Plant Physiology

Chang, Caren; Stewart, Richard C.

doi: 10.1104/pp.117.3.723pmid: 9662515

SENSORY-RESPONSE CIRCUITS: REALITY CHECKS AT THE CELLULAR LEVEL Unicellular microorganisms experience “life on the edge,” as they have little ability to change their environment and face fierce competition for limited resources. They must therefore respond to a barrage of environmental cues in a rapid and accurate manner. Among multicellular organisms, plants in particular cannot escape their environment and so must be masters at adapting and coordinating cellular events to accommodate prevailing conditions. The penalty for losing touch with reality is often death. The study of sensory-response systems has defined the basics of how many organisms detect and respond with exquisite sensitivity to changes in their chemical or physical environments. Such studies have recently focused on events that occur at the cellular and molecular levels, elucidating the mechanisms of detecting extracellular signals and transducing such signals into the appropriate intracellular events. In a large number of cases, these signaling pathways involve phosphorylation of key effector proteins by protein kinases. In bacteria numerous sensory-response circuits operate by making use of a phosphorylation control mechanism referred to as the “two-component system” (Nixon et al., 1986; Parkinson and Kofoid, 1992). The basic biochemical events of two-component signal transduction were first established by Ninfa and Magasanik (1986) for the NR system, a regulatory system that controls gene expression in response to nitrogen-source availability in Escherichia coli. At about the same time, Ausubel and co-workers (Nixon et al., 1986) recognized amino acid sequence similarities between the components of the NR system and components of numerous other bacterial sensory systems that had not been characterized at a biochemical level. Such similarities raised the exciting possibility that these other systems operated via a signaling mechanism analogous to that utilized by the NR system. Subsequent work has borne out this idea, and the list of two-component systems has expanded to include hundreds of distinct systems. Fueled in part by the explosion of sequence information provided by various genome projects, the number of two-component systems continues to grow at a rapid pace, and numerous review articles on the topic have been published (e.g. Stock et al., 1990; Bourret et al., 1991; Parkinson and Kofoid, 1992; Hoch and Silhavy, 1995). Whereas the two-component system has been firmly established as a prevalent signaling mechanism in bacteria, the existence of two-component regulators in eukaryotic systems has been uncovered only very recently and, to date, only in a limited number of organisms (fungi, slime molds, and plants) (Loomis et al., 1997; Wurgler -Murphy et al., 1997). In the first part of this review, we outline the basics of how two-component systems operate in well-characterized bacterial systems. In the second part, we review the emerging picture of two-component signaling in the context of eukaryotic cells, particularly in higher plants. BASIC PLAYERS: IT TAKES TWO TO SIGNAL The basic two-component system involves a sensor kinase, or HPK, as well as an RR. As depicted in Figure1, the role of the HPK is to direct phosphorylation of its cognate RR in response to a specific environmental signal; this phosphorylation regulates the activity of the RR. Some bacteria make extensive use of such systems. For example, inspection of the complete genome of E. coli indicates that over 30 distinct HPK-RR circuits operate in this single bacterium. Basic Local Alignment Search Tool (BLAST) searches of theMycoplasma genetilium genome database, however, revealed no likely HPK homologs, suggesting that not all prokaryotes utilize two-component systems as extensively as E. coli. Similar surveys of other sequence databases indicate that while some eukaryotes (e.g. Arabidopsis thaliana) may have a number of two-component systems, others (e.g. Saccharomyces cerevisiae) appear to have only a single two-component system. Here we outline some of the basic characteristics common to the large families of two-component HPKs and RRs. Fig. 1. Open in new tabDownload slide Example of a basic two-component system. TheE. coli osmolarity-response system consists of an HPK osmosensor (EnvZ) and an RR