances will undoubtedly appear in the not-too-distant future. But most importantly, genomics will lead to discoveries currently unforeseen and nearly unfathomable. Even 2 years ago we did not dream that microbial genomes would exhibit the degree of plasticity that has been revealed by genome sequencing, or that the “minimal genome” would be so limited in scope. Living organisms have solved the fundamental problems of life in many diverse ways. It is an exciting time to be working in the biological sciences, and this excitement is largely attributable to developments in genomics. The advances of the future will be limited only by the imaginations of current and future generations of molecular biologists. Table VI. Microbial genomics: future directions Sequencing explosion: genome sequencing will become the primary source of biological information Comparative genomics: functional assignments in one organism will be directly applicable to many others Molecular archeology: sequence comparisons and three-dimensional structural analyses will allow deduction of evolutionary origins of most macromolecules Functional identification: many new types of genes must be characterized biochemically and physiologically Regulatory constraints: identification of new genes requires an understanding of how their expression is regulated Virulence mechanisms: novel factors and mechanisms concerned with microbial pathogenesis will be discovered Unculturable organisms: microorganisms that cannot be currently cultured in the laboratory will be characterized Industrial applications: industry will use microorganisms to an ever-increasing degree for the production of useful products Novel technological advances: technologies will be developed for understanding and using the genetic information encoded within microbes Unforeseen discoveries: many novel discoveries will be made in almost every imaginable dimension, with far-reaching consequences Sequencing explosion: genome sequencing will become the primary source of biological information Comparative genomics: functional assignments in one organism will be directly applicable to many others Molecular archeology: sequence comparisons and three-dimensional structural analyses will allow deduction of evolutionary origins of most macromolecules Functional identification: many new types of genes must be characterized biochemically and physiologically Regulatory constraints: identification of new genes requires an understanding of how their expression is regulated Virulence mechanisms: novel factors and mechanisms concerned with microbial pathogenesis will be discovered Unculturable organisms: microorganisms that cannot be currently cultured in the laboratory will be characterized Industrial applications: industry will use microorganisms to an ever-increasing degree for the production of useful products Novel technological advances: technologies will be developed for understanding and using the genetic information encoded within microbes Unforeseen discoveries: many novel discoveries will be made in almost every imaginable dimension, with far-reaching consequences Open in new tab Table VI. Microbial genomics: future directions Sequencing explosion: genome sequencing will become the primary source of biological information Comparative genomics: functional assignments in one organism will be directly applicable to many others Molecular archeology: sequence comparisons and three-dimensional structural analyses will allow deduction of evolutionary origins of most macromolecules Functional identification: many new types of genes must be characterized biochemically and physiologically Regulatory constraints: identification of new genes requires an understanding of how their expression is regulated Virulence mechanisms: novel factors and mechanisms concerned with microbial pathogenesis will be discovered Unculturable organisms: microorganisms that cannot be currently cultured in the laboratory will be characterized Industrial applications: industry will use microorganisms to an ever-increasing degree for the production of useful products Novel technological advances: technologies will be developed for understanding and using the genetic information encoded within microbes Unforeseen discoveries: many novel discoveries will be made in almost every imaginable dimension, with far-reaching consequences Sequencing explosion: genome sequencing will become the primary source of biological information Comparative genomics: functional assignments in one organism will be directly applicable to many others Molecular archeology: sequence comparisons and three-dimensional structural analyses will allow deduction of evolutionary origins of most macromolecules Functional identification: many new types of genes must be characterized biochemically and physiologically Regulatory constraints: identification of new genes requires an understanding of how their expression is regulated Virulence mechanisms: novel factors and mechanisms concerned with microbial pathogenesis will be discovered Unculturable organisms: microorganisms that cannot be currently cultured in the laboratory will be characterized Industrial applications: industry will use microorganisms to an ever-increasing degree for the production of useful products Novel technological advances: technologies will be developed for understanding and using the genetic information encoded within microbes Unforeseen discoveries: many novel discoveries will be made in almost every imaginable dimension, with far-reaching consequences Open in new tab Abbreviation: Mbp megabase pair LITERATURE CITED 1 Andersson JO Andersson SGE Genomic rearrangements during evolution of the obligate intracellular parasite Rickettsia prowazekii as inferred from an analysis of 52015 bp nucleotide sequence. Microbiology 143 1997 2783 2795 Google Scholar Crossref Search ADS PubMed WorldCat 2 Battista JR Against the odds: the survival strategies of Deinococcus radiodurans. Annu Rev Microbiol 51 1997 203 224 Google Scholar Crossref Search ADS PubMed WorldCat 3 Bevan M Bancroft I Bent E Love K Goodman H Dean C Bergkamp R Dirkse W Van Staveren M Stiekema W and others Analysis of 1.9 Mb of contiguous sequence from chromosome 4 of Arabidopsis thaliana. Nature 391 1998 485 488 Google Scholar PubMed OpenURL Placeholder Text WorldCat 4 Blattner FR Plunkett G III Bloch CA Perna NT Burland V Riley M Collado-Vides J Glasner JD Rode CK Mayrew GF and others The complete genome sequence of Escherichia coli K-12. Science 277 1997 1453 1474 Google Scholar Crossref Search ADS PubMed WorldCat 5 Bloomfield SF Stewart GSAB Dodd CER Booth IR Power EGM The viable but non-culturable phenomenon explained? Microbiology 144 1998 1 2 Google Scholar Crossref Search ADS PubMed WorldCat 6 Clayton RA White O Ketchum KA Venter JC The first genome from the third domain of life. Nature 387 1997 459 462 Google Scholar Crossref Search ADS PubMed WorldCat 7 DeRisi JL Iyer VR Brown PO Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278 1997 680 686 Google Scholar Crossref Search ADS PubMed WorldCat 8 Ewald PW Guarding against the most dangerous emerging pathogens: insights from evolutionary biology. Emerging Infect Dis 2 1996 245 257 Google Scholar Crossref Search ADS WorldCat 9 Fleischmann RD Adams MD White O Clayton RA Kirkness EF Kerlavage AR Bult CJ Tomb JF Dougherty BA Merrick JM and others Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269 1995 496 512 Google Scholar Crossref Search ADS PubMed WorldCat 10 Goffeau A, Aert R, Agostini-Carbone ML, Ahmed A, Aigle M, Alberghina L, Albermann K, Albers M, Aldea M, Alexandraki D, and others (1997) The yeast genome directory. Nature 387(suppl): 1–105 11 Groisman EA Ochman H Pathogenicity islands: bacterial evolution in quantum leaps. Cell 87 1996 791 794 Google Scholar Crossref Search ADS PubMed WorldCat 12 Kaneko T Sato S Kotani H Tanaka A Asamizu E Nakamura Y Miyajima N Hirosawa M Sugiura M Sasamoto S and others Sequence analysis of the genome of the unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination of the entire genome and assignment of potential protein-coding regions. DNA Res 3 1996 109 136 Google Scholar Crossref Search ADS PubMed WorldCat 13 Karp PD Riley M Paley SM Pelligrini-Toole A EcoCyc: an encyclopedia of Escherichia coli genes and metabolism. Nucleic Acids Res 24 1996 32 39 Google Scholar Crossref Search ADS PubMed WorldCat 14 Koonin EV Mushegian AR Galperin MY Walker DR Comparison of archaeal and bacterial genomes: computer analysis of protein sequences predicts novel functions and suggests a chimeric origin for the archaea. Mol Microbiol 25 1997 619 637 Google Scholar Crossref Search ADS PubMed WorldCat 15 Kunst F Ogasawara N Moszer I Albertini AM Alloni G Azevedo V Bertero MG Bessieres P Bolotin A Borchert S and others The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390 1997 249 272 Google Scholar Crossref Search ADS PubMed WorldCat 16 Pao SS Paulsen IT Saier MH Jr The major facilitator superfamily. Microbiol Mol Biol Rev 62 1998 1 32 Google Scholar Crossref Search ADS PubMed WorldCat 17 Paulsen IT Sliwinski MK Saier MH Jr Microbial genome analyses: global comparisons of transport capabilities based on phylogenies, bioenergetics and substrate specificities. J Mol Biol 277 1998 573 592 Google Scholar Crossref Search ADS PubMed WorldCat 18 Peeling RW Brunham RC Chlamydiae as pathogens: new species and new issues. Emerging Infect Dis 2 1996 307 319 Google Scholar Crossref Search ADS WorldCat 19 Perego M Glaser P Hoch JA Aspartyl-phosphate phosphatases deactivate the response regulator components of the sporulation signal transduction system in Bacillus subtilis. Mol Microbiol 19 1996 1151 1157 Google Scholar Crossref Search ADS PubMed WorldCat 20 Perego M Hanstein C Welsh KM Djavakhishvili T Glaser P Hoch JA Multiple protein-aspartate phosphatases provide a mechanism for the integration of diverse signals in the control of development in B. subtilis. Cell 79 1994 1047 1055 Google Scholar Crossref Search ADS PubMed WorldCat 21 Reizer J Hoischen C Titgemeyer F Rabus R Stülke J Rivolta C Karamata D Saier MH Jr Hillen W A novel protein kinase that controls carbon catabolite repression in bacteria. Mol Microbiol 27 1998 1157 1169 Google Scholar Crossref Search ADS PubMed WorldCat 22 Reizer J Reizer A Saier MH Jr Is the ribulose monophosphate pathway widely distributed in bacteria? Microbiology 143 1997 2519 2520 Google Scholar Crossref Search ADS PubMed WorldCat 23 Saier MH Jr Molecular phylogeny as a basis for the classification of transport proteins from bacteria, archaea and eukarya. Poole RK Advances in Microbial Physiology 1998 Academic Press San Diego, CA (in press) 24 Williams JM Chen G-C Zhu L Rest RF Using the yeast two-hybrid system to identify human epithelial cell proteins that bind gonococcal Opa proteins: intracellular gonococci bind pyruvate kinase via their Opa proteins and require host pyruvate for growth. Mol Microbiol 27 1998 171 186 Google Scholar Crossref Search ADS PubMed WorldCat 25 Wodicka L Dong H Mittmann M Ho MH Lockhart DJ Genome-wide expression monitoring in Saccharomyces cerevisiae. Nature Biotechnol 15 1997 1359 1367 Google Scholar Crossref Search ADS WorldCat Author notes 1 The conference, entitled “Microbial Genomics II,” was organized by Claire Fraser of the Institute for Genomic Research in the United States and Bart Barrell of the Sanger Center in England, and took place at Hilton Head, South Carolina, from January 31 to February 3, 1998. The program and abstracts of the meeting are presented in Microbial and Comparative Genomics(1998) 3: 1–96. * E-mail [email protected]; fax 1–619–534–7108. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Schöffl, Fritz; Prändl, Ralf; Reindl, Andreas

doi: 10.1104/pp.117.4.1135pmid: 9701569

THE HEAT-SHOCK RESPONSE AND THERMOTOLERANCE The heat-shock response is a conserved reaction of cells and organisms to elevated temperatures (heat shock or heat stress). Whereas severe heat stress leads to cellular damage and cell death, sublethal doses of heat stress induce a cellular response, the heat-shock response, which (a) protects cells and organisms from severe damage, (b) allows resumption of normal cellular and physiological activities, and (c) leads to a higher level of thermotolerance. Crucial to the survival of cells is the sensitivity of proteins and enzymes to heat inactivation and denaturation. Therefore, adaptive mechanisms exist that protect cells from the proteotoxic effects of heat stress. Owing to their sessile lifestyle, the acquisition of higher levels of environmental stress tolerance is of utmost importance to plants. It is not surprising that the heat-shock response is also linked to several other environmental stresses. Furthermore, an increasing number of studies indicate cross-protection between heat stress, dehydration/drought, cold/chilling/freezing, heavy-metal stress, and oxidative stress in plants. HSPs ARE MOLECULAR CHAPERONES At the molecular level the heat-shock response is a transient reprogramming of cellular activities featured by the synthesis of HSPs, concomitant with a cessation of normal protein synthesis. HSPs seem to accumulate in a dosage-dependent manner to amounts sufficient to protect cells and to provide a higher level of thermotolerance. In most organisms, the major groups of stress proteins, HSP100, HSP90, HSP70, HSP60, and small HSPs, are represented by a few members of each class. HSPs are functionally linked to the large and diverse group of molecular chaperones that are defined by their capacity to recognize and to bind substrate proteins that are in an unstable, inactive state. All cellular proteins probably have to interact with molecular chaperones at least once in their lifetime, such as during synthesis, subcellular targeting, or degradation. Owing to heat denaturation, the fraction of potential targets for molecular chaperones seems to dramatically increase upon heat stress and, consequently, the cellular chaperone pool has to be replenished. It is not surprising that, except for small HSPs and HSP100, each class of HSPs is matched by one or several HSCs expressed at normal temperatures. Different HSPs may have different functional properties but common to all of them is their capacity to interact with other proteins and to act as molecular chaperones in vitro (for overview, see Boston et al., 1996;Schöffl et al., 1998a, 1998b). The in vivo chaperone function of plant HSPs was recently demonstrated by the protection and reactivation of a luciferase reporter in Arabidopsis cells (Forreiter et al., 1997). MUTATIONAL ANALYSIS AND GENETIC ENGINEERING There is a striking correlation between the occurrence of HSPs and acquisition of thermotolerance, but there is little direct evidence for a causal relationship. Mutations would be required that result in a coordinate change in the expression of HSPs to study: (a) the signal pathway from stress to gene, (b) the mechanism of transcriptional regulation, and (c) the role of HSPs in thermotolerance. The effects of mutations in individual heat-shock genes have been investigated in different organisms. Analyses in yeast provided evidence for an important role of HSP104 and a minor, accessory role of HSP70 in thermotolerance (Sanchez et al., 1993). Mutations in Hsp26, the sole gene for a small HSP in yeast (Petko and Lindquist, 1986), overexpression of small HSPs, and antisense approaches in transgenic plants (Schöffl et al., 1987) had no obvious effects on the phenotype. The protective effect of HSPs is sometimes dependent on the physiological conditions of the cell, as has been shown shown by the disruption of a mitochondrial HSP30 gene in Neurospora crassa, which resulted in strains that were less thermotolerant under certain carbohydrate limitations (Plesovsky-Vig and Brambl, 1995). In other eukaryotes, other groups of HSPs seem to play important roles in thermotolerance; for example, HSP70 overexpression in mammalian cells and in Drosophila melanogaster (for overview, see Morimoto et al., 1990; Welte et al., 1993). Using genetic engineering of Arabidopsis as a model for higher plants, dominant regulatory mutations were generated that showed a constitutive synthesis of HSPs at normal temperatures (Lee et al., 1995;Prändl et al., 1998). In these transgenic plants the fundamental role of HSPs in stress tolerance is indicated by significantly higher levels of basal thermotolerance. However, it is not yet clear whether in addition to HSPs, other as-yet-unknown genes are involved in the generation of enhanced stress tolerance. TRANSCRIPTIONAL REGULATION OF HEAT-SHOCK GENES The expression of the heat-shock genes encoding the different HSPs in plants is similar to the situation in other eukaryotes, that is, it is primarily regulated at the transcriptional level. The thermoinducibility is attributed to conserved cis-regulatory promoter elements (HSEs) located in the TATA-box-proximal 5′-flanking regions of heat-shock genes. The occurrence of multiple HSEs within a few hundred base pairs is a signature of most eukaryotic heat-shock genes. The eukaryotic HSE consensus sequence has been ultimately defined as alternating units of 5′-nGAAn-3′. In plants the optimal HSE core consensus was shown to be 5′-aGAAg-3′ (Barros et al., 1992). HSEs are the binding sites for the trans-active HSF, and efficient binding requires at least three units, resulting in 5′-nGAAnnTTCnnGAAn-3′. Plant HSF1 from Arabidopsis has been shown to bind consensus tripartite HSE sequences and HSE-containing regions of the D. melanogaster HSP70 promoter (Hübel and Schöffl, 1994; Hübel et al., 1995). Arabidopsis HSF1 expressed in Escherichia coli has been also shown to form trimers in vitro. Trimerization is required for efficient DNA binding and is a key step in regulating HSF activity in metazoans. The importance of HSE for heat-dependent transcriptional regulation in plants has been verified by promoter deletions and by the capacity of synthetic HSE sequences, integrated in a truncated cauliflower mosaic virus 35S promoter, to stimulate heat-inducible reporter gene expression in transgenic tobacco (Schöffl et al., 1989). In addition to HSEs, a number of sequence motifs were found to have quantitative effects on the expression of certain heat-shock genes. In plants there is evidence for involvement of CCAAT-box elements, AT-rich sequences, and scaffold-attachment regions (Czarnecka et al., 1989;Rieping and Schöffl, 1992; Schöffl et al., 1993). These data suggest that sequences affecting the chromatin structure may be important for efficient access of transcription factors (e.g. the TATA-box binding protein) and/or the transcriptional activator proteins (e.g. HSF). The following model integrates the current knowledge about the activation of heat-shock gene expression: The binding of a chromatin-modifying factor, e.g. the GAGA-sequence binding factor (Giardina et al., 1992; Tsukijama et al., 1994), or scaffold attachment affects chromatin structure in a way that provides TBP access to the TATA box, which is a prerequisite for subsequent assembly of the basal transcription complex. In this “stand-by” mode, heat-shock genes are primed for transcriptional activation upon heat stress, and this is mediated by the trimerization and binding of HSF to the HSE sequences. In many organisms, including plants, the expression of heat-shock genes is not only triggered by a number of environmental stresses but also by developmental cues. In plants certain stages of male gametogenesis and embryogenesis are accompanied by an accumulation of HSPs. This suggests that the requirements for protein chaperoning and catabolism are altered during development, and this alteration is compensated for by the induction of heat-shock gene expression. In this paper we try to relate recent progress in studying plant HSF gene structure, modification, transgenic expression, and developmental regulation to other eukaryotic systems, and to draw a picture about the possible molecular mechanisms and pathway of regulation and signaling in plants. THE REGULATION OF HSF A Conserved Mechanism of HSF Activation In response to heat stress, HSF of higher eukaryotes is converted from a monomeric to a trimeric form capable of high-affinity binding to HSE and transcriptional activation. In Saccharomyces cerevisiae and Kluyveromyces lactis, HSF is bound to heat-shock promoters in the absence of stress, indicating that the primary level of regulation involves the acquisition oftrans-activating competency (Mager and De Krujiff, 1995; Wu, 1995). Comparative DNase I footprinting analysis using D. melanogaster DmHSF and Arabidopsis AtHSF1 revealed an almost identical pattern of protected sequences comprising the HSE-containing region of a D. melanogaster heat-shock promoter. However, differences in the patterns of DNase-I-hypersensitive sites flanking the protected region suggest differences in the conformation of the DNA-to-protein interaction between D. melanogaster and Arabidopsis HSFs (Hübel et al., 1995). However, these subtle differences in DNA recognition do not interfere with the conservation of mechanism exemplified in the regulation of gene expression via theD. melanogaster hsp70 promoter in plants (Spena et al., 1985) or in the ability of transiently expressed Arabidopsis AtHSF1 to activate heat-shock gene expression in D. melanogaster, albeit constitutively, at normal temperatures (Hübel et al., 1995). Domain Structure of HSF Similar to vertebrates, all plant species investigated so far contain multiple HSFs, in contrast to the single HSF genes reported for yeast and D. melanogaster. To date, four HSFs have been described from Arabidopsis (Hübel and Schöffl, 1994; Nover et al., 1996; Prändl et al., 1998), six from soybean (Czarnecka-Verner et al., 1995), three from tomato (Scharf et al., 1990), and three from maize (Gagliardi et al., 1995). Molecular masses of plant HSFs are in the range of 31.2 to 57.5 kD. Based on sequence homology and domain structure, plant HSFs can be subdivided in the two classes, A and B (Nover et al., 1996). Structural features of plant HSFs, exemplified for Arabidopsis HSF1, HSF3, and HSF4, are compared with the sole HSF of D. melanogaster in Figure1A. The DNA-binding domain and the oligomerization domain are located in the N-terminal region of HSF (Fig. 1A). Both domains are conserved in primary structure throughout the HSF protein family. Other regions show significant homology only between closely related HSFs. Nuclear localization signals, hydrophobic heptad repeats localized in the C-terminal region, and activation domains have been identified by functional studies in several HSFs (for overview, see Mager and De Krujiff, 1995; Wu, 1995), including those from tomato (Treuter et al., 1993; Lyck et al., 1997). Fig. 1. Open in new tabDownload slide Structure and regulation of HSFs. A, Schematic drawing of three HSFs from Arabidopsis (HSF1, HSF3, and HSF4) and the HSF of D. melanogaster (DmHSF). The DNA-binding domain and the hydrophobic regions A and B are conserved between all HSFs described so far. Plant HSFs group into the classes A and B. Characteristic for class A is an additional hydrophobic heptad repeat inserted between regions A and B. B, Model of HSF regulation. The dissociation of a negative regulatory molecule (R), oligomerization, and binding to heat-shock elements (-GAA--TTC--GAA-) are key steps in HSF activation. Synthesis of HSP feeds back to the regulation of HSF. Abi3 is essential for the expression of small HSPs during seed maturation and thus may be involved in the signal-transduction pathway of HSF activation. Meiosis is suggested to be another HSF-activating cellular process. During the cell cycle, HSF may be repressed by phosphorylation via Cdc2a. aa, Amino acids. Fig. 1. Open in new tabDownload slide Structure and regulation of HSFs. A, Schematic drawing of three HSFs from Arabidopsis (HSF1, HSF3, and HSF4) and the HSF of D. melanogaster (DmHSF). The DNA-binding domain and the hydrophobic regions A and B are conserved between all HSFs described so far. Plant HSFs group into the classes A and B. Characteristic for class A is an additional hydrophobic heptad repeat inserted between regions A and B. B, Model of HSF regulation. The dissociation of a negative regulatory molecule (R), oligomerization, and binding to heat-shock elements (-GAA--TTC--GAA-) are key steps in HSF activation. Synthesis of HSP feeds back to the regulation of HSF. Abi3 is essential for the expression of small HSPs during seed maturation and thus may be involved in the signal-transduction pathway of HSF activation. Meiosis is suggested to be another HSF-activating cellular process. During the cell cycle, HSF may be repressed by phosphorylation via Cdc2a. aa, Amino acids. DNA-Binding Domain HSFs carry a conserved DNA-binding domain consisting of an antiparallel four-stranded β-sheet packed against a bundle of three α-helices, as determined for HSFs from K. lactis, D. melanogaster, and tomato (for overview, see Mager and De Krujiff, 1995; Wu, 1995; Nover et al., 1996). The second and the third helices form a typical helix-turn-helix motif, with the third helix establishing specific nucleic acid contacts with the HSEs. A distinguishing feature of unknown significance between nonplant and plant HSFs is an 11-amino acid deletion in a solvent-exposed loop between two β-sheets in plant HSFs. Oligomerization Domain The oligomerization domain is characterized by a hydrophobic-repeat region A/B, which is separated from the DNA-binding domain by a linker of variable length and sequence. Region A of the hydrophobic repeats is based on a seven-amino acid repetition of hydrophobic amino acids, whereas region B is composed of two overlapping seven-amino acid repeats. In class-A plant HSFs, these arrays are separated by three seven-amino acid repeats, whereas plant HSFs of class B lack this subdomain. It is assumed that the function of the hydrophobic-repeat A/B region is to allow homotrimer formation through a triple-stranded, α-helical coiled-coil structure (for overview, see Mager and De Krujiff, 1995; Wu, 1995; Nover et al., 1996). In higher eukaryotes the formation of trimeric HSFs requires heat stress, but how is the suppression of HSF trimerization achieved under nonstress conditions? The C-terminal hydrophobic repeats is involved in the regulation of trimerization of animal HSFs, in which mutations in this region lead to constitutive trimerization and DNA-binding capacity for D. melanogaster HSF, chicken HSF1 and HSF3, and human HSF1 (Nakai and Morimoto, 1993; Rabindran et al., 1993; Zuo et al., 1994). Although the C-terminal hydrophobic region is well conserved in animal HSFs, it is poorly conserved in plant and yeast HSFs. A model proposes that intramolecular coiled-coil interactions between the hydrophobic regions A/B and C suppress trimer formation under normal growth conditions; however, deletion mapping of D. melanogaster HSF has revealed larger portions of HSF involved in the negative control of trimer formation (Orosz et al., 1996). The role of the C-terminal hydrophobic repeats has not been established for plant HSFs. Nuclear Localization HSFs carry two clusters of basic amino acids that have been proposed to function as nuclear localization sequences. A highly conserved cluster of basic amino acids is located at the C terminus of the DNA-binding domain, and a second cluster resides C-terminally from the A/B hydrophobic region (Sheldon and Kingston, 1993; Wu, 1995). In functional studies with two class-A tomato HSFs, the more C-terminal nuclear localization sequence was found to be exclusively required for nuclear import (Lyck et al., 1997). In contrast, vertebrate HSFs require either both or only the N-terminal nuclear localization sequence for translocation. It has been shown that the nuclear localization sequence is sufficient for stress-induced nuclear entry, supporting the view that nuclear import is one layer of HSF regulation by stress (Zandi et al., 1997). Activation Domain The activation domains of HSFs of higher eukaryotes are localized C-terminally, whereas the HSFs of S. cerevisieae andK. lactis carry activation domains at C- and N-terminal sites of the protein (for overview, see Mager and De Krujiff, 1995; Wu, 1995; Nover et al., 1996). The activation domains of human HSF1 andD. melanogaster HSF show limited sequence identity and are rich in hydrophobic and acidic amino acids (Newton et al., 1996;Wisniewski et al., 1996). In yeast HSF is assumed to be regulated primarily at the level of trans-activating competence. A specific amino acid in the DNA-binding domain, hydrophobic region B, and a yeast-specific control element (CE2) have been shown to be involved in the repression of the activation domain under nonstress conditions (Bonner et al., 1992; Chen et al., 1993). Close inspection of amino acid sequences in the C-terminal part of tomato HSFs suggests that aromatic, bulky hydrophobic, and acidic residues may play a role in transcriptional activation (Treuter et al., 1993). Similar clusters are also present in other HSFs and other transcription-activator proteins (for overview, see Nover et al., 1996). REGULATORS OF HSFs ACTIVITY Negative Regulation of HSFs by HSP70 There is genetic evidence for an autoregulation of the heat-shock response in E. coli, yeast, and higher eukaryotes (for overview, see Mager and De Krujiff, 1995; Wu, 1995). In S. cerevisiae, mutations in two constitutively expressed HSC70/HSP70 genes activate a β-galactosidase reporter gene in an HSE-dependent manner but in the absence of heat stress (Boorstein and Craig, 1990). These data suggest that HSF activity is regulated by HSP70 directly or indirectly. According to the chaperone-titration model, the pool of free HSC70/HSP70 is deplenished during heat shock due to binding of HSC70/HSP70 to unfolded proteins, thereby relieving the repression of HSC70/HSP70 on HSF. In a negative feedback loop, the synthesis of excess levels of HSP70 shuts off HSF activity and, consequently, the heat-shock response. With respect to trimer formation, HSC70/HSP70 may maintain HSF in a monomeric state or may participate in the disassembly of trimeric HSFs. Stoichiometric complexes between nonactivated HSF1 and HSP70 have been described previously, as well as inhibition of heat activation of HSF1 in mammalian cells that transiently overexpress HSP70 (Baler et al., 1996). In plants there is also genetic evidence for a negative regulation of HSF activity and feedback control. Arabidopsis HSF1 is repressed under nonstress conditions and trimerizes upon heat shock. A heat-stress-independent derepression of Arabidopsis HSF1 was obtained by constitutive overexpression of HSF1-GUS fusion proteins (Lee et al., 1995). The molecular mechanism of derepression is still unknown but seems not to be restricted to GUS fusions of HSF. The conformation of the fusion protein may be inaccessible to a negative regulatory molecule, or overexpression of this protein may titrate a transacting negative regulator. It is interesting that, unlike AtHSF1, overexpression of AtHSF3, another Arabidopsis HSF, appears to be sufficient for derepression of the heat-shock response in transgenic Arabidopsis (Prändl et al., 1998). On the other hand, overexpresssion of AtHSF4 (a class-B HSF) or AtHSF4-GUS fusion proteins in transgenic Arabidopis was not sufficient to derepress the synthesis of HSPs at normal temperatures (Prändl et al., 1998). Arabidopsis HSF1 shows also a constitutive DNA binding upon heterologous expression in D. melanogaster and human cells and was able to activate transcription of a suitable reporter gene inD. melanogaster (Hübel et al., 1995). Thus, the negative control of HSF in homologous plant cells seems to depend on a factor that is obviously absent in cultured animal cells. Involvement of HSP70 as a negative regulator of HSF in Arabidopsis is indicated by the analysis of transgenic Arabidopsis plants carrying a heat-inducible HSP70 antisense gene (Lee and Schöffl, 1996). In antisense plants, endogenous HSC70/HSP70 levels are reduced, and during the recovery from heat shock, HSF1 trimers are present longer than in control plants. Negative Regulation of HSFs by Phosphorylation Phosphorylation has been proposed to play a role in activation and inactivation of HSFs (for overview, see Mager and Krujiff, 1995; Wu, 1995). However, recent functional studies suggest that phosphorylation is primarily involved in repression of HSF. In yeast phosphorylation of CE2-adjacent Ser residues has been shown to enhance deactivation of HSF after heat shock (Hoj and Jakobsen, 1994). In human cell cultures HSF1 is phosphorylated at normal growth temperatures at two Ser residues in the regulatory domain that modulate the activation domain. These two Ser residues are involved in maintaining human HSF1 in the repressed state under basal conditions (Kline and Morimoto, 1997). Phosphorylation of these residues is increased upon stimulation of the Raf/ERK pathway, a mitogen-activated protein kinase pathway responsive to growth factors, and results in inhibition of HSF1 activity in mammalian cells (Chu et al., 1996; Knauf et al., 1996). In plants phosphorylation of HSF has been demonstrated for recombinant AtHSF1 in extracts of Arabidopsis suspension-cultured cells. AtHSF1 became phosphorylated at Ser residues and, consequently, its capacity for HSE binding decreased. Immunological characterization of the kinase activity has identified CDC2a kinase, a cyclin-dependent kinase regulating the cell cycle (Reindl et al., 1997). Therefore, in human cells as well as in Arabidopsis, phosphorylation of HSF through various kinases may integrate growth signals. As yet it is unknown whether cyclin-dependent kinases are involved in HSF phosphorylation in animals or whether mitogen-activated protein kinases play a role in HSF regulation in plants. It is conceivable that in growing cells phosphorylation of HSF is required for repression of the heat-shock response that might otherwise interfere with proliferation. This interpretation is supported by growth inhibition of D. melanogaster cells overexpressing HSP70 at normal temperatures (Feder et al., 1992). DEVELOPMENTAL REGULATION OF THE HEAT-SHOCK RESPONSE Expression of Small HSPs in the Absence of Environmental Stress Induction of heat-shock gene transcription, independent of environmental stress, is evident during meiosis in various organisms. In maize, mRNAs of ZmHsp18–1 and ZmHsp18–9accumulate during meiosis and at the binucleate stage of the gametophyte, but with different timing of maximal expression (Atkinson et al., 1993). A third gene encoding a small HSP (ZmHsp18–3) is not expressed at all. Recently, HSPs of different classes have been verified in maize microspores (Magnard et al., 1996) Expression of heat-shock genes occurs during embryogenesis from somatic cells, microspores, and developing pollen in alfalfa and tobacco (Györgyey et al., 1991; Zársky et al., 1995). Changes in concentrations of artificial phytohormones, heat shock, and starvation are known inducers of somatic or microspore embryogenesis. Despite these largely different conditions, microspore-derived embryos from tobacco and somatic embryos from alfalfa express small HSPs during the globular and heart stages but not during the following torpedo stage. These data raise the question of whether heat-shock gene expression during early somatic embryogenesis is a general phenomenon that is also relevant to zygotic embryogenesis. In zygotic embryos expression of heat-shock genes occurs during the maturation stage of the seed, when cell division has ceased and seeds adapt to desiccation and long-term survival. In sunflower, expression of class II small HSPs seems to parallel roughly storage protein and lipid accumulation, whereas expression of class I coincides with seed desiccation (Coca et al., 1994). It has been proposed that HSPs are important for desiccation tolerance of the embryo or are required for germination upon rehydration. Similar to other plants, Arabidopsis accumulates a specific set of HSPs (AtHSP17.4 and AtHSP17.6) during seed maturation, whereas AtHSP18.2 is not expressed (Wehmeyer et al., 1996). The expression of subsets of heat-shock genes during gametogenesis and embryogenesis suggests that the developmentally expressed HSPs serve certain functions that may differ to some extent from those required for coping with environmentally stressed vegetative tissue. Furthermore, these findings may indicate differences in the signal-transduction pathway. On the Mechanism of Developmental Regulation In plants the regulation of developmental expression of HSPs has not yet been investigated in great detail. The analysis of a developmentally regulated soybean heat-shock promoter in transgenic tobacco suggests participation of HSE sequences and, consequently, binding and involvement of HSF (Prändl and Schöffl, 1996). However, it cannot be excluded that other sequences andtrans-active factors are involved in seed-specific expression of HSPs. The control of this expression by a developmental program rather than by a stress signal is indicated by the negative effect of the abi3 mutation in Arabidopsis on seed-specific expression of sHSP (Wehmeyer et al., 1996). ABI3, originally identified as an ABA-insensitive mutant allele in Arabidopsis, appears to have a dominant regulatory effect on the developmental expression of heat-shock genes in the embryo. Recent models for the action of VP1 (Hill et al., 1996; Quatrano et al., 1997), the structural/functional homolog of ABI3 in maize, suggest that VP1 and ABI3 act in the stabilization and activation of regulatory complexes involved in the transcription of target genes. Further investigation of the activation of heat-shock promoters during seed maturation will be required to test the hypothesis that ABI3, directly or via the action of secondary factors, is a regulator of HSF activity. It should be noted that in D. melanogaster, developmental regulation of certain heat-shock genes, such as the expression of HSP82 and HSP26 in oocytes and early larval stages, seems to be regulated by steroid hormones and does not involve an HSE:HSF interaction. In addition, the sole HSF of D. melanogaster plays an essential role at this stage of development, although this function does not appear to be directly related to the expression of HSPs (Jedlicka et al., 1997). CONCLUSIONS AND PERSPECTIVES Some of the plant responses to heat stress show certain characteristics that are unique to plants, that were originally discovered in plants, or, more importantly, that are more important to plants than to other organisms. Future research will focus on the roles of HSP100, HSP90, HSP70, and small HSPs in an effort to identify specific determinants involved in protection from the deleterious effects of heat, cold, heavy metal, desiccation, reactive oxygen species, and other stresses in plants. The regulation of HSF activity and the multiplicity of HSFs in plants are problems of continuing scientific interest. The mechanism of derepression of HSF activity is still not understood. HSF1 protein fusions and HSF3 of Arabidopsis are constitutively active upon transgenic overexpression, suggesting that negative regulation and/or conformational changes are involved in the mechanism of activation (Fig. 1B). Up to six HSF-like genes were identified in plants, including tomato, Arabidopsis, maize, and soybean. The question of whether the genetic redundancy of HSF reflects diversification of functions has to be addressed and answered by future research. It seems possible that some HSFs, classified by the criterion of structural features in the DNA-binding and multimerization domains (Fig. 1A), may work as repressor proteins that counteract transcriptional activation. Preliminary results suggest that this may be true for certain HSFs in subclass B (Fig. 1A) (Czarnecka-Verner et al., 1998). Such proteins could act through DNA binding, either as repressors or through protein:protein interaction as modulators of HSF activity. Is there a signal pathway that senses stress from external sources and triggers the heat-shock response via HSF? Components in the pathway upstream from HSF are not yet known. It is conceivable that HSF itself or its interaction with HSC70 and other proteins (Fig. 1B) is the sensor of heat stress and results in an activation of HSF via conformational changes involving monomer-to-trimer transition, nuclear targeting, DNA binding, and transcriptional activation. An alternative model for temperature sensing and regulation of the heat-shock response integrates observed membrane alterations (for overview, see Wu, 1995;Carratù et al., 1996). Developmental signaling seems to be responsible for the expression of HSPs during seed maturation. The involvement of HSF is indicated by the dependence of HSE promoter sequences, and signaling through ABA pathways is suggested by the negative effect of an abi3mutation in Arabidopsis (Fig. 1B). However, neither the responsible HSF nor the level of control by ABI3 has been identified. ABA does not seem to be involved in microspore development, so it can be concluded that this pathway is probably not involved in the meiosis-dependent activation of heat-shock gene expression. Yet another pathway may exist that integrates signals of cell proliferation and results in cell-cycle-dependent phosphorylation of HSF via Cdc2a (Fig. 1B). It will be important to find out whether HSF phosphorylation also occurs in vivo, whether phosphorylation blocks the activity of native HSF, and whether HSF has as-yet-unknown biological functions in cell growth and development. Although up to now the cellular targets of developmentally expressed HSPs are unknown and no mutants in the developmental heat-shock response are available, the current data suggest that HSPs are important to cells in certain stages of development. Abbreviations: HSC heat-shock constitutive or cognate protein HSE heat-shock consensus element HSF heat-shock transcription factor HSP heat-shock protein LITERATURE CITED 1 Atkinson BG Raizada M Bouchard RA Frappier RA Walden DB The independent stage-specific expression of the 18 kDa heat shock protein genes during microsporogenesis in Zea mays L. Dev Genet 14 1993 15 26 Google Scholar Crossref Search ADS PubMed WorldCat 2 Baler R Zou J Voellmy R Evidence for a role of Hsp70 in the regulation of the heat shock response in mammalian cells. Cell Stress Chap 1 1996 33 39 Google Scholar Crossref Search ADS WorldCat 3 Barros MD Czarnecka E Gurley WB Mutational analysis of a plant heat shock element. Plant Mol Biol 19 1992 665 675 Google Scholar Crossref Search ADS PubMed WorldCat 4 Bonner JJ Heyward S Fackenthal DL Temperature-dependent regulation of a heterologous transcriptional activation domain fused to heat shock transcription factor. Mol Cell Biol 12 1992 1021 1030 Google Scholar Crossref Search ADS PubMed WorldCat 5 Boorstein WR Craig EA Transcriptional regulation of SSA3, a HSP70 gene from Saccharomyces cerevisiae. Mol Cell Biol 10 1990 3262 3267 Google Scholar Crossref Search ADS PubMed WorldCat 6 Boston RS Viitanen PV Vierling E Molecular chaperones and protein folding in plants. Plant Mol Biol 32 1996 191 222 Google Scholar Crossref Search ADS PubMed WorldCat 7 Carratù L Franceschelli S Pardini CL Kobayashi GS Horvath I Vigh L Maresca B Membrane lipid pertubation modifies the set point of the temperature of heat shock response in yeast. Proc Natl Acad Sci USA 93 1996 3870 3875 Google Scholar Crossref Search ADS PubMed WorldCat 8 Chen Y Barlev NA Westergaard O Jakobsen BK Identification of the C-terminal activator domain in yeast heat shock factor: independent control of transient and sustained transcriptional activity. EMBO J 12 1993 5007 5018 Google Scholar Crossref Search ADS PubMed WorldCat 9 Chu B Soncin F Price BD Stevenson MA Calderwood ST Sequential phosphorylation by mitogen-activated protein kinase and glycogen synthase kinase 3 represses transcriptional activation by heat shock factor 1. J Biol Chem 271 1996 30847 30857 Google Scholar Crossref Search ADS PubMed WorldCat 10 Coca MA Almoguera C Jordano J Expression of sunflower low molecular weight heat shock proteins during embryogenesis and persistence after germination: localization and possible functional implications. Plant Mol Biol 25 1994 479 492 Google Scholar Crossref Search ADS PubMed WorldCat 11 Czarnecka E Key JL Gurley WB Regulatory domains of the Gmhsp17.5-E heat shock promoter of soybean: a mutational analysis. Mol Cell Biol 9 1989 3457 3463 Google Scholar Crossref Search ADS PubMed WorldCat 12 Czarnecka-Verner E Yuan CX Fox PC Gurley WB Isolation and characterization of six heat shock transcription factor cDNA clones from soybean. Plant Mol Biol 29 1995 37 51 Google Scholar Crossref Search ADS PubMed WorldCat 13 Czarnecka-Verner E Yuan CX Nover L Scharf KD English G Gurley WB Plant heat shock transcription factors: positive and negative aspects of regulation. Acta Physiol Plant 19 1998 529 537 Google Scholar Crossref Search ADS WorldCat 14 Feder JH Rossi JM Solomon J Solomon N Lindquist S The consequences of expressing hsp70 in Drosophila cells at normal temperature. Genes Dev 6 1992 1404 1413 Google Scholar Crossref Search ADS WorldCat 15 Forreiter C Kirschner M Nover L Stable transformation of an Arabidopsis cell suspension culture with firefly luciferase providing a cellular system for analysis of chaperone activity in vivo. Plant Cell 9 1997 2171 2181 Google Scholar PubMed OpenURL Placeholder Text WorldCat 16 Gagliardi D Breton C Chaboud A Vergne P Dumas C Expression of heat shock factor and heat shock protein 70 genes during maize pollen development. Plant Mol Biol 29 1995 841 856 Google Scholar Crossref Search ADS PubMed WorldCat 17 Giardina C Perez-Riba M Lis JT Promoter melting and TFIID complexes on Drosophila genes in vivo. Genes Dev 15 1992 2737 2744 Google Scholar OpenURL Placeholder Text WorldCat 18 Györgyey J Gartner A Németh K Magyar Z Hirt H Heberle-Bors E Dudits D Alfalfa heat shock genes are differentially expressed during somatic embryogenesis. Plant Mol Biol 16 1991 999 1007 Google Scholar Crossref Search ADS PubMed WorldCat 19 Hill A Nantel A Rock CD Quatrano R A conserved domain of the viviparous-1 gene product enhances the DNA binding activity of the bZIP protein EmBP-1 and other transcription factors. J Biol Chem 271 1996 3366 3374 Google Scholar Crossref Search ADS PubMed WorldCat 20 Hoj A Jakobsen BK A short element required for turning off heat shock transcription factor: evidence that phosphorylation enhances deactivation. EMBO J 13 1994 2617 2624 Google Scholar Crossref Search ADS PubMed WorldCat 21 Hübel A Lee JH Wu C Schöffl F Arabidopsis heat shock factor is constitutively active in Drosophila and human cells. Mol Gen Genet 248 1995 136 141 Google Scholar Crossref Search ADS PubMed WorldCat 22 Hübel A Schöffl F Arabidopsis heat shock factor: characterization of the gene and the recombinant protein. Plant Mol Biol 26 1994 353 362 Google Scholar Crossref Search ADS PubMed WorldCat 23 Jedlicka P Mortin MA Wu C Multiple functions of Drosophila heat shock transcription factor in vivo. EMBO J 16 1997 2452 2462 Google Scholar Crossref Search ADS PubMed WorldCat 24 Kline MP Morimoto RI Repression of the heat shock factor 1 transcriptional activation domain is modulated by constitutive phosphorylation. Mol Cell Biol 17 1997 2107 2115 Google Scholar Crossref Search ADS PubMed WorldCat 25 Knauf U Newton EM Kyriakis J Kingston RE Repression of human heat shock factor 1 activity at control temperature by phosphorylation. Genes Dev 10 1996 2782 2793 Google Scholar Crossref Search ADS PubMed WorldCat 26 Lee JH Hübel A Schöffl F Derepression of the activity of genetically engineered heat shock factor causes constitutive synthesis of heat shock proteins and increased thermotolerance in transgenic Arabidopsis. Plant J 8 1995 603 612 Google Scholar Crossref Search ADS PubMed WorldCat 27 Lee JH Schöffl F An Hsp70 antisense gene affects the expression of HSP70/HSC70, the regulation of HSF, and the acquisition of thermotolerance in transgenic Arabidopsis thaliana. Mol Gen Genet 252 1996 11 19 Google Scholar PubMed OpenURL Placeholder Text WorldCat 28 Lyck R Harmening U Höhfeld I Treuter E Scharf KD Nover L Intracellular distribution and identification of the nuclear localization signals of two plant heat-stress transcription factors. Planta 202 1997 117 125 Google Scholar PubMed OpenURL Placeholder Text WorldCat 29 Mager WH De Krujiff AJJ Stress-induced transcriptional activation. Microbiol Rev 59 1995 506 532 Google Scholar Crossref Search ADS PubMed WorldCat 30 Magnard JL Vergne P Dumas C Complexity and genetic variability of heat shock protein expression in isolated maize microspores. Plant Physiol 111 1996 1085 1096 Google Scholar Crossref Search ADS PubMed WorldCat 31 Morimoto RI Tissiérs A Georgopoulos C Stress Proteins in Biology and Medicine. 1990 Cold Spring Harbor Laboratory Press Cold Spring Harbor, New York 32 Nakai A Morimoto RI Characterization of a novel chicken heat shock transcription factor, heat shock factor 3, suggests a new regulatory pathway. Mol Cell Biol 13 1993 1983 1997 Google Scholar Crossref Search ADS PubMed WorldCat 33 Newton EM Knauf U Green M Kingston RE The regulatory domain of human heat shock factor 1 is sufficient to sense heat stress. Mol Cell Biol 16 1996 839 846 Google Scholar Crossref Search ADS PubMed WorldCat 34 Nover L Scharf KD Gagliardi D Vergne P Czarnecka-Verner E Gurley WB The Hsf world: classification of plant heat stress transcription factors. Cell Stress Chap 1 1996 215 223 Google Scholar Crossref Search ADS WorldCat 35 Orosz A Wisniewski J Wu C Regulation of Drosophila heat shock factor trimerization: global sequence requirements and independence of nuclear localization. Mol Cell Biol 16 1996 7018 7030 Google Scholar Crossref Search ADS PubMed WorldCat 36 Petko L Lindquist S Hsp26 is not required for growth at high temperatures, nor for thermotolerance, spore development, or germination. Cell 45 1986 885 894 Google Scholar Crossref Search ADS PubMed WorldCat 37 Plesovsky-Vig N Brambl R Disruption of the gene for Hsp30, an α-crystallin-related heat shock protein of Neurospora crassa, causes defects in thermotolerance. Proc Natl Acad Sci USA 92 1995 5032 5036 Google Scholar Crossref Search ADS PubMed WorldCat 38 Prändl R Hinderhofer K Eggers-Schumacher G Schöffl F HSF3, a new heat shock factor from Arabidopsis thaliana, derepresses the heat shock response and confers thermotolerance when overexpressed in transgenic plants. Mol Gen Genet 258 1998 269 278 Google Scholar Crossref Search ADS PubMed WorldCat 39 Prändl R Schöffl F Heat shock elements are involved in heat shock promoter activation during tobacco seed maturation. Plant Mol Biol 31 1996 157 162 Google Scholar Crossref Search ADS PubMed WorldCat 40 Quatrano RS Bartels D Ho THD Páges M New insights into ABA-mediated processes. Plant Cell 9 1997 470 475 Google Scholar Crossref Search ADS WorldCat 41 Rabindran SK Haroun RI Clos J Wisniewski J Wu C Regulation of heat shock factor trimer formation: role of a conserved leucine zipper. Science 259 1993 230 234 Google Scholar Crossref Search ADS PubMed WorldCat 42 Reindl A Schöffl F Schell J Koncz C Bako L Phosphorylation by a cyclin-dependent kinase modulates DNA-binding of the Arabidopsis heat shock transcription factor HSF1 in vitro. Plant Physiol 115 1997 93 100 Google Scholar Crossref Search ADS PubMed WorldCat 43 Rieping M Schöffl F Synergistic effect of upstream sequences, CCAAT box elements, and HSE sequences for enhanced expression of chimaeric genes in transgenic tobacco. Mol Gen Genet 231 1992 226 232 Google Scholar Crossref Search ADS PubMed WorldCat 44 Sanchez Y Parsell DA Taulien J Vogel JL Craig EA Lindquist SL Genetic evidence for a functional relationship between Hsp104 and Hsp70. J Bacteriol 175 1993 6484 6491 Google Scholar Crossref Search ADS PubMed WorldCat 45 Scharf KD Rose S Zott W Schöffl F Nover L Three tomato genes code for heat stress transcription factors with a region of remarkable homology to the DNA-binding domain of yeast HSF. EMBO J 9 1990 4495 4501 Google Scholar Crossref Search ADS PubMed WorldCat 46 Schöffl F, Hübel A, Lee JH (1998a) Manipulation of temperature stress tolerance in transgenic plants. In K Lindsey, ed, Transgenic Plant Research. Harwood Academic Publishers, London (in press) 47 Schöffl F, Prändl R, Reindl A (1998b) Molecular responses to heat stress. In K Shinozaki, ed, Drought, Salt, Cold and Heat Stress: Molecular Responses in Higher Plants. Landes Bioscience Publishers, Georgetown, TX (in press) 48 Schöffl F Rieping M Baumann G Constitutive transcription of a soybean heat shock gene by a cauliflower mosaic virus promoter in transgenic tobacco plants. Dev Genet 8 1987 365 374 Google Scholar Crossref Search ADS WorldCat 49 Schöffl F Rieping M Baumann G Bevan M Angermüller S The function of heat shock promoter elements in the regulated expression of chimaeric genes in transgenic tobacco. Mol Gen Genet 217 1989 246 253 Google Scholar Crossref Search ADS PubMed WorldCat 50 Schöffl F Schröder G Kliem M Rieping M A SAR sequence containing 395 bp fragment mediates enhanced, gene-dosage-correlated expression of a chimaeric heat shock gene in transgenic tobacco plants. Transgenic Res 2 1993 93 100 Google Scholar Crossref Search ADS PubMed WorldCat 51 Sheldon LA Kingston RE Hydrophobic coiled-coil domains regulate the subcellular localization of human heat shock factor 2. Genes Dev 7 1993 1549 1558 Google Scholar Crossref Search ADS PubMed WorldCat 52 Spena A Hain R Ziervogel U Saedler H Schell J Construction of a heat-inducible gene for plants: demonstration of heat-inducible activity of the Drosophila hsp70 promoter in plants. EMBO J 4 1985 2739 2743 Google Scholar Crossref Search ADS PubMed WorldCat 53 Treuter E Nover L Ohme K Scharf KD Promoter specificity and deletion analysis of three heat shock transcription factors of tomato. Mol Gen Genet 240 1993 113 125 Google Scholar Crossref Search ADS PubMed WorldCat 54 Tsukijama T Becker PB Wu C ATP-dependent nucleosome disruption at a heat shock promoter mediated by binding of GAGA transcription factor. Nature 367 1994 525 532 Google Scholar Crossref Search ADS PubMed WorldCat 55 Wehmeyer N Hernandez LD Finkelstein RR Vierling E Synthesis of small heat shock proteins is part of the developmental program of late seed maturation. Plant Physiol 112 1996 747 757 Google Scholar Crossref Search ADS PubMed WorldCat 56 Welte MA Tetrault JM Dellavalle RP Lindquist S A new method for manipulating transgenes: engineering heat tolerance in a complex multicellular organism. Curr Biol 3 1993 842 853 Google Scholar Crossref Search ADS PubMed WorldCat 57 Wisniewski J Orosz A Allada R Wu C The C-terminal region of Drosophila heat shock factor (HSF) contains a constitutively functional transactivation domain. Nucleic Acids Res 24 1996 367 374 Google Scholar Crossref Search ADS PubMed WorldCat 58 Wu C Heat shock transcription factors: structure and regulation. Annu Rev Cell Dev Biol 11 1995 441 469 Google Scholar Crossref Search ADS PubMed WorldCat 59 Zandi E Tran TN Chamberlain W Parker CS Nuclear entry, oligomerization, and DNA-binding of the Drosophila heat shock transcription factor are regulated by a unique nuclear localization sequence. Genes Dev 11 1997 1299 1314 Google Scholar Crossref Search ADS PubMed WorldCat 60 Zársky V Garrido D Eller N Tupy J Vicente O Schöffl F Heberle-Bors E The expression of a small heat shock gene is activated during induction of tobacco pollen embryogenesis by starvation. Plant Cell Environ 18 1995 139 147 Google Scholar Crossref Search ADS WorldCat 61 Zuo J Baler R Dahl G Voellmy R Activation of the DNA-binding ability of human heat shock transcription factor 1 may involve the transition from an intramolecular to an intermolecular triple-stranded coiled-coil structure. Mol Cell Biol 14 1994 7557 7568 Google Scholar Crossref Search ADS PubMed WorldCat Author notes * Corresponding author; [email protected]; fax 49–7071–29–5042. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Chaumont, François; Barrieu, François; Herman, Eliot M.; Chrispeels, Maarten J.