transcription factor (OmpR) (Pratt and Silhavy, 1995). EnvZ autophosphorylates using ATP as the phosphate donor. The phosphate from the transmitter module of EnvZ is then transferred to an Asp residue in the receiver module of OmpR, thereby affecting the promoter interactions of the OmpR DNA-binding module, which regulates the transcription of two porin genes,ompF and ompC. Changes in osmolarity are perceived by the amino-terminal module of EnvZ. In response to such changes, EnvZ changes the level of phosphorylated OmpR. The dotted lines depict intra-protein regulatory interactions. The dashed line depicts phosphorylation/dephosphorylation events. P, Phosphoryl group; H, His; D, Asp. Fig. 1. Open in new tabDownload slide Example of a basic two-component system. TheE. coli osmolarity-response system consists of an HPK osmosensor (EnvZ) and an RR transcription factor (OmpR) (Pratt and Silhavy, 1995). EnvZ autophosphorylates using ATP as the phosphate donor. The phosphate from the transmitter module of EnvZ is then transferred to an Asp residue in the receiver module of OmpR, thereby affecting the promoter interactions of the OmpR DNA-binding module, which regulates the transcription of two porin genes,ompF and ompC. Changes in osmolarity are perceived by the amino-terminal module of EnvZ. In response to such changes, EnvZ changes the level of phosphorylated OmpR. The dotted lines depict intra-protein regulatory interactions. The dashed line depicts phosphorylation/dephosphorylation events. P, Phosphoryl group; H, His; D, Asp. Sensor HPKs In several respects, HPKs are similar to the well-defined family of receptor Tyr kinases (Stock et al., 1991): HPKs operate as dimers and autophosphorylate; they are associated with the cytoplasmic membrane, usually via one or two membrane-spanning sequences; and they typically contain extracellular sensory input modules fused to the protein kinase catalytic module (Bourret et al., 1991). This arrangement makes it easy to envision environmental stimuli impinging on the HPK in a manner that regulates its kinase activity. However, there are relatively few cases in which we have much understanding of the actual ligands that interact directly with the HPKs, and in several cases a distinct protein serves as the primary receptor for the stimulus (Fig. 2, A and B). Because of this, it has been difficult to determine the exact relationship between signal perception and catalytic activity of the HPK (e.g. whether the signal stimulates HPK activity). Despite the general mechanistic similarities shared by HPKs and other types of protein kinases, sequence analysis indicates that HPKs are only distantly related to Tyr kinases and Ser/Thr kinases (Stock et al., 1995). Fig. 2. Open in new tabDownload slide Examples of diversity in the two-component system. In A and B, a cell-surface receptor or transport protein is responsible for direct binding/detection of a stimulus, and this information is then conveyed to the appropriate HPK via protein-protein interactions. A, Part of the E. coli chemotaxis signaling pathway, a system in which the CheA HPK phosphorylates either of two different RRs; the CheY RR promotes changes in swimming direction, whereas the CheB RR promotes sensory adaptation (Bourret et al., 1991; Stock et al., 1991). The location of the phosphorylation site in CheA is atypical in that it is located outside of the transmitter module (Parkinson and Kofoid, 1992). B, Basic elements of the E. coli Pho(phosphate) system, which is responsible for controlling gene expression in response to phosphate availability. In this system, two distinct HPKs, PhoR and CreC, can phosphorylate the RR transcription factor PhoB. CreC responds to the intracellular concentration of some unknown metabolite, whereas PhoR is regulated by a phosphate-specific transport system (Wanner, 1994). C, BvgS, a hybrid HPK that regulates expression of virulence determinants of the human pathogen Bordetella pertussis in response to as-yet-unknown host factors. BvgS undergoes His to Asp to His phosphotransfer prior to phosphorylation of the RR transcription factor BvgA (Uhl and Miller, 1996). H, His; P, phosphoryl group; D, Asp. Fig. 2. Open in new tabDownload slide Examples of diversity in the two-component system. In A and B, a cell-surface receptor or transport protein is responsible for direct binding/detection of a stimulus, and this information is then conveyed to the appropriate HPK via protein-protein interactions. A, Part of the E. coli chemotaxis signaling pathway, a system in which the CheA HPK phosphorylates either of two different RRs; the CheY RR promotes changes in swimming direction, whereas the CheB RR promotes sensory adaptation (Bourret et al., 1991; Stock et al., 1991). The location of the phosphorylation site in CheA is atypical in that it is located outside of the transmitter module (Parkinson and Kofoid, 1992). B, Basic elements of the E. coli Pho(phosphate) system, which is responsible for controlling gene expression in response to phosphate availability. In this system, two distinct HPKs, PhoR and CreC, can phosphorylate the RR transcription factor PhoB. CreC responds to the intracellular concentration of some unknown metabolite, whereas PhoR is regulated by a phosphate-specific transport system (Wanner, 1994). C, BvgS, a hybrid HPK that regulates expression of virulence determinants of the human pathogen Bordetella pertussis in response to as-yet-unknown host factors. BvgS undergoes His to Asp to His phosphotransfer prior to phosphorylation of the RR transcription factor BvgA (Uhl and Miller, 1996). H, His; P, phosphoryl group; D, Asp. There are also operational features that distinguish HPKs from other protein kinases. First, HPKs do not catalyze direct transfer of a phosphate from ATP to their “substrate” RR; rather, each HPK must first autophosphorylate, and then the phosphoryl group from HPK-P is passed to the RR. A second difference is that the site of HPK autophosphorylation is a His residue, and the site of RR phosphorylation is an Asp residue (Bourret et al., 1991). The energetics and chemical stabilities of phospho-His and phospho-Asp differ significantly from those of “more traditional” phospho-amino acids (phospho-Tyr, phospho-Ser, and phospho-Thr) (Stock et al., 1990,1995). Several hundred HPKs (some well characterized, some surmised based on sequence analysis) have been found in bacteria, and amino acid sequence comparisons have identified a common 250-amino acid “transmitter module” in each of these. This module is thought to encompass the autokinase active site and, in most cases, the His-phosphorylation site. Excluding sequences of closely related homologs, the transmitter modules from any two HPKs typically share 20 to 50% sequence identity (average sequence identity, 25%). Five blocks of 5 to 10 amino acids with higher conservation have been identified in most transmitter modules (Parkinson and Kofoid, 1992; Stock et al., 1995). Some HPKs also have phosphatase activities, i.e. they can catalyze dephosphorylation of their cognate RRs (Igo et al., 1989; Makino et al., 1989). This dephosphorylation appears to involve a mechanism that is distinct from simple reversal of the HPK-RR phosphotransfer reaction (Hsing and Silhavy, 1997). RRs The sensor HPK regulates the activity of a cytoplasmic RR by directing its phosphorylation as depicted in Figure 1. GenBank now contains over 400 different examples of RRs. Analysis of the amino acid sequences of known and suspected RRs has established two general themes: (a) RRs have an approximately 110-amino acid domain referred to as a “receiver module” that contains the Asp-phosphorylation site; and (b) most RRs are two-domain proteins in which the receiver module is fused to a second domain having some kind of output or effector activity (Parkinson and Kofoid, 1992). In many cases, the output domain is a DNA-binding module whereby the RR functions as a transcription factor, and Asp phosphorylation serves to control its ability to either bind its target DNA sequence or interact with other components of the transcription machinery (Hakenbeck and Stock, 1996). There are also RRs that have nothing to do with transcription. For example, E. coli CheB demethylates the chemotaxis-receptor proteins, and phosphorylation of the CheB receiver module serves to enhance this activity (Fig. 2A) (Lupas and Stock, 1989). In the case ofE. coli SprE, the output module regulates the activity of a protease (Pratt and Silhavy, 1996). Thus, the basic conformational changes associated with receiver phosphorylation are able to control a variety of activities (Lowry et al., 1994). If one excludes sequences of closely related homologs (e.g. NRIfrom two closely related bacterial species), receiver modules from any two RRs share