doi: 10.1104/pp.117.4.1143pmid: 9701570

Abstract We studied aquaporins in maize (Zea mays), an important crop in which numerous studies on plant water relations have been carried out. A maize cDNA,ZmTIP1, was isolated by reverse transcription-coupled PCR using conserved motifs from plant aquaporins. The derived amino acid sequence of ZmTIP1 shows 76% sequence identity with the tonoplast aquaporin γ-TIP (tonoplast intrinsic protein) from Arabidopsis. Expression of ZmTIP1 in Xenopus laevisoocytes showed that it increased the osmotic water permeability of oocytes 5-fold; this water transport was inhibited by mercuric chloride. A cross-reacting antiserum made against bean α-TIP was used for immunocytochemical localization of ZmTIP1. These results indicate that this and/or other aquaporins is abundantly present in the small vacuoles of meristematic cells. Northern analysis demonstrated thatZmTIP1 is expressed in all plant organs. In situ hybridization showed a high ZmTIP1 expression in meristems and zones of cell enlargement: tips of primary and lateral roots, leaf primordia, and male and female inflorescence meristems. The high ZmTIP1 expression in meristems and expanding cells suggests that ZmTIP1 is needed (a) for vacuole biogenesis and (b) to support the rapid influx of water into vacuoles during cell expansion. The vacuole is a multifunctional organelle with important roles in space filling, osmotic adjustment, storage, and digestion. In dividing cells the vacuolar compartment is represented by small vacuoles that first increase in number as a result of de novo biogenesis, and then expand and coalesce to form one or several highly lobed structures that occupy most of the cellular volume. Vacuole biogenesis and enlargement require the transport of osmotically active substances across the tonoplast, followed by the rapid influx of water into the vacuole. This influx generates the turgor pressure that drives cell expansion and maintains cell shape. Recent studies (Maurel et al., 1997; Niemietz and Tyerman, 1997) show that the tonoplast is highly permeable to water and that this high permeability is caused by the presence of mercuric-chloride-inhibitable water channels that permit the rapid passage of water with a low energy of activation. Such observations are consistent with the presence of aquaporins in the tonoplast. Aquaporins form a large family (Weig et al., 1997) of proteins present in the plasma membrane (PIPs) and tonoplast (TIPs) that increase the hydraulic conductivity of the plasma membrane when expressed inXenopus laevis oocytes (for review, see Maurel, 1997). They are 25- to 29-kD membrane proteins with primary sequences similar to those of the MIP family (Park and Saier, 1996). MIPs have six transmembrane domains with cytosolic amino and carboxy termini and short, conserved amino acid motifs, including the signature sequence SGxHxNPA, which is repeated in the second half of the protein as NPA. Some of these proteins transport small solutes, others transport small solutes and water, and still others transport only water (Park and Saier, 1996). The expression patterns of specific plant aquaporins are tissue- and cell-type specific. The aquaporin α-TIP from common bean accumulates during seed maturation (Johnson et al., 1989; Melroy and Herman, 1991), and the aquaporins γ-TIP and δ-TIP from Arabidopsis are preferentially expressed in elongating root cells and in the parenchymal cells of vascular tissues, respectively (Ludevid et al., 1992; Daniels et al., 1996). The plasma membrane aquaporin RD28 from Arabidopsis is found in all plant organs, but is absent from seeds (Daniels et al., 1994). Several other studies have revealed the organ- and cell-type-specific expression patterns of TIP and PIP aquaporins (Yamamoto et al., 1991; Kammerloher et al., 1994; Opperman et al., 1994; Kaldenhoff et al., 1995; Yamada et al., 1995). The variety of the expression patterns suggests that aquaporins may function in long-distance transport (xylem and phloem loading and unloading), in short-distance transcellular water flow, and in intracellular osmotic adjustment. Maize (Zea mays) has been used extensively to study water transport and its regulation by environmental parameters (Westgate and Boyer, 1985; Sharp et al., 1988; Zhu and Steudle, 1991), and for this reason we decided to characterize its aquaporins and study their expression patterns. The presence of conserved sequence motifs in plant MIPs allows their cDNAs to be isolated by RT-PCR. In this paper we report the isolation and properties of a highly expressed maize tonoplast aquaporin cDNA, ZmTIP1, and document its expression in tissues of maize that are actively dividing and beginning to elongate: meristems of primary roots and lateral roots, leaf primordia, and male and female inflorescence meristems. We interpret our results to indicate that TIPs may be needed for vacuole biogenesis and enlargement in cells that are still dividing and beginning to expand. MATERIALS AND METHODS Plant Growth Conditions Maize (Zea mays, Oh43 line) was grown in a greenhouse under a 16-h light/8-h dark photoperiod. Seedlings were grown on moistened filter paper at 30°C in the dark. RNA Extraction Total RNA was obtained from seeds, embryos, and endosperm at 19 d after pollination from shoots and roots of germinating seedlings, from leaves of 1- to 2-week-old plants, and from developing ears and tassels approximately 2 cm in size. Endosperm samples were isolated from developing seeds by cutting off the top of the seed coat, extracting the seed contents with a small spatula, and removing the embryo from the endosperm. All tissue samples were frozen in liquid N2 after isolation and stored at −70°C. Total RNA was extracted as previously described (Cone et al., 1986). Poly(A+) RNA was isolated from total RNA using the Poly(A+) Tract Kit (Promega) following the instructions of the manufacturer. Identification of MIP cDNAs by RT-PCR cDNA was synthesized from 0.5 μg of seed mRNA using oligo(dT)12–18 as a primer and Moloney murine leukemia virus RT (GIBCO-BRL). Partial ZmTIP1 cDNA was amplified by PCR using degenerate TIP2 and TIP4 primers (Weig et al., 1997), and the reaction products were separated and cloned as described previously (Weig et al., 1997). ZmTIP1 cDNA Cloning Full-length ZmTIP1 cDNA was obtained using the 5′/3′ RACE kit (Boehringer Mannheim) following the instructions of the manufacturer. For the ZmTIP1 5′/3′ RACE, three antisense- and one sense-specific primers (MRACE3, 5′-GCGATGGTGCCCAGGCTGCC-3′; MRACE7, 5′-GGTCCACCGCCGTGGCGTAC-3′; MRACE10, 5′-CAGCACGTGCGCCACCCAGTA-3′; and MRACE5, 5′-GCAGGCCACGGGCACCTTCG-3′) were used. The PCR products were cloned into pCRII (TA cloning kit, Invitrogen) and sequenced. The full-lengthZmTIP1 cDNA was amplified using Pfupolymerase (Stratagene) with proofreading activity and specific primers to the 5′- and 3′-noncoding regions (ZMTIP1–1, 5′-CGGAATTCTCCAGCTCCAATCACAGTC-3′; and ZMTIP1–2, 5′-CGGAATTCACGGTTACAAGCAG-3′) incorporating EcoRI sites on both ends, and subcloned into EcoRI site of Bluescript II SK+ (Stratagene). Plasmid Constructions and in Vitro RNA Synthesis cDNA encoding ZMTIP1 was amplified by PCR with specific primers (ZMTIP1–3, 5′-GGCGGATCCTACCATGCCGATCAATAGGAT-3′; and ZMTIP1–4, 5′-CGATGGATCCACGTGCACGAG-3′) incorporating BamHI sites on both ends, and subcloned into the BglII site of a pSP64T-derived Bluescript vector carrying 5′- and 3′-untranslated sequences of a β-globin gene from Xenopus laevis(Preston et al., 1992). The orientation of the insert was determined by restriction mapping and sequencing. Capped complementary RNA encoding ZMTIP1 was synthesized in vitro using T3 RNA polymerase, and was purified as described by Preston et al. (1992). The 3′-untranslated region of ZmTIP1 was amplified by PCR with specific primers (ZMTIP1–5, 5′-CACCGGATCCTAAAAGCCGAAG-3′; and ZMTIP1–2) incorporating BamHI and EcoRI sites on the ends, and subcloned into the corresponding sites of pBluescript II SK+ (Stratagene) (pBS3′-ZmTIP1). Part of ZmTIP1 cDNA encoding the carboxy-terminal 62 amino acid residues of ZMTIP1 was amplified by PCR with T7 and ZMTIP1–7 (5′-GGCGGCGAATTCGACGGCGC-3′) primers. The PCR product was digested with EcoRI and SalI and subcloned in the corresponding sites of pGEX-4T-1 (Pharmacia) (pGEX-C-Zmtip1). Osmotic Water-Permeability Assay X. laevis oocytes were prepared and injected as previously described (Daniels et al., 1996), and the osmotic water permeability of the plasma membrane was determined (Weig et al., 1997). DNA Gel-Blot Analysis Total DNA was extracted from leaf tissue as described previously (Schmidt et al., 1987). DNA blots and hybridizations were as described previously (Evola et al., 1986). For probe synthesis, the 3′-untranslated region of ZmTIP1 cDNA was gel purified and radiolabeled using a kit (Rediprime, Amersham) following the instructions of the manufacturer. Hybridizations were performed at 42°C in 50% formamide. Washes were performed four times for 15 min each in 0.1× SSC (1× SSC is 150 mm NaCl and 15 mmNa3C6H5O7) and 0.1% SDS at 60°C. RNA Gel-Blot Analysis Total RNA samples (20 μg each) were fractionated by electrophoresis on a Hepes-formaldehyde 1.5% agarose gel following the protocol of Tsang et al. (1993), and were transferred to Hybond-N nylon membranes (Amersham) using standard blotting techniques (Sambrook et al., 1989). Ethidium-bromide-stained rRNAs were used as the internal loading control. The RNA was bound to the membrane with UV illumination and baking at 80°C for 1 to 2 h. The prehybridization and hybridization were performed at 42°C in 50% formamide, 5× SSPE (1× SSPE is 180 mm NaCl, 1 mm EDTA, and 10 mm Na2HPO4, pH 7.7), 5× Denhardt's solution (1× Denhardt's solution is 0.02% [w/v] BSA, 0.02% [w/v] Ficoll, 0.02% [w/v] PVP), 0.5% SDS, and 100 μg mL−1 of yeast tRNA. The random-primer-labeled probes were generated using the Rediprime kit following the instructions of the manufacturer. Hybridized membranes were washed under high-stringency conditions (0.2× SSPE, 0.2 SDS at 65°C for 20 min), and then exposed to radiographic film with intensifying screens at −70°C. GST-C-ZMTIP1 Expression in Escherichia coli and Immunodetection pGEX-C-ZmTIP1 plasmid was introduced in the M15 bacterial strain (Qiagen, Santa Clarita, CA), and GST-C-ZMTIP1 expression was induced by 2 mm isopropyl β-d-thiogalactopyranoside for 2 h. Appropriate quantities of total protein extract were fractionated by 12.5% SDS-PAGE, transferred to nitrocellulose, and the proteins detected using the rabbit antisera raised against Arabidopsis γ-TIP (Höfte et al., 1992) and bean α-TIP (Johnson et al., 1989). Goat anti-rabbit IgG coupled to horseradish peroxidase (Bio-Rad) was used as the secondary antibody. Immunocytochemical Localization The immunocytochemical localization of ZmTIP1 in the embryo after 1 d of germination was performed with antiserum raised against bean seed α-TIP, as described previously (Melroy and Herman, 1991). RNA in Situ Hybridization Maize tissues were fixed in 50% (v/v) ethanol, 5% (v/v) acetic acid, and 3.7% (v/v) formaldehyde at room temperature for 4 h with occasional degassing under a vacuum for 15 min. After fixation, the tissues were dehydrated through an alcohol series and embedded in Paraplast Plus (Oxford Labware, St. Louis, MO). The tissues were sectioned into 8- to 10-μm slices, dewaxed with Histoclear (National Diagnostics, Atlanta, GA), and hydrated by passing through an alcohol series to water. Sections were prepared for in situ hybridization as described previously (Marrison and Leech, 1994). The in situ hybridizations were performed as described previously (Marrison and Leech, 1994) with some modifications. ZmTIP1sense- and antisense-labeled probes were generated using pBS3′-ZmTIP1 linearized with EcoRI orBamHI and transcribed using a digoxigenin RNA-labeling mixture (Boehringer Mannheim) with either T3 or T7 RNA polymerase (Promega), respectively. The probes were hybridized to the tissue sections overnight at 50°C at a concentration of 200 to 400 ng mL−1 in 40 μL of hybridization buffer (6× SSC, 3% [w/v] SDS, 50% [v/v] formamide, and 100 μg mL−1 tRNA). After hybridization, the sections were incubated twice in wash buffer (2× SSC and 50% [v/v] formamide) at 50°C for 90 min; treated with RNase A (10 μg mL−1 in 2× SSC) at 37°C for 30 min; and washed at 50°C for 1 h in wash buffer. The sections were incubated in a blocking solution (Boehringer Mannheim, 0.5% in TBS) for 1 h; in 1% (w/v) BSA and 0.3% (v/v) Triton X-100 in TBS for 30 min; and in the same solution containing alkaline phosphatase-conjugated antibodies (Boehringer Mannheim) at a 1/1000 dilution for 90 min. Unbound antibody conjugate was removed andZmTIP1 transcripts were detected according to the method ofMarrison and Leech (1994). Photographs were made using a light microscope (Optiphot-2, Nikon). The slides were digitized using a slide scanner (CoolScan, Nikon). Brightness and contrast were adjusted using Photoshop 3.0 (Adobe Systems, Mountain View, CA). Composite figures were prepared in Canvas 3.5 (Deneba Software, Miami, FL) and printed using a dye-sublimation color printer (Phaser IIsdx, Tektronix, Wilsonville, OR). RESULTS Isolation of ZmTIP1 cDNA A comparison of plant aquaporin amino acid sequences showed the presence of several conserved regions. Two of them, HI/VNPAVT and WI/VF/YWVGP, were used to design degenerate oligonucleotide primers for RT-PCR (Weig et al., 1997). Using these primers with cDNAs prepared from maize seeds 19 d after pollination, we obtained a PCR-amplified fragment (0.42 kb) containing a sequence homologous to plant TIP aquaporins. The corresponding full-length cDNA was recovered by 5′/3′ RACE with RNA from maize seeds and roots and namedZmTIP1 (accession no. AF037061). The ZmTIP1 cDNA consists of 1097 bp upstream of the poly(A+) tail, which includes a 93-bp leader sequence, followed by 753 bp of open reading frame encoding 250 amino acids, and, finally, a 251-bp 3′ noncoding region. ZmTIP1 has a calculatedMr of 25,820 and contains the MIP family signature sequence SGxHxNPAVT, which is repeated in the second half of the protein as NPA. A comparison of the amino acid sequences of six other TIPs is shown in Figure 1. ZmTIP1 has the highest sequence identity at the amino acid level with two other monocot TIPs from rice (Liu et al., 1994) and barley (Schünmann and Ougham, 1996) (95.2% and 90.4%, respectively). ZmTIP1 is also related to the known vacuolar aquaporins BobTIP26 from cauliflower (Barrieu et al., 1998; F. Barrieu, D. Marty-Mazars, F. Chaumont, M. Chrispeels, and F. Marty, unpublished data) and γ-TIP from Arabidopsis (Maurel et al., 1993) (77.3% and 76.3% identity, respectively). These proteins cluster together on a dendogram, whereas other TIP aquaporins such as δ-TIP from Arabidopsis (Daniels et al., 1996) and seed α-TIP from bean (Johnson et al., 1990) are more distant (61.1% and 52.7% identity with ZmTIP1, respectively) (Fig.2). Fig. 1. Open in new tabDownload slide Comparison of ZmTIP1 sequence with other plant TIPs. Amino acid sequences were compared with the Clustal W multiple alignment program (Thompson et al., 1994). The amino acid sequences were obtained from the following sources: ZmTIP1 (this work); OsTIP1 (Liu et al., 1994); HvTIP1 (Schünmann and Ougham, 1996); BobTIP26 (Barrieu et al., 1998); Atγ-TIP (Hofte et al., 1992); Atδ-TIP (Daniels et al., 1996); and Pvα-TIP (Johnson et al., 1990). Identical amino acid residues common to at least three sequences are shaded. Numbering refers to the respective amino acid sequence. The position of the Cys residue responsible for the mercury sensitivity of Atγ-TIP and Atδ-TIP is noted by an arrowhead in the consensus line. Fig. 1. Open in new tabDownload slide Comparison of ZmTIP1 sequence with other plant TIPs. Amino acid sequences were compared with the Clustal W multiple alignment program (Thompson et al., 1994). The amino acid sequences were obtained from the following sources: ZmTIP1 (this work); OsTIP1 (Liu et al., 1994); HvTIP1 (Schünmann and Ougham, 1996); BobTIP26 (Barrieu et al., 1998); Atγ-TIP (Hofte et al., 1992); Atδ-TIP (Daniels et al., 1996); and Pvα-TIP (Johnson et al., 1990). Identical amino acid residues common to at least three sequences are shaded. Numbering refers to the respective amino acid sequence. The position of the Cys residue responsible for the mercury sensitivity of Atγ-TIP and Atδ-TIP is noted by an arrowhead in the consensus line. Fig. 2. Open in new tabDownload slide Dendogram of the comparison between ZmTIP1 and other plant TIPs. Amino acid sequences from Figure 1 were compared using the program PILEUP (Genetics Computer Group, Madison, WI). Underlined sequences have been identified as aquaporins. Fig. 2. Open in new tabDownload slide Dendogram of the comparison between ZmTIP1 and other plant TIPs. Amino acid sequences from Figure 1 were compared using the program PILEUP (Genetics Computer Group, Madison, WI). Underlined sequences have been identified as aquaporins. ZmTIP1 Forms Water Channels in X. laevis Oocytes In vitro-transcribed cRNA encoding ZmTIP1 was injected intoX. laevis oocytes and osmotically driven water transport into the oocytes was investigated 3 d after injection. Oocytes were exposed to hypoosmotic conditions by diluting the culture medium, and the changes in cell volume were recorded. In these conditions water-injected oocytes swelled slowly. In contrast, oocytes injected with ZmTIP1 cRNA rapidly increased their volume, indicating the presence of a facilitated water-transport pathway. The osmotic water-permeability coefficient (Pf) of the oocyte membrane increased 4- to 5-fold over the control value (Fig.3). Fig. 3. Open in new tabDownload slide Osmotic water permeability (Pf) values of individual ZmTIP1 cRNA-injected oocytes derived from volume change measurements made over two independent preparations of oocytes. White bars, Control (no mercuric chloride); black bars, assay performed in the presence of 3 mm mercuric chloride with a 10-min preincubation. Data are expressed as the mean ± se, with the number of replicates indicated next to each bar in parentheses. Fig. 3. Open in new tabDownload slide Osmotic water permeability (Pf) values of individual ZmTIP1 cRNA-injected oocytes derived from volume change measurements made over two independent preparations of oocytes. White bars, Control (no mercuric chloride); black bars, assay performed in the presence of 3 mm mercuric chloride with a 10-min preincubation. Data are expressed as the mean ± se, with the number of replicates indicated next to each bar in parentheses. Mercuric chloride is a characteristic inhibitor of many water-channel proteins (Preston et al., 1992; Maurel et al., 1993). The mercury-sensitive sites of Arabidopsis γ-TIP and δ-TIP have been identified as Cys-118 and Cys-116, respectively, at a conserved position in a presumed membrane-spanning domain (Daniels et al., 1996). This Cys residue is conserved among the TIPs, including ZmTIP1, with the exception of α-TIP from bean (see arrow in Fig. 1). Water transport through ZmTIP1 is inhibited 70% by 3 mm mercuric chloride (Fig. 3). These results support the interpretation that ZmTIP1 forms channels in oocyte membranes that facilitate water transport. ZmTIP1 Cross-Reacts with Different Aquaporin Antisera In the past our laboratory has raised antisera against the 30 carboxy-terminal amino acid residues of Arabidopsis γ-TIP (Höfte et al., 1992) and the whole α-TIP from bean (Johnson et al., 1989). To determine if these antisera cross-react with ZmTIP1, we fused the sequence encoding the carboxy-terminal 62 amino acid residues of ZmTIP1 to the GST gene in the pGEX-4T-1 plasmid vector, and the fusion protein was expressed in E. coli (see Methods). When the induced culture was allowed to express the fusion protein for 2 h, a strong band of 34 kD, corresponding to the GST-C-ZmTIP1 polypeptide, was produced as observed by SDS-PAGE analysis (Fig. 4, lane 2). Fig. 4. Open in new tabDownload slide Coomassie blue-stained gel and immunoblot of extracts of E. coli expressing GST-C-ZmTIP1. TotalE. coli protein extract before (lanes 1, 3, and 5) and after (lanes 2, 4, and 6) 2 h of induction of GST-C-ZmTIP1 expression by 2 mm isopropyl β-d-thiogalactopyranoside was fractionated by SDS-PAGE. Polypeptides were visualized with Coomassie blue (lanes 1 and 2) or transferred to nitrocellulose and immunostained using Arabidopsis γ-TIP antiserum (lanes 3 and 4) or bean α-TIP (lanes 5 and 6). The positions of molecular mass standards are indicated. Fig. 4. Open in new tabDownload slide Coomassie blue-stained gel and immunoblot of extracts of E. coli expressing GST-C-ZmTIP1. TotalE. coli protein extract before (lanes 1, 3, and 5) and after (lanes 2, 4, and 6) 2 h of induction of GST-C-ZmTIP1 expression by 2 mm isopropyl β-d-thiogalactopyranoside was fractionated by SDS-PAGE. Polypeptides were visualized with Coomassie blue (lanes 1 and 2) or transferred to nitrocellulose and immunostained using Arabidopsis γ-TIP antiserum (lanes 3 and 4) or bean α-TIP (lanes 5 and 6). The positions of molecular mass standards are indicated. Immunoblot analysis of the same bacterial extract using the Arabidopsis γ-TIP antiserum showed that this serum detects the GST-C-ZmTIP1 polypeptide and cross-reacts with two E. coliproteins (Fig. 4, lanes 3 and 4). In the same way, the bean α-TIP antiserum cross-reacted with GST-C-ZmTIP (Fig. 4, lane 6). The reactivity of these two sera with ZmTIP1 came from the ZmTIP1 polypeptide (and not from the GST) because neither γ-TIP or α-TIP antisera elicited an immunostaining reaction with expressed GST protein (data not shown). Sequence identity in this carboxy-terminal region of ZmTIP1 with Arabidopsis γ-TIP and bean α-TIP was 73% and 55%, respectively (Fig. 1). These data indicate that antigenic epitopes recognized by γ-TIP and α-TIP antisera are conserved in TIPs from monocots and dicots. A ZmTIP1 Cross-Reacting Serum Labels the Tonoplast The cross-reactivity of ZmTIP1 with α-TIP antiserum allowed us to examine the subcellular localization of ZmTIPs by immunocytochemistry. We chose maize embryos for this localization because ZmTIP1 is highly expressed there (see below). Meristematic cells of embryos are characterized by the presence of numerous small vacuoles, which subsequently fuse and enlarge. Figure5 shows abundant colloidal gold labeling of the interface between the cytoplasm and the vacuole where the tonoplast is located. This method of fixation, which minimizes the destruction of protein epitopes, does not allow for the visualization of the tonoplast. There was no specific labeling of the vacuolar content (Fig. 5) or of the plasma membrane (data not shown). These results indicate that ZmTIPs are localized in the tonoplast of maize vacuoles. We do not know if the labeling was caused by the presence of ZmTIP1 alone or by the presence of other aquaporins or MIPs that cross-react with this serum Fig. 5. Open in new tabDownload slide Immunocytochemical localization of ZmTIP1 in maize embryos. The gold particles are primarily at the interface of the cytoplasm and the vacuole (V). The vacuoles apparently contain aggregated protein. Magnification is ×60,000. Fig. 5. Open in new tabDownload slide Immunocytochemical localization of ZmTIP1 in maize embryos. The gold particles are primarily at the interface of the cytoplasm and the vacuole (V). The vacuoles apparently contain aggregated protein. Magnification is ×60,000. Expression of ZmTIP1 in Different Tissues during Development To analyze the expression pattern of ZmTIP1, a 203-bp DNA fragment from the 3′-untranslated region ofZmTIP1 cDNA was used as a probe. The specificity of the probe was tested by Southern hybridization (Fig.6). In this experiment, only restriction enzymes that do not cut the 3′-untranslated sequence (EcoRI, HindIII, and XbaI) were used to digest genomic DNA samples. Hybridization at high-stringency conditions (0.1× SSC, 0.1% SDS, and 60°C) revealed only one band for each of the restriction digests. This result suggests that the probe is likely to be ZmTIP1 gene specific. Fig. 6. Open in new tabDownload slide Genomic Southern analysis. Total maize genomic DNA (15 μg per lane) was digested with EcoRI,HindIII, and BamHI and hybridized with labeled 3′-untranslated region of ZmTIP1 cDNA. The positions of the Mr markers are indicated. Fig. 6. Open in new tabDownload slide Genomic Southern analysis. Total maize genomic DNA (15 μg per lane) was digested with EcoRI,HindIII, and BamHI and hybridized with labeled 3′-untranslated region of ZmTIP1 cDNA. The positions of the Mr markers are indicated. To characterize the pattern of expression of ZmTIP1, gel-blot analysis of total RNA from different maize tissues was performed. ZmTIP1 transcripts with a size of 1.15 kb were observed in all of the expanding tissues studied, from the embryo to the flower organs (Fig. 7A, lanes 3–8). The transcripts were absent from the endosperm, which represents more than 90% of the total seed extract (Fig. 7A, lane 2). To determine if the high ZmTIP1 expression seen in the expanding tissues persists in older organs, we performed an RNA-blot hybridization with total RNA obtained from leaves of light-grown seedlings at the three-leaf stage of development (Fig. 7, B–D). In these seedlings the first plumular leaf (leaf no. 1) was fully expanded, leaf no. 2 was close to the end of its growth, and the youngest leaf (leaf no. 3) was still growing rapidly (Fig. 7B). TheZmTIP1 transcript level was highest in the youngest expanding leaf (Fig. 7C), indicating a possible role of ZmTIP1 in leaf expansion. ZmTIP1 transcript abundance in the different leaves was lower in these green leaves compared with the level in the developing etiolated shoot. Fig. 7. Open in new tabDownload slide Gel-blot analysis of ZmTIP1 mRNA in different vegetative and reproductive organs. Total RNA (20 μg) was extracted from the indicated organs (A, C, and D) and from 10-d-old maize plantlet leaves (1–3 in B–D), and separated by gel electrophoresis in the presence of ethidium bromide (D). After transfer the blots were hybridized with ZmTIP1 probe (A and C). Total shoot RNA was used as a control to compare the signal intensity in the different blots. Fig. 7. Open in new tabDownload slide Gel-blot analysis of ZmTIP1 mRNA in different vegetative and reproductive organs. Total RNA (20 μg) was extracted from the indicated organs (A, C, and D) and from 10-d-old maize plantlet leaves (1–3 in B–D), and separated by gel electrophoresis in the presence of ethidium bromide (D). After transfer the blots were hybridized with ZmTIP1 probe (A and C). Total shoot RNA was used as a control to compare the signal intensity in the different blots. To more precisely determine the localization of ZmTIP1expression in developing organs, the patterns of ZmTIP1mRNA localization were determined by in situ hybridization of digoxigenin-labeled RNA probes using longitudinal sections through various organs (Fig. 8). The intensity of the red color indicates the abundance of mRNA. The controls probed with sense cRNA were white (Fig. 8, C, E, and I). In the primary root of a maize seedling the highest expression of ZmTIP1 was detected in the apical meristem and the cell-elongation zone (Fig. 8A). Cells close to the vascular bundles stained more intensely than the cortical cells. No transcripts were detected in the root cap or the quiescent center. At more distal regions from the root tip,ZmTIP1 expression decreased dramatically, and seemed to be restricted to the epidermis and a zone surrounding the vascular cylinder. More distally, strong signals were found in the new lateral root primordia at the periphery of the vascular cylinder (Fig. 8B). A weak expression was still detectable around the vascular bundle. Fig. 8. Open in new tabDownload slide Localization of ZmTIP1 mRNA by in situ hybridization. The controls, hybridized with sense RNA, are shown in C, E, and I; all other panels were hybridized with antisense RNA. A, Longitudinal section of 3-d-old root tip; B, longitudinal section in the zone of lateral root initiation; C, control, same section as shown in A; D and E, median sections of 3-d-old plumule; F, median section of an immature tassel; G, close-up of F; H and I, median section of an immature ear. Ca, Root cap; DZ, division zone; EZ, elongation zone; Gl, glume; Le, lemma; LF, lower floret; Lo, lodicule; LP, leaf primordium; S, stamen; VB, vascular bundle; TZ, transition zone; UF, upper floret. White and black arrows in B indicate RNA transcript signal in the lateral root meristems and the vascular bundle, respectively. Fig. 8. Open in new tabDownload slide Localization of ZmTIP1 mRNA by in situ hybridization. The controls, hybridized with sense RNA, are shown in C, E, and I; all other panels were hybridized with antisense RNA. A, Longitudinal section of 3-d-old root tip; B, longitudinal section in the zone of lateral root initiation; C, control, same section as shown in A; D and E, median sections of 3-d-old plumule; F, median section of an immature tassel; G, close-up of F; H and I, median section of an immature ear. Ca, Root cap; DZ, division zone; EZ, elongation zone; Gl, glume; Le, lemma; LF, lower floret; Lo, lodicule; LP, leaf primordium; S, stamen; VB, vascular bundle; TZ, transition zone; UF, upper floret. White and black arrows in B indicate RNA transcript signal in the lateral root meristems and the vascular bundle, respectively. Figure 8D shows ZmTIP1 transcripts in the shoot apical region of a seedling plumule, where ZmTIP1 was most strongly expressed in leaf primordia and expanding leaves. No transcripts were detected in the coleoptile at this stage of seedling development (data not shown). In immature male and female inflorescences, ZmTIP1 expression was mainly localized in the developing spikelets (Fig. 8, F–H), but transcripts were also present around the vascular bundles. In the tassel spikelet, expression was highest in the stamen and lodicule primordia and in the adjoining vessel bundles, but signal was also present in the developing glume and lemma surrounding the florets (Fig. 8G). In the ear spikelet,ZmTIP1 expression was seen mainly in the upper and lower floret primordia (Fig. 8H). DISCUSSION The discovery of water-channel proteins in the membranes of plant cells allows the formulation of new mechanisms that may be used by plants to control water transport and osmotic adjustment (Maurel, 1997). The presence of highly conserved motifs in plant aquaporins permitted us to identify and clone by RT-PCR and RACE a tonoplast aquaporin cDNA from maize, ZmTIP1, which is closely related to the Arabidopsis γ-TIP aquaporin (76% amino acid identity). γ-TIP is an integral TIP expressed in the vegetative body of Arabidopsis (Höfte et al., 1992) that can form water channels inX. laevis oocyte membranes (Maurel et al., 1993). In the same way, ZmTIP1 increased the water membrane permeability of X. laevis oocytes. Both aquaporins are sensitive to mercuric chloride. On a dendogram, the ZmTIP1 amino acid sequence clusters with TIP homologs from two monocots, rice (Liu et al., 1994) and barley (Schünmann and Ougham, 1996), and together these three form a larger group with the cauliflower BobTIP26 and Arabidopsis γ-TIP, two dicot aquaporins. This group diverges from other identified tonoplast aquaporins such as the Arabidopsis δ-TIP (Daniels et al., 1996) and bean α-TIP (Johnson et al., 1990), which have different expression patterns. The clustering of γ-TIP homologs in two groups according to the plant classes suggests that a common but already specialized γ-TIP ancestor diverged during the evolution of the monocots and dicots. ZmTIP1 Is Highly Expressed in Dividing Cells Detailed analysis of ZmTIP1 transcript localization by in situ hybridization showed a high expression in zones of cell division and elongation of the roots, leaves, and reproductive organs. The high level of expression observed in conducting tissues is discussed in the accompanying paper (Barrieu et al., 1998). Dividing cells contain numerous small vacuoles in different stages of development. Stereological measurements with meristematic cells ofVicia faba showed that the combined volume of the spherical vacuoles represents 27% of the cell volume and that the combined surface area of these vacuoles is as large as that of the plasma membrane area (Steer, 1981). Meristematic cells must generate equal amounts of tonoplast and plasma membrane between rounds of cell division, a process that requires the synthesis of new membrane components. Vacuole biogenesis proceeds through the formation of provacuoles that fuse in an autophagic process (for review, see Marty, 1997). Because TIPs are abundant in the tonoplast, one might expect a high level of TIP transcripts in dividing cells. The presence of TIPs in meristematic cells has been previously shown in root and shoot of beet (Marty-Mazars et al., 1995), in barley and pea root tips (Paris et al., 1996), and in cauliflower florets (Barrieu et al., 1998). Transcripts of the root-specific TobRB7 were also detected in meristematic cells but it is not known if this gene encodes a tonoplast or plasma membrane aquaporin (Yamamoto et al., 1991). The expression ofZmTIP1 reported here for dividing cells differs substantially from our previous finding with the close Arabidopsis homolog γ-TIP (Ludevid et al., 1992). Analysis of γ-TIP promoter-GUS gene fusion-transformed plant and whole-mount in situ hybridizations carried out with seedlings showed expression in vascular bundles and other tissues, but not in meristems. With respect to the GUS fusions it is likely that regulatory elements were missing from the promoter-GUS fusion construct. ZmTIP1 Is Highly Expressed in Expanding Cells In addition to the zone of cell division, root tips have a zone of cell elongation, and between these two there is a transition zone or distal elongation zone, in which the cells expand isodiametrically, growing in width as much as in length (Fig. 7A) (Ishikawa and Evans, 1995; Baluska et al., 1996). In this transition zone cells have to develop the necessary synthetic machinery for the biogenesis of new tonoplast and plasma membranes, cell wall components, new enzymatic complexes, and cytoplasmic structures that support the rapid growth in the elongation zone (Baluska et al., 1996). Cells of the distal elongation zone respond to a variety of signals, such as auxin (Ishikawa and Evans, 1993), water stress (Sharp et al., 1988) and gravistimulation (Ishikawa et al., 1991), differently from the cells in the main elongation zone. For instance, the elongation of cells in this zone is unaffected by reducing the water potential, whereas the rate of elongation in the main elongation zone is inhibited (Sharp et al., 1988). As observed by in situ hybridization experiments, the expression of the tonoplast aquaporin ZmTIP1 is high in these cells. It would be interesting to analyze the pattern of expression ofZmTIP1 and/or other aquaporin genes in this zone in response to external signals. Rapid elongation of plant cells is based on an extensive uptake of solutes coupled with the uptake of water, resulting in the formation of a prominent vacuolar compartment. This mechanism maintains the turgor pressure that drives cell expansion. Rapid cell expansion may require a high hydraulic permeability of the tonoplast to support water entry into the vacuole. An important role for TIPs during this process was initially suggested by the observation that Arabidopsis γ-TIP is highly expressed in the zone of cell elongation in roots, hypocotyls, and leaves (Ludevid et al., 1992). Arabidopsis γ-TIP expression was shown to be up-regulated after application of GA3 inga1, a GA-deficient dwarf mutant (Phillips and Huttly, 1994). Also, HvTIP1 transcripts were increased in the slender mutant of barley, characterized by a faster elongation rate of the leaves (Schünmann and Ougham, 1996). Maize ZmTIP1expression is also high in young, developing leaves and zones of cell elongation in roots, as observed by RNA gel-blot analysis and in situ hybridization. The high water permeability of the plant tonoplast was recently demonstrated directly with tonoplast vesicles of cultured tobacco cells (Maurel et al., 1997) and wheat roots (Niemietz and Tyerman, 1997). Tonoplast vesicles have channels that transport water with a low energy of activation and that are inhibited by mercuric chloride, whereas plasma membrane vesicles either do not have such channels or the channels are inactive. Together these experiments support the interpretation that TIPs permit the rapid influx of water into the vacuole of elongating cells. The much lower permeability of plasma membrane vesicles observed in the same studies (Maurel et al., 1997;Niemietz and Tyerman, 1997) may indicate that cells regulate the influx of water at the plasma membrane. ACKNOWLEDGMENTS We thank Dr. R.J. Schmidt and his collaborators for helpful discussions, and members of Dr. M.F. Yanofsky's laboratory for help with the in situ hybridization and use of their equipment. Abbreviations: GST glutathione S transferase MIP major intrinsic protein PIP plasma membrane intrinsic protein RACE rapid amplification of cDNA ends RT-PCR reverse transcription-coupled PCR TIP tonoplast intrinsic protein LITERATURE CITED 1 Baluska F Volkmann D Barlow PW Specialized zones of development in roots. View from the cellular level. Plant Physiol 112 1996 3 4 Google Scholar Crossref Search ADS PubMed WorldCat 2 Barrieu F Chaumont F Chrispeels M High expression of the tonoplast aquaporin ZmTIP1 in epidermal and conducting tissues of maize. Plant Physiol 117 1998 1153 1163 Google Scholar Crossref Search ADS PubMed WorldCat 3 Barrieu F Thomas D Marty-Mazars D Charbonnier M Marty F Tonoplast intrinsic proteins from cauliflower (Brassica oleracea L. var. botrytis): immunological analysis, cDNA cloning and evidence for expression in meristematic tissues. Planta 204 1998 335 344 Google Scholar Crossref Search ADS PubMed WorldCat 4 Cone KC Burr FA Burr B Molecular analysis of the maize anthocyanin regulatory locus C1. Proc Natl Acad Sci USA 83 1986 9631 9635 Google Scholar Crossref Search ADS PubMed WorldCat 5 Daniels MJ Chaumont F Mirkov TE Chrispeels MJ Characterization of a new vacuolar membrane aquaporin sensitive to mercury at a unique site. Plant Cell 8 1996 587 599 Google Scholar PubMed OpenURL Placeholder Text WorldCat 6 Daniels MJ Mirkov TE Schroeder JI Chrispeels MJ The plasma membrane of Arabidopsis thaliana contains a mercury-insensitive aquaporin that is a homolog of the tonoplast water channel protein TIP. Plant Physiol 106 1994 1325 1333 Google Scholar Crossref Search ADS PubMed WorldCat 7 Evola SV Burr FA Burr B The suitability of restriction fragment length polymorphisms as genetic markers in maize. Theor Appl Genet 71 1986 765 771 Google Scholar Crossref Search ADS PubMed WorldCat 8 Höfte H Hubbard L Reizer J Ludevid D Herman EM Chrispeels MJ Vegetative and seed-specific isoforms of a putative solute transporter in the tonoplast of Arabidopsis thaliana. Plant Physiol 99 1992 561 570 Google Scholar Crossref Search ADS PubMed WorldCat 9 Ishikawa H Evans ML The role of the distal elongation zone in the response of maize roots to auxin and gravity. Plant Physiol 102 1993 1203 1210 Google Scholar Crossref Search ADS PubMed WorldCat 10 Ishikawa H Evans ML Specialized zones of development in roots. Plant Physiol 109 1995 725 727 Google Scholar Crossref Search ADS PubMed WorldCat 11 Ishikawa H Hasenstein KH Evans ML Computer based video digitizer analysis of surface extension in maize roots: kinetics of growth rate changes during gravitropism. Planta 183 1991 381 390 Google Scholar Crossref Search ADS PubMed WorldCat 12 Johnson KD Herman EM Chrispeels MJ An abundant, highly conserved tonoplast protein in seeds. Plant Physiol 91 1989 1006 1013 Google Scholar Crossref Search ADS PubMed WorldCat 13 Johnson KD Höfte H Chrispeels MJ An intrinsic tonoplast protein of protein storage vacuoles in seeds is structurally related to a bacterial solute transporter (GlpF). Plant Cell 2 1990 525 532 Google Scholar PubMed OpenURL Placeholder Text WorldCat 14 Kaldenhoff R Kolling A Meyers J Karmann U Ruppel G Richter G The blue light-responsive ATHH2 gene of Arabidopsis thaliana is primarily expressed in expanding as well as in differentiating cells and encodes a putative channel protein of the plasmalemma. Plant J 7 1995 87 95 Google Scholar Crossref Search ADS PubMed WorldCat 15 Kammerloher W Fischer U Piechottka GP Schäffner AR Water channels in the plant plasma membrane cloned by immunoselection from a mammalian expression system. Plant J 6 1994 187 199 Google Scholar Crossref Search ADS PubMed WorldCat 16 Liu Q Umeda M Uchimiya H Isolation and expression analysis of two rice genes encoding the major intrinsic protein. Plant Mol Biol 26 1994 2003 2007 Google Scholar Crossref Search ADS PubMed WorldCat 17 Ludevid D Höfte H Himelblau E Chrispeels MJ The expression pattern of the tonoplast intrinsic protein γ-TIP in Arabidopsis thaliana is correlated with cell enlargement. Plant Physiol 100 1992 1633 1639 Google Scholar Crossref Search ADS PubMed WorldCat 18 Marrison JL Leech RM The subcellular and intra-organelle recognition of nuclear and chloroplast transcripts in developing leaf cells. Plant J 6 1994 605 614 Google Scholar Crossref Search ADS WorldCat 19 Marty F The biogenesis of vacuoles: insights from microscopy. Leigh A Sanders D The Plant Vacuoles, Vol 25. 1997 1 42 Academic Press San Diego, CA 20 Marty-Mazars D Clémencet MC Dozolme P Marty F Antibodies to the tonoplast from the storage parenchyma cells of beetroot recognize a major intrinsic protein related to TIPs. Eur J Cell Biol 66 1995 106 118 Google Scholar PubMed OpenURL Placeholder Text WorldCat 21 Maurel C Aquaporins and water permeability of plant membranes. Annu Rev Plant Physiol Plant Mol Biol 48 1997 399 429 Google Scholar Crossref Search ADS PubMed WorldCat 22 Maurel C Reizer J Schroeder JI Chrispeels MJ The vacuolar membrane protein γ-TIP creates water specific channels in Xenopus oocytes. EMBO J 12 1993 2241 2247 Google Scholar Crossref Search ADS PubMed WorldCat 23 Maurel C Tacnet F Güclü J Guern J Ripoche P Purified vesicles of tobacco cell vacuolar and plasma membranes exhibit dramatically different water permeability and water channel activity. Proc Natl Acad Sci USA 94 1997 7103 7108 Google Scholar Crossref Search ADS PubMed WorldCat 24 Melroy DL Herman EM TIP, an integral membrane protein of the protein-storage vacuoles of the soybean cotyledon undergoes developmentally regulated membrane accumulation and removal. Planta 184 1991 113 122 Google Scholar Crossref Search ADS PubMed WorldCat 25 Niemietz CM Tyerman ST Characterization of water channels in wheat root membrane vesicles. Plant Physiol 115 1997 561 567 Google Scholar Crossref Search ADS PubMed WorldCat 26 Opperman CH Taylor CG Conkling MA Root-knot nematode-directed expression of a plant root-specific gene. Science 263 1994 221 223 Google Scholar Crossref Search ADS PubMed WorldCat 27 Paris N Stanley CM Jones RL Rogers JC Plant cells contain two functionally distinct vacuolar compartments. Cell 85 1996 563 572 Google Scholar Crossref Search ADS PubMed WorldCat 28 Park JH Saier MH Jr Phylogenetic characterization of the MIP family of transmembrane channel proteins. J Membr Biol 153 1996 171 180 Google Scholar Crossref Search ADS PubMed WorldCat 29 Phillips AL Huttly AK Plant Mol Biol 24 1994 603 615 Crossref Search ADS PubMed 30 Preston GM Carroll TP Guggino WB Agre P Appearance of water channels in Xenopus oocytes expressing red cell CHIP28 protein. Science 256 1992 385 387 Google Scholar Crossref Search ADS PubMed WorldCat 31 Sambrook J Fritsch EF Maniatis T Molecular Cloning. A Laboratory Manual. 1989 Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 32 Schmidt RJ Burr FA Burr B Transposon tagging and molecular analysis of the maize regulatory locus opaque-2. Science 238 1987 960 963 Google Scholar Crossref Search ADS PubMed WorldCat 33 Schünmann PHD Ougham HJ Identification of three clones expressed in the leaf extension zone and with altered patterns of expression in the slender mutant of barley: a tonoplast intrinsic protein, a putative structural protein and photochlorophyllide oxidoreductase. Plant Mol Biol 31 1996 529 537 Google Scholar Crossref Search ADS PubMed WorldCat 34 Sharp RE Silk WK Hsiao TC Growth of the maize primary root at low water potentials. I. Spatial distribution of expansive growth. Plant Physiol 87 1988 50 57 Google Scholar Crossref Search ADS PubMed WorldCat 35 Steer MW (1981) Understanding Cell Structure. Cambridge University Press, Cambridge, UK, 126 pp 36 Thompson JD Higgins DG Gibson TJ Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 1994 4673 4680 Google Scholar Crossref Search ADS PubMed WorldCat 37 Tsang S Yin X Guzzo-Arkuran C Jones V Davidson A Loss of resolution of gel electrophoresis of RNA: a problem associated with the presence of formaldehyde gradients. BioTechniques 14 1993 380 381 Google Scholar PubMed OpenURL Placeholder Text WorldCat 38 Weig A Deswarte C Chrispeels MJ The major intrinsic protein family of Arabidopsis has 23 members that form three distinct groups with functional aquaporins in each group. Plant Physiol 114 1997 1347 1357 Google Scholar Crossref Search ADS PubMed WorldCat 39 Westgate ME Boyer JS Osmotic adjustment and the inhibition of leaf, root, stem and silk growth at low water potentials in maize. Planta 164 1985 540 549 Google Scholar Crossref Search ADS PubMed WorldCat 40 Yamada S Katsuhara M Kelly W Michalowski C Bohnert H A family of transcripts encoding the water channel proteins: tissue-specific expression in the common ice plant. Plant Cell 7 1995 1129 1142 Google Scholar PubMed OpenURL Placeholder Text WorldCat 41 Yamamoto YT Taylor CG Acedo GN Cheng C-L Conkling MA Characterization of cis-acting sequences regulating root-specific gene expression in tobacco. Plant Cell 3 1991 371 382 Google Scholar PubMed OpenURL Placeholder Text WorldCat 42 Zhu GL Steudle E Water transport across maize roots. Simultaneous measurement of flows at the cell and root level by double pressure probe technique. Plant Physiol 95 1991 305 315 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This work was supported by a cell biology grant from the National Science Foundation. F.C. was supported by a European Molecular Biology Organization fellowship. * Corresponding author; e-mail [email protected]; fax 1–619–534–4052. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Barrieu, François; Chaumont, François; Chrispeels, Maarten J.