sequence identity at only 20 to 30% of the positions, but all receiver modules are thought to have a similar three-dimensional structure (Stock et al., 1990; Volz, 1993). X-ray crystal structures and/or NMR-derived three-dimensional structures have been obtained for CheY (Stock et al., 1989; Volz and Matsumura, 1991), Spo0F (Feher et al., 1997), and NarL (Baikalov et al., 1996) proteins. These structures indicate a common αβ protein structure for the receiver modules in RRs, with the phosphorylation site located in the loop connecting two of the central strands of β sheet that comprise the core of the receiver module structure. The three-dimensional structures of receiver modules are strikingly similar to that of the small GTP-binding protein Ras (Stock et al., 1991). This similarity is especially interesting in view of the ability of Ras to control MAPK pathways in several eukaryotic systems as we discuss later (Avruch et al., 1994). A “Simple” Example The EnvZ-OmpR system of E. coli provides a relatively straightforward example of the basics of two-component signaling (Fig.1). This system regulates the expression of the ompF andompC porin genes in response to changes in extracellular osmolarity (Pratt and Silhavy, 1995). EnvZ is an autophosphorylating HPK that serves as an osmosensor. The osmo-sensing module of EnvZ is located in the periplasmic space of the bacterial cell, and the EnvZ transmitter domain is situated in the cytoplasm. The actual signal perceived by EnvZ has not been determined, but under conditions of high osmolarity, autophosphorylated EnvZ readily transfers its high-energy His-phosphoryl group to the conserved Asp in the receiver module of the RR OmpR. P-OmpR binds to sequences upstream of the ompF andompC genes, regulating their expression. There are numerous complexities to this regulation that are beyond the scope of this review, but, overall, this two-component system controls the relative levels of OmpF and OmpC proteins. OmpF and OmpC form homotrimeric pores in the outer bacterial membrane, and by regulating the relative levels of larger (OmpF) and smaller (OmpC) pores, the EnvZ-OmpR systems restricts the rate of diffusion of materials through the outer membrane under conditions of high osmolarity. In addition to serving as an HPK, EnvZ also catalyzes dephosphorylation of P-OmpR. The response of this system to osmotic conditions results from control of the two opposing enzymatic activities of EnvZ: kinase versus phosphatase (Pratt and Silhavy, 1995). LESSONS LEARNED FROM BACTERIAL TWO-COMPONENT SYSTEMS Modularity Because RRs and HPKs are modular, it has been possible to determine the activities of isolated domains of these proteins. For example, in vitro studies on HPK activity have often been carried out on modified versions of HPKs that lack membrane-associated regions. In many cases (including that of EnvZ), deletion of such regions removes the sensory-input modules, resulting in a partially or completely active form of the kinase (Parkinson and Kofoid, 1992). This indicates that the input domain may often serve to inhibit kinase activity, and suggests that a common mechanism of kinase regulation could be the removal of this inhibition. Without knowing the ligands or “direct stimuli” for most HPKs, however, it is difficult to test these ideas. An added complication in such analyses is that the input domain may simultaneously regulate phosphatase activity of the HPK. In a similar strategy, removal of the receiver modules from RRs has been useful in defining whether the receiver has a positive or negative influence on the activity of the output module. As a result of such studies, there are examples in which the receiver module operates as an inhibitor of RR output (Lupas and Stock, 1989; Kahn and Ditta, 1991; Baikolov et al., 1996), and those in which it operates in a positive manner to stimulate RR output (Drummond et al., 1990; Tsuzuki et al., 1994). More-than-Two-Component Systems Although some two-component systems appear to be as simple as indicated in Figure 1, many systems are more complex and involve either additional two-component modules or a variety of accessory proteins (e.g. Fig. 2). Some two-component systems, for instance, require an additional phosphatase to control the phosphorylation level of the RR. There are also numerous examples of systems that utilize more than one HPK or RR. These examples include: (a) multiple HPKs directing a single RR, (b) multiple RRs directed by a single HPK, (c) multistep phosphotransfer relays, and (d) hybrid sensor HPKs (Parkinson and Kofoid, 1992). Many of the sensor kinases identified in eukaryotic systems are hybrid HPKs, in which a receiver module is fused to the HPK such that a single protein encompasses both of the two-component elements. Most hybrid kinases appear to phosphorylate a receiver module on a second distinct protein; this opens up the possibility of having different pathways by which a phosphate can be transferred from a His-phosphorylation site to a receiver module (Appleby et al., 1996). FrzE in Myxococcus xanthus provides an interesting exception to this generality in that this hybrid kinase appears to be capable of carrying out effector functions without the help of a distinct RR (Ward and Zusman, 1997). Control Points Different two-component systems appear to control RR phosphorylation levels via somewhat distinct mechanisms. For example, in response to a stimulus some systems alter RR-phosphorylation levels by controlling the rate of HPK autophosphorylation (Borkovich and Simon, 1990), whereas in other systems it is the phosphatase activity of the HPK or an additional component that is regulated in response to a stimulus (Atkinson et al., 1994; Perego and Hoch, 1996). This diversity underscores the impressive flexibility of two-component circuitry; it can be modified to operate in a variety of different contexts using different aspects of the basic protein structures of receiver and transmitter modules and the basic biochemistry of the phosphorylation/dephosphorylation chemistry. Science by Analogy: Proceed with Caution Several HPK-RR pairs have been subjected to extensive random and site-directed mutagenesis. The resulting mutants have helped to define functionally important positions within the respective transmitter and receiver modules of each HPK-RR pair. It seems reasonable to expect that such positions identified in one system would also play important roles in other two-component systems, and that mutations at such sites could be useful starting points for analyzing newly discovered two-component systems. In practice, however, such an approach has not been very successful. For mutation sites that are outside of the immediate vicinity of the active sites of HPKs and RRs, there are numerous examples of mutations that have a strong phenotype in one system but not in another (Parkinson and Kofoid, 1992; Stock et al., 1995). Results obtained with the HPK homolog SpoIIAB in Bacillus subtilis further underscore the need for caution when using sequence homology information to make predictions about function or mechanism: SpoIIAB actually operates as a Ser protein kinase, phosphorylating another protein (SpoIIAA) without any involvement of the His-Asp phosphorelay that is the hallmark of traditional two-component systems (Min et al., 1993). EUKARYOTIC TWO-COMPONENT SYSTEMS Members of the two-component family are now starting to be found with increasing frequency in eukaryotes, suggesting that the basic His-to-Asp phosphotransfer mechanism is employed by a variety of eukaryotic sensory-response pathways (Loomis et al., 1997;Wurgler-Murphy and Saito, 1997). A number of genes encoding HPKs, hybrid HPKs, and RRs have been reported in yeasts (S. cerevisiae, Schizosaccharomycespombe, andCandida albicans), in the slime mold Dictyostelium discoideum, in Neurospora crassa, and in higher plants (e.g. Brown et al., 1993; Chang et al., 1993; Ota and Varshavsky, 1993;Wilkinson et al., 1995; Alex et al., 1996; Kakimoto, 1996; Posas et al., 1996; Schuster et al., 1996; Shaulsky et al., 1996; Wang et al., 1996; Sakakibara et al., 1998). In all but a few cases, the designation of a component as an HPK or an RR has been based exclusively on sequence similarities to known bacterial HPKs and RRs. One of the tacit assumptions in making such assignments is that “if it looks like a duck, it will quack like a duck.” However, we really know very little concerning the input stimuli, output activities, biochemical properties, and signaling activities of most eukaryotic HPKs and RRs. Such information will provide much-needed tests of whether each of these HPK and RR “look-alikes” operate biochemically in the same manner as the well-characterized bacterial proteins. In this regard, we point