doi: 10.1104/pp.117.4.1153pmid: 9701571

Abstract Aquaporins are integral membrane proteins of the tonoplast and the plasma membrane that facilitate the passage of water through these membranes. Because of their potentially important role in regulating water flow in plants, studies documenting aquaporin gene expression in specialized tissues involved in water and solute transport are important. We used in situ hybridization to examine the expression pattern of the tonoplast aquaporinZmTIP1 in different organs of maize (Zea mays L.). This tonoplast water channel is highly expressed in the root epidermis, the root endodermis, the small parenchyma cells surrounding mature xylem vessels in the root and the stem, phloem companion cells and a ring of cells around the phloem strand in the stem and the leaf sheath, and the basal endosperm transfer cells in developing kernels. We postulate that the high level of expression ofZmTIP1 in these tissues facilitates rapid flow of water through the tonoplast to permit osmotic equilibration between the cytosol and the vacuolar content, and to permit rapid transcellular water flow through living cells when required. Long-distance transport of water and solutes occurs through xylem vessels and phloem sieve tubes that have no real membrane barriers to such transport. In contrast, water and solutes that enter these principal conduits pass through living tissues and may encounter membrane barriers when they follow the transcellular path. Cell-to-cell flow can be a major transport route for water, although the extent to which water also follows an apoplastic path is still a matter of debate and may depend on the organ or tissue, its stage of development, or its physiological state. Cell types in which transcellular flow and, therefore, transmembrane flow are limiting have been identified. For example, in roots, the Casparian strip of the endodermis is a barrier to the apoplastic route for water and ions that enter the stele (Schreiber, 1996). On the basis of results obtained from pressure-probe experiments with soybean hypocotyls, Nonami and Boyer (1993) suggested that the small xylem parenchyma cells around the vascular bundles limit the radial transport of water out of the xylem vessels. Do plants regulate the hydraulic permeability of the membranes of these cells and, if so, what mechanisms are involved? The discovery of plant aquaporins (water-channel proteins) by Maurel et al. (1993) has given us new insights into how plants might regulate transcellular water flow and intracellular osmotic equilibration. Clearly, plants could alter both the abundance and the activity of aquaporins to modulate transmembrane water flow (for reviews, seeChrispeels and Maurel, 1994; Maurel, 1997). Aquaporins are members of a large gene family (Weig et al., 1997) and the elucidation of the physiological function(s) of the individual members will require a combination of experimental approaches, including expression studies, creation of plants in which expression is down-regulated or knocked out, and examination of water fluxes across the membranes of individual cells or vesicles derived from specific membranes. Because of the potential role of aquaporins in regulating water flow in plants, a number of studies have focused on the sites of aquaporin gene expression. Yamamoto et al. (1991) showed that TobRB7, a putative plasma membrane aquaporin of tobacco, is highly expressed in the meristem and in the immature central cylinder of roots. We demonstrated that the Arabidopsis aquaporin γ-TIP is highly expressed in vascular bundles of roots and leaves (Ludevid et al., 1992). Yamada et al. (1995) analyzed the expression pattern of the aquaporin MIP A in roots of Mesembryanthenum crystallinum and found that this plasma membrane aquaporin is preferentially expressed in the epidermis and in the youngest portions of the xylem. Kaldenhoff et al. (1995) showed that AthH2, a plasma membrane aquaporin, is highly expressed in newly formed tissues and organs. Most recently, Sarda et al. (1997)demonstrated high expression of SunTIP7 and SunTIP20 in the guard cells of sunflower leaves. This expression pattern is in agreement with the suggestion by Maurel et al. (1997a) that TIPs play a role in osmotic equilibration of the cytoplasm. In this paper we use in situ hybridization to examine the expression pattern of ZmTIP1, a highly expressed tonoplast aquaporin of maize, in tissues and cells involved in water and solute uptake and transport. This newly described maize tonoplast aquaporin has already been shown to be expressed in zones of cell elongation and enlargement (Chaumont et al., 1998). Here we show that this tonoplast water channel is also highly expressed in cell types that are thought to regulate water flow and/or are sites of intense solute or water transport: the root epidermis, the root endodermis, the small parenchyma cells surrounding mature xylem vessels in the root and the stem, phloem companion cells and a ring of cells around the phloem strand in the stem and the leaf sheath, the outer layer of the nucellus, and the basal endosperm transfer cells in developing kernels. To our knowledge, there is presently no evidence that plant aquaporins transport solutes. The high level of expression of ZmTIP1 in these tissues may facilitate rapid intracellular osmotic equilibration and permit rapid water flow through the vacuoles in tissues experiencing transcellular water flow. This transcellular flow may be regulated at the plasma membrane, which is less permeable to water than the tonoplast (Maurel et al., 1997b; Niemietz and Tyerman, 1997). Taken together, our results strongly suggest a role for tonoplast water channels in regulating the hydraulic permeability of the vacuolar membranes and in adjusting the water homeostasis of the protoplasm under various physiological conditions. MATERIALS AND METHODS Plant Material and Growth Conditions All experiments were carried out with the inbred line of maize (Zea mays Oh43). For root studies, surface-sterilized seeds were germinated on filter paper moistened with water in the dark at 30°C for 72 h. For the analysis of other tissues, seeds were germinated and grown in a mixture of sand, peat moss, and horticultural Perlite (Aztec Perlite, Escondido, CA) containing the controlled-release fertilizer Osmocote (Scotts-Sierra, Maysville, OH). The plants were grown in a greenhouse under natural light conditions and watered daily. Preparation of Riboprobes The 3′-untranslated region of the ZmTIP1 cDNA (203 bp) (Chaumont et al., 1998) was subcloned in pBluescript SK to provide a template to generate sense and antisense RNA probes. The plasmid was linearized using appropriate restriction endonucleases, and digoxigenin-labeled RNA probes were prepared using a digoxigenin RNA-labeling mix (Boehringer Mannheim) and either T3 or T7 RNA polymerase (Promega). After ethanol precipitation, the probes were resuspended in 100 μL of hybridization buffer (6× SSC [1 × SSC is 150 mm NaCl, 15 mmNa3C6H5O7], 3% [w/v] SDS, 50% [v/v] formamide, and 100 μg mL−1 tRNA) and stored at −80°C before use. Tissue Preparation Maize tissues were fixed in 50% (v/v) ethanol with 5% (v/v) acetic acid and 3.7% (v/v) formaldehyde (Huijser et al., 1992) at room temperature for 3 to 4.5 h with occasional degassing under vacuum for 15 min. After fixation, the tissues were dehydrated through an alcohol series. Ethanol was gradually replaced by Histoclear (National Diagnostics, Manville, NJ) and Paraplast Plus (Sigma) chips were added. Tissues were incubated at 60°C for 2 h before the Histoclear/Paraplast mix was replaced by melted Paraplast. After five to six changes of Paraplast followed by a 3-h incubation at 60°C, tissues were finally embedded in Paraplast Plus blocks and stored at 4°C before sectioning. The embedded tissues were sectioned into 8- to 10-μm-thick slices and placed on Superfrost/Plus slides (Fisher Scientific). Sections were dried and affixed to the slides by incubating the slides on a hot plate at 45°C for 18 h, dewaxed with Histoclear (National Diagnostics), and hydrated by passing through an alcohol series. The sections were then treated successively with 0.2 m HCl for 20 min and with 1 μg mL−1 proteinase K in 100 mm Tris-HCl pH 8.0, 50 mm EDTA pH 8.0 for 30 min. The proteinase K was blocked by incubating the tissues in 2 mg mL−1 Gly in PBS for 2 min. Subsequently, the sections were treated with 4% formaldehyde in PBS for 10 min, followed by two rinses of 5 min each in PBS and two rinses of 5 min each in water. Finally, the sections were dehydrated through an alcohol series to 100% ethanol and dried under vacuum. In Situ Hybridization The in situ hybridization protocol used was a modified procedure based on the work of Marrison and Leech (1994). The ZmTIP1sense and antisense probes were hybridized to the tissue sections overnight at 50°C at a concentration of 200 to 400 ng mL−1 in 40 μL of hybridization buffer (6× SSC, 3% [w/v] SDS, 50% [v/v] formamide, and 100 μg mL−1 tRNA). After the hybridization, the coverslips were removed with gentle stirring in wash buffer (2× SSC, 50% [v/v] formamide) at room temperature and the sections were incubated two times for 90 min in wash buffer at 50°C. An RNase A treatment (10 μg mL−1 in 2× SSC) was performed at 37°C for 30 min and the slides were washed for another hour at 50°C in wash buffer. After a brief wash in TBS buffer (100 mm Tris-HCl, pH 7.5, and 400 mm NaCl), sections were incubated successively for 1 h in a blocking solution (Boehringer Mannheim, 0.5% in TBS) and 30 min in 1% (w/v) BSA, 0.3% (v/v) Triton X-100 in TBS. The sections were then incubated for 90 min in the same solution containing alkaline phosphatase-conjugated antibodies (Boehringer Mannheim) at a 1/1000 dilution. After three washes of 20 min each in 1% (w/v) BSA, 0.3% (v/v) Triton X-100 in TBS, the ZmTIP1 transcripts were detected by incubating the slides in color development solution (0.15 mg mL−1 nitroblue tetrazolium chloride and 0.075 mg mL−1 5-bromo-4-chloro-3-indolyl-phosphate in 100 mm Tris-HCl pH 9.5, 100 mm NaCl, and 50 mm MgCl2) for 16 to 36 h. The color reaction was stopped by washing the slides two times for 5 min in water. Sections were finally dehydrated through an alcohol series to 100% ethanol and dried under vacuum. Image Processing Photographs of the sections were made under dark-field conditions using an Optiphot-2 light microscope (Nikon). The slides were digitized using a slide scanner (CoolScan, Nikon). Brightness and contrast were adjusted using Photoshop 3.0 (Adobe Systems, Mountain View, CA). Composite figures were prepared in Canvas 3.5 (Deneba Software, Miami, FL) and printed using a dye-sublimation color printer (Phaser IIsdx, Tektronix, Wilsonville, OR). RESULTS Expression of ZmTIP1 in Tips of Primary Maize Roots Recent results from our laboratory (Chaumont et al., 1998) indicate that the tonoplast aquaporin ZmTIP1 is highly expressed in all plant organs and especially in meristematic and elongating cells and in vascular bundles. The expression in the xylem and the phloem vascular bundles suggests a possible involvement in long-distance water transport, and we therefore made a detailed study of ZmTIP1 expression in roots, leaves, stems, and flowers of maize, especially in relation to possible transporting tissues. The absorption of water and solutes is one of the major functions of the root system of plants. A longitudinal section through a root tip shows successively a root cap, overlapping zones of rapid cell division and cell elongation, and a zone in which the root is covered by root hairs (Fig. 1B). To determine the level of ZmTIP1 mRNA accumulation, we probed cross-sections of roots taken at different distances from the tip with a gene-specific antisense ZmTIP1 mRNA labeled with digoxigenin. The RNA-RNA hybrids were visualized with alkaline phosphatase-conjugated antibodies to digoxigenin. The chromogen used here produced a red to purple, insoluble reaction product, and the intensity of the red color indicates the abundance of the mRNA per volume of cytoplasm. Figure 1A represents a typical result of a control hybridization with aZmTIP1 sense probe used on a cross-section through the middle of the elongation zone. Nonspecific hybridization was very low, indicated by the faint pink color in the section shown in Figure 1A, but no specific red precipitate could be detected. A comparison of Figure 1, A and D, shows the difference between the sense probe (control) and the antisense probe. Fig. 1. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in maize root tip. Transverse sections of the root tip were hybridized with ZmTIP1 sense (A) or antisense (C–F) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. A, Control transverse section in the middle of the elongation zone hybridized with aZmTIP1 sense probe. B, Schematic representation of a longitudinal section of a root tip. Discontinuous arrows indicate the approximate sites of transverse sections presented in D, E, and F. C, High magnification of the area boxed in D. Arrow indicates the expression of ZmTIP1 in epidermal cells. Arrowheads indicate the probe accumulation in the parenchyma cells that surround the small early metaxylem vessels. Xv, Xylem vessels. D, Transverse section at the end of the elongation zone. Arrow indicates the expression of ZmTIP1 in epidermal cells. E, Transverse section in the middle of the elongation zone. Arrow indicatesZmTIP1 expression in the endodermis/pericycle. Arrowheads indicate the probe accumulation around the early metaxylem vessels. F, Transverse sections in the meristematic zone. Fig. 1. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in maize root tip. Transverse sections of the root tip were hybridized with ZmTIP1 sense (A) or antisense (C–F) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. A, Control transverse section in the middle of the elongation zone hybridized with aZmTIP1 sense probe. B, Schematic representation of a longitudinal section of a root tip. Discontinuous arrows indicate the approximate sites of transverse sections presented in D, E, and F. C, High magnification of the area boxed in D. Arrow indicates the expression of ZmTIP1 in epidermal cells. Arrowheads indicate the probe accumulation in the parenchyma cells that surround the small early metaxylem vessels. Xv, Xylem vessels. D, Transverse section at the end of the elongation zone. Arrow indicates the expression of ZmTIP1 in epidermal cells. E, Transverse section in the middle of the elongation zone. Arrow indicatesZmTIP1 expression in the endodermis/pericycle. Arrowheads indicate the probe accumulation around the early metaxylem vessels. F, Transverse sections in the meristematic zone. To analyze the changes in ZmTIP1 expression, we made transverse sections of different regions of the root, including the meristematic zone (Fig. 1F) and the beginning (Fig. 1E) and the end (Fig. 1D) of the elongation zone. In the meristem itself close to the tip (Fig. 1F), the probe was detected in all cells, but some differences in signal intensities were observed. Cells of the epidermis and a ring of cells at the interface of the cortex and the stele, which likely represent the maturing endodermis/pericycle, contained higher signal density than did cortical cells. At the beginning of the elongation zone (Fig. 1E), the signal was still observed in elongating cortical cells and in the root epidermis, but a higher level of transcripts was observed in the endodermis/pericycle cell layers (Fig. 1E, arrow). More interestingly, the probe was also concentrated in parenchyma cells adjacent to the small, early metaxylem vessels (Fig. 1E, white arrowheads) and not next to the bigger, late metaxylem vessels. At the end of the elongation zone (Fig. 1D), the cortical cells are elongated and the vacuole occupies most of the intracellular volume. The signal intensity was much lower in the cortex and the endodermis/pericycle but remained strong in the epidermis layer (Fig.1D, arrow). The area that is boxed in Figure 1D is shown at higher magnification in Figure 1C. At this magnification the greater expression in the epidermis is clearly visible (arrow in Fig. 1C). The probe was also detected in the cytoplasmic part of some cortical cells. A careful examination of the probe concentration in the stele revealed some accumulation in the parenchyma cells that surround the small (and functional) early metaxylem vessels (Fig. 1C, arrowheads) but not around the large ones. At this level, only a weak accumulation ofZmTIP1 transcripts was found in the endodermal cells. Expression of ZmTIP1 in Mature Maize Root To find out if expression in mature sections of the root might be different from sections close to the tip, we probed transverse sections of mature maize roots, about 12 cm from the root tip, with aZmTIP1 probe (Fig. 2). The most striking aspect of the distribution of ZmTIP1 aquaporin expression at this greater distance from the tip was the high level of signal in the parenchyma cells that surround the early and late metaxylem (Fig. 2A). In late metaxylem, expression of ZmTIP1was localized in the two or three layers of cells surrounding the vessel and forming the xylem parenchyma (Fig. 2A, arrowheads). Probe accumulation was also strong in the parenchyma of the early metaxylem vessels (Fig. 2A, arrows) and was limited there to the first layer of cells. A weak signal was also detected in the endodermal cells. Figure2B represents another control experiment carried out with aZmTIP1 sense probe and shows that no signal was detected in these conditions. At 12 cm from the root tip there is no epidermis (the cells have died and been sloughed off) and the outermost cell layer of the root now consists of a hypodermis (Varney et al., 1993), in which we detected no accumulation of ZmTIP1 mRNA (data not shown). Fig. 2. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in mature maize root. Transverse sections of the root (10–12 cm from the tip) were hybridized with ZmTIP1 antisense (A) or sense (B) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. A, Expression ofZmTIP1 in the parenchyma cells of early (arrows) and late (arrowheads) xylem vessels. Xv, Xylem vessels; Ph, phloem strand. B, Control section hybridized with a ZmTIP1 sense probe. Fig. 2. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in mature maize root. Transverse sections of the root (10–12 cm from the tip) were hybridized with ZmTIP1 antisense (A) or sense (B) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. A, Expression ofZmTIP1 in the parenchyma cells of early (arrows) and late (arrowheads) xylem vessels. Xv, Xylem vessels; Ph, phloem strand. B, Control section hybridized with a ZmTIP1 sense probe. Expression of ZmTIP1 in Maize Stem To determine whether this aquaporin is expressed in similar cell types in the stem as in the root, we analyzed the sites of expression of the ZmTIP1 in mid-mature stems about 1.5 cm in diameter. A transverse section hybridized with sense probe (control) is shown in Figure 3B. Hybridization of theZmTIP1 antisense probe to a transverse stem section resulted in a high intensity of staining in the epidermal cells (Fig. 3A, arrow). The vascular bundles also had a high level of ZmTIP1transcripts (Fig. 3A, arrowhead). There was some stain in the cortex cells but these cells appear less intensely stained than the vascular bundles because they are large and vacuolated. Whether the expression of ZmTIP1 (expressed per volume of cytoplasm) is actually less in the cortex than in the vascular bundles cannot be determined. Fig. 3. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in the vascular bundles and epidermis of stems and in the vascular bundles of leaves. Transverse sections of stems (A–D) and leaf sheaths (E–H) of 5-week-old maize plants were hybridized withZmTIP1 antisense (A, C, D, E, F, and G) or sense (B and H) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. Cc, Companion cells; Ph, phloem strand; St, sieve tubes; Xv, xylem vessels. A, Expression ofZmTIP1 in the epidermis (arrow) and in cells close to the vascular bundles (arrowhead) of maize stem. B, Control section of maize stem hybridized with a ZmTIP1 sense probe. C, Expression of ZmTIP1 in cells close to a peripheral vascular bundle of the stem. Arrow indicates the high accumulation of ZmTIP1 transcripts in parenchyma cells around the phloem bundle. D, Expression of ZmTIP1 in cells close to a central vascular bundle of the stem. E and F, Expression of ZmTIP1 in cells close to small (E) and large (F) vascular bundles of maize leaf. Arrows indicate the high concentration of the probe in parenchyma cells located between the phloem strand and the xylem vessels. G, High magnification of the phloem strand presented in F showing expression ofZmTIP1 in parenchyma cells (white arrows) and companion cells (black arrows). H, Control section of a leaf phloem strand hybridized with a ZmTIP1 sense probe. Fig. 3. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in the vascular bundles and epidermis of stems and in the vascular bundles of leaves. Transverse sections of stems (A–D) and leaf sheaths (E–H) of 5-week-old maize plants were hybridized withZmTIP1 antisense (A, C, D, E, F, and G) or sense (B and H) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. Cc, Companion cells; Ph, phloem strand; St, sieve tubes; Xv, xylem vessels. A, Expression ofZmTIP1 in the epidermis (arrow) and in cells close to the vascular bundles (arrowhead) of maize stem. B, Control section of maize stem hybridized with a ZmTIP1 sense probe. C, Expression of ZmTIP1 in cells close to a peripheral vascular bundle of the stem. Arrow indicates the high accumulation of ZmTIP1 transcripts in parenchyma cells around the phloem bundle. D, Expression of ZmTIP1 in cells close to a central vascular bundle of the stem. E and F, Expression of ZmTIP1 in cells close to small (E) and large (F) vascular bundles of maize leaf. Arrows indicate the high concentration of the probe in parenchyma cells located between the phloem strand and the xylem vessels. G, High magnification of the phloem strand presented in F showing expression ofZmTIP1 in parenchyma cells (white arrows) and companion cells (black arrows). H, Control section of a leaf phloem strand hybridized with a ZmTIP1 sense probe. The maize stem has a well-defined gradient of size and maturation of both the vascular bundles and the cortical cells (Fig. 3B). Near the center of the stem the cortical cells are larger than at the periphery and the vessels in the central bundles are also much larger than in the peripheral bundles (Fig. 3B). Panels C and D both show more centrally located larger vascular bundles; the bundle shown in D was closer to the center than the one shown in C. As in the roots, the parenchyma that surrounds the xylem vessels was intensely stained, whereas the region of the phloem was relatively unstained. This picture is clearly seen in both bundles. A ring of parenchyma cells around the phloem bundle is clearly stained more intensely in Fig. 3C (arrow) than in Fig. 3D. Expression of ZmTIP1 in Maize Leaves The expression pattern of ZmTIP1 in maize leaves resembles closely the pattern observed in the stem. The images shown here are from tissue sections close to the top of the leaf sheath. In either the small (Fig. 3E) or the larger vascular bundles (Fig. 3F), the ZmTIP1 transcripts were abundant throughout the xylem parenchyma and around the phloem strands. A ring of cells surrounding the phloem strand exhibited the highest concentration of the probe in the cells facing the xylem strand (Fig. 3, E and F, arrows). Figure 3G represents a higher magnification of the phloem strand shown in Figure3F and confirms that the ZmTIP1 transcripts are especially abundant in the parenchyma cells between the xylem vessel and the phloem strand (Fig. 3G, arrows). At this magnification, it was possible to observe some punctate signals in the phloem strand that may represent ZmTIP1 expression in the phloem companion cells (Fig. 3G). Figure 3H represents the result of a hybridization with aZmTIP1 sense probe on a leaf phloem bundle and shows that no specific signal was observed in these conditions. Expression of ZmTIP1 in Developing Maize Pistils and Kernels In developing maize pistils (i.e. before fertilization), a single sessile ovule consisting of a nucellus with integuments develops within the ovary made up of fused carpels. After fertilization and as the seed develops, the ovary wall will become the pericarp and the integuments will give rise to the seed coat. Each ovule develops near the end of a vascular bundle and transport of materials through this bundle will nourish the developing seed. At the stage of ovule development shown in Figure 4A, expression ofZmTIP1 can be detected in the vascular strand under the ovule (Fig. 4A, arrowheads) and in a well-defined ring of tissue at the periphery of the nucellus (Fig. 4A, arrow). Higher magnification of the developing ovule confirms the presence of the probe in the vascular tissue (Fig. 4B, arrowhead) and in the outer layer(s) of the nucellus (Fig. 4B, arrow). Again, no significant reaction product was detected in tissues hybridized with a ZmTIP1 sense probe (Fig. 4C). Fig. 4. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in developing pistils and caryopses of maize. Longitudinal sections of nonfertilized maize ears 7-cm long (A–C) and developing maize caryopses 14 d after pollination (D and E) were hybridized withZmTIP1 antisense (A, B, D, and E) or sense (C) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. C, Carpel wall; En, endosperm; I, integuments; N, Nucellus; Pe, Pedicel; Per, Pericarp; Pl, Placenta-chalaza. A, Section of a developing pistil showing expression of ZmTIP1 in the termination zone of the vascular bundle under the ovule (arrowheads) and around the nucellus (arrow). B, High magnification of the developing ovule presented in A showing expression of ZmTIP1 in the vascular tissue (arrowhead) and in the outer layer(s) of the nucellus (arrow). C, Control section of a developing pistil hybridized with a ZmTIP1 sense probe. D, Expression of ZmTIP1 in the basal region of the developing caryopse. The ZmTIP1 transcripts are detected in the pedicel area (arrowheads) and in a zone of the endosperm that is adjacent to the pedicel (arrows). E, High magnification of the pedicel area presented in D showing expression of ZmTIP1 in the basal endosperm transfer cells (BETC). F, Schematic representation of the three main tissues shown in E (adapted from Thorne, 1985). Red arrows within the cells indicate probable symplastic intercellular transport of assimilates and water. Blue arrows over the cell walls indicate apoplastic movement of assimilates and water. Fig. 4. Open in new tabDownload slide In situ localization of ZmTIP1 mRNA in developing pistils and caryopses of maize. Longitudinal sections of nonfertilized maize ears 7-cm long (A–C) and developing maize caryopses 14 d after pollination (D and E) were hybridized withZmTIP1 antisense (A, B, D, and E) or sense (C) digoxigenin-labeled RNA probes and photographed under dark-field conditions. The transcript signal is red. C, Carpel wall; En, endosperm; I, integuments; N, Nucellus; Pe, Pedicel; Per, Pericarp; Pl, Placenta-chalaza. A, Section of a developing pistil showing expression of ZmTIP1 in the termination zone of the vascular bundle under the ovule (arrowheads) and around the nucellus (arrow). B, High magnification of the developing ovule presented in A showing expression of ZmTIP1 in the vascular tissue (arrowhead) and in the outer layer(s) of the nucellus (arrow). C, Control section of a developing pistil hybridized with a ZmTIP1 sense probe. D, Expression of ZmTIP1 in the basal region of the developing caryopse. The ZmTIP1 transcripts are detected in the pedicel area (arrowheads) and in a zone of the endosperm that is adjacent to the pedicel (arrows). E, High magnification of the pedicel area presented in D showing expression of ZmTIP1 in the basal endosperm transfer cells (BETC). F, Schematic representation of the three main tissues shown in E (adapted from Thorne, 1985). Red arrows within the cells indicate probable symplastic intercellular transport of assimilates and water. Blue arrows over the cell walls indicate apoplastic movement of assimilates and water. We also determined the sites of ZmTIP1 expression in developing kernels 14 d after pollination. ZmTIP1transcripts were detected at the base of the kernels in two distinct and well-defined tissues: the phloem termination that connects the developing kernel to the cob—this tissue is called the pedicel (Fig.4D)—and that portion of the endosperm that is adjacent to the pedicel (Fig. 4D). This region is referred to as the basal endosperm transfer cell layer. Basal endosperm transfer cells are specialized cells thought to mediate the transfer of nutrients from the maternal tissues into the developing seed. In this tissue the highest expression is closest to the pedicel and expression diminishes in both directions as one moves away from the pedicel. No transcripts were detected in the central endosperm cells and in the pericarp (data not shown). Higher magnification (Fig. 4E) indicated that ZmTIP1 was expressed in several layers of basal endosperm transfer cells. No signal was detected in the placenta-chalaza region (Fig. 4E). Figure 4F shows a schematic representation of the three main tissues in Figure 4E: the pedicel, the placenta chalaza, and the basal endosperm transfer tissue. Red arrows within the cells indicate probable symplastic intercellular transport, whereas the blue arrows over the cell walls indicate apoplastic movement of assimilates and water (Thorne, 1985). DISCUSSION According to the composite transport model of Steudle (1994a,1994b), water moves along distinct but parallel transport pathways through the apoplast and through cells (symplastic and transcellular flows) and has to overcome barriers specific for each pathway. Cellular membranes pose a major barrier to transcellular flow and Casparian strips pose a major barrier for the apoplastic flow. Since the discovery of the first tonoplast aquaporin, Arabidopsis γ-TIP, numerous other aquaporins have been found in both the plasma membrane and the vacuolar membrane of plant cells, and multiple roles for aquaporins in transmembrane water flow have been postulated (for review, see Maurel, 1997). However, because of an absence of functional studies, we do not yet understand the roles that these proteins play in the physiology of the plant. One way to approach function is to carefully study the expression patterns of the genes that encode these proteins. The expression patterns of aquaporins and putative aquaporins (major intrinsic proteins) have been studied by RNA gel-blot analysis, in situ hybridization, and expression analysis of promoter-GUS fusions in transgenic plants (see Maurel, 1997, and refs. therein). In this study we used a gene-specific probe to measure ZmTIP1 mRNA abundance and we assumed that this will translate into protein abundance, although this was not always the case. High expression of TIPs in meristematic cells and zones of cell elongation demonstrated by in situ hybridization (Yamamoto et al., 1991; Barrieu et al., 1998; Chaumont et al., 1998) is consistent with the conclusion that these proteins are needed for the biogenesis of new vacuoles and to sustain the high rate of water influx into the vacuole associated with cell enlargement. Some aquaporin genes are also highly expressed in vascular bundles and other tissues that are thought to be involved in water transport (Yamamoto et al., 1991; Ludevid et al., 1992; Kaldenhoff et al., 1995; Yamada et al., 1995; Daniels et al., 1996). These expression patterns are consistent with two postulated functions of aquaporins: a role for TIPs in intracellular osmotic equilibration, and a role for PIPs in the regulation of transcellular water transport. These two roles may intersect in cells that participate in solute transport, because solute entry into cells via channels or transporters or via a symplastic route (plasmodesmata) may necessitate osmotic equilibration between cytoplasm and vacuole and may require transcellular water flow (e.g. for phloem loading). To our knowledge there is at present no evidence that plant aquaporins participate in solute transport. Recent results (Maurel et al., 1997b;Niemietz and Tyerman, 1997) indicate that tonoplast-derived vesicles are 10 to 100 times more permeable to water than plasma membrane-derived vesicles. Given the high hydraulic conductivity of the tonoplast, the regulation of transcellular water flow is more likely to occur at the plasma membrane than at the tonoplast. The expression patterns we obtained for ZmTIP1 are discussed in this framework of postulated aquaporin functions. The Limitations of in Situ Hybridization In situ hybridization, which measures the abundance of mRNA, has definite advantages over promoter GUS fusions to study gene expression (Taylor, 1997). Gene-specific probes make it possible to study the expression of individual genes, and the specificity of the probe used in this work has been documented (Chaumont et al., 1998). However, it is difficult to compare different cell types, especially if they differ in cytoplasmic content or the relative volume taken up by the vacuole. Thus, the intensity of the signal reflects the abundance of cytoplasm as well as the abundance of the mRNA under study. Furthermore, abundance of mRNA does not always translate into abundance of protein, because of posttranscriptional regulation of gene expression. In addition, aquaporin activity may be regulated by posttranslational modification (Johansson et al., 1998). It is tempting to extrapolate from mRNA abundance to hydraulic conductivity of the membrane, but we must keep in mind that there are many other points of regulation. Expression in the Epidermis The uptake and movement of solutes and water in roots are complex processes that are still being unraveled (for review, see McCully, 1995). According to Varney and Canny (1993), water uptake is similar in the part of the root having a living epidermis (root tips and the branch roots) as in the zone of the main root where the epidermal cells have already died (Varney and Canny, 1993), suggesting that the epidermis may not be important for water uptake. The observation thatZmTIP1 is highly expressed in the epidermis of the root tip is therefore puzzling. The expression in the epidermis of the meristem and elongation zone is undoubtedly related to the need to sustain vacuolar biogenesis and the influx of water for cell elongation (seeChaumont et al., 1998). Cells that leave the meristematic zone elongate rapidly and the volume of maize root epidermal cells can increase up to 40-fold during their development (Moore and Smith, 1990). The high expression of ZmTIP1 in the epidermis could indicate a role for ZmTIP1 in osmotic equilibration of the cytoplasm. Epidermal cells are in contact with the soil solution and are involved in nutrient uptake. This uptake process and the sudden changes in water potential in the root environment may necessitate a capacity for rapid osmotic equilibration of the cytoplasm with the water from the vacuole and may be the reason for the high water permeability of the tonoplast (Maurel et al., 1997b; Niemietz and Tyerman, 1997) (see Fig.5A). Such a role for TIPs was first suggested by Maurel et al. (1997a) for α-TIP. Fig. 5. Open in new tabDownload slide Schematic representation of two roles for tonoplast aquaporins. A, Tonoplast aquaporins are needed for cytoplasmic osmotic equilibration in cells that can experience rapid fluxes of metabolites or mineral nutrients. B, Tonoplast aquaporins permit rapid transcellular flow and increase the effective cross-section of the cytoplasm for symplastic flow. Fig. 5. Open in new tabDownload slide Schematic representation of two roles for tonoplast aquaporins. A, Tonoplast aquaporins are needed for cytoplasmic osmotic equilibration in cells that can experience rapid fluxes of metabolites or mineral nutrients. B, Tonoplast aquaporins permit rapid transcellular flow and increase the effective cross-section of the cytoplasm for symplastic flow. Expression in the Xylem Parenchyma One of our most striking findings was that ZmTIP1 is highly expressed in the xylem parenchyma cells of mature roots, stems, and leaves. Hydrostatic pressure drives water flow in and out of the xylem vessels and water has to go through the xylem parenchyma cells before entering the vessels. In addition, in the case of root pressure, water is thought to enter the xylem vessels because of the buildup of an osmotic gradient across the root endodermis (White et al., 1958). In stems and leaves, the small parenchyma cells surrounding the xylem vessels have an active role in establishing a water potential gradient necessary for the radial exit of water from the xylem vessels into the growing tissues (Nonami and Boyer, 1993). Moreover, the recent findings of daily embolism and repair of the water column in xylem vessels (Canny, 1997; McCully, 1997) provide an additional possible function for the xylem parenchyma cells in the control and/or the regulation of the cavitation events occurring in these vessels. Thus, the high expression of the ZmTIP1 tonoplast aquaporin in xylem parenchyma cells would facilitate a transcellular water flow and allow these cells to control water movement in and out of the xylem vessels (see Fig. 5B). Expression in the Endodermis The high level of expression of ZmTIP1 we observed in the endodermis/pericycle region of the root tip may be related to the function of this tissue prior to its functional differentiation. The most striking feature of the endodermis is the encrustment of the cell walls with lipid material (suberin) that forms the Casparian strip (Esau, 1977). The function of the Casparian strip in the terminal 10 cm of the root is unclear. In the root portion between 10 and 50 cm from the tip, the endodermis clearly limits radial water transport. However, closer to the tip, the endodermis appears to be quite permeable to water (Frensch et al., 1996). This high permeability may be the result of the high expression of aquaporin observed here if water transport through this cell layer is transcellular. Alternatively, the high expression of tonoplast aquaporin may again be related to the need for osmotic equilibration of the cytosol with vacuolar water. Cells may have to cope with rapid changes in osmotic pressure (caused by influx of ions or metabolites) in the terminal 10 cm of the root. Nutrient uptake is high in root tips, and root tips are also prime sites for phloem unloading (Oparka et al., 1994). Rapid changes in nutrient uptake as the root grows and changes in phloem unloading may result in osmotic imbalances that have to be accommodated in the cytoplasm by the rapid influx or outflux of water to and from the vacuole. Expression in the Phloem Bundles The phloem is the major pathway for long-distance transport of assimilates. In leaves, the entry of solutes in the sieve tubes of phloem bundles, controlled by the companion cells (for review, seeSauer, 1997), creates an osmotic pressure difference that results in rapid water entry into the sieve tubes. Assimilates and water entering the phloem strands are then transported to different parts of the plant, where they are unloaded. Köckenberger et al. (1997)recently demonstrated that water is internally recirculated between the phloem and the xylem. Phloem ends are therefore sites of rapid metabolite and water transport, although such transport may also occur all along the phloem strand. The high expression of ZmTIP1in the cells between the phloem and the xylem strands (Fig. 3) are in agreement with the findings of Köckenberger et al. (1997)mentioned above. In developing pistils and caryopses, assimilates are unloaded from the phloem terminals located either underneath the ovule or in the pedicel. The high expression of tonoplast aquaporins in the companion cells, the cells surrounding the phloem strands and the phloem terminals, suggests an important role for tonoplast water channels in cells involved in solute transport. The changes in solute concentration that probably occur at these sites as a result of solute transport and the recirculation of water probably necessitate an increased capacity for intracellular osmotic equilibration between cytosol and vacuole. In addition, high levels of tonoplast aquaporins may facilitate transcellular water movement. The high expression of ZmTIP1 in certain tissues of the nucellus and the developing kernels lead to a similar conclusion. The pedicel, where assimilates transported to the grain are unloaded from the phloem, is part of the maternal tissue that surrounds the developing embryo and the large, starchy endosperm. The veins reticulate and terminate within the parenchyma of the pedicel. Numerous plasmodesmata connect the cytoplasm of these parenchyma cells, providing a symplastic route for assimilates when they exit the sieve tubes and intermediary cells (Felker and Shannon, 1980; Thorne, 1985). Assimilates then enter the apoplast of the placenta-chalaza, which is also a maternal tissue, and diffuse apoplastically. Uptake of assimilates by the endosperm is finally facilitated by the conversion of the outer layer of the endosperm (aleurone layer) to transfer cells (Felker and Shannon, 1980). At this point, assimilates re-enter the symplast and are translocated throughout the endosperm. We observed high expression of ZmTIP1 in the two tissues where transport of assimilates is symplastic, and no expression in the placenta-chalaza region, where transport is apoplastic. Using promoter-GUS fusions,Ludevid et al. (1992) also observed high expression of the aquaporin γ-TIP in the pedicel of Arabidopsis. These observations confirm the idea that a high permeability of the tonoplast to water is necessary in cells that can be exposed to rapid changes in cytosolic metabolite concentration. In conclusion, although aquaporins probably do not transport solutes, the results presented here show that a tonoplast aquaporin is abundantly expressed in those cell types where rapid transport of inorganic solutes and metabolites occurs. We postulate that such cellular activities necessitate a capacity for rapid adjustment of the water potential of the cytoplasm and that this is facilitated by the high water permeability of the tonoplast. Until we know whether transcellular water flow is regulated at the plasma membrane or at the tonoplast, we have to assume that the high level of expression of tonoplast aquaporins may also permit the rapid transcellular flow of water in these tissues. ACKNOWLEDGMENTS The authors are grateful to Gary Ditta, Cristina Ferrandiz, and Martin Yanofsky (University of California, San Diego) for their advice and assistance with the in situ hybridization experiments. We thank Margaret McCully (Carleton University, Ottawa) for her helpful comments about ZmTIP1 expression in roots. We are also grateful to Christophe Maurel (Centre National de la Recherche Scientifique, Gif-sur-Yvette, France) for his critical comments on the manuscript. Abbreviation: MIP major intrinsic protein PIP plasma membrane intrinsic protein TIP tonoplast intrinsic protein LITERATURE CITED 1 Barrieu F Thomas D Marty-Mazars D Charbonnier M Marty F Tonoplast intrinsic proteins from cauliflower (Brassica oleracea L. var. botrytis): immunological analysis, cDNA cloning and evidence for expression in meristematic tissues. Planta 204 1998 335 344 Google Scholar Crossref Search ADS PubMed WorldCat 2 Canny MJ Vessel contents during transpiration: embolisms and refilling. Am J Bot 84 1997 1223 1230 Google Scholar Crossref Search ADS PubMed WorldCat 3 Chaumont F Barrieu F Herman EM Chrispeels MJ Characterization of a maize tonoplast aquaporin expressed in zones of cell division and elongation. Plant Physiol 117 1998 1143 1152 Google Scholar Crossref Search ADS PubMed WorldCat 4 Chrispeels MJ Maurel C Aquaporins: the molecular basis of facilitated water movement through living plant cells. Plant Physiol 105 1994 9 13 Google Scholar Crossref Search ADS PubMed WorldCat 5 Daniels MJ Chaumont F Mirkov TE Chrispeels MJ Characterization of a new vacuolar membrane aquaporin sensitive to mercury at a unique site. Plant Cell 8 1996 587 599 Google Scholar PubMed OpenURL Placeholder Text WorldCat 6 Esau K (1977) Anatomy of Seed Plants. John Wiley, New York, pp 221–223 7 Felker FC Shannon JC Movement of 14C-labeled assimilates into kernels of Zea mays L. III. An anatomical examination and microautoradiographic study of assimilate transfer. Plant Physiol 65 1980 864 870 Google Scholar Crossref Search ADS PubMed WorldCat 8 Frensch J Hsiao TC Steudle E Water and solute transport along developing maize roots. Planta 198 1996 348 355 Google Scholar Crossref Search ADS WorldCat 9 Huijser P Klein J Lonnig WE Meijer H Saedler H Sommer H Bracteomania, an inflorescence anomaly, is caused by the loss of function of the MADS-box gene squamosa in Antirrhinum majus. EMBO J 11 1992 1239 1249 Google Scholar Crossref Search ADS PubMed WorldCat 10 Johansson I Karlsson M Shukla VK Chrispeels MJ Larsson C Kjellbom P Water transport activity of the plasma membrane aquaporin PM28A is regulated by phosphorylation. Plant Cell 10 1998 451 459 Google Scholar Crossref Search ADS PubMed WorldCat 11 Kaldenhoff R Kölling A Meyers J Karmann U Ruppel G Richter G The blue light-responsive AthH2 gene of Arabidopsis thaliana is primarily expressed in expanding as well as in differentiating cells and encodes a putative channel protein of the plasmalemma. Plant J 7 1995 97 95 Google Scholar Crossref Search ADS PubMed WorldCat 12 Köckenberger W Pope JM Xia Y Jeffrey KR Komor E Callaghan PT A non-invasive measurement of phloem and xylem water flow in castor bean seedlings by nuclear magnetic resonance microimaging. Planta 201 1997 53 63 Google Scholar Crossref Search ADS WorldCat 13 Ludevid D Höfte H Himelblau E Chrispeels MJ The expression pattern of the tonoplast intrinsic protein γ-TIP in Arabidopsis thaliana is correlated with cell enlargement. Plant Physiol 100 1992 1633 1639 Google Scholar Crossref Search ADS PubMed WorldCat 14 Marrison JL Leech RM The subcellular and intra-organelle recognition of nuclear and chloroplast transcripts in developing leaf cells. Plant J 6 1994 605 614 Google Scholar Crossref Search ADS WorldCat 15 Maurel C Aquaporins and water permeability of plant membranes. Annu Rev Plant Physiol Plant Mol Biol 48 1997 399 429 Google Scholar Crossref Search ADS PubMed WorldCat 16 Maurel C Chrispeels MJ Lurin M Tacnet F Geelen D Ripoche P Guern J Function and regulation of plant seed aquaporins. J Exp Bot 48 1997a 421 430 Google Scholar Crossref Search ADS WorldCat 17 Maurel C Reizer J Schroeder JI Chrispeels MJ The vacuolar membrane protein γ-TIP creates water specific channels in Xenopus oocytes. EMBO J 12 1993 2241 2247 Google Scholar Crossref Search ADS PubMed WorldCat 18 Maurel C Tacnet F Guclu J Guern J Ripoche P Purified vesicles of tobacco cell vacuolar and plasma membranes exhibit dramatically different water permeability and water channel activity. Proc Natl Acad Sci USA 94 1997b 7103 7108 Google Scholar Crossref Search ADS WorldCat 19 McCully M How do real roots work? Plant Physiol 109 1995 1 6 Google Scholar Crossref Search ADS PubMed WorldCat 20 McCully M A microscopist's view of root water relations (abstract no. 20001). Plant Physiol 114 1997 S-4 Google Scholar OpenURL Placeholder Text WorldCat 21 Moore R Smith H Morphometric analysis of epidermal differentiation in primary roots of Zea mays. Am J Bot 77 1990 727 735 Google Scholar Crossref Search ADS PubMed WorldCat 22 Niemietz CM Tyerman ST Characterization of water channels in wheat root membrane vesicles. Plant Physiol 115 1997 561 567 Google Scholar Crossref Search ADS PubMed WorldCat 23 Nonami H Boyer JS Direct demonstration of a growth-induced water potential gradient. Plant Physiol 102 1993 13 19 Google Scholar Crossref Search ADS PubMed WorldCat 24 Oparka KJ Duckett CM Prior DAM Fisher DB Real-time imaging of phloem unloading in the root tip of Arabidopsis. Plant J 6 1994 759 766 Google Scholar Crossref Search ADS WorldCat 25 Sarda X Tousch D Ferrare K Legrand E Dupuis JM Casse-Delbart F Lamaze T Two TIP-like genes encoding aquaporins are expressed in sunflower guard cells. Plant J 12 1997 1103 1111 Google Scholar Crossref Search ADS PubMed WorldCat 26 Sauer N Sieve elements and companion cells: extreme division of labour. Trends Plant Sci 2 1997 285 286 Google Scholar Crossref Search ADS WorldCat 27 Schreiber L Chemical composition of Casparian strips isolated from Clivia miniata Reg. roots: evidence for lignin. Planta 199 1996 596 601 Google Scholar Crossref Search ADS WorldCat 28 Steudle E The regulation of plant water at the cell, tissue, and organ level: role of active processes and of compartmentation. Schulze E-D Flux Control in Biological Systems: From the Enzyme to the Population and Ecosystem Level. 1994a 237 299 Academic Press San Diego, CA 29 Steudle E Water transport across roots. Plant Soil 167 1994b 79 90 Google Scholar Crossref Search ADS WorldCat 30 Taylor CB Promoter fusion analysis: an insufficient measure of gene expression. Plant Cell 9 1997 273 275 Google Scholar Crossref Search ADS WorldCat 31 Thorne JH Phloem unloading of C and N assimilates in developing seeds. Annu Rev Plant Physiol Plant Mol Biol 36 1985 317 343 Google Scholar Crossref Search ADS WorldCat 32 Varney GT Canny MJ Rates of water uptake into the mature root system of maize plants. New Phytol 123 1993 775 786 Google Scholar Crossref Search ADS WorldCat 33 Varney GT McCully ME Canny MJ Sites of entry of water into the symplast of maize roots. New Phytol 125 1993 733 741 Google Scholar Crossref Search ADS PubMed WorldCat 34 Weig A, Deswarte C., Chrispeels MJ (1997) The major intrinsic protein family of Arabidopsis has 23 members that form three distinct groups with functional aquaporins in each group. Plant Physiol 114: 1347–1357 35 White PR Schuker E Kern JR Fuller FH Root-pressure in gymnosperms. Science 128 1958 308 309 Google Scholar Crossref Search ADS PubMed WorldCat 36 Yamada S Katsuhara M Kelly W Michalowski C Bohnert H A family of transcripts encoding the water channel proteins: tissue-specific expression in the common ice plant. Plant Cell 7 1995 1129 1142 Google Scholar PubMed OpenURL Placeholder Text WorldCat 37 Yamamoto YT Taylor CG Acedo GN Cheng CL Conkling MA Characterization of cis-acting sequences regulating root-specific gene expression in tobacco. Plant Cell 3 1991 371 382 Google Scholar PubMed OpenURL Placeholder Text WorldCat Author notes 1 This work was supported by a grant from the National Science Foundation (Cell Biology). F.C. was supported by a European Molecular Biology Organization fellowship. * Corresponding author; e-mail [email protected]; fax 1–619–534–4052. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Serino, Germán; Maliga, Pal