out that in addition to SpoIIAB (the B. subtilis HPK “look-alike” mentioned above), there is a family of mitochondrial protein kinases that has sequence similarity to HPKs, but that actually functions as Ser/Thr kinases (Popov et al., 1993). Mindful that the “logic of the duck” can lead to a certain amount of egg-laying, we note here that there do seem to be some general trends emerging in eukaryotic two-component systems. First, amino acid sequence similarities shared by any two eukaryotic two-component regulators are about the same as those shared by any two bacterial regulators or any eukaryotic-bacterial comparison. Second, arrangements of the protein modules in eukaryotic two-component systems are similar to those encountered in prokaryotes. Third, prokaryotic and eukaryotic two-component systems may respond to the same or similar signals. For example, the two-component system is known to play an important role in controlling responses to osmotic stress in bacteria (Pratt and Silhavy, 1995), in the budding yeast S. cerevisiae (Posas et al., 1996), in the fission yeast S. pombe (Shieh et al., 1997), and in the slime mold D. discoideum (Schuster et al., 1996). In addition, an HPK in D. discoideum regulates gene expression in prestalk cells and controls terminal differentiation of prespore cells (Wang et al., 1996) in a manner that generally resembles the two-component pathway controlling sporulation in the bacteriumB. subtilis (Hoch, 1995). Fourth, several eukaryotic two-component systems appear to regulate extended downstream effector cascades; that is, the two-component system may comprise only the upstream portion of a more extensive signaling pathway. This situation represents a clear difference from most prokaryotic two-component systems, in which the HPK-RR circuit comprises most or all of the sensory-response pathway, with the RR components serving as the end-of-the-line effectors. Several eukaryotic two-component pathways, including their output activities, are outlined in TableI. Table I. Some of the known eukaryotic two-component systems and their output activities Organism . Probable Signal . Pathway . Output Signaling . References . Hybrid HPK (His→Asp) . . RR (→Asp) . S. cerevisiae Osmolarity SLN1   YPD1 (→His) SSK1 MAPK cascade Maeda et al. (1994); Posas et al. (1996) S. pombe Various stresses ? MCS4 MAPK cascade Shieh et al. (1997) A. thaliana Ethylene ETR1  ? MAPK cascade (?) Chang et al. (1993); Hua et al. (1995); Hua et al. (1997) ERS-a ? MAPK cascade (?) ETR2  ? MAPK cascade (?) EIN4   ? MAPK cascade (?) D. discoideum Osmolarity DOKA ? Cytoskeletal alteration (?) Schuster et al. (1996) Secreted peptide DHKA REGA cAMP-dependent protein kinase activity Wang et al. (1996); Shaulsky et al. (1996); Shaulsky et al. (1998) Organism . Probable Signal . Pathway . Output Signaling . References . Hybrid HPK (His→Asp) . . RR (→Asp) . S. cerevisiae Osmolarity SLN1   YPD1 (→His) SSK1 MAPK cascade Maeda et al. (1994); Posas et al. (1996) S. pombe Various stresses ? MCS4 MAPK cascade Shieh et al. (1997) A. thaliana Ethylene ETR1  ? MAPK cascade (?) Chang et al. (1993); Hua et al. (1995); Hua et al. (1997) ERS-a ? MAPK cascade (?) ETR2  ? MAPK cascade (?) EIN4   ? MAPK cascade (?) D. discoideum Osmolarity DOKA ? Cytoskeletal alteration (?) Schuster et al. (1996) Secreted peptide DHKA REGA cAMP-dependent protein kinase activity Wang et al. (1996); Shaulsky et al. (1996); Shaulsky et al. (1998) F0-a A typical (not a hybrid) HPK. Open in new tab Table I. Some of the known eukaryotic two-component systems and their output activities Organism . Probable Signal . Pathway . Output Signaling . References . Hybrid HPK (His→Asp) . . RR (→Asp) . S. cerevisiae Osmolarity SLN1   YPD1 (→His) SSK1 MAPK cascade Maeda et al. (1994); Posas et al. (1996) S. pombe Various stresses ? MCS4 MAPK cascade Shieh et al. (1997) A. thaliana Ethylene ETR1  ? MAPK cascade (?) Chang et al. (1993); Hua et al. (1995); Hua et al. (1997) ERS-a ? MAPK cascade (?) ETR2  ? MAPK cascade (?) EIN4   ? MAPK cascade (?) D. discoideum Osmolarity DOKA ? Cytoskeletal alteration (?) Schuster et al. (1996) Secreted peptide DHKA REGA cAMP-dependent protein kinase activity Wang et al. (1996); Shaulsky et al. (1996); Shaulsky et al. (1998) Organism . Probable Signal . Pathway . Output Signaling . References . Hybrid HPK (His→Asp) . . RR (→Asp) . S. cerevisiae Osmolarity SLN1   