doi: 10.1104/pp.117.4.1165pmid: 9701572

Abstract Plastid genes in photosynthetic higher plants are transcribed by at least two RNA polymerases. The plastid rpoA, rpoB, rpoC1, and rpoC2 genes encode subunits of the plastid-encoded plastid RNA polymerase (PEP), an Escherichia coli-like core enzyme. The second enzyme is referred to as the nucleus-encoded plastid RNA polymerase (NEP), since its subunits are assumed to be encoded in the nucleus. Promoters for NEP have been previously characterized in tobacco plants lacking PEP due to targeted deletion ofrpoB (encoding the β-subunit) from the plastid genome. To determine if NEP and PEP share any essential subunits, therpoA, rpoC1, and rpoC2genes encoding the PEP α-, β′-, and β"-subunits were removed by targeted gene deletion from the plastid genome. We report here that deletion of each of these genes yielded photosynthetically defective plants that lack PEP activity while maintaining transcription specificity from NEP promoters. Therefore, rpoA,rpoB, rpoC1, and rpoC2 encode PEP subunits that are not essential components of the NEP transcription machinery. Furthermore, our data indicate that no functional copy ofrpoA, rpoB, rpoC1, orrpoC2 that could complement the deleted plastidrpo genes exists outside the plastids. At least two distinct RNA polymerases are involved in the transcription of plastid genes in photosynthetic higher plants. One of these contains homologs of the Escherichia coli enzyme, including the α-, β-, β′-, and β"-subunits encoded in the plastid rpoA, rpoB, rpoC1, andrpoC2 genes, and is referred to as PEP. The promoters for PEP are reminiscent of the E. coliς70-type promoters, and have two conserved hexameric blocks of sequences (TTGACA or “-35” element; TATAAT or “−10” element) 17 to 19 nucleotides apart. Transcription from PEP promoters initiates 5 to 7 nucleotides downstream of the “−10” promoter element (Igloi and Kössel, 1992; Gruissem and Tonkyn, 1993; Link, 1996). Promoter specificity to PEP is conferred by nuclear-encoded ς-like factors (Isono et al., 1997; Tanaka et al., 1997). Several reports indicate the existence of a second, NEP activity (Morden et al., 1991; Hess et al., 1993; Allison et al., 1996). A candidate for NEP is an approximately 110-kD protein that has properties similar to the mitochondrial and phage T3/T7 RNA polymerases that may be part of a larger complex (Lerbs-Mache, 1993; Hedtke et al., 1997). NEP promoters share a loose, 10-nucleotide consensus, ATAGAATA/GAA, overlapping the transcription-initiation site, which is reminiscent of promoters recognized by the mitochondrial and phage T3/T7 RNA polymerases (Hajdukiewicz et al., 1997; Hübschmann and Börner, 1998; for review, see Maliga, 1998). Plastid RNA polymerase activities with distinct sensitivities to inhibitors are present in higher plants in multisubunit complexes (Pfannschmidt and Link, 1994). Sharing of essential subunits of RNA polymerases has been reported in yeast (Sentenac et al., 1992). Therefore, plastid NEP and PEP could be part of the same complex. To test if NEP and PEP share any essential subunits, therpo genes encoding PEP subunits were removed by targeted gene deletion from the plastid genome. Study of promoter activity in plastids lacking the rpoB gene has shown that the PEP β-subunit is essential for PEP transcription activity, but it is not required for transcription by NEP (Allison et al., 1996;Hajdukiewicz et al., 1997). This study addresses the contribution of the rpoA,rpoC1, and rpoC2 genes to transcription from PEP and NEP promoters. We report here that deletion of each of these genes yields photosynthetically defective plants that lack PEP activity while maintaining transcription from NEP promoters. Therefore,rpoA, rpoB, rpoC1, andrpoC2 encode essential PEP subunits that are not components of the NEP transcription machinery. Furthermore, no functional copy of the rpo genes that could complement the deleted plastidrpo genes exists outside the plastid. MATERIALS AND METHODS Plasmid Construction Plasmid pGS95 carries the tobacco (Nicotiana tabacum) ptDNA HincII fragment (sites are at nucleotides 78990–82117 in the ptDNA) (Shinozaki et al., 1986), cloned into theEcoRV site of a pBSKS+ (Stratagene) plasmid derivative with the ScaI site removed. The BglII/ScaI fragment (sites are at positions 80549 and 81466) containing therpoA-coding region was replaced by a chimeric spectinomycin-resistance gene (aadA) from plasmid pOVZ34 as a BamHI/SmaI fragment (note that theBamHI and BglII ends are compatible). Plasmid pOVZ34 is a pUC119 plasmid derivative and carries the aadAgene in a psbA cassette as in plastid vector pOVZ15 (Zoubenko et al., 1994). Plasmid pGS97 carries the PstI/Psp1406I ptDNA fragment (sites are at nucleotides 20283 and 25662) cloned intoPstI/AccI-digested pBSIIKS+ plasmid (Stratagene). Note that AccI and Psp1406I ends are compatible. In the cloned ptDNA fragment most of therpoC1-coding region is contained between AccI sites at positions 21797 and 23840. The rpoC1-coding region between the indicated AccI sites was replaced with a chimeric aadA gene as a BspHI/Acc65I fragment (ends were rendered blunt with T4 DNA polymerase) from plasmid pOVZ11, a pUC118 plasmid derivative. The pOVZ11 plasmid carries the Prrn::aadA::TpsbAchimeric gene in plastid vector pPRV112 (Zoubenko et al., 1994). Plasmid pGS99 carries the tobacco ptDNA SacI fragment (sites are at nucleotides 15662 and 22658) cloned intoSacI-digested pBSIIKS+ plasmid (Stratagene). TherpoC2-coding region was excised as aStuI/BsrGI fragment (sites are at nucleotides 17397 and 21048) and replaced with the chimeric aadA gene (BspHI/Acc65I fragment) from plasmid pOVZ11, as described for pGS97. Plastid Transformation Tungsten particles were coated with pGS95, pGS97, or pGS99 plasmid DNA and introduced into plastids of tobacco leaves with a particle-delivery system (PDS1000He, Bio-Rad) (Svab and Maliga, 1993). Transgenic shoots were regenerated on spectinomycin-containing (500 μg/mL) RMOP medium containing Murashige and Skoog salts (Murashige and Skoog, 1962), 3% Suc, 1.0 mg/L 6-benzylaminopurine, and 0.1 mg/L naphthaleneacetic acid (Svab et al., 1990). White sectors lacking rpo genes were identified in variegated leaves during propagation on antibiotic-free plant maintenance (RM) medium (Murashige and Skoog salts and 3% Suc; Murashige and Skoog, 1962). Uniformly transformed white shoots were regenerated from white sectors in spectinomycin-free RMOP medium. The ΔrpoBplants were described previously (Allison et al., 1996). DNA and RNA Gel Blots Total leaf DNA (Mettler, 1987) was digested with restriction endonucleases and electrophoresed in 0.7% agarose gels (3 μg per lane). For the RNA gel blots, total leaf RNA was extracted using the TRIzol reagent (GIBCO-BRL) and electrophoresed in 1% agarose/formaldehyde gels (5 μg of RNA per lane). RNA and DNA gels were transferred to N-Hybond membranes (Amersham) with the PosiBlot Transfer apparatus (Stratagene). Nucleic acid hybridization was carried out for 3 or more h at 65°C in Rapid Hybridization buffer (Amersham) with [32P]dCTP-labeled double-stranded DNA probes synthesized by random priming (Boehringer-Mannheim). The following gene probes were used: 16SrDNA,EcoRI/EcoRV fragment, sites are at nucleotides 138447 and 140855 in the tobacco ptDNA; atpB, PCR amplified with primers GCAGGAGCAGGGTCGGTCAAATC and GAGAGGAATGGAAGTGATTGACA (fragment ends are at nucleotides 55751–56512 of the tobacco ptDNA);clpP, fragment PCR amplified with primers GAGGGAATGCTAGACG and GACTTTATCGAGAAAG (ends are at nucleotides 73340–73621 of the tobacco ptDNA); rbcL, BamHI fragment (restriction sites are at nucleotides 58047–59285 of the tobacco ptDNA);accD, fragment PCR amplified with primers GGATTTAGGGGCGAA and GTGATTTTCTCTCCG (ends are at nucleotides 60211–60875 of the tobacco ptDNA); cytoplasmic 25S rRNA gene, fragment PCR amplified with primers TCACCTGCCGAATCAACTAGC and GACTTCCCTTGCCTACATTG. Primer-Extension Reactions Reactions were carried out with 10 μg of total leaf RNA (Allison and Maliga, 1995) using the following primers: 16SrDNA, TTCATAGTTGCATTACTTATAGCTTC (5′ nucleotide complementary to 102757); clpP, GGGACTTTTGGAACACCAATAGGCAT (5′ at nucleotide 74479);rbcL, ACTTGCTTTAGTCTCTGTTTGTGGTGACAT (5′ nucleotide complementary to 57616); accD, ccgagcTCTTATTTCCTATCAGACTAAGC (5′ nucleotide complementary to 59758); and atpB, CCCCAGAACCAGAAGTAGTAGGATTGA (5′ nucleotide at 56736). The primers listed above were previously used to map transcription-initiation sites of these genes (Allison et al., 1996;Hajdukiewicz et al., 1997). Lowercase nucleotides are nonplastidic sequences. The position of RNA 5′ ends was determined using these same primers and homologous DNA templates as the reference. Sequence ladders were generated with the Sequenase II kit (Amersham). RESULTS Targeted Deletion of rpoA, rpoC1, andrpoC2 from the Plastid Genome Yields Pigment-Deficient Plants To construct vectors for targeted deletion of the rpogenes, ptDNA fragments were cloned in Bluescript plasmids. Subsequently, the rpo-coding region in the cloned ptDNA fragment was replaced by a selectable spectinomycin-resistance gene (aadA) (Fig. 1, A–C). The size of the deletion in the targeting plasmids was: rpoA, 90% of the coding region; rpoC1, 63% of the coding region (80% of the 3′ exon); and rpoC2, 73% of the coding region. The transforming DNA was introduced into tobacco chloroplasts in leaf cells by the biolistic process. Targeted deletion of therpo genes was achieved by replacement of the coding region with aadA as the result of two homologous recombination events via the flanking ptDNA sequences (Fig. 1, A–C). Culture of the bombarded leaf segments on spectinomycin-containing RMOP medium facilitated shoot regeneration with transformed plastid genomes. Since the chimeric aadA gene is transcribed by PEP, cells carrying only knockout plastid genomes are sensitive to spectinomycin. Therefore, the developing green shoots and calli contained plastids with a mixed population of knockout plastid genomes expressingaadA, and wild-type plastid genomes expressing the targetedrpo subunit gene (Fig. 2A). To facilitate formation of homoplasmic sectors, the shoots regenerating on the leaf segments were excised and transferred onto antibiotic-free plant maintenance medium. Plastid genome sorting in developing shoots facilitated formation of chimeric leaves, with white sectors containing a uniform population of knockout plastid genomes and green sectors with wild-type ptDNA (Fig. 2B). A second cycle of shoot regeneration from the white sectors yielded white plants (Fig. 2C). These plants carry a uniform population of transformed ptDNA lacking rpoA (Fig.1, A and D), rpoC1 (Fig. 1, B and D), or rpoC2(Fig. 1, C and D). Fig. 1. Open in new tabDownload slide Targeted deletion of rpo genes from the plastid genome. A, Deletion of the rpoA gene. Homologous recombination events (hatched lines) between ptDNA sequences in vector pGS95 and the tobacco plastid genome yields a genome lackingrpoA. Probes for Southern blots in D are marked with thick horizontal lines. Map position of the probed restriction fragments with size in kilobases is shown below the maps.aadA, Chimeric spectinomycin resistance gene (Svab and Maliga, 1993); rpoA, rpoB,rpoC1, and rpoC2, the plastid genes encoding the α-, β-, β′-, and β"-subunits of PEP, respectively;atpI, petD, rps2, andrps11, plastid genes (Shinozaki et al., 1986). Restriction endonuclease cleavage sites: H, HincII; X,XbaI; Bg, BglII; Sc, ScaI; P, PstI; B, BamHI; Pp,Psp1406I; A, AccI; SI,SacI; SII, SacII; StI,StuI; E, EcoRV; Bs, BsrGI. Brackets indicate restriction sites eliminated during cloning. B, Deletion of the rpoC1 gene. Homologous recombination events (crossed lines) between ptDNA sequences in vector pGS97 and the tobacco plastid genome yields a genome lacking rpoC1. C, Deletion of therpoC2 gene. Homologous recombination events (crossed lines) between ptDNA sequences in vector pGS99 and the tobacco plastid genome yields a genome lacking rpoC2. D, Southern probing demonstrates a uniform population of transformed plastid genomes. Total cellular DNA was isolated from the leaves of plants transformed with plasmids pGS95 (targeting rpoA), pGS97 (targeting rpoC1), and pGS99 (targetingrpoC2), and from wild-type green leaves (WT). Data are shown for two independently transformed lines (pGS95-2, pGS95-3), or two plants derived from the same transformation event (pGS97-2.2, pGS97-2.3 and pGS99-4.1, pGS99-4.4). Fig. 1. Open in new tabDownload slide Targeted deletion of rpo genes from the plastid genome. A, Deletion of the rpoA gene. Homologous recombination events (hatched lines) between ptDNA sequences in vector pGS95 and the tobacco plastid genome yields a genome lackingrpoA. Probes for Southern blots in D are marked with thick horizontal lines. Map position of the probed restriction fragments with size in kilobases is shown below the maps.aadA, Chimeric spectinomycin resistance gene (Svab and Maliga, 1993); rpoA, rpoB,rpoC1, and rpoC2, the plastid genes encoding the α-, β-, β′-, and β"-subunits of PEP, respectively;atpI, petD, rps2, andrps11, plastid genes (Shinozaki et al., 1986). Restriction endonuclease cleavage sites: H, HincII; X,XbaI; Bg, BglII; Sc, ScaI; P, PstI; B, BamHI; Pp,Psp1406I; A, AccI; SI,SacI; SII, SacII; StI,StuI; E, EcoRV; Bs, BsrGI. Brackets indicate restriction sites eliminated during cloning. B, Deletion of the rpoC1 gene. Homologous recombination events (crossed lines) between ptDNA sequences in vector pGS97 and the tobacco plastid genome yields a genome lacking rpoC1. C, Deletion of therpoC2 gene. Homologous recombination events (crossed lines) between ptDNA sequences in vector pGS99 and the tobacco plastid genome yields a genome lacking rpoC2. D, Southern probing demonstrates a uniform population of transformed plastid genomes. Total cellular DNA was isolated from the leaves of plants transformed with plasmids pGS95 (targeting rpoA), pGS97 (targeting rpoC1), and pGS99 (targetingrpoC2), and from wild-type green leaves (WT). Data are shown for two independently transformed lines (pGS95-2, pGS95-3), or two plants derived from the same transformation event (pGS97-2.2, pGS97-2.3 and pGS99-4.1, pGS99-4.4). Fig. 2. Open in new tabDownload slide Isolation of homoplasmic ΔrpoAplants. A, Callus and shoots carrying a mixed population of wild-type and ΔrpoA plastid genomes are green. B, Chimeric leaves with white (transgenic) and green (wild-type) sectors. C, White, homoplasmic ΔrpoA plant with transgenomes only. Fig. 2. Open in new tabDownload slide Isolation of homoplasmic ΔrpoAplants. A, Callus and shoots carrying a mixed population of wild-type and ΔrpoA plastid genomes are green. B, Chimeric leaves with white (transgenic) and green (wild-type) sectors. C, White, homoplasmic ΔrpoA plant with transgenomes only. Plastid Transcript Accumulation Pattern Is Similar in All Plastidrpo-Deleted Mutants Deletion of genes for essential PEP subunits prevents assembly of functional PEP enzyme. In the absence of PEP activity, mRNAs will accumulate at significant levels only from NEP promoters. The mRNAs initiating from PEP promoters will be absent. However, transcripts for genes with PEP promoters only may be present at low levels due to read-through transcription from upstream NEP promoters and processing (Allison et al., 1996; Hajdukiewicz et al., 1997). We expect that if NEP and PEP share a subunit, deletion of the relevant rpogene should prevent mRNA accumulation from both PEP and NEP promoters. Therefore, steady-state mRNA level in the Δrpo plants was determined for a number of plastid genes (Fig.3). The rbcL gene in tobacco plastids is transcribed from a PEP promoter. Accumulation ofrbcL mRNA in each of the rpo deletion derivatives at significantly reduced (25-fold lower) levels is consistent with the lack of transcription from the PEP promoter, and with the accumulation of processed read-through transcripts (Allison et al., 1996). TheatpB, 16SrDNA, and clpP genes have both PEP and NEP promoters (Allison et al., 1996; Hajdukiewicz et al., 1997). High steady-state levels of mRNAs for each of these genes in theΔrpo plants is consistent with sustained NEP promoter activity. The accD gene in tobacco is transcribed from a NEP promoter from which mRNA accumulation in wild-type chloroplasts is low, while it is highly elevated in ΔrpoB plants (Hajdukiewicz et al., 1997). Accumulation of accD mRNA in therpoA, rpoC1, and rpoC2 deletion derivatives is elevated as in the ΔrpoB plants (Fig. 3). Sustained NEP activity in the rpo-deleted plants indicates the lack of contribution of the PEP α-, β′-, and β"-subunit to NEP function. Fig. 3. Open in new tabDownload slide Accumulation of plastid mRNAs in wild-type and plastid rpo gene deletion derivatives. Data are shown for genes carrying only PEP promoters (rbcL), only NEP promoters (accD), or PEP and NEP promoters (clpP, 16S rDNA, atpB) in wild-type, ΔrpoA, ΔrpoB,ΔrpoC1, and ΔrpoC2 leaves. The excess of wild-type over Δrpo intensities (average of the four Δrpo lines) for each probe is given in parentheses. Gel blots were prepared with total leaf RNA (5 μg per lane) from wild-type plants, and in plants transformed with plasmids pGS95 (ΔrpoA), pGS97 (ΔrpoC1), and pGS99 (ΔrpoC2). Upper panels show blots probed for plastid genes. Lower panels show loading controls, obtained by probing the same filters for the cytoplasmic 25S rRNA. The blots were scanned with a phosphor imager (Molecular Dynamics, Sunnyvale, CA). Hybridization signals were quantified with Imagequant software (Molecular Dynamics) and normalized to the 25S rRNA signal. Fig. 3. Open in new tabDownload slide Accumulation of plastid mRNAs in wild-type and plastid rpo gene deletion derivatives. Data are shown for genes carrying only PEP promoters (rbcL), only NEP promoters (accD), or PEP and NEP promoters (clpP, 16S rDNA, atpB) in wild-type, ΔrpoA, ΔrpoB,ΔrpoC1, and ΔrpoC2 leaves. The excess of wild-type over Δrpo intensities (average of the four Δrpo lines) for each probe is given in parentheses. Gel blots were prepared with total leaf RNA (5 μg per lane) from wild-type plants, and in plants transformed with plasmids pGS95 (ΔrpoA), pGS97 (ΔrpoC1), and pGS99 (ΔrpoC2). Upper panels show blots probed for plastid genes. Lower panels show loading controls, obtained by probing the same filters for the cytoplasmic 25S rRNA. The blots were scanned with a phosphor imager (Molecular Dynamics, Sunnyvale, CA). Hybridization signals were quantified with Imagequant software (Molecular Dynamics) and normalized to the 25S rRNA signal. Promoter Utilization Is Identical in All rpoDeletion Lines Many of the plastid genes have multiple promoters. Therefore, it was important to show which of the promoters are active in theΔrpo plants. Transcription activity from previously characterized NEP and PEP promoters was determined by mapping transcript 5′ ends with primer-extension analysis. The photosynthetic rbcL gene is transcribed from a single PEP promoter (PrbcL-182 in wild-type tobacco chloroplasts [Shinozaki and Sugiura, 1982]). This promoter is not active in therpo-deletion derivatives (Fig.4). The 5′ end at position −59 (indicated by in Fig. 4) derives from longer transcripts by processing in both wild-type and Δrpo mutants (Mullet et al., 1985; Allison et al., 1996). The atpB gene in wild-type tobacco is transcribed from four promoters (Fig. 4; Hajdukiewicz et al., 1997). The PatpB-255, PatpB-488/-502, and PatpB-611 PEP promoters are active in the wild-type, but not in the Δrpo plants (Fig. 4). In contrast, the PatpB-289 NEP promoter is active in the leaves of wild-type and Δrpo plants. The tobacco rRNA operon (rrn) has one promoter for each of the two RNA polymerases (Vera and Sugiura, 1995; Allison et al., 1996). The PEP promoter initiates transcription 113 and 114 bp upstream of the mature 16SrRNA in wild-type leaves, whereas it is inactive in the rpo-deleted plants. In contrast, the Prrn-62 NEP promoter is inactive in wild-type leaves, but active in the rpo deletion derivatives (Fig. 4). The clpP gene is transcribed from four promoters (Hajdukiewicz et al., 1997; fig. 5B). Although the PEP transcript (PclpP-95) is absent in allrpo-deleted lines, the activity of the three NEP promoters (PclpP-53, PclpP-173, PclpP-511) is evident in the Δrpo mutants (Fig. 4; Hajdukiewicz et al., 1997). Finally, accD has one NEP promoter. This promoter, located 129 bp upstream of the accD- coding region (Hajdukiewicz et al., 1997), is active in the lines deficient in the PEP α-, β-, β′-, and β"-E. coli-like subunits (Fig.4). In summary, the PEP promoters (six tested) were inactive, whereas transcription initiated at the same position from each of the six NEP promoters tested in the rpoA-, rpoB-, rpoC1-, andrpoC2-deletion derivatives. Fig. 4. Open in new tabDownload slide Mapping of transcription-initiation sites in plastids of wild-type and rpo-deletion derivatives. Primer-extension data are shown for the rbcL,atpB, 16SrDNA, clpP, andaccD genes. Mapped NEP (•) and PEP (○) promoters are identified by the distance between the transcription-initiation site and the translation-initiation codon (ATG) in nucleotides (Allison et al., 1996; Hajdukiewicz et al., 1997). Processing sites are also marked (). Schematic maps with transcription-initiation sites for NEP and PEP promoters are shown at the bottom of the figure. Fig. 4. Open in new tabDownload slide Mapping of transcription-initiation sites in plastids of wild-type and rpo-deletion derivatives. Primer-extension data are shown for the rbcL,atpB, 16SrDNA, clpP, andaccD genes. Mapped NEP (•) and PEP (○) promoters are identified by the distance between the transcription-initiation site and the translation-initiation codon (ATG) in nucleotides (Allison et al., 1996; Hajdukiewicz et al., 1997). Processing sites are also marked (). Schematic maps with transcription-initiation sites for NEP and PEP promoters are shown at the bottom of the figure. DISCUSSION The first successful targeted deletion of a plastid RNA polymerase subunit gene was that of rpoB from the tobacco plastid genome (Allison et al., 1996). We report here deletion of the genes for the remaining core subunits of the plastid-encoded RNA polymerase (rpoA, rpoC1, and rpoC2). We propose that deletion of the rpo genes from the plastid genome is possible because NEP, an alternative, nucleus-encoded enzyme transcribes all essential housekeeping and metabolic genes. Attempts at targeted deletion of the plastid rpoB1, rpoB2, orrpoC2a genes in the unicellular alga Chlamydomonas reinhardtii failed to yield homoplasmic cells lacking PEP (Rochaix, 1997). Therefore, C. reinhardti may not have NEP, or it may have NEP but transcription of at least some of the essential genes is dependent on PEP. NEP promoters are active in the liverwortMarchantia polymorpha and the conifer Pinus contorta, indicating duplication of the plastid-transcription machinery early during the evolution of the land plants (D. Silhavy and P. Maliga, unpublished data). Deletion of the plastid rpo genes in this study led to the loss of transcription from ς70-type PEP promoters and to a mutant phenotype. These findings indicate that subunits of the E. coli-like plastid RNA polymerase are the products of plastid genes and that no functional copy of therpo genes exists outside the plastids, which could complement the deleted-plastid rpo genes. Our experiments extend the earlier work of Bogorad and coworkers, who provided evidence for the contribution of the plastid rpo genes to the plastid RNA polymerase activity by sequencing the N-terminal amino acids of a purified maize RNA polymerase (Hu and Bogorad, 1990; Hu et al., 1991). Contribution of plastid rpo genes to plastid RNA polymerase activity was also shown by the sensitivity of in vitro transcription to antibodies obtained in rabbits immunized with fusion peptides expressed from genes containing rpo gene segments (Little and Hallick, 1988). We report here that deletion of the plastid-encoded PEP subunit genes does not affect NEP transcription specificity, so PEP subunits are not shared with NEP. The α-subunit gene could be deleted without interfering with the expression of other plastid genes sincerpoA is the last open reading frame of the rpl23operon. Interpretation of data in plants lacking the β"-subunit gene was also unambiguous, since rpoC2 is the last gene of therpoB operon. rpoC1 is the second gene of therpoB operon, which, after deletion of rpoC1,consists of three genes: rpoB, aadA (replacingrpoC1), and rpoC2. Since polycistronic mRNAs are efficiently translated on the plastid ribosomes (Staub and Maliga, 1995), it is likely that deletion of rpoC1 does not interfere with the expression of the downstream rpoC2 gene. Furthermore, deletion of rpoC1 could only affect the expression of rpoC2 already shown to be nonessential for NEP activity. Transcription of the rpoB operon initiates 345 nucleotides upstream of rpoB (nucleotide position 27846 in the plastid genome; G. Serino and P. Maliga, unpublished data). In the previously described ΔrpoB plant (Allison et al., 1996), expression of the entire rpoB operon should be affected since the deletion included the operon promoter. Therefore, the ΔrpoC2, ΔrpoC1, and ΔrpoB plants form a series lacking the β" (ΔrpoC2), β′ and possibly β" (ΔrpoC1), and β, β′, and β" (ΔrpoB) PEP subunits. Collectively, these data indicate that none of the PEP subunits is part of the NEP complex. Identification of NEP subunits will depend on purification of the NEP enzyme and development of an in vitro transcription assay. Important steps in this direction were the cloning of the gene for a 113-kD protein, the likely catalytic subunit of NEP (Hedtke et al., 1997), and identification of promoters recognized by the NEP-transcription machinery (Allison et al., 1996; Hajdukiewicz et al., 1997;Hübschmann and Börner, 1998). Abbreviations: NEP nuclear-encoded plastid RNA polymerase PEP plastid-encoded plastid RNA polymerase ptDNA plastid DNA LITERATURE CITED 1 Allison A Simon D Maliga P Deletion of rpoB reveals a second distinct transcription system in plastids of higher plants. EMBO J 15 1996 2802 2809 Google Scholar Crossref Search ADS PubMed WorldCat 2 Allison LA Maliga P Light-responsive and transcription-enhancing elements regulate the plastid psbD core promoter. EMBO J 14 1995 3721 3730 Google Scholar Crossref Search ADS PubMed WorldCat 3 Gruissem W Tonkyn JC Control mechanisms of plastid gene expression. Crit Rev Plant Sci 12 1993 19 55 Google Scholar Crossref Search ADS WorldCat 4 Hajdukiewicz PTJ Allison LA Maliga P The two RNA polymerases encoded by the nuclear and the plastid compartments transcribe distinct groups of genes in tobacco plastids. EMBO J 16 1997 4041 4048 Google Scholar Crossref Search ADS PubMed WorldCat 5 Hedtke B Börner T Weihe A Mitochondrial and chloroplast phage-type RNA polymerases in Arabidopsis. Science 277 1997 809 811 Google Scholar Crossref Search ADS PubMed WorldCat 6 Hess WR Prombona A Fieder B Subramanian AR Börner T Chloroplast rps15 and the rpoB/C1/C2 gene cluster are strongly transcribed in ribosome-deficient plastids: evidence for a functioning non-chloroplast-encoded RNA polymerase. EMBO J 12 1993 563 571 Google Scholar Crossref Search ADS PubMed WorldCat 7 Hu J Bogorad L Maize chloroplast RNA polymerase: the 180-, 120-, and 38-kilodalton polypeptides are encoded in chloroplast genes. Proc Natl Acad Sci USA 87 1990 1531 1535 Google Scholar Crossref Search ADS PubMed WorldCat 8 Hu J Troxler RF Bogorad L Maize chloroplast RNA polymerase: the 78-kilodalton polypeptide is encoded by the plastid rpoC1 gene. Nucleic Acids Res 19 1991 3431 3434 Google Scholar Crossref Search ADS PubMed WorldCat 9 Hübschmann T Börner T Characterization of transcription initiation sites in ribosome-deficient barley plastids. Plant Mol Biol 36 1998 493 496 Google Scholar Crossref Search ADS PubMed WorldCat 10 Igloi GL Kössel H The transcriptional apparatus of chloroplasts. Crit Rev Plant Sci 10 1992 525 558 Google Scholar OpenURL Placeholder Text WorldCat 11 Isono K Shimizu M Yoshimoto K Niwa Y Satoh K Yokota A Kobayashi H Leaf-specifically expressed genes for polypeptides destined for chloroplasts with domains for ς70 factors of bacterial RNA polymerases in Arabidopsis thaliana. Proc Natl Acad Sci USA 94 1997 14948 14953 Google Scholar Crossref Search ADS PubMed WorldCat 12 Lerbs-Mache S The 110-kDa polypeptide of spinach plastid DNA-dependent RNA polymerase: single-subunit enzyme or catalytic core of multimeric enzyme complexes? Proc Natl Acad Sci USA 90 1993 5509 5513 Google Scholar Crossref Search ADS PubMed WorldCat 13 Link G Green life: control of chloroplast gene transcription. Bioessays 18 1996 465 471 Google Scholar Crossref Search ADS WorldCat 14 Little MC Hallick RB Chloroplast rpoA, rpoB, and rpoC genes specify at least three components of a chloroplast DNA-dependent RNA polymerase active in tRNA and mRNA transcription. J Biol Chem 263 1988 14302 14307 Google Scholar Crossref Search ADS PubMed WorldCat 15 Maliga P Two plastid RNA polymerases of higher plants: an evolving story. Trends Plant Sci 3 1998 4 6 Google Scholar Crossref Search ADS WorldCat 16 Mettler IJ A simple and rapid method for minipreparation of DNA from tissue cultured plant cells. Plant Mol Biol Rep 5 1987 346 349 Google Scholar Crossref Search ADS WorldCat 17 Morden CW Wolfe KH dePamphilis CW Palmer JD Plastid translation and transcription in a non-photosynthetic plant: intact, missing and pseudo genes. EMBO J 10 1991 3281 3288 Google Scholar Crossref Search ADS PubMed WorldCat 18 Mullet JE Orozco EM Chua NH Multiple transcripts for higher plant rbcL and atpB genes and localization of the transcription initiation site of the rbcL gene. Plant Mol Biol 4 1985 39 54 Google Scholar Crossref Search ADS PubMed WorldCat 19 Murashige T Skoog F A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15 1962 493 497 Google Scholar Crossref Search ADS WorldCat 20 Pfannschmidt T Link G Separation of two classes of plastid DNA-dependent RNA polymerases that are differentially expressed in mustard (Sinapis alba L.) seedlings. Plant Mol Biol 25 1994 69 81 Google Scholar Crossref Search ADS PubMed WorldCat 21 Rochaix JD Chloroplast reverse genetics: new insights into the function of plastid genes. Trends Plant Sci 2 1997 419 425 Google Scholar Crossref Search ADS WorldCat 22 Sentenac A Riva M Thuriaux P Buhler JM Treich I Carles C Werner M Ruet A Huet J Mann C and others Yeast RNA polymerase subunits and genes. Yamamoto KR McKnight SL Transcriptional Regulation. 1992 27 54 Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 23 Shinozaki K Ohme M Tanaka M Wakasugi T Hayashida N Matsubayashi T Zaita N Chunwongse J Obokata J Yamaguchi-Shinozaki K and others The complete nucleotide sequence of the tobacco chloroplast genome: its gene organization and expression. EMBO J 5 1986 2043 2049 Google Scholar Crossref Search ADS PubMed WorldCat 24 Shinozaki K Sugiura M The nucleotide sequence of the tobacco chloroplast gene for the largest subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Gene 20 1982 91 102 Google Scholar Crossref Search ADS PubMed WorldCat 25 Staub JM Maliga P Expression of a chimeric uidA gene indicates that polycistronic mRNAs are efficiently translated in tobacco plastids. Plant J 7 1995 845 848 Google Scholar Crossref Search ADS PubMed WorldCat 26 Svab Z Hajdukiewicz PTJ Maliga P Stable transformation of plastids in higher plants. Proc Natl Acad Sci USA 87 1990 8526 8530 Google Scholar Crossref Search ADS PubMed WorldCat 27 Svab Z Maliga P High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene. Proc Natl Acad Sci USA 90 1993 913 917 Google Scholar Crossref Search ADS PubMed WorldCat 28 Tanaka K Tozawa Y Mochizuki N Shinozaki K Nagatani A Wakasa K Takahashi H Characterization of three cDNA species encoding plastid RNA polymerase sigma factors in Arabidopsis thaliana: evidence for the sigma factor heterogeneity in higher plant plastids. FEBS Lett 413 1997 309 313 Google Scholar Crossref Search ADS PubMed WorldCat 29 Vera A Sugiura M Chloroplast rRNA transcription from structurally different tandem promoters: an additional novel-type promoter. Curr Genet 27 1995 280 284 Google Scholar Crossref Search ADS PubMed WorldCat 30 Zoubenko OV Allison LA Svab Z Maliga P Efficient targeting of foreign genes into the tobacco plastid genome. Nucleic Acids Res 22 1994 3819 3824 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This research was supported by the National Science Foundation (grant no. MCB96-30763). G.S. was the recipient of a Johanna and Charles Busch Predoctoral Fellowship award. * Corresponding author; e-mail [email protected]; fax 1–732–445–5735. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Morris, Paul F.; Bone, Elizabeth; Tyler, Brett M.