YPD1 (→His) SSK1 MAPK cascade Maeda et al. (1994); Posas et al. (1996) S. pombe Various stresses ? MCS4 MAPK cascade Shieh et al. (1997) A. thaliana Ethylene ETR1  ? MAPK cascade (?) Chang et al. (1993); Hua et al. (1995); Hua et al. (1997) ERS-a ? MAPK cascade (?) ETR2  ? MAPK cascade (?) EIN4   ? MAPK cascade (?) D. discoideum Osmolarity DOKA ? Cytoskeletal alteration (?) Schuster et al. (1996) Secreted peptide DHKA REGA cAMP-dependent protein kinase activity Wang et al. (1996); Shaulsky et al. (1996); Shaulsky et al. (1998) F0-a A typical (not a hybrid) HPK. Open in new tab TWO-COMPONENT REGULATORS IN HIGHER PLANTS Receptors for Ethylene In the ethylene signal transduction pathway of Arabidopsis there are at least four related HPK genes, ETR1, ERS,ETR2, and EIN4, which are thought to encode ethylene receptors (Chang et al., 1993; Hua et al., 1995, 1997;Schaller and Bleecker, 1995). Their predicted protein sequences are most similar to one another in the amino-terminal “sensory input” module (67–82% amino acid similarity). For ETR1, this region was shown to bind ethylene in a reversible and saturable manner, providing compelling evidence that ETR1 is an ethylene receptor (Schaller and Bleecker, 1995). It seems likely that ERS, ETR2, and EIN4 will also be found to bind ethylene, based on their sequence similarities with ETR1 as well as their similar ethylene-insensitive mutant phenotypes. The carboxyl-terminal portion of each of these ethylene receptors contains a putative HPK transmitter module. ETR1, ETR2, and EIN4 also have a carboxyl-terminal receiver module fused to the transmitter. Thus, ETR1, ETR2, and EIN4 have adopted the hybrid HPK arrangement, whereas ERS has the appearance of a typical HPK. The ETR2 sequence is the most diverged from the bacterial HPK consensus sequences, lacking, for example, the conserved His autophosphorylation site (Hua et al., 1997). Although RRs would be the predicted effectors for the ethylene receptors, there is currently no evidence that RRs function in ethylene signal transduction. Notably, all of the mutants that have been isolated for each of the Arabidopsis ethylene-receptor genes are dominant to the wild type and display ethylene insensitivity. Moreover, all of the mutations that have been identified are located within one of three hydrophobic regions in the amino-terminal ethylene-binding region. It is possible that recessive loss-of-function mutations, including those that would fall within the transmitter or receiver modules, have not been isolated due to the redundancy of the ethylene receptors. Indeed, there is evidence (from intragenic suppressor mutations of the dominant mutantetr1 gene) that null etr1 mutants have a wild-type phenotype (Hua et al., 1997). It is unclear why plants have multiple receptors for ethylene. Conceivably, the different receptors have tissue- or stage-specific functions (partially redundant) or act together as a hetero-multimeric receptor complex. A similar family of two-component ethylene receptors exists in tomato (Wilkinson et al., 1995; Yen et al., 1995; Zhou et al., 1996), and one of these homologs was identified as the gene for Never-Ripe (Wilkinson et al., 1995). Never-Ripe mutants have a dominant ethylene-insensitive phenotype, which includes a severe delay in fruit ripening (Yen et al., 1995). Cytokinin Signaling Recently, another two-component gene, CKI1, was identified in Arabidopsis. The CKI1 gene was isolated from an enhancer-tagged line on the basis of cytokinin-independent hypocotyl growth (Kakimoto, 1996). This particular phenotype suggests that a two-component system might be involved in cytokinin signal transduction. CKI1 encodes a hybrid HPK comprised of a unique amino-terminal domain followed by a transmitter domain and a receiver domain. The amino-terminal portion of CKI1 (the presumed sensory-input module) has no sequence similarity to that of the ethylene-receptor family, and one attractive hypothesis is that CKI1 serves as a receptor for cytokinin. In maize there is an RR gene that might be involved in cytokinin-mediated nitrogen signaling from root to shoot; expression of this RR gene was induced by nanomolar concentrations of t-zeatin in detached maize leaves (Sakakibara et al., 1998). Clues to Plant Phytochrome Action The mechanism of plant phytochrome signaling has long remained elusive. One suggested mechanism is Ser protein kinase