doi: 10.1104/pp.117.4.1171pmid: 9701573

Abstract We have investigated the role of the isoflavones daidzein and genistein on the chemotropic behavior of germinating cysts of Phytophthora sojae. Hyphal germlings were shown to respond chemotropically to daidzein and genistein, suggesting that hyphal tips from zoospores that have encysted adjacent to the root may use specific host isoflavones to locate their host. Observations of the contact response of hyphal germlings were made on several different substrates in the presence and absence of isoflavones. Hyphal tips of germlings detected and penetrated pores in membranes and produced multiple appressoria on smooth, impenetrable surfaces. Hyphae that successfully penetrated the synthetic membrane were observed to grow away from the membrane surface. The presence of isoflavones in the medium surrounding the hyphal germlings did not appear to alter any of those habits. Daidzein and genistein did not inhibit germination or initial hyphal growth at concentrations up to 20 μm. For host-specific pathogens or symbionts, the ability to recognize and move in the direction of a plant signal may be critical to the survival of the organism. Germination or chemotropism in response to a host-specific signal has now been described in several plant-fungus associations (Coley-Smith, 1990; Podila et al., 1993; Ruan et al., 1995). In bacteria, expression of nodulation genes inRhizobium and Bradyrhizobium species is induced by flavones or isoflavones (Fisher and Long, 1992), and some species such as Rhizobium meliloti also respond chemotactically to the nodulation signals (Dharmatilake and Bauer, 1992). In addition, chemotaxis to plant exudates appears to be an important factor contributing to the virulence of Agrobacterium species in heterogenous soil mixtures (Hawes and Smith, 1989). Zoospores of oömycetes also exhibit positive chemotaxis to plant-derived compounds (Zentmyer, 1961; Carlile, 1983; Horio et al., 1992; Morris and Ward, 1992; Sekizaki et al., 1993). Zoospores of the soybean pathogen Phytophthora sojae are highly sensitive to the isoflavones daidzein and genistein, which are exuded from the roots of soybeans into the rhizosphere (Morris and Ward, 1992; Tyler et al., 1996). Because six other species of Phytophthora and one species of Pythium displayed no sensitivity to these isoflavones, Morris and Ward (1992) suggested that the specific attraction to soybean isoflavones might be part of the mechanism that determines host range. Although oömycetes have a predominantly filamentous hyphal growth pattern, the relationship between soil water and disease severity suggests that zoospores are the predominant means by which pathogenic oömycetes spread throughout the soil and infect plant roots, especially in flooded soils (Duniway, 1983; Erwin and Ribeiro, 1996). Despite the complex structure and small pore size of most soils, zoospores are capable of traveling substantial distances (25–35 mm) to initiate infection within a 24-h period (Duniway, 1976). However, the majority of zoospores released from the zoosporangium on the hyphae do not reach their host and eventually form cysts. Hardham and Gubler (1990) established that both adhesion and the initial direction from which the germ tube emerges are determined at the time of encystment. Factors that influence the direction of hyphal growth after germination are less clearly defined. Autoaggregation of zoospores in the absence of an available host is characteristic of some but not all oömycetes (Reid et al., 1995). Zentmyer (1961) demonstrated thatPhytophthora cinnamoni cysts that were adjacent to the root of their host germinated rapidly and grew in the direction of the root, but the chemical signal was not identified. A chemotropic response of hyphae to nutrient sources has also been demonstrated in several saprophytic and parasitic oömycetes (Musgrave et al., 1977; Manavathu and Thomas, 1985; Jones et al., 1991). Thus, chemotropic responses of oömycetes hyphae might also contribute to their effectiveness as plant pathogens. In this study we report on an in vitro system that we have developed to study the encystment and subsequent germination of zoospores in response to soybean isoflavones. We show that both thigmotropic (contact) and specific chemotropic determinants control the direction of growth in germinating hyphae. MATERIALS AND METHODS Preparation of Zoospores and Chemotropism Assays Phytophthora sojae Kauf. & Gerd., strains P6497 and P7063 (Förster et al., 1994), were grown on vegetable juice agar, and zoospores were produced by repeated washing of plates with distilled water as described previously (Morris and Ward, 1992). These strains were used because their differential responses to daidzein and genistein have been well characterized (Tyler et al., 1996). In capillary assays, genistein is 10 and 100 times more potent than daidzein in P6497 and P7063, respectively. Chemotropism assays were performed in an assay chamber that was created by supporting a coverslip with two glass pieces on a glass slide. The weight of the coverslip was sufficient to hold a 250-μL drop of zoospores in place, and small soybean roots or 1-μL capillary tubes (Drummond microcaps) containing the isoflavones daidzein or genistein could be inserted directly into the chamber. Daidzein and genistein were obtained from Indofine Chemical (Somerville, NJ). Stock solutions of 40 μm in water were stored at −20°C. To demonstrate the chemotropic properties of hyphal germlings, a 1-μL capillary tube containing 20 μm daidzein or genistein was introduced into a chemotaxis chamber and left undisturbed for 3 h. Hyphal germlings surrounding the mouth of the capillary tube were photographed under phase-contrast optics using a BH-2 microscope (Olympus). To test the ability of uniformly dispersed cysts to germinate and reorient in response to host roots or an isoflavone gradient, P6497 zoospores were induced to encyst by adding 10 mm CaCl2 combined with vortexing for 15 s. The zoospores were then pipetted into the chemotaxis chamber and left undisturbed for 1 h. A soybean root or a capillary tube containing 20 μm genistein was then inserted into the chemotaxis chamber. A 50-μL drop of genistein was also applied to the open end of the capillary tube, which was then left undisturbed for 3 h. Quantitative Analysis of Hyphal Chemotropism The angle of hyphal growth relative to the root surfaces was determined by defining a plane parallel to the surface of the root, and measuring the angle of the hyphal tip as a deviation (in degrees) from a direction directly toward this plane. Thus, hyphal tips growing directly toward the “source” were given a value of 0°, and hyphal tips growing directly away from the source were assigned a value of 180°. The angle of hyphal growth relative to the capillary tube was determined by drawing a line from the mouth of the capillary tube to the hyphal tip. The angle was measured as a deviation from that line, so that hyphal tips that pointed directly at the tube were given a value of 0°. The distance of each hyphal tip from the source was determined by measuring the distance in the photographs and converting this value to actual distances using a photograph of a stage micrometer taken at the same magnification. A total of 231 and 279 data points were calculated from 13 and 15 photographs of capillary tubes and roots, respectively. For each data set, all points were ordered by distance, and the mean of the cosine was calculated for a 200-μm window sliding from 0 μm to the end at 20-μm intervals. A 95% confidence interval was calculated for the points in each data window using a t distribution. The number of points in each window ranged from 30 to 74. Assessment of Chemotropic and Contact Responses of Hyphal Germlings Cell-culture plates and inserts (Falcon, Fisher Scientific) were used to test the chemotropic and thixotropic (contact) responses of hyphae on a solid surface. In a typical experiment, 1 mL of swimming zoospores was placed in one well of the cell-culture plate. The isoflavone attractant was dissolved in a 0.2% agarose solution, which was added to the cell-culture insert cup. The bottom layer of the cup consisted of a porous PET membrane with 3-μm pores. When the insert cup was placed in the well containing the zoospores, the isoflavones diffused through the pores, producing a concentration gradient that caused zoospores to swim toward the membrane. After 40 min the insert was removed from the chamber and the membrane surface carefully rinsed to remove any zoospores that had not encysted on the membrane surface. The insert was then placed in a second well containing only water or water plus isoflavonoids. To compare how gravity might influence the chemotropic response of hyphae, the zoospores were also placed in the cell-culture insert, and the agarose containing the isoflavone attractant was added directly to the cell-culture well. To test the response of hyphae to a soft, smooth surface, a drop of Vitrogen 100 (Collagen Corp., Palo Alto, CA) was applied to one side of the PET membrane on the cell-insert cup and cross-linked by incubating in the presence of NH4OH vapor in a desiccation chamber for 12 h. The proteinaceous surface was rinsed briefly in distilled water and a 200-μL drop of 1 μm genistein was applied to the inner chamber of the cup. The cell-culture insert was then placed in a sample well containing swimming zoospores. After 4 h the cell-culture insert was removed and germinating hyphae on the membrane were fixed and prepared for scanning electron microscopy as described below. To test the response of hyphae to a smooth, impermeable surface, a piece of clear plastic wrap (Dow Chemical, Indianapolis, IN) was glued to the lower end of the cell-culture insert. The cell-culture insert was inverted and a 30-μL drop of 20 μm daidzein or genistein was placed on the membrane surface. The cell-culture insert was quickly turned right-side up again and placed in a well containing 1 mL of swimming zoospores (1 × 106). Encysted zoospores were left undisturbed for 40 min because initial experiments confirmed the earlier observations by Donaldson and Deacon (1992) that further mechanical perturbation of newly formed cysts delayed germination of hyphae. The insert was then removed, rinsed free of swimming zoospores, and transferred to a new well containing water or water plus isoflavones. After 4 h cells were fixed and prepared for electron microscopy. Effect of Isoflavones on Cyst Germination A cell-culture insert with affixed clear plastic wrap membrane was placed in a sample well containing swimming zoospores. Stock solutions of daidzein and genistein were added to the sample well to adjust the final isoflavone concentrations to 1 or 20 μm. CaCl2 (10 mm final concentration) was used to induce encystment of all zoospores (Griffith et al., 1988). After 2 h the cells on the plastic membrane were fixed with 2% glutaraldehyde in 0.05 mNa2HPO4, pH 7.2. Germination, hyphal germling length, and the percentage of hyphae with appressoria were counted by surveying several microscopic fields. Each experiment was repeated at least four times with both strains. Fixation and Microscopy For scanning electron microscopy, germinating cysts were fixed on membranes for 1 h in 2% glutaraldehyde in 0.05 mNa2HPO4, pH 7.2, and then rinsed in buffer. Some samples were postfixed for 2 h in 1% OsO4 in 0.05 mNa2HPO4 buffer, pH.7.2, and rinsed twice with buffer. After dehydration in a graded ethanol series, the zoospores were critical-point dried, mounted on aluminum stubs, and coated with 10 nm of gold-palladium using a sputter coater (Polaron, Milton Keynes, UK). The zoospores were viewed with a S-2700 scanning electron microscope (Hitachi, Tokyo, Japan). Hyphae that had penetrated the PET membrane were photographed by light microscopy 16 h after encystment by adjusting the plane of focus to distances progressively closer to the membrane surface. Visualization of the hyphal threads was improved by prior addition of 0.1% 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazollium bromide in 1 mm KH2PO4, pH 7.0. RESULTS When a capillary tube containing 20 μm daidzein or genistein was introduced to the chemotaxis chamber and left undisturbed, zoospores rapidly plugged the capillary tube and others encysted around the mouth of the tube. Some zoospores that had encysted farthest from the capillary tube opening germinated and grew away from the capillary tube before turning in the direction of the isoflavone source (Fig. 1). Similarly, when a soybean root was introduced to swimming zoospores, encystment occurred both on and adjacent to the root tip. Cysts adjacent to the root germinated and grew toward the root surface (not shown). To confirm that the chemotropic signal was an isoflavone and was not derived from adjacent germinating cysts, zoospores were induced to encyst randomly, then a soybean root tip or a capillary tube containing genistein was introduced into the chemotaxis chamber after cyst germination had occurred. Visual inspection of hyphae indicated that both encystment and the initial direction of hyphal growth were random. The tropic response of the hyphae toward the root was significant at distances up to about 300 μm from the root surface (Fig.2). The tropic response of hyphae toward genistein was significant at distances up to 750 μm from the mouth of the capillary tube (Fig. 3). Hyphae behaved in a similar manner in reorientation experiments using daidzein (not shown). Fig. 1. Open in new tabDownload slide Chemotropism of hyphae toward a capillary tube containing genistein (magnification ×165). Zoospores encysted around the capillary tube and the majority of cysts produced hyphae that grew in the direction of the source. Hyphae farthest from the source changed direction to grow toward the capillary tube. Fig. 1. Open in new tabDownload slide Chemotropism of hyphae toward a capillary tube containing genistein (magnification ×165). Zoospores encysted around the capillary tube and the majority of cysts produced hyphae that grew in the direction of the source. Hyphae farthest from the source changed direction to grow toward the capillary tube. Fig. 2. Open in new tabDownload slide Chemotropic growth of hyphae toward soybean root tips. Zoospores were induced to encyst in a random orientation. Approximately 3 h after the introduction of the root tip into the chemotaxis chamber, the angles of hyphal tips were measured relative to a line drawn perpendicular to the root surface. ▪, Cosine of growth angle; thick line, cosines averaged over a 200-μm window at 20-μm increments; thin lines, upper and lower 95% significance limits for cosine means calculated using a t test. The number of data points in each window ranged from 38 to 74. Chemotropism was considered significant when the lower confidence limit was greater than 0. Fig. 2. Open in new tabDownload slide Chemotropic growth of hyphae toward soybean root tips. Zoospores were induced to encyst in a random orientation. Approximately 3 h after the introduction of the root tip into the chemotaxis chamber, the angles of hyphal tips were measured relative to a line drawn perpendicular to the root surface. ▪, Cosine of growth angle; thick line, cosines averaged over a 200-μm window at 20-μm increments; thin lines, upper and lower 95% significance limits for cosine means calculated using a t test. The number of data points in each window ranged from 38 to 74. Chemotropism was considered significant when the lower confidence limit was greater than 0. Fig. 3. Open in new tabDownload slide Chemotropic growth of hyphae toward capillary tubes containing 20 μm genistein. Zoospores were induced to encyst in a random orientation. Approximately 3 h after the introduction of the capillary into the chemotaxis chamber, the angles of hyphal tips were measured relative to a line drawn from the counterpoint of the mouth of the capillary. •, Cosine of growth angle; thick line, cosines averaged over a 200-μm window at 20-μm increments; thin line, upper and lower 95% significance limits for cosine means calculated using a t test. The number of data points in each window ranged from 30 to 66. Chemotropism was considered significant when the lower confidence limit was greater than 0. Fig. 3. Open in new tabDownload slide Chemotropic growth of hyphae toward capillary tubes containing 20 μm genistein. Zoospores were induced to encyst in a random orientation. Approximately 3 h after the introduction of the capillary into the chemotaxis chamber, the angles of hyphal tips were measured relative to a line drawn from the counterpoint of the mouth of the capillary. •, Cosine of growth angle; thick line, cosines averaged over a 200-μm window at 20-μm increments; thin line, upper and lower 95% significance limits for cosine means calculated using a t test. The number of data points in each window ranged from 30 to 66. Chemotropism was considered significant when the lower confidence limit was greater than 0. To determine the effect of isoflavones on newly formed cysts, zoospores were induced to encyst on clear plastic wrap membranes glued to cell-culture inserts in the presence of varying levels of isoflavones. After 2 h, germination in both strains was 100% in the presence of 0, 1, or 20 μm levels of daidzein and genistein for both strains there were no significant differences in the length of the germinating hyphae or the percentage of hyphae that had formed appressoria (Table I). The wide variation in the length of the germlings appeared to be dependent on whether the germinating cyst immediately produced an appressorium or continued to grow along the membrane surface. Table I. Effect of isoflavones on initial growth of germinating cysts Treatment . Concentration . Strain P7063 . Strain P6497 . Hyphal length . Appressoria . Hyphal length . Appressoria . μm μm % μm % Control 750  ± 230 50 720  ± 300 38 Daidzein 1 515  ± 50 32 710  ± 200 36 Daidzein 20 610  ± 180 44 650  ± 150 51 Genistein 1 680  ± 260 52 740  ± 100 41 Genistein 20 540  ± 180 54 640  ± 130 46 Treatment . Concentration . Strain P7063 . Strain P6497 . Hyphal length . Appressoria . Hyphal length . Appressoria . μm μm % μm % Control 750  ± 230 50 720  ± 300 38 Daidzein 1 515  ± 50 32 710  ± 200 36 Daidzein 20 610  ± 180 44 650  ± 150 51 Genistein 1 680  ± 260 52 740  ± 100 41 Genistein 20 540  ± 180 54 640  ± 130 46 Data from a typical experiment are shown. Germination in all treatment groups at 2 h was 100%. Differences in length of the hyphae and cyst or in the percentage of hyphae forming appressoria are not significant. Open in new tab Table I. Effect of isoflavones on initial growth of germinating cysts Treatment . Concentration . Strain P7063 . Strain P6497 . Hyphal length . Appressoria . Hyphal length . Appressoria . μm μm % μm % Control 750  ± 230 50 720  ± 300 38 Daidzein 1 515  ± 50 32 710  ± 200 36 Daidzein 20 610  ± 180 44 650  ± 150 51 Genistein 1 680  ± 260 52 740  ± 100 41 Genistein 20 540  ± 180 54 640  ± 130 46 Treatment . Concentration . Strain P7063 . Strain P6497 . Hyphal length . Appressoria . Hyphal length . Appressoria . μm μm % μm % Control 750  ± 230 50 720  ± 300 38 Daidzein 1 515  ± 50 32 710  ± 200 36 Daidzein 20 610  ± 180 44 650  ± 150 51 Genistein 1 680  ± 260 52 740  ± 100 41 Genistein 20 540  ± 180 54 640  ± 130 46 Data from a typical experiment are shown. Germination in all treatment groups at 2 h was 100%. Differences in length of the hyphae and cyst or in the percentage of hyphae forming appressoria are not significant. Open in new tab To determine how germinating hyphae responded to tactile and chemical signals, zoospores were induced to encyst on the porous PET membranes of cell-culture inserts by adding isoflavones to the adjacent or opposite side of the PET membrane. In the presence of isoflavones, hyphae germinated and grew along the membrane surface until they came in contact with a pore (Fig. 4). The hyphae grew through the pores and emerged on the other side of the membrane. Hyphae emerging from the pores grew away from the membrane rather than remaining in contact with the membrane surface (Fig.5). Fig. 4. Open in new tabDownload slide Hyphal germlings growing along and penetrating pores of a PET membrane. Zoospores were induced to encyst on the membrane by application of an agar plug containing isoflavones to the opposite side of the membrane. Germinating hyphae penetrated pores detected by the hyphal tip. The distance indicated is the distance between two hatch marks. Fig. 4. Open in new tabDownload slide Hyphal germlings growing along and penetrating pores of a PET membrane. Zoospores were induced to encyst on the membrane by application of an agar plug containing isoflavones to the opposite side of the membrane. Germinating hyphae penetrated pores detected by the hyphal tip. The distance indicated is the distance between two hatch marks. Fig. 5. Open in new tabDownload slide Hyphae growing away from a membrane after having penetrated a pore (magnification ×27). Zoospores were induced to encyst on a PET membrane. Hyphae that had successfully penetrated through pores were visualized by staining with 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazollium bromide. The plane of focus in each picture (A–D) is progressively closer to the membrane surface and is slightly above the membrane in D. Arrows point to hyphae that are more visible in frames A, B, or C, indicating that they must be growing away from the membrane surface (D). Fig. 5. Open in new tabDownload slide Hyphae growing away from a membrane after having penetrated a pore (magnification ×27). Zoospores were induced to encyst on a PET membrane. Hyphae that had successfully penetrated through pores were visualized by staining with 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazollium bromide. The plane of focus in each picture (A–D) is progressively closer to the membrane surface and is slightly above the membrane in D. Arrows point to hyphae that are more visible in frames A, B, or C, indicating that they must be growing away from the membrane surface (D). Several attempts were made to maintain an unequal distribution of isoflavones across the porous membrane to try to change the initial tactile responses of the hyphae. For these experiments we placed an agar plug containing isoflavones on the same or the opposite side of the membrane as the encysted zoospores. In no case were we able to induce the hyphae to emerge from the cyst and grow away from the membrane surface (not shown); nor were we able to inhibit the hyphae from growing through the membrane pores. Zoospores that were induced to encyst on a smooth surface consisting of cross-linked collagen overlying the PET membrane germinated and immediately penetrated the collagen layer. The hyphae grew along the PET membrane a short distance before forming an appressorial structure, possibly over a membrane pore (Fig. 6). Zoospores that were induced to encyst on a smooth template of clear plastic wrap germinated and produced multiple appressoria (Fig.7) in what appeared to be successive attempts to penetrate the membrane surface. None of the hyphae were observed to grow away from the template surface. In chemotropism assays the majority of the zoospores encysted on the coverslip and also tended to grow along the surface rather than away from it. Fig. 6. Open in new tabDownload slide Germination of cysts on a surface of cross-linked collagen overlying a PET membrane. Zoospores were induced to encyst on the collagen by application of an agar plug containing isoflavones to the opposite side of the membrane. Germinating hyphae penetrated the collagen layer and subsequently formed appressorial structures that are believed to be located over membrane pores. The distance indicated is the distance between two hatch marks. Fig. 6. Open in new tabDownload slide Germination of cysts on a surface of cross-linked collagen overlying a PET membrane. Zoospores were induced to encyst on the collagen by application of an agar plug containing isoflavones to the opposite side of the membrane. Germinating hyphae penetrated the collagen layer and subsequently formed appressorial structures that are believed to be located over membrane pores. The distance indicated is the distance between two hatch marks. Fig. 7. Open in new tabDownload slide Multiple appressoria were produced by a germinating hyphae on clear plastic wrap (magnification ×1000). Zoospores were induced to encyst on a smooth surface. The hyphal germlings produced multiple appressoria as they grew along the surface. Fig. 7. Open in new tabDownload slide Multiple appressoria were produced by a germinating hyphae on clear plastic wrap (magnification ×1000). Zoospores were induced to encyst on a smooth surface. The hyphal germlings produced multiple appressoria as they grew along the surface. DISCUSSION Zoospores that encyst adjacent to the root tend to germinate and grow toward the root surface (Zentmyer, 1961; Musgrave et al., 1977;Manavathu and Thomas, 1985; Jones et al., 1991). Here we have shown that when P. sojae zoospores have been induced to encyst and germinate before the introduction of a soybean root, the hyphal tips closest to the root grew chemotropically toward the root surface. Because the hyphal tips from germinating zoospores are also chemotropically attracted to a capillary tube containing genistein, the release of isoflavones from the root tips (Graham, 1991) may function as a chemotropic signal for P. sojae hyphae. Thus, bothP. sojae zoospores (Morris and Ward, 1992) and hyphal germlings respond to host signals. The chemotropic response of hyphae to daidzein and genistein is significant, because in our laboratory experiments, many zoospores encysted before reaching the root. In the soil zoospores that encyst adjacent to the root can produce hyphae that can use an isoflavone gradient to reorient in the direction of a growing root tip. Although genistein is more potent than daidzein in chemotaxis assays (Tyler et al., 1996) for these isolates, daidzein is the most abundant isoflavone excreted into the rhizosphere by root tips and may be the most important isoflavone used by P. sojaezoospores and germlings to locate soybean roots. These experiments do not rule out the possibility that hyphal tips ofP. sojae also respond to an attractant from adjacent masses of zoospores, such as those clustered around a root (Reid et al., 1995). However, because the zoospores encysted without clustering in the chemotaxis chamber, and the direction of initial hyphal growth was fixed before introduction of the root or capillary tube, we observed that an autoaggregation signal could not account for the tropic response of hyphae to roots or isoflavones. The isoflavones daidzein and genistein function as chemical signals directing several key steps in the early stages of the infection response: (a) They mediate chemotaxis of swimming zoospores toward the root tips (Morris and Ward, 1992), where most of the isoflavones are exuded by the root (Graham, 1991). (b) Sudden exposure of zoospores to elevated levels of isoflavones was effective in inducing the encystment of zoospores on artificial surfaces such as a capillary tube or plastic membrane (Morris and Ward, 1992; this paper). (c) Isoflavones induce chemotropic growth of germlings toward the roots (this paper). At elevated concentrations, genistein (concentration that results in 50% inhibition of growth = 150 μm) but not daidzein appears to function as a phytoalexin (Rivera-Vargas et al., 1993), and Vedenyalpina et al. (1993) reported that at lower levels (11 μm), genistein altered the pattern of mycelial branching. Genistein acts to inhibit Tyr kinase activity (inhibitor concentration for 50% displacement = 3–50 μm;Akiyama et al., 1987), so inhibition at very high levels of genistein might be expected unless this pathogen has also evolved to become more tolerant. Isoflavones are stored in the endosperm tissue as malonylated and glucosylated compounds (Graham, 1991; Morris et al., 1991), but there is no evidence that the localized concentrations of these conjugates contribute to either cultivar-specific resistance of soybeans to P. sojae or nonspecific age-related resistance in mature tissues such as leaves (Morris et al., 1991). In chemotactic assays, zoospores are strongly attracted to the rhizosphere surrounding the root cap and the area of the root immediately behind the meristem. Graham (1991) estimated that in this region of the rhizosphere, concentrations of genistein and its conjugates would not exceed 2 μm. However, in results reported here, germination of cysts and initial hyphal elongation were not inhibited by 20 μm daidzein or genistein. Thus, it seems unlikely that in vivo levels of these isoflavones in the roots are sufficient to restrict the initial growth of the pathogen. The ability of hyphal germlings to respond to surface topography has been described for both plant and animal pathogens (Allen et al., 1991;Read et al., 1992; Gow et al., 1994). Surface cues such as pores, grooves, and ridges are primary determinants of hyphal growth on both their hosts and on artificial templates. In experiments reported here, hyphae penetrated pores on the membrane surface or, in the absence of pores, formed appressoria to attempt the penetration of plastic membranes or glass surfaces. Germinating hyphae typically infect soybean hypocotyl tissue by penetrating between the anticlinal walls of epidermal cells (Stössel et al., 1980; Ward et al., 1989). The preference for this site may be attributable to the hyphae detecting a concentration gradient of plant metabolites at this site or its ability to recognize grooves and ridges on the host surface. Isoflavones appear not to be necessary to induce appressorial formation, because zoospores that encysted on clear plastic wrap germinated and produced appressoria in the presence and absence of isoflavones. Although the isoflavones stimulated hyphal germination and chemotropic growth, they would not induce the hyphal tip to grow away from the membrane surface. Thus, the thigmotropic response appears to be a more important determinant of the direction of hyphal growth in germinating cysts. Nevertheless, chemotropic orientation of hyphae on the coverslip of the chemotaxis chamber was still observed in response to an isoflavone gradient. The initial thigmotropic response ofP. sojae hyphae to surfaces is consistent with previous accounts of the importance of surface features for both plant and animal fungal pathogens. In contrast to the growth habit ofCandida albicans, in which the hyphae continued to be appressed to the membrane surface after emergence on the opposite side of the membrane (Gow et al., 1994), the hyphae of P. sojaegrew away from the membrane surface into the aqueous medium. Because this behavior was not observed on smooth, impermeable templates despite the production of multiple appressoria, the process of successful penetration could trigger a new developmental response that might be similar to what happens during the normal course of infection (Ward et al., 1989). In summary, we have shown that the chemotropic response of germinating hyphae toward roots may be explained by their ability to respond to soybean isoflavones. Isoflavones in the range of concentrations likely to be present in the rhizosphere are not toxic to zoospores or germinating hyphae. However, the tactile response of hyphae appears to be a more important determinant of early hyphal growth than the isoflavones, since germinating hyphae could not be induced to grow away from the substrate on which they had encysted. ACKNOWLEDGMENTS We thank Dan Schwab and Carol Heckman for their assistance with scanning microscopy. Abbreviation: PET polyethylene terephthalate LITERATURE CITED 1 Akiyama T Ishida J Nakagawa S Ogawara H Watanabee S Itoh N Shibuya M Fukami Y Genistein, a specific inhibitor of tyrosine-specific protein kinases. J Biol Chem 262 1987 5592 5595 Google Scholar Crossref Search ADS PubMed WorldCat 2 Allen EA Hazen BE Hoch HC Kwon Y Leinhos ME Staples RC Stumpf MA Terhune BT Appressorium formation in response to topographical signals by 27 rust species. Phytopathology 81 1991 323 331 Google Scholar Crossref Search ADS WorldCat 3 Carlile MJ (1983) Motility, taxis, and tropism inPhytophthora. In DC Erwin, S Bartnicki-Garcia, PH Tsao, eds, Phytophthora: Its Biology, Taxonomy, Ecology, and Pathology. American Phytopathological Society Press, St. Paul, MN, pp 95–107 4 Coley-Smith JR White rot disease of Allium: problems of soil-borne diseases in microcosm. Plant Pathol 39 1990 214 222 Google Scholar Crossref Search ADS WorldCat 5 Dharmatilake AJ Bauer WD Chemotaxis of Rhizobium meliloti towards nodulation gene-inducing compounds from alfalfa roots. Appl Environ Microbiol 58 1992 1153 1158 Google Scholar Crossref Search ADS PubMed WorldCat 6 Donaldson SP Deacon JW Role of calcium in adhesion and germination of zoospore cysts of Pythium: a model to explain infection of host plants. J Gen Microbiol 138 1992 2051 2059 Google Scholar Crossref Search ADS WorldCat 7 Duniway JM Movement of zoospores of Phytophthora cryptogea in soils of various textures and matric potentials. Phytopathology 66 1976 877 882 Google Scholar Crossref Search ADS WorldCat 8 Duniway JM (1983) Role of physical factors in the development ofPhytophthora diseases. In DC Erwin, S Bartnicki-Garcia, PH Tsao, eds, Phytophthora: Its Biology, Taxonomy, Ecology, and Pathology. American Phytopathological Society, St. Paul, MN, pp 175–187 9 Erwin DC, Ribeiro OK (1996) Phytophthora Diseases Worldwide. American Phytopathological Society, St. Paul, MN, pp 146–184 10 Fisher RF Long SR Rhizobium-plant signal exchange. Nature 357 1992 655 659 Google Scholar Crossref Search ADS PubMed WorldCat 11 Förster H Tyler BM Coffey MD Phytophthora sojae races have arisen by clonal evolution and by rare outcrosses. Mol Plant Microbe Interact 7 1994 780 791 Google Scholar Crossref Search ADS WorldCat 12 Gow NAR Perera THS Sherwood HJ Gooday GW Gregory DW Marshall D Investigation of touch-sensitive responses by hyphae of the human pathogenic fungus Candida albicans. Scanning Microsc 8 1994 705 709 Google Scholar PubMed OpenURL Placeholder Text WorldCat 13 Graham TL Flavonoid and isoflavonoid distribution in developing soybean seedling tissues and in seed and root exudates. Plant Physiol 95 1991 594 603 Google Scholar Crossref Search ADS PubMed WorldCat 14 Griffith JM Iser JR Grant BR Calcium control of differentiation of Phytophthora palmivora. Arch Microbiol 149 1988 565 571 Google Scholar Crossref Search ADS WorldCat 15 Hardham A Gubler F Polarity of attachment of zoospores of a root pathogen and prealignment of the emerging germ tube. Cell Biol Int Rep 14 1990 947 955 Google Scholar Crossref Search ADS WorldCat 16 Hawes MC Smith LY Requirement for chemotaxis in pathogenicity of Agrobacterium tumefaciens on roots of soil-grown pea plants. J Bacteriol 71 1989 5668 5671 Google Scholar OpenURL Placeholder Text WorldCat 17 Horio T Kawabata Y Takayama T Tahara S KawabataY Fukushi Y Nishimura H Mizutani J A potent attractant of zoospores of Aphanomyces cochlioides isolated from its host, Spinacia oleracea. Experientia 48 1992 410 414 Google Scholar Crossref Search ADS WorldCat 18 Jones SW Donaldson SP Deacon JW Behaviour of zoospores and zoospore cysts in relation to root infection by Pythium aphanidermatum. New Phytol 117 1991 289 301 Google Scholar Crossref Search ADS WorldCat 19 Manavathu EK Thomas DS Chemotropism of Achlya ambisexualis to methionine and methionyl compounds. J Gen Microbiol 131 1985 751 756 Google Scholar OpenURL Placeholder Text WorldCat 20 Morris PF Savard ME Ward EWB Identification and accumulation of isoflavonoids and isoflavone glucosides in soybean leaves and hypocotyls in resistance responses to Phytophthora megasperma f sp glycinea. Physiol Mol Plant Pathol 39 1991 229 234 Google Scholar Crossref Search ADS WorldCat 21 Morris PF Ward EWB Chemoattraction of zoospores of the soybean pathogen Phytophthora sojae by isoflavones. Physiol Mol Plant Pathol 40 1992 17 22 Google Scholar Crossref Search ADS WorldCat 22 Musgrave A Ero L Scheffer R Oehlers E Chemotropism of Achlya bisexualis germ hyphae to casein hydrolysate and amino acids. J Gen Microbiol 101 1977 65 70 Google Scholar Crossref Search ADS WorldCat 23 Podila GK Chemical signals from avocado surface wax trigger germination and appressorium formation in Colletotrichum gloeosporioides. Plant Physiol 103 1993 267 272 Google Scholar Crossref Search ADS PubMed WorldCat 24 Read ND Kellock LJ Knight H Trewavas AJ Contact sensing during infection by fungal pathogens. Callow JA Green JR Perspectives in Plant Cell Recognition. 1992 137 172 Cambridge University Press London 25 Reid B Morris BM Gow NAR Calcium-dependent, genus specific, autoaggregation of zoospores of phytopathogenic fungi. Exp Mycol 19 1995 202 213 Google Scholar Crossref Search ADS WorldCat 26 Rivera-Vargas LI Schmitthenner AF Graham TL Soybean flavonoid effects on and metabolism by Phytophthora sojae. Phytochemistry 32 1993 851 857 Google Scholar Crossref Search ADS WorldCat 27 Ruan Y Kotriaiah V Straney DC Flavonoids stimulate spore germination in Fusarium solani pathogenic on legumes in a manner sensitive to inhibitors of cAMP-dependent protein kinase. Mol Plant Microbe Interact 8 1995 929 938 Google Scholar Crossref Search ADS WorldCat 28 Sekizaki H Yokosawa R Chinen C Adachi H Yamane Y Studies on zoospore attracting activity. II. Synthesis of isoflavones and their attracting activity to Aphanomyces euteiches zoospores. Biol Pharm Bull 16 1993 698 701 Google Scholar Crossref Search ADS PubMed WorldCat 29 Stössel P Lazarovits G Ward EWB Penetration and growth of compatible and incompatible races of Phytophthora megasperma var. sojae in soybean hypocotyl tissues differing in age. Can J Bot 58 1980 2594 2601 Google Scholar Crossref Search ADS WorldCat 30 Tyler BM Wu MH Wang JM Cheung W Morris PF Chemotactic preferences and strain variation in the response of Phytophthora sojae zoospores to host isoflavones. Appl Environ Microbiol 62 1996 2811 2817 Google Scholar Crossref Search ADS PubMed WorldCat 31 Vedenyalpina EG Safir GR Niemira BA Chase TE Low concentrations of the isoflavone genistein influence in vitro asexual reproduction and growth of Phytophthora sojae. Phytopathology 86 1993 144 148 Google Scholar Crossref Search ADS WorldCat 32 Ward EWB Cahill DM Bhattacharyya MK Early cytological differences between compatible and incompatible interactions of soybeans with Phytophthora megasperma f sp. glycinea. Physiol Mol Plant Pathol 34 1989 267 273 Google Scholar Crossref Search ADS WorldCat 33 Zentmyer GA Chemotaxis of zoospores for root exudates. Science 133 1961 1595 1596 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This work was supported by U.S. Department of Agriculture grant no. 94-37303-0700 to P.F.M. and B.M.T., and by National Science Foundation equipment grants BIR-9009697 and BIR-9249275. * Corresponding author; e-mail [email protected]; fax 1–419–372–2024. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Kusaba, Shinnosuke; Fukumoto, Masashi; Honda, Chikako; Yamaguchi, Isomaro; Sakamoto, Tomoaki; Kano-Murakami, Yuriko

doi: 10.1104/pp.117.4.1179pmid: 9701574

Abstract We previously reported that overexpression of the rice homeobox gene OSH1 led to altered morphology and hormone levels in transgenic tobacco (Nicotiana tabacum L.) plants. Among the hormones whose levels were changed, GA1 was dramatically reduced. Here we report the results of our analysis on the regulatory mechanism(s) ofOSH1 on GA metabolism. GA53 and GA20, precursors of GA1, were applied separately to transgenic tobacco plants exhibiting severely changed morphology due to overexpression of OSH1. Only treatment with the end product of GA 20-oxidase, GA20, resulted in a striking promotion of stem elongation in transgenic tobacco plants. The internal GA1 and GA20 contents inOSH1-transformed tobacco were dramatically reduced compared with those of wild-type plants, whereas the level of GA19, a mid-product of GA 20-oxidase, was 25% of the wild-type level. We have isolated a cDNA encoding a putative tobacco GA 20-oxidase, which is mainly expressed in vegetative stem tissue. RNA-blot analysis revealed that GA 20-oxidase gene expression was suppressed in stem tissue of OSH1-transformed tobacco plants. Based on these results, we conclude that overexpression ofOSH1 causes a reduction of the level of GA1by suppressing GA 20-oxidase expression. The regulatory mechanisms controlling plant morphogenesis constitute one of the most important questions in plant biology. The homeobox gene knotted-1, which is involved in maize leaf development, was isolated in 1989 (Hake et al., 1989). Many plant homeobox genes have subsequently been isolated and it is believed that these genes play a role in regulating morphogenesis (Kerstetter et al., 1994). The homeobox gene products share a unique and homologous structure, the homeodomain (Gehring, 1987). Homeodomain proteins possess a helix-turn-helix motif, and recognize and bind to specific DNA sequences, resulting in altered expression of the target gene (Scott et al., 1989). Accordingly, plant homeobox genes are thought to control plant morphogenesis through the regulation of expression of genes involved in plant development. It has been reported that ectopic expression of the rice homeobox geneOSH1 causes morphological changes in rice, Arabidopsis, tobacco (Nicotiana tabacum L.), and kiwifruit (Kano-Murakami et al., 1993; Matsuoka et al., 1993; Kusaba et al., 1995). For example,OSH1-transformed tobacco plants exhibit abnormal-shaped leaves and flowers, and loss of apical dominance. These observations suggest that the OSH1 gene product may regulate the expression of genes involved in plant morphogenesis. Kano-Murakami et al. (1993) suggested that OSH1 need not be expressed continuously or throughout the entire plant to result in morphological aberrations. These results indicate that OSH1 may be a morphological regulator acting at an early stage of tissue or organ differentiation. However, the molecular mechanism(s) by whichOSH1 regulates plant morphogenesis are unknown. Plant morphogenesis is thought to be regulated by various physiological factors, including gene expression and plant hormones. It is well known that different plant hormones have distinct influences on plant growth and development. Our recent results indicate that ectopic expression ofOSH1 causes morphological changes in transgenic tobacco plants by affecting plant hormone metabolism (Kusaba et al., 1998). InOSH1-transformed tobacco plants showing dwarfism, GA1 levels were drastically reduced. From the fact that ectopic expression of OSH1 causes morphological changes and the product of OSH1 contains a putative DNA-binding domain, it is possible that OSH1 regulates the expression of gene(s) involved in hormone metabolism or sensitivity of plants. In the present study we report results that implicateOSH1 in the regulation of expression of a gene involved in GA biosynthesis in transgenic tobacco plants. MATERIALS AND METHODS Plant Materials The preparation of OSH1-transformed tobacco (Nicotiana tabacum cv Samsun NN) plants was as described inKano-Murakami et al. (1993). T2 seedlings of 35S-OSH1 transformants and wild-type seedlings were grown under greenhouse conditions at 25°C. Treatment with GA Derivatives Ten microliters of a 10 or 100 μm solution of GA20 or GA53 in 5% acetone was applied to the shoot apex of severe-phenotype transformants once a week. GA20 and GA53 used in this study were prepared as described in a previous report (Murofushi et al., 1982). Analysis of GA Derivatives Analysis of GA1, GA20, and GA19 was performed by ELISA using antibodies raised against GA4 (Nakajima et al., 1991), GA20 methyl-ester (Yamaguchi et al., 1987), and GA24 (Yamaguchi et al., 1992), respectively. Extraction of GA derivatives and ELISA procedures were performed as described in Kusaba et al. (1998) with some modifications to the HPLC conditions. HPLC analyses of extracts were performed using an ODS column (6- × 150-mm i.d.; Pegasil ODS, Senshu Kagaku, Tokyo, Japan). Samples were eluted with 0.5% acetic acid in 10% aqueous acetonitrile (solvent A) and 0.5% acetic acid in 80% aqueous acetonitrile (solvent B) at room temperature as follows: 0 to 30 min, linear gradient of 0% solvent B to 50% solvent B; 30 to 35 min, linear gradient of 50% solvent B to 100% solvent B; and 35 to 50 min, isocratic elution with solvent B. The flow rate of the solvent was 1.5 mL min−1 and fractions were collected every minute. The retention times of GA1, GA19, and GA20 were 20 to 21 min, 20 to 22 min, and 21 to 23 min, respectively. Fractions containing each GA (retention time ±3 min) were divided into three parts and assayed by ELISA. The cross-reactivity of the antibodies to other GAs was less than 1%. Cloning of Tobacco GA 20-Oxidase PCR Fragment First-strand cDNA was synthesized using a reverse transcription-PCR Kit (Takara Shuzo, Otsu, Shiga, Japan) with random primers. Total RNA extracted from young leaves of wild-type tobacco was used as a template. PCR was carried out with primers (5′-CA[AG]TT[CT]AT[ACT]TGGCCNGA-3′ and 5′-CTGACGGAGCGCCATTCGTTG-3′) using the first-strand cDNA as a template. Samples were heated to 94°C for 2 min, then subjected to 28 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 90 s. The reaction was completed by a 10-min incubation at 72°C. The resulting 720-bp DNA fragment was cloned into the vector pCRII (Invitrogen, San Diego, CA). Isolation of cDNA Clones A cDNA library was constructed from RNA isolated from stem tissue of mature tobacco plants. Poly(A+)-enriched RNA was purified by two passes through an oligo d(T) cellulose column (Type 7, Pharmacia Biotech). Double-stranded cDNA was synthesized from poly(A+) RNA and EcoRI adapters were added using a cDNA synthesis kit (Pharmacia Biotech). The products were ligated into λZAP II (Stratagene) that had been digested withEcoRI and dephosphorylated. Ligation products were packaged using Gigapack II (Stratagene) and the resulting cDNA library of 2.4 × 105 recombinants was amplified by passage through Escherichia coli XL1 Blue. Screening was performed in 6× SSC, 5× Denhardt's solution, 0.1% SDS, and 100 μg mL−1 salmon-sperm DNA at 57°C for 16 h using the PCR product described above as a probe. Filters were washed in 2× SSC and 0.1% SDS at room temperature and then further washed in 0.2× SSC and 0.2% SDS at 57°C. Sequence Analysis Nucleotide sequences were determined by the dideoxynucleotide chain-termination method using an automated sequencing system (ALF DNA Sequencer II, Pharmacia Biotech). Analysis of cDNA and inferred amino acid sequences were carried out using Lasergene computer software (DNASTAR, Inc., Madison, WI). RNA-Blot Analysis Total RNA was prepared from various organs for gel-blot analysis. Ten micrograms of each RNA preparation was separated on agarose gels in the presence of formaldehyde, followed by transfer to Hybond-N membrane (Amersham). The tobacco GA 20-oxidase cDNA or aXbaI/SacI fragment of the OSH1 cDNA was labeled with [α-32P]dCTP using theRediprime DNA-labeling system (Amersham). Hybridization was carried out at 42°C in a solution containing 50% formamide, 5× SSC, 0.2% SDS, 0.1% N-lauroylsarcosine, 1% blocking reagent (Boehringer Mannheim), 10% dextran sulfate, and 100 μg mL−1 salmon- sperm DNA. Blots were hybridized for 14 h, washed in 2× SSC and 0.1% SDS at room temperature, then in 0.2× SSC and 0.1% SDS at 65°C, and then exposed to Kodak XAR film. RESULTS We previously demonstrated that the morphology of transgenic tobacco plants expressing OSH1 under the control of the cauliflower mosaic virus 35S promoter could be divided into three categories ranging from a mild to a severe phenotype (Kano-Murakami et al., 1993). In these transformants severe-phenotype plants were dwarf and the axillary buds developed into vegetative stems; these buds were dormant in wild-type plants (Fig. 1). We have analyzed the hormone contents of OSH1-transformed tobacco plants to investigate the regulatory mechanism(s) through whichOSH1 alters plant morphogenesis, and have shown that the morphological changes are accompanied by a decrease of GA1 content (Kusaba et al., 1998). Fig. 1. Open in new tabDownload slide Severe-phenotype transgenic tobacco plants expressing OSH1. Fig. 1. Open in new tabDownload slide Severe-phenotype transgenic tobacco plants expressing OSH1. Treatment of Severe-Phenotype Tobacco Plants with GA1 Precursors We have previously reported that stem elongation in severe-phenotype OSH1-transformed tobacco plants was restored by GA3 treatment (Kusaba et al., 1998). This suggests that the dwarfism observed in plants expressingOSH1 at a high level could be caused by the suppression of GA1 biosynthesis by OSH1 rather than changes in the GA1 signal transduction pathway. If this is the case, precursors of GA1 that are formed after the OSH1 block point in the GA biosynthetic pathway should be able to restore stem elongation in severe-phenotype plants. When GA53, a substrate of GA 20-oxidase, and GA20, an end product of GA 20-oxidase, were applied to the shoot apex of severe-phenotype transgenic tobacco plants, only GA20 could restore stem elongatation in a dose-dependent manner (Fig. 2). This result indicates that in OSH1-overexpressing plants the GA biosynthetic pathway is blocked between GA53and GA20. Fig. 2. Open in new tabDownload slide Stem elongation of severe-phenotype transgenic tobacco plants treated with GA53 or GA20. Ten microliters of a 10 or 100 μm solution of GA53 or GA20 in 5% acetone was applied to the shoot apex of severe-phenotype transformants once a week. Fig. 2. Open in new tabDownload slide Stem elongation of severe-phenotype transgenic tobacco plants treated with GA53 or GA20. Ten microliters of a 10 or 100 μm solution of GA53 or GA20 in 5% acetone was applied to the shoot apex of severe-phenotype transformants once a week. Contents of GA1 Precursors in Severe-Phenotype Tobacco Plants The GA19, GA20, and GA1 contents of wild-type and severe-phenotype transgenic tobacco plants were analyzed to confirm that OSH1 could suppress GA 20-oxidase activity in transformants (Fig. 3). The content of GA19, a mid-product of GA 20-oxidase, was decreased to 25% of that observed in wild-type plants. In contrast, GA20, an end product of GA 20-oxidase, was reduced to a very low level, similar to that of GA1. These observations strongly suggest thatOSH1 overexpression leads to a decrease in GA1 content by suppressing GA 20-oxidase activity in transgenic tobacco. Fig. 3. Open in new tabDownload slide Levels of GA19, GA20, and GA1 in leaves of wild-type and severe-phenotypeOSH1-transformed tobacco plants. fw, Fresh weight. Fig. 3. Open in new tabDownload slide Levels of GA19, GA20, and GA1 in leaves of wild-type and severe-phenotypeOSH1-transformed tobacco plants. fw, Fresh weight. Cloning of a Tobacco GA 20-Oxidase cDNA Plant GA 20-oxidase genes have recently been isolated from several species, e.g. pumpkin (Lange et al., 1994), Arabidopsis (Phillips et al., 1995; Xu et al., 1995), spinach (Wu et al., 1996), pea (Martin et al., 1996), and French bean (Garcı́a-Martı́nez et al., 1997). We used degenerate primers based on conserved regions of the GA 20-oxidase genes (Fig. 4) to amplify a fragment of the GA 20-oxidase gene from tobacco. Sequence analysis revealed that the 720-bp fragment obtained by PCR encoded a polypeptide that was 77% identical and 88% similar to the GA 20-oxidase inferred from the French bean gene (Garcı́a-Martı́nez et al., 1997). The 720-bp PCR product was used to screen a tobacco cDNA library constructed using mRNA isolated from vegetative stem tissue. Several positive clones were identified from the 2.4 × 105 recombinant library. Plasmids containing the inserts of the clones were obtained by in vivo rescue. Restriction endonuclease digestion showed that one of these clones contained a 1.5-kb insert, the expected size for a full-length GA 20-oxidase cDNA clone. DNA sequencing revealed that the insert of this cDNA clone contained the sequence of the 720-bp PCR product and possessed an open reading frame encoding 379 amino acids (Fig. 4), indicating that it represented a full-length clone. The deduced amino acid sequence of this cDNA showed 74%, 66%, and 50% identity to those of GA 20-oxidase cloned from French bean (Pv15–11; Garcı́a-Martı́nez et al., 1997), Arabidopsis (At2301;Phillips et al., 1995), and pumpkin (Cm20ox; Lange et al., 1994), respectively. From these results, the 1.5-kb cDNA appeared to represent a full-length clone of tobacco GA 20-oxidase. Fig. 4. Open in new tabDownload slide Nucleotide and deduced amino acid sequences of tobacco GA 20-oxidase cDNA. Regions corresponding to the degenerate primers used in PCR amplification are underlined. Fig. 4. Open in new tabDownload slide Nucleotide and deduced amino acid sequences of tobacco GA 20-oxidase cDNA. Regions corresponding to the degenerate primers used in PCR amplification are underlined. Expression Analysis of Tobacco GA 20-Oxidase To investigate the expression of the putative tobacco GA 20-oxidase gene, RNA-blot hybridization was performed. Ten micrograms of total RNA extracted from mature leaves, vegetative stems, developed flowers, and developing siliques was probed with the32P-labeled full-length tobacco GA 20-oxidase cDNA. Accumulation of tobacco GA 20-oxidase mRNA was seen mainly in stem tissue, with relatively low levels detected in RNA from leaves, siliques, and flowers (Fig. 5a). Fig. 5. Open in new tabDownload slide RNA-blot analysis of GA 20-oxidase gene expression. 32P-Labeled GA 20-oxidase cDNA orXbaI/SacI fragment of OSH1cDNA was hybridized with 10 μg of total RNA extracted from mature leaves, vegetative stem, developed flowers, and developing siliques (a), and stem tissue treated without (−) or with (+) 100 μm GA3 for 8 h (b), and stem tissue of wild-type (left) and severe-phenotype OSH1-transformed (right) tobacco plants (c). Fig. 5. Open in new tabDownload slide RNA-blot analysis of GA 20-oxidase gene expression. 32P-Labeled GA 20-oxidase cDNA orXbaI/SacI fragment of OSH1cDNA was hybridized with 10 μg of total RNA extracted from mature leaves, vegetative stem, developed flowers, and developing siliques (a), and stem tissue treated without (−) or with (+) 100 μm GA3 for 8 h (b), and stem tissue of wild-type (left) and severe-phenotype OSH1-transformed (right) tobacco plants (c). In stem tissue, treatment with GA3 8 h before RNA extraction reduced the abundance of tobacco GA 20-oxidase mRNA (Fig. 5b). Similar results have also been obtained in Arabidopsis (Phillips et al., 1995; Xu et al., 1995) and in pea (Martin et al., 1996). Severe-phenotype transgenic tobacco plants expressing OSH1showed extreme dwarfism. To confirm whether this dwarfism could be attributed to the suppression of GA 20-oxidase gene expression in stem tissue, we analyzed the abundance of GA 20-oxidase mRNA in stem tissue of severe-phenotype and wild-type tobacco plants. The GA 20-oxidase mRNA was substantially suppressed in severe-phenotype stems compared with wild-type stems (Fig. 5c). DISCUSSION Expression of the rice homeobox gene OSH1 causes morphological changes in transgenic tobacco, including dwarfism and loss of apical dominance (Kano-Murakami et al., 1993). InOSH1-transformed tobacco plants exhibiting a severe phenotype, hormone levels are altered, with a decrease of GA1 and increased levels of ABA andtrans-zeatin (Kusaba et al., 1998). Many GA-responsive mutants showing dwarfism have been isolated from several species. These dwarf mutants show decreased bioactive GA levels, and their growth can be restored with applied bioactive GA (Hedden and Kamiya, 1997). Our recent finding that exogenous GA3 can correct the dwarfism in severe-phenotype tobacco plants expressing OSH1indicates that these plants may represent GA-responsive dwarfs (Kusaba et al., 1998). The application of GA53 and GA20, precursors of GA1, to severe-phenotype tobacco transformants indicated that the biosynthetic pathway between GA53 and GA20 appears to be blocked in these plants (Fig.2). The conversion of GA53 to GA20 is catalyzed by the multifunctional 2-oxoglutarate-dependent dioxygenase GA 20-oxidase (Lange, 1994). In the GA-responsive semidwarf ga5 mutant of Arabidopsis (Koornneef and van der Veen, 1980), the contents of C19-GAs were reduced compared with the wild type (Talon et al., 1990). Xu et al. (1995) determined that the GA5 locus of Arabidopsis encodes GA 20-oxidase. Severe-phenotype tobacco plants also showed a drastic decrease of the C19-GAs GA20 and GA1 (Fig. 3). These observations suggest that overexpression of OSH1 in transgenic tobacco results in a suppression of GA 20-oxidase activity. Because the OSH1 gene product contains a putative DNA-binding domain, the homeodomain, OSH1 is thought to control plant morphogenesis through the regulation of gene expression (Matsuoka et al., 1993). However, no target gene of OSH1 has yet been identified. These observations plus our current results indicate that overexpression of OSH1 may regulate GA 20-oxidase gene expression either directly or indirectly. To investigate this hypothesis, we cloned a tobacco cDNA encoding GA 20-oxidase. The amino acid sequence deduced from this full-length cDNA showed 74%, 66%, and 50% identity to those of GA 20-oxidase cloned from French bean (Pv15–11; Garcı́a-Martı́nez et al., 1997), Arabidopsis (At2301; Phillips et al., 1995), and pumpkin (Cm20ox, Lange et al., 1994), respectively. GA 20-oxidases exhibit a relatively low degree of sequence conservation, with amino acid identities ranging from 50% to 75% (Hedden and Kamiya, 1997). Tobacco GA 20-oxidase gene expression was suppressed by GA application (Fig.5b), as has been demonstrated in several other plant species (Phillips et al., 1995; Xu et al., 1995; Martin et al., 1996). These data indicate that the cDNA isolated from tobacco almost certainly encodes GA 20-oxidase. The GA 20-oxidases are encoded by multiple genes in Arabidopsis (Phillips et al., 1995), pea, and French bean (Garcı́a-Martı́nez et al., 1997). The GA 20-oxidase genes in Arabidopsis exhibit tissue-specific expression, leading to the belief that the various genes are responsible for GA biosynthesis associated with different aspects of plant development. The gene corresponding to the GA5 locus shows stem-specific expression, indicating that stem-specific GA 20-oxidases may be involved in stem elongation in Arabidopsis. The tobacco GA 20-oxidase gene was expressed mainly in developing stem tissue, with relatively low-level expression in leaves and siliques (Fig. 5a). Taken together, these results indicate that tobacco GA 20-oxidase may also be involved in stem elongation. We propose that the dwarfism of severe-phenotype transgenic tobacco plants may be due to the suppression of GA 20-oxidase gene expression (Fig. 5c). Recently, a tobacco homeobox gene termed NTH15(Nicotianatabacumhomeobox15) was isolated and its homeodomain sequence shows 88% identity to that of OSH1 (Tamaoki et al., 1997). Ectopic expression of NTH15 in transgenic tobacco causes morphological changes that are in large part similar to those seen inOSH1 transformants. In transgenic tobacco expressingNTH15, a drastic decrease of GA1content was also observed. In wild-type tobacco NTH15 gene expression was strongly expressed in vegetative stems and weakly expressed in shoot apices, flower buds, and flowers. These results imply that expression of NTH15 in stem tissue may be involved in stem elongation by regulating the expression of GA 20-oxidase. The deduced amino acid sequence of OSH1 contains a homeodomain, leading us to propose that the OSH1 gene product controls plant morphogenesis through regulation of expression of certain target gene(s). However, little is known about the target genes of plant homeodomain-containing proteins. Our recent results suggest that OSH1 affects plant hormone metabolism either directly or indirectly, thereby causing changes in plant development (Kusaba et al., 1998). Our present results indicate that a developmental signal from the OSH1 protein may act to suppress GA 20-oxidase expression in transgenic tobacco. GA 20-oxidase expression has been reported to be developmental stage and organ specific, and to be regulated by end products and photoperiod (Hedden and Kamiya, 1997). However, the analysis of cis-elements andtrans-factor(s) that regulate the expression of GA 20-oxidase genes has not yet been reported. Further work is needed to elucidate the regulatory mechanisms controlling GA 20-oxidase gene expression. ACKNOWLEDGMENTS We would like to thank Y. Ohashi (National Institute of Agrobiological Resources, Tsukuba, Japan) for kindly supplying us with wild-type tobacco plants, M. Nakajima and M. Hasegawa (University of Tokyo) for skillful technical assistance, and T. Maotani (National Institute of Fruit Tree Science) for helpful comments. The accession number for the nucleotide sequence of tobacco GA 20-oxidase described in this article is AB012856. LITERATURE CITED 1 Garcı́a-Martı́nes JL López-Diaz I Sánchez-Beltrán MJ Phillips AL Ward DA Gaskin P Hedden P Isolation and transcript analysis of gibberellin 20-oxidase genes in pea and bean in relation to fruit development. Plant Mol Biol 33 1997 1073 1084 Google Scholar Crossref Search ADS PubMed WorldCat 2 Gehring WJ Homeo boxes in the study of development. Science 236 1987 1245 1252 Google Scholar Crossref Search ADS PubMed WorldCat 3 Hake S Vollbrecht E Freeling M Cloning Knotted, the dominant morphological mutant in maize using Ds2 as a transposon tag. EMBO J 8 1989 15 22 Google Scholar Crossref Search ADS PubMed WorldCat 4 Hedden P Kamiya Y Gibberellin biosynthesis: enzymes, genes and their regulation. Annu Rev Plant Physiol Plant Mol Biol 48 1997 431 460 Google Scholar Crossref Search ADS PubMed WorldCat 5 Kano-Murakami Y Yanai T Tagiri A Matsuoka M A rice homeotic gene, OSH1, causes unusual phenotype in transgenic tobacco. FEBS Lett 334 1993 365 368 Google Scholar Crossref Search ADS PubMed WorldCat 6 Kerstetter R Vollbrecht E Lowe B Veit B Yamaguchi J Hake S Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6 1994 1877 1887 Google Scholar PubMed OpenURL Placeholder Text WorldCat 7 Koornneef M van der Veen JH Induction and analysis of gibberellin-sensitive mutants in Arabidopsis thaliana (L.) Heynh. Theor Appl Genet 58 1980 257 263 Google Scholar Crossref Search ADS PubMed WorldCat 8 Kusaba S Kano-Murakami Y Matsuoka M Fukumoto M A rice homeobox containing gene altered morphology of tobacco and kiwifruit. Acta Hortic 392 1995 203 208 Google Scholar OpenURL Placeholder Text WorldCat 9 Kusaba S Kano-Murakami Y Matsuoka M Tamaoki M Sakamoto T Yamaguchi I Fukumoto M Alteration of hormone levels in transgenic tobacco plants overexpressing a rice homeobox gene OSH1. Plant Physiol 116 1998 471 476 Google Scholar Crossref Search ADS PubMed WorldCat 10 Lange T Purification and partial amino-acid sequence of gibberellin 20-oxidase from Cucurbita maxima L. endosperm. Planta 195 1994 108 115 Google Scholar PubMed OpenURL Placeholder Text WorldCat 11 Lange T Hedden P Graebe JE Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis. Proc Natl Acad Sci USA 91 1994 8552 8556 Google Scholar Crossref Search ADS PubMed WorldCat 12 Martin DN Proebsting WM Parks TD Dougherty WG Lange T Lewis MJ Gaskin P Hedden P Feed-back regulation of gibberellin biosynthesis and gene expression in Pisum sativum L. Planta 200 1996 159 166 Google Scholar Crossref Search ADS PubMed WorldCat 13 Matsuoka M Ichikawa H Saito A Tada Y Fujimura T Kano-Murakami Y Expression of a rice homeobox gene causes altered morphology of transgenic plants. Plant Cell 5 1993 1039 1048 Google Scholar PubMed OpenURL Placeholder Text WorldCat 14 Murofushi N Shigematsu Y Nagura S Takahashi N Metabolism of steviol and its derivatives of Gibberella fujikuroi. Agric Biol Chem 46 1982 2305 2311 Google Scholar OpenURL Placeholder Text WorldCat 15 Nakajima M Yamaguchi I Nagatani A Kizawa S Murofushi N Furuya F Takahashi N Monoclonal antibodies specific for non-derivatized gibberellins. I. Preparation of monoclonal antibodies against GA4 and their use in immunoaffinity chromatography. Plant Cell Physiol 32 1991 515 521 Google Scholar OpenURL Placeholder Text WorldCat 16 Phillips AL Ward DA Uknes S Appleford NEJ Lange T Huttly AK Gaskin P Graebe JE Hedden P Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis. Plant Physiol 108 1995 1049 1057 Google Scholar Crossref Search ADS PubMed WorldCat 17 Scott MP Tamkun JW Hartzell GW The structure and function of the homeodomain. Biochem Biophys Acta 989 1989 25 48 Google Scholar PubMed OpenURL Placeholder Text WorldCat 18 Talon M Koornneef M Zeevaart JAD Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. Proc Natl Acad Sci USA 87 1990 7983 7987 Google Scholar Crossref Search ADS PubMed WorldCat 19 Tamaoki M Kusaba S Kano-Murakami Y Matsuoka M Ectopic expression of a tobacco homeobox gene, NTH15, dramatically alters leaf morphology and hormone levels in transgenic tobacco. Plant Cell Physiol 38 1997 917 927 Google Scholar Crossref Search ADS PubMed WorldCat 20 Wu K Li L Gage DA Zeevaart JAD Molecular cloning and photoperiod-regulated expression of gibberellin 20-oxidase from the long-day plant spinach. Plant Physiol 110 1996 547 554 Google Scholar Crossref Search ADS PubMed WorldCat 21 Xu Y-L Li L Wu K Peeters AJM Gage DA Zeevaart JAD The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular expression and functional expression. Proc Natl Acad Sci USA 92 1995 6640 6644 Google Scholar Crossref Search ADS PubMed WorldCat 22 Yamaguchi I Nakagawa R Kurogochi S Murofushi N Takahashi N Weiler EW Radioimmunoassay of gibberellins A5 and A20. Plant Cell Physiol 28 1987 815 824 Google Scholar Crossref Search ADS WorldCat 23 Yamaguchi I Nakajima M Kanazawa K Mander LN Murofushi N Takahasi N Preparation and application of antibodies for non-derivatized gibberellins. Karssen CM van Loon LC Vreugdenhill D Progress in Plant Growth Regulation. 1992 874 882 Kluwer Academic Publishers Dordrecht, The Netherlands Author notes * Corresponding author; e-mail [email protected]; fax 81–298–38–6437. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Shpigel, Etai; Roiz, Levava; Goren, Raphael; Shoseyov, Oded

doi: 10.1104/pp.117.4.1185pmid: 9701575

Abstract Recombinant cellulose-binding domain (CBD) derived from the cellulolytic bacterium Clostridium cellulovorans was found to modulate the elongation of different plant cells in vitro. In peach (Prunus persica L.) pollen tubes, maximum elongation was observed at 50 μg mL−1 CBD. Pollen tube staining with calcofluor showed a loss of crystallinity in the tip zone of CBD-treated pollen tubes. At low concentrations CBD enhanced elongation of Arabidopsis roots. At high concentrations CBD dramatically inhibited root elongation in a dose-responsive manner. Maximum effect on root hair elongation was at 100 μg mL−1, whereas root elongation was inhibited at that concentration. CBD was found to compete with xyloglucan for binding to cellulose when CBD was added first to the cellulose, before the addition of xyloglucan. When Acetobacter xylinum L. was used as a model system, CBD was found to increase the rate of cellulose synthase in a dose-responsive manner, up to 5-fold compared with the control. Electron microscopy examination of the cellulose ribbons produced by A. xylinum showed that CBD treatment resulted in a splayed ribbon composed of separate fibrillar subunits, compared with a thin, uniform ribbon in the control. Endogenous regulation of cell elongation appears to be dominated by cell wall mechanics. This process is a result of the interaction between internal turgor pressure and the mechanical strength of the cell wall (Steer and Steer, 1989). Unlike most plant cells, the growth of pollen tubes and root hairs is restricted to the tip zone (Cresti and Tiezzi, 1992). The growing region of pollen tubes consists of two distinct layers when fully mature. The inner layer consists mostly of callose-related molecules, and the outer layer contains pectin, XG, cellulose (at low levels and poor crystallinity), and other polysaccharides (Steer and Steer, 1989). XG is bound to cellulose microfibrils in the cell walls of all dicotyledons and some monocotyledons (Roberts, 1994). The XG bound to the cellulose microfibrils cross-links the cell wall framework. Plant cell expansion requires the integration of local wall loosening and the controlled deposition of new wall materials. Fry et al. (1992) and Nishitani and Tominaga (1992) purified XG endo-transglycosylase and endo-XG transferase, respectively. These two enzymes were shown to be responsible for the transfer of intermicrofibrillar XG segments to another XG molecule and were therefore suggested to be wall-loosening enzymes. However, McQueen-Mason et al. (1993) showed that XG endo-transglycosylase activity did not correlate with in vitro cell wall extension in cucumber hypocotyls. Another type of cell wall-loosening protein, expansin, was isolated by McQueen-Mason et al. (1992). Expansin does not exhibit hydrolytic activity with any of the cell wall components. Instead, it binds at the interface between cellulose microfibrils and matrix polysaccharides in the cell wall and is suggested to induce cell wall expansion by reversibly disrupting noncovalent bonds within this polymeric network (McQueen-Mason and Cosgrove, 1995). XGs are linear chains of β-(1→4)-d-glucan, but unlike cellulose, they possess numerous xylosyl units added at regular sites to the O-6 position of the glucosyl units of the chain (Carpita and Gibeaut, 1993). XG can be extracted by alkaline treatment and then bound again in vitro to cellulose (Hayashi et al., 1994). The effect of XG on growing tissues has been investigated extensively. XG oligosaccharides, produced by partial digestion with β-(1 → 4)-d-glucanase and referred to as “oligosaccharins,” alter plant cell growth (Aldington and Fry, 1993). In pea stem segments one such oligosaccharin, XXFG (XG9), antagonizes the auxin-induced growth promotion at a concentration of about 1 nm (York et al., 1984; McDougall and Fry, 1988). On the other hand, in etiolated pea stem segments high concentrations (100 μm) of oligosaccharins promote the elongation process (McDougall and Fry, 1990). The mode of action of such oligosaccharins is still unknown. The gram-negative bacterium Acetobacter xylinum has long been regarded as a model of cellulose synthesis, mainly because it separates between the cellulose microfibril synthesis and cell wall formation (Ross et al., 1991). Cellulose synthesized byA. xylinum is produced as separate ribbons composed of microfibrils; thus, potential interactions with other polysaccharides do not exist as in the plant cell wall. Since polymerization and crystallization are coupled processes in cellulose synthesis inA. xylinum, interference with the crystallization results in the acceleration of polymerization (Benziman et al., 1980). Some cellulose-binding organic substances can also alter cell growth and cellulose microfibril assembly in vivo. Direct dyes, CMC, and fluorescent brightening agents (e.g. calcofluor white ST) prevent microfibril crystallization in A. xylinum, thereby enhancing polymerization. These molecules bind to the polysaccharide chains immediately after their extrusion from the cell surface, preventing normal assembly of microfibrils and cell walls (Haigler, 1991). Shoseyov and Doi (1990) isolated a unique cellulose-binding protein from the cellulolytic bacterium Clostridium cellulovorans L. This major subunit of the cellulase complex was found to bind to cellulose but had no hydrolytic activity and was essential for the degradation of crystalline cellulose. The cbpA gene has been cloned and sequenced (Shoseyov et al., 1992). When PCR primers flanking the CBD gene were used, the latter was successfully cloned into an overexpression vector that enabled us to overproduce the 17-kD CBD inEscherichia coli. The recombinant CBD exhibits very strong affinity to cellulose (Goldstein et al., 1993). In recent years, several CBDs have been isolated from different sources, but most of them have been isolated from proteins that have separate catalytic cellulase and CBDs, and only two have been isolated from proteins that have no apparent hydrolytic activity but exhibit cellulose-binding activity (Goldstein et al., 1993; Morag et al., 1995). In this study we investigated the effect of CBD on the elongation of growing plant tissues and its interaction with XG on cellulose binding. We show that CBD modulates the elongation of plant cells and tissues, competes with XG for cellulose binding, and increases the rate of cellulose synthase of A. xylinum. MATERIALS AND METHODS Plant Material Peach (Prunus persica L. cv Texas) flowers were obtained from a plot near Rehovot, Israel. Anthers collected from the flowers on the 1st d of anthesis were excised from the filaments and dehydrated at 30°C for at least 24 h. The released pollen was used fresh or stored at −20°C. Seeds of Arabidopsis cv Columbia were obtained from the Hebrew University of Jerusalem stock. Pea (Pisum sativum L.) seeds were purchased from HAZERA (Mevchor, Israel). Expression and Purification of CBD Overexpression of CBD was obtained in Escherichia coliBL21 (DE3) harboring the pET-CBD plasmid (Goldstein et al., 1993). Inoculum was prepared by growing the cells overnight in M9 minimal medium (0.6% Na2HPO4, 0.3% KH2PO4, 0.25% NaCl, 0.5% NH4Cl, 0.2% Glc, 2 mmMgSO4, 0.1 mmCaCl2, and 1 mm thiamine-HCl) containing 50 μg mL−1 ampicillin. The percentages of salt concentrations were expressed as weight per volume. After dilution to a ratio of 1:50 in TB medium (1.2% tryptone, 2.4% yeast extract, 0.4% [v/v] glycerol, 0.17 mKH2PO4, and 0.72m K2HPO4) containing 100 μg mL−1 ampicillin, cells were grown in shaking flasks at 250 rpm, 37°C, to anA600 of 1.7, after which 0.5 mm isopropyl β-d-thiogalactopyranoside was added. After 4 h of incubation the cells were harvested by centrifugation at 2,000g, resuspended in 20 mmTris-HCl buffer, pH 7.0, and sonicated. Inclusion bodies were isolated by centrifugation at 10,000g and washed with water to remove the slimy part of the pellet. The white pellet was dissolved in urea buffer (4.5 m urea, 40 mm Tris base, and 1 mm Cys, pH 11.3) at a protein concentration of 1 mg mL−1 and stirred at 4°C for 2 to 4 h to solubilize the inclusion bodies. The denatured proteins were dialyzed twice against 20 mm Tris, pH 8.6, containing 10 mm β-mercaptoethanol, and once against 20 mmTris-HCl buffer, pH 7.0, at 4°C. At this stage CBD was already more than 95% pure as determined by 12.5% SDS-PAGE (Laemmli, 1970). To remove bacterial components that might have been carried along during the CBD preparation, CBD was further affinity purified on a cellulose column and refolded as described above. The binding capacity to cellulose was determined according to the work of Goldstein et al. (1993). Pollen Germination in Vitro Pollen grains were germinated in liquid cultures, each containing 100 μL of 15% Suc, 100 μg mL−1H3BO3, 200 μg mL−1 MgSO4 · 7H2O, and 200 μg mL−1Ca(NO3)2 · 4H2O in 1.5-mL microtubes. Different concentrations of CBD or BSA were added to the growth medium. The number of pollen grains in each tube was approximately 1000, as determined by a hemocytometer. After an overnight incubation at 25°C in a dark chamber, the pollen tubes were fixed and stained according to the method of Alexander (1980). The pollen was examined in three populations of at least 100 grains per specimen (300 grains per treatment). Seed Germination Arabidopsis seeds were washed in 70% ethanol for 1 min and then five times in distilled water. About 100 seeds per treatment were soaked in 1 mL of distilled water containing different concentrations of CBD or BSA in 2-cm-diameter, 10-cm-long, glass culture tubes. The tubes were placed in a growth chamber at 25°C under a 16-/8-h light/dark photoperiod. At different intervals or after 3 d the lengths of the shoot, root, and longest representative root hair were measured in each seedling. The examinations were conducted in three populations of 30 seedlings per treatment. Histochemical Observation Peach pollen tubes, grown with or without CBD, were separated from the growth medium by pelleting for 1 min at 10,000g and fixed overnight at 4°C using 4% (v/v) glutaraldehyde in 0.1m phosphate buffer, pH 7.4. The pollen tubes were repelleted, thoroughly washed with distilled water, and stained with white fluorescent brightener (0.1% [w/v] calcofluor in 0.1m K3PO3) to reveal crystalline cell wall components under a fluorescent light microscope (Zeiss). Arabidopsis seedlings were treated similarly, except that the solutions were replaced without pelleting. Peach pollen tubes and Arabidopsis seedlings were examined by IGSS to detect CBD attachment to cellulose. The plant material was first fixed overnight at 4°C in 4% glutaraldehyde in PBST (15 mmphosphate buffer, 150 mm NaCl, 3 mm KCl, pH 7.4, and 0.1% [v/v] Tween 20). The specimens were washed with PBST for 1 h, soaked for 1 h in 1% skim milk, and then incubated for 1 h with polyclonal rabbit anti-CBD antibodies or preimmune serum, both diluted 1:500 in PBST. The specimens were then washed three times, for 10 min each time, in PBST and then incubated for 1 h with goat anti-rabbit IgG conjugated with 5-nm gold particles diluted 1:100 in PBST. The specimens were washed twice, for 10 min each time, with PBST and once with water. A silver-stain kit (BioCell Research Laboratories, Cardiff, UK) was used for the final development of the reaction. The specimens were soaked in the combined kit solutions for about 10 min, washed in excess distilled water, and observed under a light microscope (BX40, Olympus). Pea XG Extraction and Cellulose Pretreatment Pea XG was extracted as described by Hayashi et al. (1987). Pea XG concentrations were determined by the iodine-sodium sulfate method (Kooiman, 1960). Cellulose (Sigma Cell 20) was extracted five times with 4% KOH containing 0.1% NaBH4 in an ultrasonic bath set at a temperature below 30°C for 3 h to remove polymeric contamination material. The cellulose was neutralized with 2 m acetic acid and washed five times with 20 mm Tris-HCl, pH 7.0. Binding Capacity of XG to Cellulose Pea XG (10 μg) was mixed with an elevated amount of pretreated cellulose in sodium acetate buffer (25 mm sodium acetate and 0.01% NaN3, pH 5.0) and incubated at 37°C for 4 h with constant mixing to resuspend the cellulose. The cellulose was then centrifuged and the amount of unbound XG was determined by the iodine-sodium sulfate method. In a preliminary experiment we found that 15 μg of pea XG binds to 1 mg of pretreated cellulose (data not shown). Competition Assay All three of the experiments were conducted in a final volume of 400 μL in 1.5-mL microtubes at 37°C in sodium acetate buffer (25 mm sodium acetate and 0.01% NaN3, pH 5.0) with constant mixing: Different amounts of CBD or BSA were first added to 1 mg of cellulose and allowed to bind for 1 h. Only then was 15 μg of XG added and binding allowed for 4 h. XG (15 μg) was added to 1 mg of cellulose and allowed to bind for 4 h. Then different amounts of CBD were added and allowed to bind for 1 h. Different amounts of CBD together with 15 μg of XG were added to 1 mg of cellulose. Binding was allowed for 4 h. The cellulose mixtures were centrifuged at 10,000g and the amount of unbound XG was determined by the iodine-sodium sulfate method. The amount of unbound CBD was determined with a Bio-Rad protein assay kit (Bradford, 1976). All of the experiments were repeated at least three times. Representative data are presented. The Effect of CBD on Cellulose Synthesis in A. xylinum A. xylinum strain ATCC 23769 was kindly donated by the laboratory of Prof. Moshe Benziman at The Hebrew University of Jerusalem. Cells were grown for 24 h under constant shaking at 30°C in a medium consisting of 0.5% peptone, 0.5% yeast extract, 2% Glc, and 0.3% K2HPO4, pH 6.0, containing 1.5 units/mL Trichoderma viride L. cellulase (Fluka). The cells were harvested by centrifugation and washed twice with precooled phosphate buffer (50 mmNaH2PO4, pH 6.0). The bacterial pellet was resuspended in phosphate buffer to a concentration of 2 mg mL−1 dry weight (2.5A600 = 1 mg mL−1). One-milliliter reaction mixtures were placed in 20-mL scintillation vials containing 0.8 mg cells mL−1 phosphate buffer. Cellulose synthesis was initiated by the addition of 40 mm Glc (d-[U-14C]Glc; Amersham) at a specific activity of 40,000 cpm μmol−1 and was conducted for 1 to 2 h at 30°C with constant shaking.14CO2 formed was trapped in coverless 1.5-mL tubes containing 0.2 mL of 1 m NaOH placed in the reaction vial. The reaction was stopped by the addition of 0.1 mL of 0.5 m HCl to the bacterial suspension and was further incubated for 15 min. One-hundred-fifty microliters of the NaOH solution containing the trapped14CO2 was transferred to scintillation tubes. The cells and the cellulose were transferred to 1.5-mL tubes, centrifuged, and washed three times with water. The cells were lysed by mixing with 0.2 n NaOH and 1% SDS; cellulose was recovered on a GF/A filter (Whatman), washed with 15 mL of water to remove radioactive background, and dried in an oven at 60°C. Filters and NaOH containing trapped14CO2 were counted in a scintillation counter using Opti-fluor (Packard, Meriden, CT) scintillation liquid for Glc incorporation (cellulose synthase activity) and respiration, respectively. Electron microscopy was conducted by placing a copper grid on top of a drop of the appropriate solution at room temperature. The cellulose synthesis reaction contained 0.5 mg mL−1 dry weight cells in phosphate buffer and 40 mm Glc with or without CBD, at a concentration of 300 μg mL−1. The reaction was incubated for 30 min and then stopped with 2.5% glutardialdehyde for 30 min, washed three times with water, and dried. The grids were negatively stained with 1.5% phosphotungstic acid and examined with a 100 CX electron microscope (JEOL) operating at 80 kV. RESULTS Pollen Tube Elongation Peach pollen was germinated in the presence of different concentrations of CBD, and its effect on pollen-tube elongation is illustrated in Figure 1. At low concentrations CBD caused an increase in tube length as compared with the control without CBD, with an optimum at 50 μg mL−1. Increasing concentrations of BSA as a control had no effect on pollen-tube elongation. Figure2 shows the effect of CBD on peach pollen tubes stained with calcofluor. In the tip region of CBD-treated pollen tubes (Fig. 2A), no fluorescence could be detected. In contrast, the control pollen tubes showed continuous bright color, suggesting crystalline cell wall structures along the length of the pollen tube (Fig. 2B). IGSS of CBD in pollen tubes grown in the presence of CBD revealed the protein along the pollen tube. Intensive staining was observed predominantly in the tip zone (Fig. 2C). In the control pollen tubes, no CBD staining was observed (Fig. 2D) Fig. 1. Open in new tabDownload slide Pollen tube elongation in liquid culture containing different concentrations of CBD. Vertical bars representse. Fig. 1. Open in new tabDownload slide Pollen tube elongation in liquid culture containing different concentrations of CBD. Vertical bars representse. Fig. 2. Open in new tabDownload slide Calcofluor staining of pollen tubes grown with (A) or without (B) CBD. IGSS of pollen tubes grown in the presence of CBD reacted with anti-CBD antibodies (C) or with preimmune serum (D). Fig. 2. Open in new tabDownload slide Calcofluor staining of pollen tubes grown with (A) or without (B) CBD. IGSS of pollen tubes grown in the presence of CBD reacted with anti-CBD antibodies (C) or with preimmune serum (D). Arabidopsis Seedlings Arabidopsis seedlings were grown in the presence of different concentrations of CBD. Figure3A shows that low concentrations (0.01–1 μg mL−1) of CBD caused an approximately 30% increase in root elongation relative to the control. Higher CBD concentrations caused a significant inhibition of root elongation in a dose-responsive manner. At lower CBD concentrations no significant effect on root elongation was observed. However, at 100 μg mL−1, CBD had the opposite effect on root hair elongation compared with its effect on root elongation. An almost 2-fold increase in root hair elongation was observed at this CBD concentration (Fig. 3B). Only at the highest concentration (500 μg mL−1) did the effect of CBD on root and root hair elongation show a similar dramatic inhibition (Fig. 3). Figure4 shows the time course of the effect of 1 μg mL−1 CBD on the length of the roots. Two days after the beginning of the experiment, no significant difference was observed between the control and the CBD-treated seedlings, indicating that CBD did not affect the germination process. The CBD effect on root elongation was first observed after 3 d. BSA had no significant effect on the Arabidopsis seedlings. Except for the highest concentration, CBD was effective in the roots rather than in the hypocotyls, as illustrated in Figure 5. IGSS of CBD-treated seedlings using anti-CBD antibodies revealed the protein to be bound primarily to the root but not to the hypocotyl (Fig. 6A). The hypocotyl of these seedlings was not permeable to calcofluor, and therefore no fluorescence could be observed above the root (Fig. 6B). The IGSS shown in Figure 7 also revealed CBD to be primarily in the root hair-zone, especially at the tips (Fig. 7C). Fig. 3. Open in new tabDownload slide The effect of CBD on root (A) and root hair (B) length. Vertical bars represent se. Fig. 3. Open in new tabDownload slide The effect of CBD on root (A) and root hair (B) length. Vertical bars represent se. Fig. 4. Open in new tabDownload slide Time-course analysis of Arabidopsis root length as affected by 1 μg mL−1 CBD. Vertical bars representse. Fig. 4. Open in new tabDownload slide Time-course analysis of Arabidopsis root length as affected by 1 μg mL−1 CBD. Vertical bars representse. Fig. 5. Open in new tabDownload slide The effect of CBD on Arabidopsis seedlings. Representative seedlings from left to right are: control (no CBD), 10−2, 100, and 500 μg mL−1 CBD. Fig. 5. Open in new tabDownload slide The effect of CBD on Arabidopsis seedlings. Representative seedlings from left to right are: control (no CBD), 10−2, 100, and 500 μg mL−1 CBD. Fig. 6. Open in new tabDownload slide A, IGSS of CBD-treated Arabidopsis seedlings using anti-CBD antibodies. B, Calcofluor staining of the seedlings. Fig. 6. Open in new tabDownload slide A, IGSS of CBD-treated Arabidopsis seedlings using anti-CBD antibodies. B, Calcofluor staining of the seedlings. Fig. 7. Open in new tabDownload slide IGSS of CBD-treated Arabidopsis seedlings. Root zone of a 500 μg mL−1 CBD-treated seedling using anti-CBD antibodies (A) or preimmune serum (B). Root hair of 1 μg mL−1 CBD-treated seedling using anti-CBD antibodies (C) or preimmune serum (D). Fig. 7. Open in new tabDownload slide IGSS of CBD-treated Arabidopsis seedlings. Root zone of a 500 μg mL−1 CBD-treated seedling using anti-CBD antibodies (A) or preimmune serum (B). Root hair of 1 μg mL−1 CBD-treated seedling using anti-CBD antibodies (C) or preimmune serum (D). CBD-XG Competition Cellulose-binding competition between CBD and XG was assayed in three different ways: (a) Different amounts of CBD were first added to a fixed amount of cellulose and allowed to bind, and only then was a saturating amount of XG (as determined in an earlier experiment) added. (b) A saturating amount of XG was added and allowed to bind to the cellulose, and only then were different amounts of CBD added. (c) Different amounts of CBD together with a saturating amount of XG were added together to a fixed amount of cellulose. Figure 8 shows that when CBD was added first, as described in method (a) above, increasing concentrations of CBD resulted in increasing amounts of unbound XG (Fig. 8A). However, when XG was added first, as described in method (b) above, increasing concentrations of CBD did not affect the level of unbound XG (Fig. 8A), whereas the level of unbound CBD was higher (Fig. 8B). When CBD and XG were added together, as described for method (c) above, the results were similar to those observed when the CBD was added first as in method (a) (data not shown). BSA had no effect on the binding of XG to cellulose (data not shown). Fig. 8. Open in new tabDownload slide CBD-XG competition. The effect of CBD concentration on the amount of unbound XG (A) and unbound CBD (B) when CBD was added first to the cellulose or when XG was added first. Vertical bars represent se. Fig. 8. Open in new tabDownload slide CBD-XG competition. The effect of CBD concentration on the amount of unbound XG (A) and unbound CBD (B) when CBD was added first to the cellulose or when XG was added first. Vertical bars represent se. The Effect of CBD on Cellulose Synthesis in A. xylinum Resting cells of A. xylinum were allowed to synthesize cellulose in phosphate buffer containing radioactive Glc and different concentrations of CBD or calcofluor (as a positive control) and BSA (as a negative control) for 1 h or for the indicated time. Cellulose synthase activity was determined as Glc incorporation. Figure9 shows the effect of CBD at different concentrations (10–500 μg mL−1, 0.6–30 μm) compared with 1 mm calcofluor and 100 μg mL−1 BSA (1.5 μm). CBD increased Glc incorporation in a dose-responsive manner by up to 5-fold at 500 μg mL−1. Calcofluor increased the rate by 2-fold, whereas BSA had no effect. Since CO2production was stimulated by only 10% in the CBD treatment (at the highest concentration), the effect of CBD on cellulose synthesis appears to be direct and not related to general processes such as Glc uptake or respiration. Fig. 9. Open in new tabDownload slide The effect of different concentrations of CBD, 1 mm calcofluor (as a positive control), and 100 μg mL−1 BSA (as a negative control) on cellulose synthase activity in A. xylinum. Vertical bars representse. Fig. 9. Open in new tabDownload slide The effect of different concentrations of CBD, 1 mm calcofluor (as a positive control), and 100 μg mL−1 BSA (as a negative control) on cellulose synthase activity in A. xylinum. Vertical bars representse. Electron microscopy examination of the cellulose ribbons produced byA. xylinum showed that CBD treatment resulted in a splayed ribbon composed of separate fibrillar subunits, as compared with a thin, uniform ribbon in the control (Fig. 10). Fig. 10. Open in new tabDownload slide The effect of CBD on cellulose ribbon produced byA. xylinum (A) or control without CBD (B). The magnification in both panels is ×26,000. Fig. 10. Open in new tabDownload slide The effect of CBD on cellulose ribbon produced byA. xylinum (A) or control without CBD (B). The magnification in both panels is ×26,000. DISCUSSION CBD is shown to modulate the elongation of various plant tissues. At low concentrations it enhances elongation; at high concentrations, however, it inhibits it. Cell walls of pollen tubes have been shown to contain exposed cellulose fibrils in the tip zone (Steer and Steer, 1989). Gold immunolabeling of CBD in pollen tubes revealed that CBD was present primarily at the tip zone. Pollen tube elongation is known to be apical (Cresti and Tiezzi, 1992). Moreover, the lack of calcofluor staining in the tip zone of CBD-treated pollen tubes suggested the absence of a crystalline structure. We propose that the elongation effect of CBD is driven by its ability to bind to cellulose and prevent the normal assembly of microfibrils and, consequently, the cell wall. At low concentrations CBD enhanced elongation of Arabidopsis roots; at high concentrations it dramatically inhibited root elongation in a dose-responsive manner. The maximum effect on root hair elongation was at 100 μg mL−1, whereas at that concentration root elongation was inhibited. IGSS of CBD-treated seedlings revealed CBD to be bound primarily to the root but not to the hypocotyl (Fig. 6). Accordingly, most of the effect of CBD was observed in the root and not in the hypocotyl (Fig. 5). Once again, the effect of CBD was seen to coincide with its location. The absence of CBD in the hypocotyl could be explained by its inability to penetrate the cuticle, as seen with the smaller molecule calcofluor (Fig. 6B). A closer observation of IGSS-treated seedlings revealed that CBD was present primarily in the root hair zone (Fig. 7A) but also on the other parts of the root. Similar to pollen tubes, CBD was predominantly present at the tip of the root hairs (Fig. 7C). There were some differences between the effect of CBD on Arabidopsis root and the effect on root hairs. Maximum elongation of the roots was achieved at 0.01 to 1 μg mL−1 CBD, whereas in root hairs maximum elongation was achieved only at 100 μg mL−1. Nevertheless, the effect of CBD on root hairs seems to be similar to its effect on the pollen tube. In both, maximum elongation was achieved at about 100 μg mL−1 CBD and the inhibitory effect was achieved at the highest concentration, although it was not as outstanding as on the root. These findings concur with the knowledge that pollen tubes and root hairs have the same elongation pattern, which is called “tip growth” (Cresti and Tiezzi, 1992; Peterson and Farquhar, 1996). The inhibitory effect of CBD can be explained by steric hindrance of the cellulose fibrils by excess amounts of CBD, which block the access of enzymes and other proteins that modulate cell elongation via loosening of the rigid cellulose-fibril network. This hypothesis is supported by the work of Nevins, who prevented auxin-induced elongation with anti-β-d-glucan antibodies (Hoson and Nevins, 1989) or with antibodies specific to cell wall glucanases (Inouhe and Nevins, 1991). It has already been established that XG chains cross-link the cellulosic network in the cell wall (Roberts, 1994). It is accepted that a prerequisite for cell elongation is a loosening of the cross-linked cellulose network by hydrolysis, as demonstrated by Inouhe and Nevins (1991), by transglycosylation (Fry et al., 1992; Nishitani and Tominaga, 1992), or by expansins that interact with the XG-cellulose bond (McQueen-Mason et al., 1992). CBD competes with XG on binding to cellulose (Fig. 8). Maximum CBD binding to cellulose has been achieved after 1 h (Goldstein et al., 1993), compared with XG binding to cellulose, which has been achieved only after 4 h (Hayashi et al., 1987). CBD was unable to elute XG from cellulose when it was already bound (Fig. 8A); note that the highest concentration of CBD tested in this experiment prevented only about 12% of the amount of XG that bound to the cellulose in the absence of CBD. It should be noted that CBD does not have expansin activity, as assayed in the cucumber hypocotyl wall by Dan Cosgrove (personal communication;Cosgrove, 1997). It suggested that during the elongation process cellulose microfibrils become exposed and CBD competes with XG on binding to the exposed cellulose microfibrils. It is therefore possible that this competition results in a temporary loosening of the cell wall and, consequently, enhanced elongation. It is evident that polymerization and crystallization are coupled reactions in cellulose synthesis in A. xylinum bacteria (Benziman et al., 1980). CBD enhances incorporation of radioactive Glc in A. xylinum by interference with the crystallization process. Our hypothesis is supported by the review by Haigler (1991), in which dyes and fluorescent brightening agents that bind to cellulose alter cellulose microfibril assembly in vivo. Modifications in cell shape were observed when red alga (Waaland and Waaland, 1975) and plant root tips (Hughes and McCully, 1975) were grown in the presence of dyes. It is now evident that these molecules can bind to the cellulose chains immediately upon their extrusion from the cell surface of prokaryotes and eukaryotes (Haigler and Brown, 1979; Benziman et al., 1980; Haigler et al., 1980; Brown et al., 1982) and prevent crystal-structure formation (Haigler and Chanzy, 1988). In addition, the rate of cellulose polymerization has been shown to increase up to 4-fold in the presence of dye (Benziman et al., 1980). It has been proposed that crystallization is the bottleneck in this coupled reaction, and its prevention results in accelerated polymerization. The suitability of A. xylinum as a model system for higher plants has long been controversial. Nevertheless, it remains fundamentally an important model organism in cellulose research. The effect of CBD as observed by electron microscopy is comparable to the effect of CMC rather than to the effect of calcofluor (Haigler, 1991); in both cases the cellulose ribbon only splayed. The effect of CBD on cellulose synthase activity was higher than the effect of CMC and was comparable and even higher than that of calcofluor (Fig.9). The different effects of CBD, CMC, and calcofluor can be attributed to the differences in their Mr and their affinities to cellulose. CMC (90 kD) can prevent only the normal association of larger fibrillar subunits and, therefore, hardly alter crystallization, whereas the small molecule calcofluor prevents the glucan chain association immediately after its initiation. CBD is somewhere between the two molecules: it is not small enough to prevent the association of very small fibrils as done by calcofluor, but its high affinity to cellulose makes it an efficient cellulose-intercalating agent, which leads to as much as a 5-fold increase in cellulose synthesis rate. Two hypotheses explaining the effect of CBD on plant cell elongation were examined in this study: (a) CBD competes with XG on binding to cellulose, thus causing loosening of the cell wall network, which results in turgor-driven elongation. (b) When A. xylinum is used as a model system, CBD enhances cellulose synthesis, which is a limiting factor in plant cell elongation. At this time, our results show that none of the above mechanisms can be ruled out. CBD is a bacterial protein. Its mode of action in modulating plant cell wall elongation is probably different from that of the natural process. However, its effect is relevant in that it may shed more light on this controversial process. In addition, its gene may be useful for biotechnological applications in modulating cell wall elongation and cell wall architecture of transgenic plants expressing cbdunder the control of various tissue-specific promoters. Construction of transgenic plants expressing the CBD protein under different promoters is under way. ACKNOWLEDGMENTS The authors are indebted to Prof. Takahisa Hayashi for his useful suggestions in XG-cellulose interaction assays, to Prof. Deborah P. Delmer for a fruitful discussion in the early days of this work, to Prof. Dan Cosgrove for conducting stress relaxation experiments with CBD, and to Prof. Moshe Benziman and Dr. Hayim Weinhouse for their kind help with the A. xylinum experiments. Abbreviations: CBD cellulose-binding domain CMC carboxymethyl-cellulose IGSS immunogold silver stain XG xyloglucan LITERATURE CITED 1 Aldington S Fry SC Oligosaccharins. Adv Bot Res 19 1993 1 101 Google Scholar Crossref Search ADS WorldCat 2 Alexander MP A versatile stain for pollen fungi, yeast and bacteria. Stain Technol 55 1980 13 18 Google Scholar Crossref Search ADS PubMed WorldCat 3 Benziman M Haigler CH Brown RM Jr White AR Cooper KM Cellulose biogenesis: polymerization and crystallization are coupled processes in Acetobacter xylinum. Proc Natl Acad Sci USA 77 1980 6678 6682 Google Scholar Crossref Search ADS PubMed WorldCat 4 Bradford MM A rapid and sensitive method for quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72 1976 248 254 Google Scholar Crossref Search ADS PubMed WorldCat 5 Brown RMJ Haigler C Cooper K Experimental induction of altered nonmicrofibrillar cellulose. Science 218 1982 1141 1142 Google Scholar Crossref Search ADS PubMed WorldCat 6 Carpita NC Gibeaut DM Structural models of primary cell walls in flowering plants: consistency of molecular structure with the physical properties of the walls during growth. Plant J 3 1993 1 30 Google Scholar Crossref Search ADS PubMed WorldCat 7 Cosgrove DJ Relaxation in a high-stress environment: the molecular bases of extensible cell walls and cell enlargement. Plant Cell 9 1997 1031 1041 Google Scholar Crossref Search ADS PubMed WorldCat 8 Cresti M Tiezzi A Pollen tube emission organization and tip growth. Cresti M Tiezzi A Sexual Plant Reproduction. 1992 89 97 Springer-Verlag Berlin 9 Fry SC Smith RC Renwick KF Martin DJ Hodge SK Matthews KJ Xyloglucan endotransglycosylase, a new wall-loosening enzyme activity from plants. Biochem J 282 1992 821 828 Google Scholar Crossref Search ADS PubMed WorldCat 10 Goldstein MA Takagi M Hashida S Shoseyov O Doi RH Segel IH Characterization of the cellulose-binding domain of the Clostridium cellulovorans cellulose-binding protein A. J Bacteriol 175 1993 5762 5768 Google Scholar Crossref Search ADS PubMed WorldCat 11 Haigler C Brown RM Jr The fluorescent brightener, calcofluor white, alters cellulose synthesis in Acetobacter xylinum (abstract). J Cell Biol 83 1979 70a Google Scholar Crossref Search ADS WorldCat 12 Haigler C Brown RM Jr Benziman M Calcofluor white ST alters the in vivo assembly of cellulose microfibrils. Science 210 1980 903 906 Google Scholar Crossref Search ADS PubMed WorldCat 13 Haigler CH (1991) Relationship between polymerization and crystallization in microfibril biogenesis. In CH Haigler, PJ Weimer, eds, Biosynthesis and Biodegradation of Cellulose. Marcel Dekker, New York, pp 99–124 14 Haigler CH Chanzy H Electron diffraction analysis of the altered cellulose synthesized by Acetobacter xylinum in the presence of fluorescent brightening agents and direct dyes. J Ultrastruct Mol Struct Res 98 1988 299 311 Google Scholar Crossref Search ADS WorldCat 15 Hayashi T Marsden MPF Delmer D Plant Physiol 83 1987 384 389 Crossref Search ADS PubMed 16 Hayashi T Ogawa K Mitsuishi Y Characterization of the adsorption of xyloglucan to cellulose. Plant Cell Physiol 35 1994 1199 1205 Google Scholar Crossref Search ADS WorldCat 17 Hoson T Nevins DJ β-d-Glucan antibodies inhibit auxin-induced cell elongation and changes in the cell wall of Zea coleoptile segments. Plant Physiol 90 1989 1353 1358 Google Scholar Crossref Search ADS PubMed WorldCat 18 Hughes J McCully ME The use of an optical brightener in the study of plant structure. Stain Technol 50 1975 319 329 Google Scholar Crossref Search ADS PubMed WorldCat 19 Inouhe M Nevins DJ Inhibition of auxin-induced cell elongation of maize coleoptiles by antibodies specific for cell wall glucanases. Plant Physiol 96 1991 426 431 Google Scholar Crossref Search ADS PubMed WorldCat 20 Kooiman P A method for the determination of amyloid in plant seeds. Recl Trav Chim Pays-Bas Bel 79 1960 675 678 Google Scholar Crossref Search ADS WorldCat 21 Laemmli UK Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227 1970 680 685 Google Scholar Crossref Search ADS PubMed WorldCat 22 McDougall GJ Fry SC Inhibition of auxin-stimulated growth of pea stem segments by a specific nonasaccharide of xyloglucan. Planta 175 1988 412 416 Google Scholar Crossref Search ADS PubMed WorldCat 23 McDougall GJ Fry SC Xyloglucan oligosaccharides promote growth and activate cellulase: evidence for a role of cellulase in cell expansion. Plant Physiol 93 1990 1042 1048 Google Scholar Crossref Search ADS PubMed WorldCat 24 McQueen-Mason SJ Cosgrove DJ Expansin mode of action on cell walls—analysis of wall hydrolysis, stress relaxation, and binding. Plant Physiol 107 1995 87 100 Google Scholar Crossref Search ADS PubMed WorldCat 25 McQueen-Mason SJ Durachko DM Cosgrove DJ Two endogenous proteins that induce cell wall extension in plants. Plant Cell 4 1992 1425 1433 Google Scholar PubMed OpenURL Placeholder Text WorldCat 26 McQueen-Mason SJ Fry SC Durachko DM Cosgrove DJ The relationship between xyloglucan endotransglycosylase and in-vitro cell wall extension in cucumber hypocotyls. Planta 190 1993 327 331 Google Scholar Crossref Search ADS PubMed WorldCat 27 Morag E Lapidot A Govorko D Lamed R Wilchek M Bayer EA Shoham Y Expression, purification, and characterization of the cellulose-binding domain of the scaffold in subunit from the cellulosome of Clostridium thermocellum. Appl Environ Microbiol 61 1995 1980 1986 Google Scholar Crossref Search ADS PubMed WorldCat 28 Nishitani K Tominaga R Endo-xyloglucan transferase, a novel class of glycosyltransferase that catalyzes transfer of a segment of xyloglucan molecule to another xyloglucan molecule. J Biol Chem 267 1992 21058 21064 Google Scholar Crossref Search ADS PubMed WorldCat 29 Peterson RL Farquhar ML Root hairs: specialized tubular cells extending root surfaces. Bot Rev 62 1996 1 40 Google Scholar Crossref Search ADS WorldCat 30 Roberts K The plant extracellular matrix: in a new expansive mood. Curr Opin Cell Biol 6 1994 688 694 Google Scholar Crossref Search ADS PubMed WorldCat 31 Ross P Mayer R Benziman M Cellulose biosynthesis and function bacteria. Microbiol Rev 55 1991 35 58 Google Scholar Crossref Search ADS PubMed WorldCat 32 Shoseyov O Doi RH Essential 170-kDa subunit for degradation of crystalline cellulose by Clostridium cellulovorans cellulase. Proc Natl Acad Sci USA 87 1990 2192 2195 Google Scholar Crossref Search ADS PubMed WorldCat 33 Shoseyov O Takagi M Goldstein MA Doi RH Primary sequence analysis of Clostridium cellulovorans cellulose binding protein A. Proc Natl Acad Sci USA 89 1992 3483 3487 Google Scholar Crossref Search ADS PubMed WorldCat 34 Steer MW Steer JM Pollen tube tip growth. New Phytol 111 1989 323 358 Google Scholar Crossref Search ADS PubMed WorldCat 35 Waaland SD Waaland JR Analysis of cell elongation in red algae by fluorescent labeling. Planta 126 1975 127 138 Google Scholar Crossref Search ADS PubMed WorldCat 36 York WS Darvill AG Albersheim P Inhibition of 2,4-dichlorophenoxyacetic acid-stimulated elongation of pea stem segments by a xyloglucan oligosaccharide. Plant Physiol 75 1984 295 297 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This study was supported in part by an Eshkol fellowship (to E.S.). * Corresponding author; e-mail [email protected]; fax 972–8–946–2283. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Cowling, Rachel J.; Kamiya, Yuji; Seto, Hideharu; Harberd, Nicholas P.

doi: 10.1104/pp.117.4.1195pmid: 9701576

Abstract The gibberellins (GAs) are a complex family of diterpenoid compounds, some of which are potent endogenous regulators of plant growth. As part of a feedback control of endogenous GA levels, active GAs negatively regulate the abundance of mRNA transcripts encoding GA biosynthesis enzymes. For example, Arabidopsis GA4 gene transcripts encode GA 3β-hydroxylase, an enzyme that catalyzes the conversion of inactive to active GAs. Here we show that active GAs regulateGA4 transcript abundance in a dose-dependent manner, and that down-regulation of GA4 transcript abundance is effected by GA4 (the product of 3β-hydroxylation) but not by its immediate precursor GA9 (the substrate). Comparison of several different GA structures showed that GAs active in promoting hypocotyl elongation were also active in regulating GA4transcript abundance, suggesting that similar GA:receptor and subsequent signal transduction processes control these two responses. It is interesting that these activities were not restricted to 3β-hydroxylated GAs, being also exhibited by structures that were not 3β-hydroxylated but that had another electronegative group at C-3. We also show that GA-mediated control of GA4 transcript abundance is disrupted in the GA-response mutants gaiand spy-5. These observations define a sensitive homeostatic mechanism whereby plants may regulate their endogenous GA levels. GAs are a family of hormones that are essential for development and growth of plants (Hooley, 1994). However, the molecular mechanism for GA perception thought to involve a GA:GA-receptor interaction has yet to be elucidated. Although more than 100 different GA structures have been identified in plants, only a few possess biological activity, suggesting a high degree of specificity to the GA:GA-receptor interaction (Takahashi et al., 1990). The study of GA action has been advanced by the use of mutants that are affected in GA biosynthesis or signal transduction (Ross, 1994). Examples of GA-biosynthesis mutants in Arabidopsis are the GA-deficient dwarfs ga1, ga4, and ga5 (Koornneef and van der Veen, 1980). A WT phenotype can be recovered in all of these mutants by applying active GAs. GA biosynthesis is a multistep pathway involving ent-kaurene synthesis and oxidation, followed by further oxidations of the GA skeleton, the latter being catalyzed by 20-oxidase and 3β-hydroxylase (Graebe, 1987; Talon et al., 1990a). GA1, GA4, and GA5 are loci that encode the copalyl diphosphate synthase (Sun and Kamiya, 1994; Hedden and Kamiya, 1997), 3β-hydroxylase (Chiang et al., 1995;Hedden and Kamiya, 1997), and 20-oxidase (Phillips et al., 1995; Xu et al., 1995) enzymes of GA biosynthesis, respectively. 3β-Hydroxylation is widely held to be a final step in the biosynthesis of active GAs, converting GA9 and GA20(inactive) to GA4 and GA1(active), respectively. Recently, it has been shown that expression of 20-oxidase andGA4 genes is negatively regulated by exogenous GA (Chiang et al., 1995; Phillips et al., 1995; Xu et al., 1995). These observations are consistent with evidence suggesting that the activities of GA biosynthesis enzyme can be down-regulated by GA (Hedden and Croker, 1992). A negative feedback loop of this nature requires that GAs active in feedback regulation can somehow be distinguished from similar (but inactive) structures in the GA biosynthesis pathways. In the case of feedback regulation of GA4 transcript levels, this could occur in one of two ways: Either the immediate products of the 3β-hydroxylation reaction or all biologically active GA structures negatively regulate GA4 transcript levels. Here we describe experiments designed to determine which of these possible mechanisms is responsible for the regulation of GA4 transcript levels. The Arabidopsis GA signal transduction mutant gai has the dwarf, dark-green characteristics of a GA-deficient plant. However, the phenotype conferred by gai cannot be rescued by the application of GA, and the gai mutant therefore displays reduced responses to both endogenous and exogenous GA (Koornneef et al., 1985; Peng and Harberd, 1993, 1997; Wilson and Somerville, 1995;Peng et al., 1997). gai has higher than wild-type levels of endogenous active GAs (Talon et al., 1990b), suggesting that negative feedback regulation of GA levels is perturbed in this mutant. Another class of Arabidopsis GA signal transduction mutants, the spymutants, display resistance to the GA biosynthesis inhibitor PAC (Jacobsen and Olszewski, 1993; Wilson and Somerville, 1995; Jacobsen et al., 1996). spy mutants are able to germinate and display elongation growth in concentrations of PAC that are inhibitory to wild-type plants. In this paper we describe experiments that define the nature of the feedback regulation of GA4 transcript levels by active GAs. Using the GA-deficient ga1–3 mutant (Sun and Kamiya, 1994), we show that GA4 transcript levels are negatively regulated by the product of the 3β-hydroxylation reaction, GA4, but not by the immediate precursor, GA9. Feedback regulation occurs in a dose-dependent manner that closely mirrors stimulation of hypocotyl elongation. We also show that the presence of a 3β-OH group does not always confer activity for feedback, and that GAs that are active in feedback do not have to be 3β-hydroxylated. Finally, we show that feedback regulation of GA4 transcript levels is disrupted ingai and spy mutants. These results indicate that negative feedback regulation of GA4 transcript levels occurs by perception of active GAs via a receptor/signal transduction pathway that is similar to that involved in GA-mediated elongation growth. MATERIALS AND METHODS Chemicals GA1 was a gift from Prof. Sassa (Yamagata University Yamagata, Japan), and GA4 was obtained from Kyowa Hakko Co., Ltd. (Tokyo, Japan). GA C was prepared from GA1 (Cross, 1960): treatment of GA1 with Dowex-resin 50W-X2 (H+ form) in refluxing methanol:water, 2:5 (v/v), for 7 h gave GA C in 84% yield.epi-GA4 was prepared from GA4: treatment of GA4 with potassium tert-butoxide in tert-butyl alcohol at room temperature for 7 d affordedepi-GA4 in 92% yield (Aldridge et al., 1965). 3-oxo-GA9 was prepared from GA4 by oxidation (Aldridge et al., 1965). All of the GAs were purified by preparative high-performance column chromatography. The purity of GAs was about 100% as checked by GC-MS. Plant Material and Growth Procedures An Arabidopsis Landsberg erecta laboratory strain (wild type) was used throughout. ga1–3 and gai mutants were originally isolated from mutagenized WT (Koornneef and van der Veen, 1980; Koornneef et al., 1985). Seeds homozygous for thespy-5 allele (also isolated from mutagenized wild type) were kindly donated by R. Wilson (Wilson and Somerville, 1995). After sterilization (Ezura and Harberd, 1995), ga1–3 seeds were chilled for 5 d at 4°C in sterile 10−6m GA4solution to initiate and synchronize germination. After a thorough rinsing in sterile water they were plated individually (50/plate) on germination medium (Ezura and Harberd, 1995) containing GA or inhibitors at the required concentration. Sterilized wild type andspy-5 seeds were directly sown (50/plate) before chilling for 5 d at 4°C. The seeds were then grown in a standard growth room at 20°C with a 16-h light/8-h dark cycle. GAs (previously purified by HPLC) were dissolved in methanol and then in sterile water. A small volume (no more than 1/1000 volume) was then added to 20 mL of cooled molten germination medium in Petri dishes. The inhibitors PAC (Zeneca Agrochemicals, Wilmington, DE) and BX-112 (Kumiai Chemical Research Institute, Shizuoka, Japan) were made up and added in the same way. Hypocotyls were measured directly to the nearest 0.5 mm using samples of 8 to 10 per treatment. QRT-PCR RNA was prepared from seedlings (entire aerial parts) harvested 2 weeks after germination (about 20 per sample). Approximately 5 μg of each RNA sample was then used in a first-strand cDNA synthesis reaction (containing RNase inhibitor) using a standard poly-dT adapter primer and Moloney murine leukemia virus reverse transcriptase, diluted 10-fold. The following oligonucleotides were made to amplify fragments of the GA4 (Chiang et al., 1995,1997), APT1 (Moffat et al., 1994) and γ-TIP(Ludevid et al., 1992) cDNAs: OLLY23, 5′-TCCCAGAATCGCTAAGATTGCC-3′; OLLY42, 5′-CCTTTCCCTTAAGCTCTG-3′; OLLY26, 5′-CGATTTCCGTAAACTTTGGC-3′; OLLY28, 5′-ATCCATTGGATAGGATGTGG-3′; OLLY40, 5′-CATCTTGAAGCTTAAATC-3′; and OLLY22, 5′-GACTCGAGTCGACAT-CGA(T)17-3′. OLLY23 and OLLY42 amplify a 478-bp fragment of APT1 cDNA. OLLY26 and OLLY28 amplify a 398-bp fragment of GA4 cDNA. Both of these products can be distinguished by size from products resulting from amplification of any contaminant genomic DNA because the primer sequences are on either side of at least one intron. For the amplification of γ-TIP cDNA, OLLY40 was used with a poly-T primer (OLLY22) to ensure that only cDNA would be amplified, as a fragment of approximately 1.1 kb (the γ-TIP genomic DNA sequence is unknown). In each case, the PCR product was cloned and sequenced, using standard techniques, so as to verify the sequence of the amplified fragments. The cloned fragments were later released from the cloning vectors via restriction endonuclease digestion and used as hybridization probes. The above cDNA solutions (5 μL) were used as the templates in a standard 50-μL PCR reaction (with 0.25 mm dNTPs and 2 ng/μL each primer) of up to 30 to 34 cycles of 1 min each at 94°C, 55°C, and 72°C. OLLY23/OLLY42 and OLLY26/OLLY28 primer pairs were used in separate reactions to avoid primer competition (Murphy et al., 1990). After at least 10 cycles, 4-μL aliquots were removed from the reactions every 2 to 4 cycles. PCR products were separated by electrophoresis, blotted, and hybridized using standard techniques ([32P]dCTP-labeled hybridization probes, as described above). QRT-PCR products were quantified by phosphor imaging, using ImageQuant software (Molecular Dynamics, Sunnyvale, CA). Curves were constructed by plotting the radioactivity of the PCR product (y-axis; log10 scale) against the number of cycles (x-axis) (see Fig. 1B). This confirmed the approximately exponential nature of the PCRs (all gradients were between 0.22 and 0.3 [the theoretical maximum for PCR]). Expression of the two genes was compared at points where both reactions were progressing exponentially, which gives a ratio of GA4/APT1expression (Noonan et al., 1990). Within each experiment, these ratios were normalized to the sample grown on GM alone or as described in the figure legends. However, in some samples the expression of theGA4 gene was so low that PCR products could not be detected within this range, and a ratio could not be calculated, so in the figures this is described as not detected. A product was always detected after 30 cycles, suggesting that the GA4 gene was never completely repressed in our experiments, but at this point the control gene reactions had already saturated. It is also possible that the primers used to amplify the GA4 product, although shown to preferentially amplify product derived from the GA4 gene itself, might also amplify the products of any genes closely related in sequence to GA4. Fig. 1. Open in new tabDownload slide A, QRT-PCR analysis of GA4 andγ-TIP (TIP) transcripts relative to those of the APT1 control gene in GA4-treated (10−7m;ga1–3 + GA) and untreated ga1–3(ga1–3). The relevant primer pairs (see Methods) were used on poly-T-primed cDNA samples in separate reactions. Aliquots taken after the stated number of cycles were separated on a 1.2% agarose gel, blotted, hybridized to radioactively labeled probes of a known sequence, and visualized by phosphor imaging. B, Kinetics of RT-PCR reactions shown in A compared with others using wild-type samples. Radioactivity of hybridized filters was measured using ImageQuant software (see Methods) and plotted on a log10 scale (y axis) (AU, arbitrary units) against the number of PCR cycles (x axis). In the GA4-treated sample, the GA4-derived primers amplified two products, the smaller of which was of the correct size to be the GA4 sequence and the signal intensity of which was measured. Gradients over the linear portions (exponential phases) of the curves range from 2.2 to 2.8. RT-PCR product levels were compared before saturation occured (cycle 24). WT, wild type. Fig. 1. Open in new tabDownload slide A, QRT-PCR analysis of GA4 andγ-TIP (TIP) transcripts relative to those of the APT1 control gene in GA4-treated (10−7m;ga1–3 + GA) and untreated ga1–3(ga1–3). The relevant primer pairs (see Methods) were used on poly-T-primed cDNA samples in separate reactions. Aliquots taken after the stated number of cycles were separated on a 1.2% agarose gel, blotted, hybridized to radioactively labeled probes of a known sequence, and visualized by phosphor imaging. B, Kinetics of RT-PCR reactions shown in A compared with others using wild-type samples. Radioactivity of hybridized filters was measured using ImageQuant software (see Methods) and plotted on a log10 scale (y axis) (AU, arbitrary units) against the number of PCR cycles (x axis). In the GA4-treated sample, the GA4-derived primers amplified two products, the smaller of which was of the correct size to be the GA4 sequence and the signal intensity of which was measured. Gradients over the linear portions (exponential phases) of the curves range from 2.2 to 2.8. RT-PCR product levels were compared before saturation occured (cycle 24). WT, wild type. RESULTS GA4 Transcript Levels Are Elevated in thega1–3 Mutant GA4 expression was followed relative to the expression of a control gene, APT1, by QRT-PCR using the kinetic method. This method permits quantification of the abundance of a specific mRNA with respect to another endogenous control mRNA (Chelly et al., 1988; Murphy et al., 1990; Noonan et al., 1990).APT1 is expressed at a low level in all tissues of Arabidopsis (Moffat et al., 1994). These experiments were performed using the ga1–3 mutant, which has greatly reduced levels of endogenous active GAs due to a deletion in a gene encoding copalyl diphosphate synthase (Sun and Kamiya, 1994; Hedden and Kamiya, 1997). Transcripts were compared in ga1–3 seedlings treated with exogenous GA4 and untreated controls. GA4 was chosen for these experiments because it is the most abundant 3β-hydroxylated GA and probably the main active GA in Arabidopsis (Talon et al., 1990a). As shown in Figure1, the levels of control APT1 transcript inga1–3 seedlings are not significantly affected by GA4 treatment (Fig. 1A), and are not significantly different from that of WT (Fig. 1B). γ-TIP transcript levels are up-regulated following GA treatment of the GA-deficient ga1–2 mutant (Phillips and Huttly, 1994). We compared the effects of exogenous GA4 on the accumulation of γ-TIP andGA4 transcripts in ga1–3 (Fig. 1A). As expected,γ-TIP transcripts were not detected in the untreatedga1–3 controls, but were clearly detectable in the GA4-treated ga1–3 sample. The behavior of GA4 transcripts in these experiments is the converse of that of γ-TIP, in that GA4transcripts were clearly detectable in the untreated ga1–3controls, but were only just detectable in the GA4-treated ga1–3 sample. ga1–3 mutant seedlings contained elevated levels ofGA4 transcript compared with the wild type (Fig. 1B). These elevated transcript levels were restored to wild-type levels by the addition of exogenous GA4 (Fig. 1B). The GA4-treated ga1–3 sample required at least six more PCR cycles to produce the same amount of GA4amplification product than did the nontreated ga1–3control, whereas APT1 was expressed at the same level in both samples (Fig. 1B). The efficiency of the PCR reaction was similar for all samples and for both genes during the exponential phase (Fig.1B). The elevated level of GA4 transcript in thega1–3 mutant is thus equivalent to an induction ofGA4 gene expression of over 60-fold (64). This result is consistent with previous observations that GA4 transcripts accumulate in a ga4 mutant to higher levels than in the wild type, and confirms that GA4 transcript abundance is negatively regulated by GAs (Chiang et al., 1995). GA-Mediated Feedback Control of GA4 Transcript Abundance Is GA Dose Dependent For the following experiments, a steady-state estimate ofGA4 mRNA abundance was obtained by calculating the ratio ofGA4:APT1 transcripts using information from plots such as the one in Figure 1B. The phosphor imager value for the GA4gene was divided by that of the APT1 gene at the value ofx (no. of PCR cycles), where both reactions were approximately exponential, and prior to saturation (cycle 22 for Fig.1B). This ratio approximates the ratio of initial templates in the PCR reaction at cycle 0, providing all of the reactions have similar efficiencies (Noonan et al., 1990). Within each experiment all samples had been prepared and processed at the same time, and ratios were calculated at the same number of cycles. Within each experiment these values were normalized to the sample grown on medium alone (i.e. in the absence of hormone or inhibitors), which was arbitrarily given theGA4:APT1 ratio of 1. All experiments were repeated with separate RNA samples, PCRs, and hybridizations; representative data are shown. The effects of a range of GA concentrations on GA4transcript abundance and hypocotyl elongation were compared (Fig.2). At a high GA4dose, ga1–3 hypocotyls were as long as those of untreated wild type, whereas GA4 transcript levels were as low as those of untreated wild type. However, as the GA4dose decreased, ga1–3 hypocotyls became progressively shorter, and GA4 transcript levels became progressively higher. Fig. 2. Open in new tabDownload slide ga1–3 seedlings were assayed for relative GA4 mRNA levels and hypocotyl length 2 weeks after germination on medium containing the stated concentration of GA4. QRT-PCR results (GA4:APT1 ratios, calculated after 22 cycles, when the reaction had yet to saturate) were normalized with respect to ga1–3 grown on germination medium only (=1). Results from untreated wild-type seedlings are shown for a comparison (open symbols). Error bars represent sehypocotyl length (sometimes smaller than symbol width). •,ga1–3 hypocotyl elongation; ○, wild-type hypocotyl elongation; ▪, GA4/APT1 transcript ratios inga1–3; □, GA4/APT1 transcript ratios in the wild type. Fig. 2. Open in new tabDownload slide ga1–3 seedlings were assayed for relative GA4 mRNA levels and hypocotyl length 2 weeks after germination on medium containing the stated concentration of GA4. QRT-PCR results (GA4:APT1 ratios, calculated after 22 cycles, when the reaction had yet to saturate) were normalized with respect to ga1–3 grown on germination medium only (=1). Results from untreated wild-type seedlings are shown for a comparison (open symbols). Error bars represent sehypocotyl length (sometimes smaller than symbol width). •,ga1–3 hypocotyl elongation; ○, wild-type hypocotyl elongation; ▪, GA4/APT1 transcript ratios inga1–3; □, GA4/APT1 transcript ratios in the wild type. Feedback Regulation by Active GAs? GA9 is 3β-hydroxylated by the 3β-hydroxylase enzyme in planta to form GA4(Fig. 3A). We investigated the hypothesis that regulation of expression of the GA4 gene is an example of product inhibition by testing the effects of GA9 (substrate) and GA4(product) on the accumulation of GA4 transcripts in thega1–3 mutant. To prevent conversion of GA9 to GA4, the inhibitor BX-112 was used. BX-112 prevents both 3β- and 2β-hydroxylation of GAs (Nakayama et al., 1990a, 1990b). Figure 3B shows that GA9 and GA4 caused a marked increase in ga1–3 hypocotyl length. However, if BX-112 was included in the medium, the effect of GA9 was greatly reduced, whereas that of GA4 was relatively unaffected. The simplest explanation for this is that GA9 is not active in itself, but becomes active following 3β-hydroxylation to GA4. 3β-Hydroxylation is largely, but not completely, abolished by the BX-112 treatment; thus, only a small amount of the inactive GA9 is converted to GA4 in the presence of BX-112. Fig. 3. Open in new tabDownload slide GA4 transcript levels are regulated by GA4 but not by GA9. A, GA9 is converted to GA4 by the addition of a 3β-OH group on C-3 (*). This reaction is catalyzed by the GA4 gene product and inhibited by BX-112. B, ga1–3 seedlings were grown for 2 weeks on germination medium supplemented with 10−4m BX-112, 10−7mGA9, and 10−7mGA4 as stated. Hypocotyl lengths were measured as described in Figure 2, error bars represent se. C,ga1–3 seedlings treated as in B were assayed forGA4 transcript levels as in Figure 2. RT-PCR products were compared after 22 cycles. Results are presented asGA4:APT1 product ratios, normalized with respect toga1–3 grown on germination medium only (=1). n.d.,GA4 transcript not detected (see Methods). Fig. 3. Open in new tabDownload slide GA4 transcript levels are regulated by GA4 but not by GA9. A, GA9 is converted to GA4 by the addition of a 3β-OH group on C-3 (*). This reaction is catalyzed by the GA4 gene product and inhibited by BX-112. B, ga1–3 seedlings were grown for 2 weeks on germination medium supplemented with 10−4m BX-112, 10−7mGA9, and 10−7mGA4 as stated. Hypocotyl lengths were measured as described in Figure 2, error bars represent se. C,ga1–3 seedlings treated as in B were assayed forGA4 transcript levels as in Figure 2. RT-PCR products were compared after 22 cycles. Results are presented asGA4:APT1 product ratios, normalized with respect toga1–3 grown on germination medium only (=1). n.d.,GA4 transcript not detected (see Methods). Seedling samples were assayed for GA4 transcript levels relative to the control gene APT1 by comparing levels of RT-PCR products after 22 cycles (Fig. 3C). GA4 transcript levels were high in the ga1–3 mutant, but were repressed by both GA9 and GA4 in the absence of BX-112. No GA4 RT-PCR product was detected in the GA9 (without BX-112) or GA4(without BX-112) samples (after 22 cycles) even though the control gene was expressed at the same level in both samples, as it is in nontreatedga1–3 (see Methods; data not shown). However, in the presence of BX-112, GA9 reducedGA4 transcript accumulation in ga1–3 only very slightly, whereas GA4 was equally effective in reducing GA4 transcript accumulation in ga1–3 in the presence or absence of BX-112. The simplest explanation for these observations is that GA4 is active in the feedback control of GA4 transcript abundance, whereas GA9 is not. Thus, a GA endogenous to Arabidopsis (GA4) regulates a product-inhibition pathway controlling the abundance of transcripts that encode an enzyme required for the biosynthesis of that GA. GA Structure-Activity Relationships in the GA4Transcript Feedback Response It might be predicted that only 3β-hydroxylated GAs would feedback regulate the abundance of GA4 transcripts (which encode the 3β-hydroxylase). It has also been suggested that the 3β-OH group is the key to GA activity in some plants (Reeve and Crozier, 1974). A range of GA structures (Fig.4A) were tested for their activity in stimulating hypocotyl elongation in ga1–3 seedlings at a set concentration of 10−7m. This is the lowest concentration at which exogenous GA4stimulates hypocotyl elongation sufficiently to make aga1–3 hypocotyl of equivalent length to an untreated wild-type hypocotyl (Fig. 2). The results of these experiments are shown in Table I. GA4, 3-oxo-GA9, andepi-GA4 exhibited strong activity as stimulators of ga1–3 hypocotyl elongation, whereas GA1, GA C, and GA4-methyl ester all exhibit low activity. For the purposes of the present paper the GAs used in these experiments are classified as active or inactive as stimulators of ga1–3 hypocotyl elongation (Table I). Fig. 4. Open in new tabDownload slide Structures of the GAs and GA analogs tested for biological activity. Significant differences in structure from GA4 (see Fig. 3A) are highlighted (*).epi-GA4 is 3α-hydroxylated rather than 3β-hydroxylated; GA1 is 13-hydroxylated; GA4-methyl ester (GA4-Me) is esterified on the carboxyl group at carbon-7; 3-oxo-GA9 has a ketone group at C-3 instead of a 3β-hydroxyl group; and GA C, a derivative of GA1, has a rearrangement of the C and D rings. Fig. 4. Open in new tabDownload slide Structures of the GAs and GA analogs tested for biological activity. Significant differences in structure from GA4 (see Fig. 3A) are highlighted (*).epi-GA4 is 3α-hydroxylated rather than 3β-hydroxylated; GA1 is 13-hydroxylated; GA4-methyl ester (GA4-Me) is esterified on the carboxyl group at carbon-7; 3-oxo-GA9 has a ketone group at C-3 instead of a 3β-hydroxyl group; and GA C, a derivative of GA1, has a rearrangement of the C and D rings. Table I. GA structure-activity relationships GA-a . Hypocotyl Length-b . GA4:APT1Ratio-c . Activity-d . mm 3β-OH-GAs  0 0.8  (0.1) 1.00 —  GA4 3.3  (0.3) n.d.-e Active  GA1 1.0  (0.1) 0.41 Inactive  GA4-Methyl ester 0.7  (0.1) 0.80 Inactive  GA C 0.9  (0.1) 0.98 Inactive Non-3β-OH-GAs  epi-GA4 2.8  (0.3) n.d. Active  3-oxo-GA9 4.1  (0.4) n.d. Active GA-a . Hypocotyl Length-b . GA4:APT1Ratio-c . Activity-d . mm 3β-OH-GAs  0 0.8  (0.1) 1.00 —  GA4 3.3  (0.3) n.d.-e Active  GA1 1.0  (0.1) 0.41 Inactive  GA4-Methyl ester 0.7  (0.1) 0.80 Inactive  GA C 0.9  (0.1) 0.98 Inactive Non-3β-OH-GAs  epi-GA4 2.8  (0.3) n.d. Active  3-oxo-GA9 4.1  (0.4) n.d. Active F0-a GA and analog structures as shown in Figure4. F0-b Seedlings were grown on germination medium containing individual GAs or analogs at 10−7m. Hypocotyls were measured as described in Figure 2 withse in parentheses. F0-c RelativeGA4 transcript levels calculated after 22 cycles.GA4 and APT1 transcript levels were obtained initially as ImageQuant phosphor imaging values (see Methods), and are expressed as normalized GA4:APT1 ratio (gal-3 grown on germination medium only = 1). F0-d Activity of each GA at 10−7m. GA1, although classed here as inactive, has mild activity. F0-e n.d., Samples where the GA4transcript level was too low to be detected, preventing calculation of the GA4:APT1 ratio. In all cases APT1 was expressed at a similar level. Open in new tab Table I. GA structure-activity relationships GA-a . Hypocotyl Length-b . GA4:APT1Ratio-c . Activity-d . mm 3β-OH-GAs  0 0.8  (0.1) 1.00 —  GA4 3.3  (0.3) n.d.-e Active  GA1 1.0  (0.1) 0.41 Inactive  GA4-Methyl ester 0.7  (0.1) 0.80 Inactive  GA C 0.9  (0.1) 0.98 Inactive Non-3β-OH-GAs  epi-GA4 2.8  (0.3) n.d. Active  3-oxo-GA9 4.1  (0.4) n.d. Active GA-a . Hypocotyl Length-b . GA4:APT1Ratio-c . Activity-d . mm 3β-OH-GAs  0 0.8  (0.1) 1.00 —  GA4 3.3  (0.3) n.d.-e Active  GA1 1.0  (0.1) 0.41 Inactive  GA4-Methyl ester 0.7  (0.1) 0.80 Inactive  GA C 0.9  (0.1) 0.98 Inactive Non-3β-OH-GAs  epi-GA4 2.8  (0.3) n.d. Active  3-oxo-GA9 4.1  (0.4) n.d. Active F0-a GA and analog structures as shown in Figure4. F0-b Seedlings were grown on germination medium containing individual GAs or analogs at 10−7m. Hypocotyls were measured as described in Figure 2 withse in parentheses. F0-c RelativeGA4 transcript levels calculated after 22 cycles.GA4 and APT1 transcript levels were obtained initially as ImageQuant phosphor imaging values (see Methods), and are expressed as normalized GA4:APT1 ratio (gal-3 grown on germination medium only = 1). F0-d Activity of each GA at 10−7m. GA1, although classed here as inactive, has mild activity. F0-e n.d., Samples where the GA4transcript level was too low to be detected, preventing calculation of the GA4:APT1 ratio. In all cases APT1 was expressed at a similar level. Open in new tab Levels of GA4 and APT1 transcripts were compared via QRT-PCR (after 22 cycles) in ga1–3 seedlings treated with the above GA structures (Table I). GA4 transcripts were not detected in the GA4, 3-oxo-GA9, orepi-GA4 samples, despite detectable expression of the APT1 gene. Thus, GA4, 3-oxo-GA9, andepi-GA4 are all active as negative regulators of GA4 transcript abundance. Conversely,GA4 transcripts were detected at levels similar to that of the untreated ga1–3 control in the GA1, GA C, and GA4-methyl ester samples (a small reduction in the GA1-treated GA4:APT1 ratio is indicative of GA1 possessing low activity). These experiments show that there is a correlation between the degrees of activity exhibited by each GA structure in the two assays described above. GAs that are active in the promotion of hypocotyl elongation are also active in the negative regulation of GA4 transcript abundance, whereas those inactive in the former assay are also inactive in the latter. Of the structures that are active (GA4, 3-oxo-GA9, andepi-GA4), only GA4 is 3β-hydroxylated. GC-MS analysis showed that the purity of the GA4, 3-oxo-GA9, andepi-GA4 samples is high, and that the activity displayed by 3-oxo-GA9 andepi-GA4 is not due to GA4 contamination (see Methods). Furthermore, GA1, GA C, and GA4-methyl ester are all 3β-hydroxylated and yet are inactive (or have low activity in the case of GA1). Thus, a specific 3β-hydroxy-GA recognition system may not be involved in the negative feedback regulation of GA4 transcript abundance. Feedback Control of GA4 Transcript Abundance Is Disrupted in gai and spy Mutants The effect of GA treatments on GA4 transcript levels was further investigated using the wild type and the GA-response mutants gai and spy-5. These plants have different/unknown endogenous GA concentrations (Talon et al., 1990a,1990b). For this reason, the plants were grown in media containing 10−7m GA4 or 10−7m PAC or both. PAC inhibits the oxidation of ent-kaurene, an early step in GA biosynthesis, and thus reduces endogenous GA levels (Graebe, 1987). The effects of these treatments on the growth of wild-type,gai, and spy-5 seedlings is shown in Figure5A. As expected, the wild type is markedly dwarfed by PAC, and this effect is reversed by the additional presence of GA4 in the medium. gai is dwarfed both in the presence and absence of PAC, and remains dwarfed in the GA plus PAC treatment. spy-5 (in the absence of PAC or GA) is approximately the same size as the wild type, and is resistant to the dwarfing effects of PAC (Wilson and Somerville, 1995). Fig. 5. Open in new tabDownload slide Effects of GA4 or PAC on wild-type (WT), gai, and spy-5 seedlings. A, Seedlings grown on germination medium containing 10−7m GA4 and/or 10−7m PAC for 2 weeks. B, Effects of exogenous GA4 (GA) and PAC (same concentrations as in A) onGA4 mRNA levels in the wild type. QRT-PCR results were converted to ratios by normalizing samples to the wild-type sample grown on germination medium only. All samples were prepared at the same time and compared after 22 cycles. C, Effects of exogenous GA4 (GA) and PAC (same concentrations as in A onGA4 mRNA levels in gai andspy mutants). Samples were prepared at the same time and data were normalized as in B and compared after 22 cycles. Fig. 5. Open in new tabDownload slide Effects of GA4 or PAC on wild-type (WT), gai, and spy-5 seedlings. A, Seedlings grown on germination medium containing 10−7m GA4 and/or 10−7m PAC for 2 weeks. B, Effects of exogenous GA4 (GA) and PAC (same concentrations as in A) onGA4 mRNA levels in the wild type. QRT-PCR results were converted to ratios by normalizing samples to the wild-type sample grown on germination medium only. All samples were prepared at the same time and compared after 22 cycles. C, Effects of exogenous GA4 (GA) and PAC (same concentrations as in A onGA4 mRNA levels in gai andspy mutants). Samples were prepared at the same time and data were normalized as in B and compared after 22 cycles. GA4 transcript levels (relative to those of APT1) were assayed in these mutants. As shown previously (Figs. 1 and 2), the wild type has lower levels of GA4 transcript than doesga1–3. However, treatment of the wild type with 10−7m PAC induces expression of the GA4 gene over 60-fold (see Fig.5B). This effect can be reversed by the addition of GA4 (Fig. 5B). GA4 transcript levels were approximately 4-fold higher in gai than in the wild type, but were appreciably lower than in ga1–3 (see Figs. 2and 5C). gai was relatively insensitive to manipulated changes in endogenous GA levels, maintaining slightly elevated levels of GA4 transcript (4–16 times untreated wild type), despite treatments with PAC or GA (Fig. 5C). In gai, GA4gene expression is partially, but not fully, repressed by its own high levels of endogenous GAs (Talon et al., 1990b). In addition, PAC treatment (depletion of endogenous GAs) did not induce GA4expression to the extent that it does in the wild type. GA4 transcript levels were also higher in spy-5than in the wild type (Fig. 5C). Furthermore, these levels were relatively unaffected by treatment with PAC (compare this with the marked induction of GA4 transcript level in the wild type by PAC). Thus, spy-5 is a mutant that displays, on PAC, GA-independent regulation of GA4 transcript levels and, likegai, blocks the GA4 transcript abundance feedback response. This is an interesting result, because spy mutants show some hallmarks of constitutive GA-response mutants (Swain and Olszewski, 1996). In another such constitutive GA-response mutant, thela crys mutant of pea, 20-oxidase transcripts accumulate to lower (rather than higher) levels than they do in wild-type plants (Martin et al., 1996). The key conclusion from these experiments is that whereas wild-type plants display a marked increase in GA4 transcript level following PAC treatments, gai and spy-5 mutant plants do not. DISCUSSION We have used GAs endogenous to Arabidopsis to demonstrate thatGA4 gene expression can be controlled by the product of the 3β-hydroxylation reaction, GA4, but not by the substrate, GA9. Active GAs have already been shown to regulate the expression of GA4, GA5, and other 20-oxidase-encoding genes in Arabidopsis (Chiang et al., 1995;Phillips et al., 1995; Xu et al., 1995) and a 20-oxidase gene in pea (Martin et al., 1996). Our experiments show that GAs that lack activity in a growth bioassay (hypocotyl-elongation response) are also inactive in the regulation of GA4 transcript levels. Conversely, GAs that control GA4 transcript levels also control hypocotyl elongation. These observations suggest that the control ofGA4 transcript levels and hypocotyl elongation may be regulated via common GA:GA-receptor interactions and subsequent signal transduction pathways. In addition, our results show that it is active GAs that regulate GA4 transcript abundance, and not only GAs that are the immediate products of the 3β-hydroxylation reaction. Negative feedback regulation of biosynthetic gene expression is potentially an important form of regulation of GA biosynthesis in plants. We have shown that control of GA4 gene expression is sensitively GA dose dependent in the normal physiological range. Thus, incremental changes in GA level result in correlated changes in theGA4 transcript level, providing a sensitive homeostatic mechanism for the regulation of in planta GA levels. This may allow the plant to subtly monitor and alter GA production in response to developmental and environmental changes. We tested the hypothesis that the 3β-OH group confers activity for the hypocotyl elongation and GA4 transcript feedback responses. We found that a 3α-OH group (epi-GA4) and a 3=O group (3-oxo-GA9) could each substitute for the 3β-OH group on the GA4 skeleton, creating molecules that were active in the regulation of both GA4 transcript levels and hypocotyl elongation. Earlier experiments demonstrated thatepi-GA4 and 3-oxo-GA9 are active in the regulation of cucumber hypocotyl elongation (Brian et al., 1967). In addition, recent experiments using the d1 mutant of maize have shown that GA5, which lacks a 3β-OH group, is active in the stimulation of leaf-sheath elongation, suggesting that a 3β-OH group may not be crucial for activity (Spray et al., 1996). Furthermore, GA22, which does not have a 3β-OH group but has a 18-OH group, promotes shoot elongation in rice in the presence of BX-112 (Kamiya et al., 1991). In this latter case it is possible that the 18-OH group compensates partially for the absence of the 3β-OH group. It is probable that the electronegative group at the C-3 position of GA4 is important for the GA:GA-receptor interaction. Both 3-oxo-GA9 andepi-GA4 have electronegative groups at C-3 (although with a slightly different orientation than in GA4), whereas GA9 and the other inactive GAs do not. Furthermore, we found that GAs that possessed a 3β-OH group but were altered at other regions of the molecule (GA1, GA4-methyl ester, and GA C) had reduced activity. Thus, our experiments indicate that activity is retained in structures in which the -OH group at the 3β position is replaced by other groups (subject to the requirement for the electronegative group at C-3), and that activity is modified by groups at positions other than C-3. It is well known that 2β-hydroxylation of 3β-hydroxylated GAs results in a loss of activity (Takahashi et al., 1990). Conclusions from structural studies must be tentative, as the capacity of seedlings to interconvert and transport different GA structures must be considered. However, the difference between the activities of GA1 and GA4 is striking (see also Sponsel et al., 1997). GA1 differs from GA4 by the presence in the former, and the absence in the latter, of a hydroxyl group at C-13 (see Fig. 4). Although we cannot discount the possibility that the applied GAs are converted to more active or inactive forms, it is unlikely that GA1 is dehydroxylated to a more active form in vivo, because the progressive oxidation of GAs is generally thought to be an irreversible process (Graebe, 1987). Thus, the presence or absence of the 13-OH group influences the activity of the GA structure. These observations are consistent with the idea that the putative GA receptor recognizes the whole of the GA molecule and not just a particular region of it (Reeve and Crozier, 1974). Our experiments show that the gai and spy-5mutants are both altered in the regulation of GA4 transcript accumulation. gai has elevated levels of GA4transcript compared with the wild type. This observation is consistent with previous reports that 20-oxidase transcript levels are also elevated in gai (Xu et al., 1995; Peng et al., 1997), and indicates that the gai mutation perturbs the feedback regulation of transcripts encoding GA biosynthesis enzymes. This could explain the elevated levels of bioactive GAs in gai (Talon et al., 1990b): Active GAs do not down-regulate GA4 andGA5 transcript abundance in gai to the extent that they do in the wild type, resulting in higher levels of 20-oxidase and 3β-hydroxylase activities and elevated active GA levels. The Arabidopsis spy mutants belong to the constitutive GA-response class of GA signal transduction mutant (Swain and Olszewski, 1996). The observation that GA4 transcript abundance in spy-5 is higher, rather than lower, than that of the wild type is perhaps surprising, since 20-oxidase levels in the pea la crys mutant (another constitutive GA-response mutant) are lower than in wild-type pea (Martin et al., 1996). This apparent discrepancy may be due to the fact that different genes (GA4, 20-oxidase) and/or different species (Arabidopsis and pea) are involved. However, the constitutive GA-response mutants may actually represent two subclasses of mutant, one (which includes spy) comprising mutants that mimic wild-type plants treated with a nonsaturating GA dose, and the other (which includes la crys) comprising mutants that mimic wild-type plants treated with a saturating GA dose (Swain and Olszewski, 1996). It is possible that the above apparent discrepancy actually represents a difference between the properties of mutants from these two subclasses. Of course, regulation of the abundance of transcripts encoding GA biosynthesis enzymes is not the only possible means of altering GA levels, and control of GA abundance may also be effected in other ways. Inactivation (by 2β-hydroxylation), conjugation, compartmentation, and transport processes may all contribute to regulating the concentration of active GAs in planta (Takahashi et al., 1990). In addition, it is possible, although untested, that feedback control may also operate via product inhibition of the enzymatic activity of GA biosynthesis enzymes. Further work will uncover the relative importance of feedback regulation of GA biosynthesis gene transcript levels in the control of the production of active GAs. ACKNOWLEDGMENTS The authors thank R. Simon, P. Carol, P. Puangsomlee, and Y.-Y. Yang for advice on experimental procedures; A. Davies for photography; K. King for help with figure preparation; and J. Peng, D. Richards, T. Ait-Ali, and S. Yamaguchi for critical review of this manuscript. Abbreviations: BX-112 prohexadione calcium BX-112 PAC paclobutrazol QRT-PCR quantitative RT-PCR RT-PCR reverse-transcription PCR LITERATURE CITED 1 Aldridge DC, Hanson JR, Mulholland TPC (1965) Gibberellic acid. Part XXVIII. Some derivatives of gibberellins A4 and A7. J Chem Soc 3539–3549 2 Brian PW Grove JF Mulholland TPC Relationships between structure and growth-promoting activity of the gibberellins and some allied compounds, in four test systems. Phytochemistry 6 1967 1475 1499 Google Scholar Crossref Search ADS WorldCat 3 Chelly J Kaplan J-C Maire P Gautrin S Kahn A Transcription of the dystrophin gene in human muscle and non-muscle tissues. Nature 333 1988 858 860 Google Scholar Crossref Search ADS PubMed WorldCat 4 Chiang H-H Hwang I Goodman HM Isolation of the Arabidopsis GA4 locus. Plant Cell 7 1995 195 201 Google Scholar PubMed OpenURL Placeholder Text WorldCat 5 Chiang H-H Hwang I Goodman HM Isolation of the Arabidopsis GA4 locus. Correction. Plant Cell 9 1997 979 980 Google Scholar Crossref Search ADS WorldCat 6 Cross BE (1960) Gibberellic acid. Part XIII. The structure of ring A. J Chem Soc 3022–3038 7 Ezura H Harberd NP Endogenous gibberellin levels influence in-vitro shoot regeneration in Arabidopsis thaliana (L.) Heyhn. Planta 197 1995 301 305 Google Scholar Crossref Search ADS PubMed WorldCat 8 Graebe JE Gibberellin biosynthesis and control. Annu Rev Plant Physiol 38 1987 419 465 Google Scholar Crossref Search ADS WorldCat 9 Hedden P Croker SJ Regulation of gibberellin biosynthesis in maize seedlings. Karssen CM van Loon LC Vreugdenhil D Progress in Plant Growth Regulation. 1992 534 544 Kluwer Academic Publishers Dordrecht, The Netherlands 10 Hedden P Kamiya Y Gibberellin biosynthesis: enzymes, genes, and their regulation. Annu Rev Plant Physiol Plant Mol Biol 48 1997 431 460 Google Scholar Crossref Search ADS PubMed WorldCat 11 Hooley R Gibberellins: perception, transduction and responses. Plant Mol Biol 26 1994 1529 1555 Google Scholar Crossref Search ADS PubMed WorldCat 12 Jacobsen SE Binkowski KA Olszewski NE SPINDLY, a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis. Proc Natl Acad Sci USA 93 1996 9292 9296 Google Scholar Crossref Search ADS PubMed WorldCat 13 Jacobsen SE Olszewski NE Mutations at the SPINDLY locus of Arabidopsis alter gibberellin signal transduction. Plant Cell 5 1993 887 896 Google Scholar PubMed OpenURL Placeholder Text WorldCat 14 Kamiya Y Kobayashi M Fujioka S Yamane H Nakayama I Sakurai A Effects of a plant growth regulator, prohexadione calcium (BX-112), on the elongation of rice shoots caused by exogenously applied gibberellins and helminthosporol, part II. Plant Cell Physiol 32 1991 1205 1210 Google Scholar OpenURL Placeholder Text WorldCat 15 Koornneef M Elgersma A Hanhart CJ van Leonen-Martinet EP van Rijn L Zeevaart JAD A gibberellin insensitive mutant of Arabidopsis thaliana. Physiol Plant 65 1985 33 39 Google Scholar Crossref Search ADS WorldCat 16 Koornneef M van der Veen JH Induction and analysis of gibberellin sensitive mutants in Arabidopsis thaliana (L.) Hehyn. Theor Appl Genet 58 1980 257 263 Google Scholar Crossref Search ADS PubMed WorldCat 17 Ludevid D Höfte H Himmelblau E Chrispeels MJ The expression pattern of the tonoplast intrinsic protein γ-TIP in Arabidopsis thaliana is correlated with cell enlargement. Plant Physiol 100 1992 1633 1639 Google Scholar Crossref Search ADS PubMed WorldCat 18 Martin DN Proebsting WL Parks TD Dougherty WG Lange T Lewis MJ Gaskin P Hedden P Feedback regulation of gibberellin biosynthesis and gene expression in Pisum sativum L. Planta 200 1996 159 166 Google Scholar Crossref Search ADS PubMed WorldCat 19 Moffat BA McWhinne EA Agarwhal SK Schaff DA The adenine phosphoribosyltransferase-encoding gene of Arabidopsis thaliana. Gene 143 1994 211 216 Google Scholar Crossref Search ADS PubMed WorldCat 20 Murphy LD Herzog CE Rudick JB Fojo AT Bates SE Use of the polymerase chain reaction in the quantification of mdr-1 gene expression. Biochemistry 29 1990 10351 10356 Google Scholar Crossref Search ADS PubMed WorldCat 21 Nakayama I Kamiya Y Kobayashi M Abe H Sakurai A Effects of a plant growth regulator, prohexadione, on the biosynthesis of gibberellins in cell-free systems derived from immature seeds. Plant Cell Physiol 31 1990a 1183 1190 Google Scholar OpenURL Placeholder Text WorldCat 22 Nakayama I Miyazawa T Kobayashi M Kamiya Y Abe H Sakurai A Effects of a new plant growth regulator prohexadione calcium (BX-112) on shoot elongation caused by exogenously applied gibberellins in rice (Oryza sativa L.) seedlings. Plant Cell Physiol 31 1990b 195 200 Google Scholar OpenURL Placeholder Text WorldCat 23 Noonan KE Beck C Holzmayer TA Chin JE Wunder JS Andrulis IL Gazdar AF Willman CL Griffith B von Hoff DD and others Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumours by polymerase chain reaction. Proc Natl Acad Sci USA 87 1990 7160 7164 Google Scholar Crossref Search ADS PubMed WorldCat 24 Peng J Carol P Richards DE King KE Cowling RJ Murphy GP Harberd NP The Arabidopsis GAI gene defines a signaling pathway that negatively regulates gibberellin responses. Genes Dev 11 1997 3194 3205 Google Scholar Crossref Search ADS PubMed WorldCat 25 Peng J Harberd NP Derivative alleles of the Arabidopsis gibberellin-insensitive (gai) mutation confer a wild-type phenotype. Plant Cell 5 1993 351 360 Google Scholar Crossref Search ADS PubMed WorldCat 26 Peng J Harberd NP Gibberellin deficiency and response mutations suppress the stem elongation phenotype of phytochrome-deficient mutants of Arabidopsis. Plant Physiol 113 1997 1051 1058 Google Scholar Crossref Search ADS PubMed WorldCat 27 Phillips AL Huttly AK Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive hybridization: expression of the tonoplast water channel, γ-TIP, is increased by GA3. Plant Mol Biol 24 1994 603 615 Google Scholar Crossref Search ADS PubMed WorldCat 28 Phillips AL Ward DA Uknes S Appleford NEJ Lange T Huttly AK Gaskin P Graebe JE Hedden P Isolation and expression of three gibberellin-20-oxidase cDNA clones from Arabidopsis. Plant Physiol 108 1995 1049 1057 Google Scholar Crossref Search ADS PubMed WorldCat 29 Reeve DR Crozier A An assessment of gibberellin structure-activity relationships. J Exp Bot 25 1974 431 445 Google Scholar Crossref Search ADS WorldCat 30 Ross JJ Recent advances in the study of gibberellin mutants. Plant Growth Reg 15 1994 193 206 Google Scholar Crossref Search ADS WorldCat 31 Sponsel VM Schmidt FW Porter SG Nakayama M Kohlstruk S Estelle M Characterization of new gibberellin-responsive semidwarf mutants of Arabidopsis. Plant Physiol 115 1997 1009 1020 Google Scholar Crossref Search ADS PubMed WorldCat 32 Spray CR Kobayashi M Suzuki Y Phinney BO Gaskin P MacMillan J The dwarf-1 (d1) mutant of Zea mays blocks three steps in the gibberellin biosynthetic pathway. Proc Natl Acad Sci USA 93 1996 10515 10518 Google Scholar Crossref Search ADS PubMed WorldCat 33 Sun T-p Kamiya Y The Arabidopsis GA1 locus encodes the cyclase ent-kaurene synthetase A of gibberellin biosythesis. Plant Cell 6 1994 1509 1518 Google Scholar PubMed OpenURL Placeholder Text WorldCat 34 Swain SM Olszewski NE Genetic analysis of gibberellin signal transduction. Plant Physiol 112 1996 11 17 Google Scholar Crossref Search ADS PubMed WorldCat 35 Takahashi N Phinney BO MacMillan J Gibberellins. 1990 Springer-Verlag New York 36 Talon M Koornneef M Zeevaart JAD Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. Proc Natl Acad Sci USA 87 1990a 7983 7987 Google Scholar Crossref Search ADS WorldCat 37 Talon M Koornneef M Zeevaart JAD Accumulation of C19-gibberellins in the gibberellin-insensitive dwarf mutant gai of Arabidopsis thaliana (L.). Planta 182 1990b 501 505 Google Scholar Crossref Search ADS WorldCat 38 Wilson RN Somerville CR Phenotypic suppression of the gibberellin-insensitive mutant (gai) of Arabidopsis. Plant Physiol 108 1995 495 502 Google Scholar Crossref Search ADS PubMed WorldCat 39 Xu Y-L Li L Wu K Peeters AJM Gage DA Zeevaart JAD The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. Proc Natl Acad Sci USA 92 1995 6640 6644 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 R.J.C. was supported by a John Innes Foundation Studentship. The work in N.P.H.'s laboratory was funded through a Biotechnology and Biological Sciences Research Council Core Strategic grant to the John Innes Centre, a Biotechnology and Biological Sciences Research Council Plant Molecular Biology grant (no. PG208/0600), and by the European Commission DG XII Biotechnology Program (contract no. BIO4-96-0621). 2 Present address: Laboratoire de Biologie Cellulaire, Institut National de la Recherche Agronomique, Route de Saint Cyr, 78026 Versailles cedex, France. * Corresponding author; e-mail [email protected]; fax 44–1603–505725. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Hihara, Yukako; Sonoike, Kintake; Ikeuchi, Masahiko

doi: 10.1104/pp.117.4.1205pmid: 9701577

Abstract Previously, we identified a novel gene, pmgA, as an essential factor to support photomixotrophic growth of Synechocystis species PCC 6803 and reported that a strain in which pmgA was deleted grew better than the wild type under photoautotrophic conditions. To gain insight into the role of pmgA, we investigated the mutant phenotype of pmgA in detail. When low-light-grown (20 μE m−2 s−1) cells were transferred to high light (HL [200μE m−2s−1]), pmgA mutants failed to respond in the manner typically associated with Synechocystis. Specifically, mutants lost their ability to suppress accumulation of chlorophyll and photosystem I and, consequently, could not modulate photosystem stoichiometry. These phenotypes seem to result in enhanced rates of photosynthesis and growth during short-term exposure to HL. Moreover, mixed-culture experiments clearly demonstrated that loss ofpmgA function was selected against during longer-term exposure to HL, suggesting that pmgA is involved in acquisition of resistance to HL stress. Finally, early induction ofpmgA expression detected by reverse transcriptase-PCR upon the shift to HL led us to conclude that pmgA is the first gene identified, to our knowledge, as a specific regulatory factor for HL acclimation. Acclimation to light regimes is one of the most important and complex responses of photosynthetic organisms to varying environmental conditions. Under different growth light cyanobacteria and plants regulate antenna pigment complexes, photochemical reaction centers, and enzymes for CO2 fixation to optimize utilization of light energy (for review, see Anderson, 1986; Melis, 1991; Anderson et al., 1995). Under light-limiting conditions, antenna pigments are selectively accumulated to collect light energy efficiently. It is well known that cyanobacteria increase their antenna size by elongation of the phycobilisome rods and by an increase in the number of phycobilisomes per unit area of thylakoid membrane upon the shift to LL (Knanna et al., 1983; Lönneborg et al., 1985). Higher plants and green algae having chlorophyll b as an antennae pigment show a marked decline in chlorophyll a to b ratio upon the shift to LL, reflecting accumulation of the light-harvesting chlorophyll a/b complex (Leong and Anderson, 1984). However, under light-saturating conditions these organisms reduce their antenna size. Moreover, Rubisco, the rate-limiting enzyme for CO2 fixation, is accumulated to balance with high photochemical activities (Björkman, 1981). Expression of enzymes such as catalase and superoxide dismutase is also enhanced to scavenge reactive oxygen species, which are generated by excess light energy (Foyer et al., 1994). The amount of PSII relative to that of PSI, the photosystem stoichiometry, is another target for the regulation in response to light intensity, since photosynthetic electron transport to generate NADPH and ATP is driven by coordination of the two photosystems with distinct antenna size (Melis et al., 1985;Fujita et al., 1987, 1994). In general, the antenna size of PSII is variable, whereas that of PSI is unchanged under various light conditions. Under LL the photosystem stoichiometry is optimized based on their antenna sizes, whereas it must be kept near unity irrespective of the antenna size under HL. Thus, organisms must balance the electron flow between the two photosystems by modulating both antenna complexes and photosystem stoichiometry at different light intensities. Although a number of reports have provided information on the physiological and biochemical characterization of various light acclimation, very little is known about molecular mechanisms for sensing light conditions or for modulating expression and/or assembly of the photosynthetic apparatus (Allen, 1995; Anderson et al., 1995). One exception is the complementary chromatic adaptation, which has been studied extensively in a cyanobacterium having inducible genes for phycocyanin and phycoerythrin. Several genes, including a possible photoreceptor and signal transduction components, have been identified based on the characterization of mutant phenotypes (Chiang et al., 1992; Grossman et al., 1994; Kehoe and Grossman, 1996). Since many light-acclimation responses are supposed to be common to both cyanobacteria and plants, cyanobacteria seem to be better models for molecular studies of light acclimation in photosynthetic organisms. Here we report that modulation of photosystem stoichiometry, one of the responses typically observed upon the shift to HL, is specifically supported by a novel gene, pmgA, in the cyanobacteriumSynechocystis sp. PCC 6803. The gene was initially identified as an essential factor required to support photomixotrophic growth with both light and Glc. However, its mutants could grow better than the wild type under photoautotrophic conditions (Hihara and Ikeuchi, 1997). Surprisingly, the mutant, which appeared spontaneously in a wild-type culture under photoautotrophic conditions, completely took over the culture for a year or so in our laboratory. Further characterization of pmgA mutants in this communication revealed its specific role in light acclimation. We also provide evidence for the physiological role of modulation of photosystem stoichiometry as a HL response. MATERIALS AND METHODS Strains and Culture Conditions A Glc-tolerant wild-type strain of Synechocystis sp. PCC 6803 (WS) and mutants (WL strain with 1 base replacement inpmgA and a disruptant with spectinomycin-resistance cassette: WL and pmgA::SpR) (Hihara and Ikeuchi, 1997) were grown at 32°C in BG-11 medium with 20 mmHepes-NaOH (pH 7.0) under continuous illumination provided by fluorescent lamps. Liquid cultures were bubbled with air containing 1.0% (v/v) CO2. The pmgA-disrupted mutant was usually maintained with 20 μg/mL spectinomycin. PPFD was measured by a quantum sensor (model LI-250, Li-Cor, Lincoln, NE). Cell density was estimated as A730 with a spectrophotometer (model UV-160A, Shimadzu, Kyoto, Japan). In all of the experiments, fresh media were inoculated at a cell density of A730 = 0.05 with precultures grown to late log phase (A730 = 0.8–0.9) under LL and then transferred to HL or LL. Unless otherwise stated, cells were grown in volumes of 50 mL with test tubes (3 cm in diameter). A larger volume of culture was provided in 500- or 1000-mL flat vessels illuminated with the same HL. The fixed culture conditions were important for HL, since the self-shading started to cancel HL at the later stage of the batch culture. Absorption and 77 K Fluorescence Emission Spectra In vivo absorption spectra of whole cells of the wild type and mutants suspended in BG-11 medium were measured at room temperature using a spectrophotometer (model U3500, Hitachi, Tokyo, Japan) with an end-on photomultiplier. Chlorophyll and phycocyanin were calculated using the equations of Arnon et al. (1974). Low-temperature fluorescence emission spectra at 77 K were recorded using a custom-made apparatus (Sonoike and Terashima, 1994). Cells containing 100 μg chlorophyll/mL in BG-11 medium were placed in a sample holder. Pigments were excited with light 400 to 600 nm in wavelength produced by passing white light from a 100-W halogen lamp through a filter (CS4–96, Corning Inc., Corning, NY). Before measurement, cells were dark adapted (>10 min) at room temperature to eliminate possible effects of the state transition. Measurement of Rates of Electron-Transfer Reactions Oxygen evolution and consumption of cells were measured in BG-11 medium with a Clark-type electrode at a chlorophyll concentration of 2.5 μg/mL. The medium was continuously stirred at 25°C and illuminated with saturating actinic light (4000 μE m−2 s−1). Whole-cell photosynthetic activity or PSII-mediated electron transfer activity was measured as oxygen evolution supported by 2 mmNaHCO3 or 2 mm 2,6-DCBQ, respectively. PSI-mediated electron transfer activity was measured as oxygen consumption in the presence of 1 mm ascorbic acid, 5 mm DAD, 2 mm MV, 20 μm DCMU, and 1 mm KCN. Determination of Photosystems Thylakoid membranes used for measurements of PSII and PSI were isolated from cells grown in 1000 mL of culture volume. Cells suspended in HN buffer (5 mm Hepes-NaOH and 10 mm NaCl, pH 7.5) were broken with a Mini-Bead Beater (Biospec, Bartlesville, OK) with zircon beads (100 μm in diameter, Biospec) for three pulses of 50 s each with 2-min cooling intervals at 0°C. After brief centrifugation to remove the beads, cell debris and thylakoid membranes were collected at 45,000g for 20 min with a rotor (RP80AT, Hitachi). Pellets were resuspended in HN buffer and sonicated for three pulses of 10 s each with 10-s cooling intervals at 0°C to liberate thylakoid membranes from cell debris. After centrifugation at 2,500g for 5 min with a RT15A8 rotor (Hitachi), thylakoid-containing supernatants were used to determine P700 and Cytb559. PSII content was estimated as one-half molar of Cytb559, as described in Fujita and Murakami (1987). Cyt b559 was determined from the difference spectrum (520–600 nm) between ascorbate- and hydroquinone-reduced conditions using a U3500 spectrophotometer. The chlorophyll concentration of thylakoid membranes was 80 μg/mL, and a difference absorption coefficient of 21 mm−1 cm−1(Garewall and Wasserman, 1974) was used. PSI content was estimated as photoactive P700 content upon illumination by continuous light. Absorbance changes at 703 nm were measured with a spectrophotometer (model 356, Hitachi) (Terashima et al., 1994). The reaction mixture contained thylakoid membranes at a chlorophyll concentration of 3 μg/mL in 50 mm Tris-HCl (pH 7.5), 10 mm sodium ascorbate, 30 μm TMPD, 10 μm MV, and 0.05% dodecylmaltoside. The reduced-minus-oxidized differential absorption coefficient of P700 is known to vary with species (Hiyama and Ke, 1972; Sonoike and Katoh, 1990) and with the preparation used (Sonoike and Katoh, 1988, 1989). Thus, we determined the absorption coefficient of P700 in the thylakoid membranes from Synechocystis sp. PCC 6803 by measuring oxidation of TMPD coupled with the reduction of flash-oxidized P700, basically as described by Hiyama and Ke (1972). Flash-induced absorbance changes on a millisecond time scale were measured with a single-beam spectrophotometer (model RA-401, Otsuka Electronics, Osaka, Japan) under aerobic conditions. Absorption changes were measured at 703 nm for P700 and 575 nm for TMPD, and the absorption coefficient of oxidized TMPD at this wavelength was assumed to be 10.7 mm−1 cm−1(Hiyama and Ke, 1972). Saturating xenon flashes (half-duration time of 5 μs) that passed through two band-pass filters (CS 4–96 and CS 7–59, Corning) and a dichroic filter (DF-B, Japan Vacuum Optics, Gotenba, Japan) were fired at 0.1 Hz, and signals were recorded with a photomultiplier (R374, Hamamatsu Photonics, Shizuoka, Japan) blocked with two cutoff filters (R-69, Toshiba, Tokyo, Japan) for P700 or with an orange cutoff filter (O-57, Toshiba) and a dichroic filter (DF-C, Japan Vacuum Optics) for TMPD. The reaction mixture contained thylakoid membranes equivalent to 3 μg/mL chlorophyll, 0.8 mm TMPD, 10 μm DCMU, 1 mm KCN, 0.05% dodecylmaltoside, and 50 mm Tris/HCl (pH 7.5). The absorption coefficient of P700 in thylakoid membranes fromSynechocystis sp. PCC 6803 in the presence of dodecylmaltoside was determined as 71 ± 3 mm−1 cm−1. This value was significantly greater than that determined forSynechococcus elongatus in similar conditions (Sonoike and Katoh, 1988), but close to the value for the PSI preparation from Triton-solubilized thylakoid membranes from Anabaena variabilis (Hiyama and Ke, 1972). Immunoblot Analysis Whole-cell extracts before removal of cell debris, as described above, were treated with LDS and subjected to SDS-PAGE. For detection of D2, PsbO, and Rubisco proteins, the extracts were solubilized with 1% LDS, 60 mm DTT, and 60 mm Tris-HCl (pH 8.0) for 10 min at room temperature, whereas for PsaA/B proteins, they were solubilized with 5% LDS, 60 mm DTT, and 60 mmTris-HCl (pH 8.0) for 2 h at room temperature to achieve complete denaturation. SDS gel electrophoresis was done by the procedure ofLaemmli (1970) with a gel containing 12.5% acrylamide and 6m urea for D2, PsbO, and Rubisco or a gradient gel of 16% to 22% acrylamide with 7.5 m urea for PsaA/B. Samples corresponding to 0.32 × 107, 0.48 × 107, 1.92 × 107, and 1.15 × 107 cells were loaded for the detection of D2, PsbO, and Rubisco and PsaA/B, respectively. Proteins were electroblotted onto PVDF membranes (Immobilon-P; Millipore). The antiserum against PsaA/B from S. elongatus was kindly provided by Dr. I. Enami (Science University of Tokyo). The antiserum against Rubisco from spinach was a generous gift from Dr. K. Okada (Tokyo University of Pharmacy and Lifescience). The antisera against D2 and PsbO were from spinach (Ikeuchi and Inoue, 1987). Reaction with antisera and immunodetection by alkaline phosphatase or peroxidase were performed according to the manufacturer's instructions (Bio-Rad). Direct Sequencing Analysis Direct sequencing analysis of pmgA was performed as described previously (Hihara and Ikeuchi, 1997). Preparation of Total RNA Cells were collected by brief centrifugation at 4°C and stored in liquid N2. The frozen cells were thawed with 20 mm EDTA and 50 mm Tris-HCl (pH 8.0) and immediately treated with phenol at 75°C for 10 min. Cells were further treated with 0.8% (w/v) SDS at 75°C for 10 min with shaking, and then extracted once with phenol/chloroform and twice with chloroform. After precipitation with ethanol, RNA was solubilized in 8m guanidine-HCl, 0.1 m sodium acetate, pH 5.2, 5 mm DTT, and 0.5% sodium lauryl sarcosinate and precipitated with ethanol. Residual DNA in the RNA preparation was removed by digestion with DNase I at 25°C for 2 h. After ethanol precipitation, the amount of RNA was determined by UV absorption at 260 nm. RT-PCR First-strand cDNA was synthesized using 1 μg of total RNA with a RT-PCR High Kit (Toyobo, Osaka, Japan) in a final volume of 20 μL, according to the manufacturer's instructions. The amount of cDNA used as a template was experimentally determined for each set of primers to achieve proportional production of the PCR product (the cDNA equivalent to RNA of 0.1 μg and 5 pg was used for amplification ofpmgA and rnpB, respectively). The oligonucleotide primers 5′-TGTAAAACGACGGCCA-GTCAGCACATTCAGGCCTCC-3′ and 5′-CAGGAAAC-AGCTATGACCGCTTAATTTTCTTGCTGA-3′ were used for amplification of a 565-bp fragment of pmgA and 5′-AGTTAGGGAGGGAGTTGC-3′ and 5′-TAAGCCGGGTTCTGTTCC-3′ were used for amplification of a 417-bp fragment of the constitutive RNase P gene,rnpB, as a positive control (Frı́as et al., 1994). After a first denaturation step of 3 min at 93°C, 30 PCR cycles were performed (93°C for 30 s, 57°C for 2 min, and 72°C for 2 min) followed by a final extension step of 10 min at 72°C. As a negative control for RT-PCR, 1 μg of RNA without the RT reaction was subjected to PCR amplification of rnpB. RESULTS Absorption Spectra and Content of Photosynthetic Pigment We isolated a mutant clone with a larger colony size (WL strain) compared with smaller colonies of the wild type (WS strain) under HL and identified a point mutation in a novel gene, pmgA,responsible for the change of colony size (Hihara and Ikeuchi, 1997). Here we observed that the WL strain and pmgA-disruptant (pmgA::SpR) cells in the liquid culture showed enhanced pigmentation and slightly higher cell density relative to wild-type cells under HL, as shown in Figure1. In HL, doubling time of the WL strain (5.39 ± 0.25 h) and the pmgA-disruptant strain (5.41 ± 0.28 h) was significantly shorter than that of the wild type (5.82 ± 0.14 h). Figure2 shows absorption spectra of cells grown in liquid culture under HL or LL. Absorption spectra were significantly different between the wild type and pmgA mutants under HL: the peak of chlorophyll absorption at 678 nm was higher than the peak of phycocyanin absorption at 628 nm in the mutants, whereas it was lower in the wild type (Fig. 2B). However, there was no difference in the relative peak heights between the wild type and mutants when grown under LL (Fig. 2A). Compared with cells grown under HL, the content of both pigments increased relative to cell density and to carotenoid absorption (approximately 495 nm) in both cell types under LL. The difference in pigmentation was barely discernible for colonies on agar plates under similar HL conditions (Hihara and Ikeuchi, 1997) or for liquid cultures under LL conditions (data not shown). Fig. 1. Open in new tabDownload slide Liquid culture of wild type (WS) andpmgA mutants (WL and the disruptantpmgA::SpR) at log phase (20 h after inoculation) under HL. A730 of WS, WL, and pmgA-disruptant was 0.56, 0.73, and 0.66, respectively. Fig. 1. Open in new tabDownload slide Liquid culture of wild type (WS) andpmgA mutants (WL and the disruptantpmgA::SpR) at log phase (20 h after inoculation) under HL. A730 of WS, WL, and pmgA-disruptant was 0.56, 0.73, and 0.66, respectively. Fig. 2. Open in new tabDownload slide Absorption spectra of cells grown under different light intensities. A, Absorption spectra of LL-grown cells. B, Absorption spectra of cells 18 h after shift to HL. The spectra of wild type (a), WL (b), and pmgA-disruptant cells (c) are normalized at A730. rel., Relative. Fig. 2. Open in new tabDownload slide Absorption spectra of cells grown under different light intensities. A, Absorption spectra of LL-grown cells. B, Absorption spectra of cells 18 h after shift to HL. The spectra of wild type (a), WL (b), and pmgA-disruptant cells (c) are normalized at A730. rel., Relative. Figure 3 shows time-course changes in cell density and pigment abundance in the small batch culture defined in Methods. Data at time 0, representing LL-grown cells, showed no significant differences between the wild type andpmgA mutants. Upon transfer to HL, the content of both chlorophyll (Fig. 3B) and phycocyanin (Fig. 3C) on a per-cell basis showed changes with three different phases: (a) drastically reduced to about two-thirds within 3 h, (b) further decreased but at a lesser rate until 12 h, and (c) gradually recovered, although cells continued to grow logarithmically (Fig. 3A). Notably, the chlorophyll content was significantly greater in pmgA mutants than in the wild type after 9 h, whereas the phycocyanin content was not much different between the strains throughout the batch culture. The cellular content of both pigments almost recovered to the initial level after 30 h due to the self-shading effect at high cell density. Taking into account that cells were dividing logarithmically, accumulation of pigments, expressed per milliliter of culture volume, is shown on a log scale (Fig. 3, D and E). Accumulation of both pigments stopped during the initial 3 h (phase 1). The pigment accumulation restarted at a low rate from 3 to 12 h (phase 2) and accelerated after 12 h (phase 3). Clearly, the pmgAmutants differed from the wild type in their chlorophyll accumulation during phase 2 (Fig. 3D), leading to a higher cellular chlorophyll content in phase 3 (Fig. 3B). However, accumulation of phycocyanin did not differ between the wild type and the mutants (Fig. 3E), although its time course was similar to that of chlorophyll. In short, loss ofpmgA function seems to abolish the specific retardation of chlorophyll synthesis at phase 2 (3–12 h) in response to HL. However, the initial suppression of chlorophyll synthesis, the recovery of chlorophyll synthesis during phase 3, and phycocyanin synthesis do not seem to be affected by the pmgA mutation. Fig. 3. Open in new tabDownload slide Growth curve and changes in the pigment content in the course of a batch culture under HL. A, Cell density. B, Chlorophyll content expressed on a per-cell basis. C, Phycocyanin content expressed on a per-cell basis. D, Chlorophyll accumulation expressed per milliliter of culture volume. E, Phycocyanin accumulation expressed per milliliter of culture volume. At time 0, the batch culture was inoculated with LL-grown cells. •, WS; ○, WL; □,pmgA::SpR. Fig. 3. Open in new tabDownload slide Growth curve and changes in the pigment content in the course of a batch culture under HL. A, Cell density. B, Chlorophyll content expressed on a per-cell basis. C, Phycocyanin content expressed on a per-cell basis. D, Chlorophyll accumulation expressed per milliliter of culture volume. E, Phycocyanin accumulation expressed per milliliter of culture volume. At time 0, the batch culture was inoculated with LL-grown cells. •, WS; ○, WL; □,pmgA::SpR. Chlorophyll-Fluorescence Spectra and Content of Photosystems Differences in chlorophyll content are assumed to reflect changes in photosystems of cyanobacteria, since they have no apparent chlorophyll-binding antenna proteins. It is widely accepted that chlorophylls of PSII emit fluorescence around 685 and 695 nm, whereas chlorophylls of PSI emit at 720 to 730 nm at 77 K (Murata et al., 1966). Thus, as shown in Figure 4, we investigated the chlorophyll-fluorescence emission spectra of cells at 77 K to determine whether photosystem stoichiometry is different between the wild type and pmgA mutants. When the spectra were normalized at the peaks of PSI fluorescence, it was notable that the peak at 695 nm originating from PSII was about 1.5-fold higher in wild-type cells grown under HL than under LL (Fig. 4A). However, the 695-nm peak was virtually unchanged in pmgA mutants (Fig. 4, B and C). This strongly indicates that the ratio of PSII to PSI increased in the wild type in response to HL, whereas it remained unchanged in the mutants. Since the fluorescence ratio (F695/F725) is a good index of the ratio of PSII to PSI, the ratio was plotted in the course of the same experimental conditions as in Figure 3. Clearly, the ratio gradually increased in the wild type 12 h after the shift to HL, reaching the maximum (about 1.5-fold of the initial) at around 18 to 24 h, whereas the ratio changed little in pmgAmutants (Fig. 4D). These differences in the time-course change of the F695/F725 ratio between the wild type and pmgA mutants appear to reflect the difference in chlorophyll accumulation (Fig. 3D). A decline of the ratio after 20 h in the wild type is possibly due to the self-shading effect in the large vessel. Fig. 4. Open in new tabDownload slide Low-temperature (77 K) fluorescence emission spectra of cells. A, Fluorescence emission spectra of WS (wild type) at 77 K. B, Fluorescence emission spectra of WL at 77 K. C, Fluorescence emission spectra of pmgA-disruptant at 77 K. Spectra of LL-grown cells (solid line) and cells 20 h after a shift to HL (dashed line) were normalized at the 725-nm peak of PSI. D, Time course of the change in the ratio of F695/F725 under HL. Conditions for the culture were the same as in Figure 3. Data are the means ± se for at least three separate experiments. rel., Relative. Fig. 4. Open in new tabDownload slide Low-temperature (77 K) fluorescence emission spectra of cells. A, Fluorescence emission spectra of WS (wild type) at 77 K. B, Fluorescence emission spectra of WL at 77 K. C, Fluorescence emission spectra of pmgA-disruptant at 77 K. Spectra of LL-grown cells (solid line) and cells 20 h after a shift to HL (dashed line) were normalized at the 725-nm peak of PSI. D, Time course of the change in the ratio of F695/F725 under HL. Conditions for the culture were the same as in Figure 3. Data are the means ± se for at least three separate experiments. rel., Relative. To confirm the results of fluorescence measurement, we determined the photosystem content of thylakoid membranes isolated from LL-and HL-grown cells by measuring Cyt b559 and P700. Cyt b559 has been known to be tightly associated with the PSII reaction center in thylakoid membranes at a molar ratio of 2:1 (Whitmarsh and Ort, 1984), whereas P700, a photoactive pigment of PSI reaction center, was used to determine PSI content (Hiyama and Ke, 1972). Table Ishows that the PSII content on a per-cell basis decreased to about 74% in the wild type during the first 13 h after the shift to HL conditions, whereas the PSI content markedly decreased to about 40% of the initial value. As a result, the ratio of PSII to PSI increased from 0.48 for LL-grown cells to 0.81 for HL-grown cells. Since cells grew logarithmically during this period, the accumulation of PSI and PSII may have been transiently suppressed and recovered as chlorophyll synthesis, as shown in Figure 3D. In pmgA mutants, content of both photosystems similarly decreased under HL but the marked suppression of PSI accumulation did not take place. As a result, the photosystem stoichiometry remained unchanged in the mutants under HL. Wild-type cells showed a slight recovery of their photosystem content and stoichiometry after 22 h. Consistently, the low-temperature fluorescence ratio (F695/F725) of the wild-type thylakoids was at the maximum level at 13 h and slightly lower at 22 h, whereas the ratio of the mutant thylakoids was not much changed (data not shown). These fluorescence changes seemed to occur slightly earlier than those observed in Figure 4D. This may be due to higher self-shading in the larger culture volume required for the measurement of Cytb559. Table I. Content of photosystems in the wild type and pmgA mutantsa Strain . Time-b . PSII . PSI . PSII/PSI . h 10−19 mol/cell WS (wild type) 0 2.01  ± 0.19 4.21  ± 0.13 0.48  ± 0.06 13 1.48  ± 0.23 1.68  ± 0.11 0.81  ± 0.08 22 1.55  ± 0.16 2.13  ± 0.19 0.73  ± 0.07 WL 0 2.17  ± 0.38 4.27  ± 0.08 0.51  ± 0.08 13 1.57  ± 0.05 2.67  ± 0.24 0.60  ± 0.07 22 1.85  ± 0.04 3.49  ± 0.32 0.53  ± 0.06 pmgA::SpR 0 2.10  ± 0.32 4.16  ± 0.21 0.50  ± 0.07 13 1.47  ± 0.09 2.51  ± 0.18 0.59  ± 0.04 22 1.79  ± 0.08 4.31  ± 0.52 0.42  ± 0.04 Strain . Time-b . PSII . PSI . PSII/PSI . h 10−19 mol/cell WS (wild type) 0 2.01  ± 0.19 4.21  ± 0.13 0.48  ± 0.06 13 1.48  ± 0.23 1.68  ± 0.11 0.81  ± 0.08 22 1.55  ± 0.16 2.13  ± 0.19 0.73  ± 0.07 WL 0 2.17  ± 0.38 4.27  ± 0.08 0.51  ± 0.08 13 1.57  ± 0.05 2.67  ± 0.24 0.60  ± 0.07 22 1.85  ± 0.04 3.49  ± 0.32 0.53  ± 0.06 pmgA::SpR 0 2.10  ± 0.32 4.16  ± 0.21 0.50  ± 0.07 13 1.47  ± 0.09 2.51  ± 0.18 0.59  ± 0.04 22 1.79  ± 0.08 4.31  ± 0.52 0.42  ± 0.04 F0-a Number of PSI and PSII on a per-cell basis were calculated from P700 and one-half of Cyt b559,respectively. Data are the means ± se for at least three separate experiments. F0-b The culture was inoculated with LL-grown cells and transferred to HL at time 0. Conditions for the culture were the same as in Figure 3, except for a larger culture volume in this experiment. Open in new tab Table I. Content of photosystems in the wild type and pmgA mutantsa Strain . Time-b . PSII . PSI . PSII/PSI . h 10−19 mol/cell WS (wild type) 0 2.01  ± 0.19 4.21  ± 0.13 0.48  ± 0.06 13 1.48  ± 0.23 1.68  ± 0.11 0.81  ± 0.08 22 1.55  ± 0.16 2.13  ± 0.19 0.73  ± 0.07 WL 0 2.17  ± 0.38 4.27  ± 0.08 0.51  ± 0.08 13 1.57  ± 0.05 2.67  ± 0.24 0.60  ± 0.07 22 1.85  ± 0.04 3.49  ± 0.32 0.53  ± 0.06 pmgA::SpR 0 2.10  ± 0.32 4.16  ± 0.21 0.50  ± 0.07 13 1.47  ± 0.09 2.51  ± 0.18 0.59  ± 0.04 22 1.79  ± 0.08 4.31  ± 0.52 0.42  ± 0.04 Strain . Time-b . PSII . PSI . PSII/PSI . h 10−19 mol/cell WS (wild type) 0 2.01  ± 0.19 4.21  ± 0.13 0.48  ± 0.06 13 1.48  ± 0.23 1.68  ± 0.11 0.81  ± 0.08 22 1.55  ± 0.16 2.13  ± 0.19 0.73  ± 0.07 WL 0 2.17  ± 0.38 4.27  ± 0.08 0.51  ± 0.08 13 1.57  ± 0.05 2.67  ± 0.24 0.60  ± 0.07 22 1.85  ± 0.04 3.49  ± 0.32 0.53  ± 0.06 pmgA::SpR 0 2.10  ± 0.32 4.16  ± 0.21 0.50  ± 0.07 13 1.47  ± 0.09 2.51  ± 0.18 0.59  ± 0.04 22 1.79  ± 0.08 4.31  ± 0.52 0.42  ± 0.04 F0-a Number of PSI and PSII on a per-cell basis were calculated from P700 and one-half of Cyt b559,respectively. Data are the means ± se for at least three separate experiments. F0-b The culture was inoculated with LL-grown cells and transferred to HL at time 0. Conditions for the culture were the same as in Figure 3, except for a larger culture volume in this experiment. Open in new tab From the data in Table I and the phycocyanin content of the samples, we also calculated the ratio of phycocyanin to PSII, which represents the antenna size of PSII. It dropped to about 80% not only in the wild type but also in pmgA mutants during the first 13 h after the shift to HL conditions (data not shown). Thus, we conclude that pmgA is essential for the modulation of the PSII-to-PSI ratio as acclimation to HL but not for the adjustment of antenna size of PSII. Electron-Transfer Activities under Different Light Intensities We pursued the relationship between the two phenotypic features ofpmgA mutants, the lack of modulation of the photosystem stoichiometry and the enhanced growth under photoautotrophic conditions, by measuring photosynthetic activities (TableII). Under LL, there were no significant differences in activities of whole-cell photosynthesis (from water to CO2), PSII (from water to 2,6-DCBQ), and PSI (from reduced DAD to MV) between the wild type and pmgAmutants. This is consistent with our previous observation that the growth rate of pmgA mutants was comparable to that of the wild type under LL (Hihara and Ikeuchi, 1997). When cells were grown under HL for 18 h, the whole photosynthetic activity of the mutants was much greater than that of the wild type. This seems to account partly for the fact that pmgA mutants grew slightly better than the wild type under HL (Fig. 3A). The PSI activity was higher in pmgA mutants than in the wild type. This is because the wild type markedly decreased PSI activity as well as PSI content in response to HL, whereas pmgA mutants did not. The slight discrepancy was observed between P700 content and PSI activity. Since DAD indirectly as well as directly donates electrons to P700, the PSI activity may also be affected by other unknown conditions (Izawa, 1980). The PSII activity was also higher in pmgA mutants than in the wild type under HL. This was due to a significant decrease in the ratio of PSII activity to PSII content only in wild-type cells transferred to HL. A possible reason for the HL effect will be addressed in Discussion. Table II. Photosynthetic activities of cells Reaction . Activities . WS (wild type) . WL . pmgA::SpR . μmol O2 evolved 109cells−1 h−1 LL  H2O to HCO−3 6.60  ± 0.51 6.49  ± 0.50 6.53  ± 0.77  PSII (water to 2,6-DCBQ) 21.72  ± 0.30 22.73  ± 0.51 22.27  ± 0.69  PSI (DAD/ascorbic acid to MV) −19.59  ± 3.31 −13.41  ± 2.82 −14.43  ± 2.89 HL1-a  H2O to HCO−3 8.87  ± 0.16 12.41  ± 1.06 11.35  ± 0.55  PSII (water to 2,6-DCBQ) 9.24  ± 0.33 13.56  ± 1.41 12.67  ± 0.83  PSI (DAD/ascorbic acid to MV) −6.02  ± 0.74 −11.24  ± 3.53 −11.41  ± 2.04 Reaction . Activities . WS (wild type) . WL . pmgA::SpR . μmol O2 evolved 109cells−1 h−1 LL  H2O to HCO−3 6.60  ± 0.51 6.49  ± 0.50 6.53  ± 0.77  PSII (water to 2,6-DCBQ) 21.72  ± 0.30 22.73  ± 0.51 22.27  ± 0.69  PSI (DAD/ascorbic acid to MV) −19.59  ± 3.31 −13.41  ± 2.82 −14.43  ± 2.89 HL1-a  H2O to HCO−3 8.87  ± 0.16 12.41  ± 1.06 11.35  ± 0.55  PSII (water to 2,6-DCBQ) 9.24  ± 0.33 13.56  ± 1.41 12.67  ± 0.83  PSI (DAD/ascorbic acid to MV) −6.02  ± 0.74 −11.24  ± 3.53 −11.41  ± 2.04 All values represent the means ± se for at least three separate experiments. F1-a Activities of cells 18 h after shift to HL. Open in new tab Table II. Photosynthetic activities of cells Reaction . Activities . WS (wild type) . WL . pmgA::SpR . μmol O2 evolved 109cells−1 h−1 LL  H2O to HCO−3 6.60  ± 0.51 6.49  ± 0.50 6.53  ± 0.77  PSII (water to 2,6-DCBQ) 21.72  ± 0.30 22.73  ± 0.51 22.27  ± 0.69  PSI (DAD/ascorbic acid to MV) −19.59  ± 3.31 −13.41  ± 2.82 −14.43  ± 2.89 HL1-a  H2O to HCO−3 8.87  ± 0.16 12.41  ± 1.06 11.35  ± 0.55  PSII (water to 2,6-DCBQ) 9.24  ± 0.33 13.56  ± 1.41 12.67  ± 0.83  PSI (DAD/ascorbic acid to MV) −6.02  ± 0.74 −11.24  ± 3.53 −11.41  ± 2.04 Reaction . Activities . WS (wild type) . WL . pmgA::SpR . μmol O2 evolved 109cells−1 h−1 LL  H2O to HCO−3 6.60  ± 0.51 6.49  ± 0.50 6.53  ± 0.77  PSII (water to 2,6-DCBQ) 21.72  ± 0.30 22.73  ± 0.51 22.27  ± 0.69  PSI (DAD/ascorbic acid to MV) −19.59  ± 3.31 −13.41  ± 2.82 −14.43  ± 2.89 HL1-a  H2O to HCO−3 8.87  ± 0.16 12.41  ± 1.06 11.35  ± 0.55  PSII (water to 2,6-DCBQ) 9.24  ± 0.33 13.56  ± 1.41 12.67  ± 0.83  PSI (DAD/ascorbic acid to MV) −6.02  ± 0.74 −11.24  ± 3.53 −11.41  ± 2.04 All values represent the means ± se for at least three separate experiments. F1-a Activities of cells 18 h after shift to HL. Open in new tab It is also of interest that the ratio of the whole photosynthetic activity to PSII or PSI activity was much higher in HL-grown than in LL-grown cells, regardless of functionality of pmgA. This suggests that the enzyme(s) for carbon assimilation were up-regulated under HL, in contrast to the down-regulation of chlorophyll content. Both regulations are typical responses of photosynthetic organisms to HL (Björkman, 1981; Raps et al., 1983). Western Analysis To confirm the measurements of photosystem content and activities, photosystem proteins and Rubisco were probed with specific antibodies as shown in Figure 5. Clearly, the cellular content of the D2 protein of PSII reaction centers, the PsbO protein of PSII oxygen-evolving complexes, and the PsaA/B proteins of PSI reaction centers were down-regulated under HL, whereas the content of the Rubisco large subunit was up-regulated. These differences in accumulation of photosystems and Rubisco proteins seem to coincide with the data on photosynthetic activity. It is interesting that only PsaA/B proteins under HL seemed to be down-regulated in the wild type and not in pmgA mutants. Although the difference in PsaA/B content was not clear, possibly due to inaccuracy of the method, the results seem to support the idea that pmgA is involved in the modulation of photosystem stoichiometry by regulating the accumulation of PSI under HL. Fig. 5. Open in new tabDownload slide Immunoblotting of polypeptides of the wild type (WS) and pmgA mutants (WL and the disruptantpmgA::SpR). Total cell extracts of LL-grown cells or cells 18 h after a shift to HL were separated by SDS-PAGE, electrotransferred, and challenged with anti-D2, anti-PsbO, anti-PsaA/B, or anti-Rubisco (RuBisCO). Proteins extracted from the same number of cells were probed with each antibody (see Methods). Fig. 5. Open in new tabDownload slide Immunoblotting of polypeptides of the wild type (WS) and pmgA mutants (WL and the disruptantpmgA::SpR). Total cell extracts of LL-grown cells or cells 18 h after a shift to HL were separated by SDS-PAGE, electrotransferred, and challenged with anti-D2, anti-PsbO, anti-PsaA/B, or anti-Rubisco (RuBisCO). Proteins extracted from the same number of cells were probed with each antibody (see Methods). Mixed-Culture Experiments at Various Light Intensities We have shown that the higher chlorophyll content and the lower PSII-to-PSI ratio in the pmgA mutants were apparently linked to the higher photosynthetic activities per cell and the higher growth rates than the wild type under HL. Next, we explored the physiological significance of the pmgA-mediated regulation mechanism, which had been acquired in wild-type Synechocystis in evolution. We attempted to answer this question by examining growth rates of a point mutant of pmgA (WL) and the wild type in mixed-culture experiments as shown in Figure6. Relative growth was estimated by direct sequencing of the pmgA gene in genomic DNA extracted from the mixed cultures, which consisted of several consecutive batch cultures. Direct sequencing provided information about the population of the two strains at the time of sampling irrespective of the extent of photodamage. Examination by direct sequencing seemed to be more reliable than subsequent growth tests, especially for damaged cells. Consistent with our previous observation on agar plates (Hihara and Ikeuchi, 1997), the mutant and the wild type grew similarly under LL or medium light (50 μE m−2s−1). Under higher-light conditions (100 μE m−2 s−1), the mutant became dominant in the second and third culture. We also confirmed that the mutant became dominant in the second culture at 200 and 400 μE m−2 s−1, when the culture was transferred every 2 d (data not shown), as shown in our previous report (Hihara and Ikeuchi, 1997). However, the WL mutant suddenly disappeared from the mixed culture under similar conditions when transferred every 24 h (Fig. 6, 200–300 μE m−2 s−1). The latter culture regime kept cells at a relatively low density so that they would receive more HL stress due to reduced self-shading. Therefore, disappearance of the pmgA mutant indicates that thepmgA mutation responsible for higher photosynthetic activities (Table II) is fatal under prolonged conditions of HL stress, suggesting that alteration in the PSII-to-PSI ratio has been selected during evolution as an adaptation to HL inSynechocystis. Fig. 6. Open in new tabDownload slide Effects of light intensities for mixed-liquid culture on the ratio of the WL to WS genotype as determined by direct sequencing. The ratio is expressed as a pie chart, whereas cell density is shown as A730 under each pie chart. A horizontal line indicates each batch culture, and a dotted line indicates the inoculation of the following batch culture. Fig. 6. Open in new tabDownload slide Effects of light intensities for mixed-liquid culture on the ratio of the WL to WS genotype as determined by direct sequencing. The ratio is expressed as a pie chart, whereas cell density is shown as A730 under each pie chart. A horizontal line indicates each batch culture, and a dotted line indicates the inoculation of the following batch culture. RT-PCR of pmgA mRNA Although we have shown that pmgA is essential for modulation of photosystem stoichiometry, which molecular processes are mediated by pmgA is still unknown. To learn more about the role of pmgA, we investigated the expression ofpmgA in the wild type by RT-PCR as shown in Figure7. In contrast to relatively constant amplification of the constitutive RNase P gene (rnpB) (Frı́as et al., 1994), production of a pmgA fragment was largely dependent on the light conditions. When cells were grown under LL, cDNA for pmgA was barely detectable, as can be seen at time 0. After 4 h of HL, cDNA for pmgAincreased severalfold and was then maintained at the high level for up to 16 h. A decrease in the cDNA level was observed at 20 h, possibly due to the self-shading effect. It was also interesting that the amount of cDNA sufficient for PCR amplification was more than 10,000 times higher for pmgA than for rnpB, suggesting that expression of pmgA is very low even under inducible conditions. We confirmed almost no DNA in the RNA preparation before the RT reactions, as shown in the negative control experiments. These suggest that the pmgA gene becomes active upon exposure to HL to acclimate to conditions of HL stress. Fig. 7. Open in new tabDownload slide Expression of pmgA in the wild type revealed by RT-PCR. The top and middle panels show PCR with primers specific to pmgA and rnpB, respectively. (+) indicates use of reverse-transcribed RNA from wild-type cells at HL as a template of PCR. The bottom panel shows PCR with primers specific to rnpB. (−) indicates use of RNA before reverse-transcription as a template. The culture for RNA isolation was inoculated with LL-grown cells and transferred to HL at time 0. Fig. 7. Open in new tabDownload slide Expression of pmgA in the wild type revealed by RT-PCR. The top and middle panels show PCR with primers specific to pmgA and rnpB, respectively. (+) indicates use of reverse-transcribed RNA from wild-type cells at HL as a template of PCR. The bottom panel shows PCR with primers specific to rnpB. (−) indicates use of RNA before reverse-transcription as a template. The culture for RNA isolation was inoculated with LL-grown cells and transferred to HL at time 0. DISCUSSION We have demonstrated that functional pmgA is specifically involved in acclimation to HL by modulating photosystem stoichiometry and, partly, chlorophyll synthesis. In our experimental conditions with Synechocystis sp. PCC 6803, we observed many changes due to HL acclimation: (a) decrease of cellular pigment content; (b) decrease of photochemical activities (on a per-cell basis); (c) decrease of antenna size of PSII; (d) increase of the PSII to PSI ratios; (e) increase of Rubisco; and (f) increase of maximum photosynthetic rate. These responses, possibly resulting from HL-induced modulation of accumulation of pigments and proteins for the photosynthetic apparatus, have been widely recognized in cyanobacteria, algae, and higher plants (Kawamura et al., 1979; Vierling and Alberte, 1980; Björkman, 1981; Raps et al., 1983; Zevenboom and Mur, 1984;Anderson et al., 1988). Our mutant analysis revealed thatpmgA is specifically responsible for the slow recovery of chlorophyll accumulation during phase 2 after the shift from LL to HL (Fig. 3D) and for an increase in the PSII-to-PSI ratio (Fig. 4; TableI). Importantly, pmgA is not directly involved in other responses. To our knowledge, this is the first gene to be identified as a regulatory factor for HL acclimation. Since modulation of photosystem stoichiometry under different growth irradiances has been well documented in various cyanobacteria, algae, and higher plants (Kawamura et al., 1979; Falkowski et al., 1981; Leong and Anderson, 1984; Neale and Melis, 1986; Wild et al., 1986; Anderson et al., 1988;Smith and Melis, 1988; Murakami and Fujita, 1991; Yokoyama et al., 1991), it would be interesting to survey other cyanobacteria and/or plants for a pmgA homolog. The phenotype causing photoautotrophic growth of pmgAmutants on agar plates to be much better than the wild type under almost all light intensities (Hihara and Ikeuchi, 1997) was totally unexpected. In this report we showed that the mutants grew significantly faster than the wild type in liquid medium when grown separately (Fig. 3A) or in mixed culture (Fig. 6). The higher growth rate of the mutants seems to be accounted for by their higher whole-cell photosynthetic activity (Table II). The higher photosynthetic activity of the mutants as compared with the wild type seems to reflect their higher activity of PSI, which is consistent with the results of P700 measurements (Table I) and immunoblotting of PSI reaction center PsaA/B proteins (Fig. 5). However,the PSII activity of the mutants was also higher than the wild type (Table II), although the cellular content of Cyt b559 and reaction center D2 protein were not much different between the mutant and wild-type cells (Table I; Fig. 5). This could be explained by the difference in sensitivity to PSII photoinhibition under HL. Since photoinhibition of PSII is caused by accumulation of reduced quinone at the primary acceptor QA site (Aro et al., 1993), the higher activity of PSI in the mutants is supposed to extract more electrons from PSII, possibly resulting in less photoinhibition of PSII, namely higher PSII activity. Thus, it can be concluded that the higher photosynthetic activity of the mutants resulting from enhanced accumulation of PSI due to loss of pmgA function is responsible for the mutant's ability to grow faster than the wild type under HL conditions. However, our results with mixed-culture experiments under extended HL stress (Fig. 6) demonstrated that the pmgA mutant, with its higher PSI content, was more sensitive to prolonged stress than the wild type. One explanation for this apparent discrepancy is increased accumulation of reactive oxygen species in the cells of thepmgA mutant under HL conditions. The increase of PSI content mitigates photoinhibition of PSII, and results in the higher activity of whole-electron transport. The increase of PSI content also results in the accumulation of electrons on the reducing side of PSI rather than on the QA site of PSII. Both the increase in the electron-transfer rate and the accumulation of electrons on the reducing side of PSI are conditions that stimulate the production of reactive oxygen species. Thus, the increased PSI content in the mutants may result in much more production of reactive species of oxygen, which might account for the loss of viability of the mutants under the prolonged stress of HL. It is widely accepted that electrons generated from PSI react with oxygen to produce the superoxide anions, which are mainly scavenged by superoxide dismutase and ascorbate peroxidase (Asada, 1992; Herbert et al., 1992). It was recently demonstrated that irreversible photoinhibition of PSI occurs at its acceptor side in chilling-sensitive plants under chilling stress, possibly due to a loss of protection against the reactive species of oxygen (Sonoike and Terashima, 1994; Sonoike, 1996). The protection against reactive oxygen species is particularly important under HL stress (Foyer et al., 1994). The physiological significance of the HL response that adjusts photosystem stoichiometry has not been fully established, although the adjustment is widespread in photosynthetic organisms. For example, it was simply stated in a review (Anderson et al., 1995) that adaptation of the photosystem stoichiometry serves to regulate the distribution of excitation energy between the photosystems and correct any imbalances. This is in contrast to many other responses of HL acclimation, such as the reduction in pigments and antenna size and the increase in CO2 fixation activity, which can be easily recognized as avoiding photoinhibition (Björkman, 1981; Anderson et al., 1988). Here we proposed another explanation for the adjustment of photosystem stoichiometry under HL: the decrease of PSI content makes cells resistant to HL stress by reducing the production of reactive oxygen species, which is otherwise lethal under prolonged HL stress. In conclusion, relative decrease of PSI content under HL conditions mediated by pmgA in Synechocystis can be a physiological response to the HL stress. pmgA mutants lack this response, resulting in the production of reactive oxygen species. It would be interesting to attempt to detect generation of the reactive oxygen species under HL in pmgA mutants. pmgA mutants have another interesting phenotypic character: They are unable to grow on agar plates under photomixotrophic conditions with 5 mm Glc even under medium light (50 μE m−2 s−1) (Hihara and Ikeuchi, 1997). On the other hand, they can grow in liquid under the same photomixotrophic conditions, although their growth is significantly slower than the wild type, as demonstrated by mixed culture (Hihara and Ikeuchi, 1997). Here we observed that wild-type cells grown in liquid under photomixotrophic conditions showed a much reduced chlorophyll content on a per-cell basis and a higher ratio of PSII to PSI than those under photoautotrophic conditions. However,pmgA mutants did not show any change in the photosystem stoichiometry under the same photomixotrophic conditions (data not shown). Since these changes were almost the same as those of HL-grown cells, the addition of Glc is supposed to intensify the light stress. This interpretation may be reasonable, since Glc provided cells with NADPH via the oxidative pentose phosphate cycle (Pelroy et al., 1972), which presumably makes the acceptor side of PSI more reductive (like the HL treatment). Thus, the phenotype of pmgA mutants unable to grow under the photomixotrophic conditions could be also explained by the inability to reduce the PSI content. How does pmgA work on the accumulation of chlorophyll and photosystem stoichiometry? Our data on photosystem content suggest that photosystem stoichiometry was mainly modulated by accumulation of PSI. Studies on light acclimation in cyanobacteria demonstrated that cellular PSI content is more variable than PSII during the adjustment of photosystem stoichiometry (Kawamura et al., 1979; Murakami and Fujita, 1991). However, it remains to be determined whether chlorophyll accumulation or PSI accumulation is the primary target of thepmgA-mediated acclimation to HL. The retardation of chlorophyll accumulation (Fig. 3D) seemed to precede the increase of the F695/F725 ratio (Fig. 4D). However, it would be rather difficult to imagine a mechanism whereby chlorophyll biosynthesis preferentially regulates assembly of the PSI complex. It should be noted that mRNA levels of pmgA were elevated severalfold for the initial 4 h after HL was begun (Fig. 7). This observation, coupled with the fact that the level of pmgA is very low even after HL induction, suggests that the pmgA product is involved in an early signaling process of the HL acclimation. So far, two genes have been documented to be specifically involved in accumulation of PSI complexes but not PSII (Wilde et al., 1995;Bartsevich and Pakrasi, 1997; Boudreau et al., 1997). Disruption of a chloroplast open reading frame, ycf4, and aSynechocystis homolog, orf184, induced a significant decline in PSI content per unit of chlorophyll. As a result, the PSII-to-PSI ratio was elevated about 3-fold in the mutant compared with wild-type Synechocystis (Wilde et al., 1995), whereas there was almost no accumulation of the PSI complex in theC. reinhardtii mutant (Boudreau et al., 1997). A second gene, btpA, seems to regulate a posttranscriptional process that affects biogenesis of the PSI complex in Synechocystis(Bartsevich and Pakrasi, 1997). A disruption mutant of btpAhad only 10% to 15% of PSI reaction center proteins compared with the wild type, whereas the PSII content remained unaffected. These different genes may regulate accumulation of PSI at a step of translation, assembly, or turnover of the PSI complex, although no relevant data were presented that indicated their involvement in physiological adjustment of photosystem stoichiometry under varying environment conditions. To our knowledge, pmgA is the first gene shown to be involved in the regulation of the PSII-to-PSI ratio under physiological conditions. ACKNOWLEDGMENTS We thank Dr. Gerry Plumley for critical reading of the manuscript, Dr. Akio Murakami for advice on the measurement of Cytb559, Dr. Arthur Grossman for advice on preparation of total RNA, and Ms. Ayako Kamei for her help with the experiments. We are also grateful to Drs. Isao Enami and Katsuhiko Okada for providing antibodies. Abbreviations: 2,6-DCBQ 2,6-dichlorobenzoquinone DAD diaminodurene HL high light (in this study, 200 μE m−2s−1) LDS lithium dodecyl sulfate LL low light (in this study, 20 μE m−2 s−1) MV methyl viologen RT-PCR reverse transcriptase-PCR TMPD N,N,N′,N′-tetramethyl-p-phenylenediamine LITERATURE CITED 1 Allen JF Thylakoid protein phosphorylation, state 1-state 2 transitions, and photosystem stoichiometry adjustment: redox control at multiple levels of gene expression. Physiol Plant 93 1995 196 205 Google Scholar Crossref Search ADS WorldCat 2 Anderson JM Photoregulation of the composition, function, and structure of thylakoid membranes. Annu Rev Plant Physiol 37 1986 93 136 Google Scholar Crossref Search ADS WorldCat 3 Anderson JM Chow WS Goodchild DJ Thylakoid membrane organization in sun/shade acclimation. Aust J Plant Physiol 15 1988 11 26 Google Scholar OpenURL Placeholder Text WorldCat 4 Anderson JM Chow WS Park Y-I The grand design of photosynthesis: acclimation of the photosynthetic apparatus to environmental cues. Photosynth Res 46 1995 129 139 Google Scholar Crossref Search ADS PubMed WorldCat 5 Arnon DI McSwain BD Tsujimoto HY Wada K Photochemical activity and components of membrane preparations from blue-green algae. I. Coexistence of two photosystems in relation to chlorophyll a and removal of phycocyanin. Biochim Biophys Acta 357 1974 231 245 Google Scholar Crossref Search ADS PubMed WorldCat 6 Aro E-M Virgin I Andersson B Photoinhibition of photosystem II. Inactivation, protein damage and turnover. Biochim Biophys Acta 1143 1993 113 134 Google Scholar Crossref Search ADS PubMed WorldCat 7 Asada K Ascorbate peroxidase: a hydrogen peroxide-scavenging enzyme in plants. Physiol Plant 85 1992 235 241 Google Scholar Crossref Search ADS WorldCat 8 Bartsevich VV Pakrasi HB Molecular identification of a novel protein that regulates biogenesis of photosystem I, a membrane protein complex. J Biol Chem 272 1997 6382 6387 Google Scholar Crossref Search ADS PubMed WorldCat 9 Björkman O Responses to different quantum flux densities. Lange OLL Nobel PS Osmond CB Ziegler H Physiological Plant Ecology I. Responses to the Physical Environment. Encyclopedia of Plant Physiology, New Series 12A. 1981 57 107 Springer-Verlag Berlin 10 Boudreau E Takahashi Y Lemieux C Turmel M Rochaix J-D The chloroplast ycf3 and ycf4 open reading frames of Chlamydomonas reinhardtii are required for the accumulation of the photosystem I complex. EMBO J 16 1997 6095 6104 Google Scholar Crossref Search ADS PubMed WorldCat 11 Chiang GG Schaefer MR Grossman AR Complementation of a red-light-indifferent cyanobacterial mutant. Proc Natl Acad Sci USA 89 1992 9415 9419 Google Scholar Crossref Search ADS PubMed WorldCat 12 Falkowski PG Owens TG Ley AC Mauzerall DC Effect of growth irradiance levels on the ratio of reaction centers in two species of marine phytoplankton. Plant Physiol 68 1981 969 973 Google Scholar Crossref Search ADS PubMed WorldCat 13 Foyer CH Lelandais M Kunert KJ Photooxidative stress in plants. Physiol Plant 92 1994 696 717 Google Scholar Crossref Search ADS WorldCat 14 Frı́as JE Flores E Herrero A Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120. Mol Microbiol 14 1994 823 832 Google Scholar Crossref Search ADS PubMed WorldCat 15 Fujita Y Murakami A Regulation of electron transport composition in cyanobacterial photosynthetic system: stoichiometry among photosystem I and II complexes and their light-harvesting antennae and cytochrome b6/f complex. Plant Cell Physiol 28 1987 1547 1553 Google Scholar OpenURL Placeholder Text WorldCat 16 Fujita Y Murakami A Aizawa K Ohki K Short-term and long-term adaptation of the photosynthetic apparatus: homeostatic properties of thylakoids. Bryant DA The Molecular Biology of Cyanobacteria. 1994 677 692 Kluwer Academic Publishers Dordrecht, The Netherlands 17 Fujita Y Murakami A Ohki K Regulation of photosystem composition in the cyanobacterial photosynthetic system: the regulation occurs in response to the redox state of the electron pool located between the two photosystems. Plant Cell Physiol 28 1987 283 292 Google Scholar OpenURL Placeholder Text WorldCat 18 Garewal HS Wasserman AR Triton X-100–4 M urea an as extraction medium for membrane proteins. I. Purification of chloroplast cytochrome b559. Biochemistry 13 1974 4063 4071 Google Scholar Crossref Search ADS PubMed WorldCat 19 Grossman AR Schaefer MR Chiang GG Collier JL The responses of cyanobacteria to environmental conditions: light and nutrients. Bryant DA The Molecular Biology of Cyanobacteria. 1994 641 675 Kluwer Academic Publishers Dordrecht, The Netherlands 20 Herbert SK Samson G Fork DC Laudenbach DE Characterization of damage to photosystem I and II in a cyanobacterium lacking detectable iron superoxide dismutase activity. Proc Natl Acad Sci USA 89 1992 8716 8720 Google Scholar Crossref Search ADS PubMed WorldCat 21 Hihara Y Ikeuchi M Mutation in a novel gene required for photomixotrophic growth leads to enhanced photoautotrophic growth of Synechocystis sp. PCC 6803. Photosynth Res 53 1997 243 252 Google Scholar Crossref Search ADS WorldCat 22 Hiyama T Ke B Difference spectra and extinction coefficients of P700. Biochim Biophys Acta 267 1972 160 171 Google Scholar Crossref Search ADS PubMed WorldCat 23 Ikeuchi M Inoue Y Specific 125I labeling of D1 (herbicide-binding protein): an indication that D1 functions on both the donor and acceptor sides of photosystem II. FEBS Lett 210 1987 71 76 Google Scholar Crossref Search ADS WorldCat 24 Izawa S Acceptors and donors for chloroplast electron transport. Methods Enzymol 69 1980 413 433 Google Scholar Crossref Search ADS WorldCat 25 Kawamura M Mimuro M Fujita Y Quantitative relationship between two reaction centers in the photosynthetic system of blue-green algae. Plant Cell Physiol 20 1979 697 705 Google Scholar Crossref Search ADS WorldCat 26 Kehoe DM Grossman AR Similarity of a chromatic adaptation sensor to phytochrome and ethylene receptors. Science 273 1996 1409 1412 Google Scholar Crossref Search ADS PubMed WorldCat 27 Knanna R Graham JR Myers J Gantt E Phycobilisome composition and possible relationship to reaction centers. Arch Biochem Biophys 224 1983 534 542 Google Scholar PubMed OpenURL Placeholder Text WorldCat 28 Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 1970 680 685 Google Scholar Crossref Search ADS PubMed WorldCat 29 Leong T-Y Anderson JM Adaptation of the thylakoid membranes of pea chloroplasts to light intensities. I. Study on the distribution of chlorophyll-protein complexes. Photosynth Res 5 1984 105 115 Google Scholar Crossref Search ADS PubMed WorldCat 30 Lönneborg A Lind LK Kalla SR Gustafsson P Öquist G Acclimation processes in the light-harvesting system of the cyanobacterium Anacystis nidulans following a light shift from white to red light. Plant Physiol 78 1985 110 114 Google Scholar Crossref Search ADS PubMed WorldCat 31 Melis A Dynamics of photosynthetic membrane composition and function. Biochim Biophys Acta 1058 1991 87 106 Google Scholar Crossref Search ADS WorldCat 32 Melis A Mandori A Glick RE Ghirardi ML McCauley SW Neale PJ The mechanism of photosynthetic membrane adaptation to environmental stress conditions: a hypothesis on the role of electron-transport capacity and of ATP/NADPH pool in the regulation of thylakoid membrane organization and function. Physiol Vég 23 1985 757 765 Google Scholar OpenURL Placeholder Text WorldCat 33 Murakami A Fujita Y Regulation of photosystem stoichiometry in the photosynthetic system of the cyanophyte Synechocystis PCC 6714 in response to light-intensity. Plant Cell Physiol 32 1991 223 230 Google Scholar Crossref Search ADS WorldCat 34 Murata N Nishimura M Takamiya A Fluorescence of chlorophyll in photosynthetic systems. III. Emission and action spectra of fluorescence-three emission bands of chlorophyll a and the energy transfer between two pigment systems. Biochim Biophys Acta 126 1966 234 243 Google Scholar Crossref Search ADS PubMed WorldCat 35 Neale PJ Melis A Algal photosynthetic membrane complexes and the photosynthesis-irradiance curve: a comparison of light-adaptation responses in Chlamydomonas reinhardtii (Chlorophyta). J Phycol 22 1986 531 538 Google Scholar Crossref Search ADS WorldCat 36 Pelroy RA Rippka R Stanier RY Metabolism of glucose by unicellular blue-green algae. Arch Microbiol 87 1972 303 322 Google Scholar OpenURL Placeholder Text WorldCat 37 Raps S Wyman K Siegelman HW Falkowski PG Adaptation of the cyanobacterium Microcystis aeruginosa to light intensity. Plant Physiol 72 1983 829 832 Google Scholar Crossref Search ADS PubMed WorldCat 38 Smith BM Melis A Photochemical apparatus organization in the diatom Cylindrotheca fusiformis: photosystem stoichiometry and excitation distribution in cells grown under high and low irradiance. Plant Cell Physiol 29 1988 761 769 Google Scholar OpenURL Placeholder Text WorldCat 39 Sonoike K Photoinhibition of photosystem I: Its physiological significance in the chilling sensitivity of plants. Plant Cell Physiol 37 1996 239 247 Google Scholar Crossref Search ADS WorldCat 40 Sonoike K Katoh S Effects of sodium dodecyl sulfate and methyl viologen on the differential extinction coefficient of P-700: a band shift of chlorophyll a associated with oxidation of P-700. Biochim Biophys Acta 935 1988 61 71 Google Scholar Crossref Search ADS WorldCat 41 Sonoike K Katoh S Simple estimation of the differential absorption coefficient of P-700 in detergent-treated preparations. Biochim Biophys Acta 976 1989 210 213 Google Scholar Crossref Search ADS WorldCat 42 Sonoike K Katoh S Variation and estimation of the differential absorption coefficient of P-700 in spinach photosystem I preparations. Plant Cell Physiol 31 1990 1079 1082 Google Scholar OpenURL Placeholder Text WorldCat 43 Sonoike K Terashima I Mechanism of photosystem-I photoinhibition in leaves of Cucumis sativus L. Planta 194 1994 287 293 Google Scholar Crossref Search ADS WorldCat 44 Terashima I Funayama S Sonoike K The site of photoin-hibition in leaves of Cucumis sativus L. at low temperatures is photosystem I, not photosystem II. Planta 193 1994 300 306 Google Scholar Crossref Search ADS WorldCat 45 Vierling E Alberte RS Functional organization and plasticity of the photosynthetic unit of the cyanobacterium Anacystis nidulans. Physiol Plant 50 1980 93 98 Google Scholar Crossref Search ADS WorldCat 46 Whitmarsh J Ort DR Stoichiometries of electron transport complexes in spinach chloroplasts. Arch Biochem Biophys 231 1984 378 389 Google Scholar Crossref Search ADS PubMed WorldCat 47 Wild A Höpfner M Rühle W Richter M Changes in the stoichiometry of photosystem II components as an adaptive response to high-light and low-light conditions during growth. Z Naturforsch 41c 1986 597 603 Google Scholar OpenURL Placeholder Text WorldCat 48 Wilde A Härtel H Hübschmann T Hoffmann P Shestakov SV Börner T Inactivation of a Synechocystis sp. strain PCC 6803 gene with homology to conserved chloroplast open reading frame 184 increases the photosystem II-to-photosystem I ratio. Plant Cell 7 1995 649 658 Google Scholar PubMed OpenURL Placeholder Text WorldCat 49 Yokoyama E Murakami A Sakurai H Fujita Y Effect of supra-high irradiation on the photosynthetic system of the cyanophyte Synechocystis PCC 6714. Plant Cell Physiol 32 1991 827 834 Google Scholar OpenURL Placeholder Text WorldCat 50 Zevenboom W Mur LR Growth and photosynthetic response of the cyanobacterium Microcystis aeruginosa in relation to photoperiodicity and irradiance. Arch Microbiol 139 1984 232 239 Google Scholar OpenURL Placeholder Text WorldCat Author notes 1 This work was supported by a Research Fellowship for Young Scientists from the Japan Society of the Promotion of Science (to Y.H.); by grants-in-aid for encouragement of young scientists (no. 09740590 to K.S.), for scientific research on priority areas (no. 07251204 to M.I.), and for scientific research C (no. 08836002 to M.I.) from the Ministry of Education, Science, and Culture, Japan; and by a grant for Scientific Research from the Human Frontier Science program (to M.I.). * Corresponding author; e-mail [email protected]; fax 81–3–5454–4337. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)