activity, but this has not been firmly established (Quail, 1997). In 1991, Schneider-Poetsch noted limited but discernable sequence similarity (roughly 25% identity) between bacterial HPKs and the carboxyl-terminal portion of plant phytochromes, leading to the proposal that phytochrome action might involve a two-component mechanism (Schneider-Poetsch et al., 1991). Currently, there is no evidence that plant phytochromes possess such activity; however, recent work in cyanobacteria strongly suggests that higher plant phytochromes are at least derived from an ancestral HPK-RR system. The strongest evidence comes from studies on the cyanobacterial Synechocystis cph1 gene, which codes for a spectrally functional phytochrome (the only such protein currently known in prokaryotes) (Hughes et al., 1997; Yeh et al., 1997). The cph1 gene product is a two-component sensor that possesses light-responsive His autokinase activity (Yeh et al., 1997). The amino-terminal domain of Cph1 has sequence similarity to plant phytochromes and is capable of binding chromophores and of undergoing red/far-red light-induced reversible absorbance changes (Hughes et al., 1997; Yeh et al., 1997). Moreover, the phosphate on Cph1 is transferred from the His to an Asp residue in the separate RR Rcp1 (Yeh et al., 1997). Cph1 and Rcp1 thus form a light-regulated two-component system, which has implications for the activity of phytochromes in higher plants. His autokinase activity is exhibited by the Pr form of Cph1 rather than by the Pfr form, even though Pfr is normally thought of as the light-activated form; this suggests that the dark (Pr) form is the active form of phytochrome and that red light reduces or shuts off its activity. Another light-responsive two-component system is the rcaE gene product from the cyanobacterium Fremyella diplosiphon. RcaE appears to be a sensor for chromatic adaptation. The amino-terminal portion of RcaE has small regions of sequence similarity to plant phytochromes and even to plant ethylene receptors (Kehoe and Grossman, 1996). RcaC is a response regulator that might act downstream of RcaE in regulating light responses in F. diplosiphon(Kehoe and Grossman, 1996). DIVERSITY IN SIGNALING OUTPUT As we have discussed, in most prokaryotic two-component systems, a membrane-associated HPK directs the activity of an RR that functions as a transcription factor. Thus, the typical output of the prokaryotic HPK-RR circuit is direct control of gene expression. What about the immediate output activity of two-component systems in eukaryotes? So far, only S. cerevisiae RR Skn7 appears to fit the “classic” prokaryotic model, operating as a transcription factor (Brown et al., 1994). However, even with Skn7 there are indications of intriguing complexities such as regulation by multiple sensory inputs (Brown et al., 1994; Page et al., 1996) and involvement in a diversity of processes ranging from cell wall biosynthesis (Brown et al., 1993) to oxidative stress responses (Krems et al., 1996; Morgan et al., 1997) and even G1 cyclin expression (Morgan et al., 1995). None of the other known eukaryotic RRs resembles a transcription factor, and none of the known eukaryotic HPK proteins appears to contain an output module. Based on the few available examples (described below), the trend in eukaryotes is that the immediate/direct output activities of two-component systems lie farther upstream of the ultimate regulators of gene expression (Table I). MAPK Cascades In three different pathways, the identification of downstream signaling elements has revealed coupling of the two-component system with the distinctly eukaryotic MAPK cascade. This is a new twist on the two-component system, as bacteria are not known to contain MAPK cascades. This also represents a new type of regulation of these cascades, which are more typically known to be regulated by upstream Tyr kinase receptors or seven-transmembrane (G-protein-coupled) receptors (Blumer and Johnson, 1994). The most established example of two-component regulation of a MAPK cascade is the S. cerevisiae osmolarity-response pathway, which controls adaptive responses to high osmolarity. The pathway involves a multistep phosphorelay from His to Asp to His to Asp residues (Posas et al., 1996). This multistep phosphorelay system can be found with slight variations in several bacterial two-component pathways such as that shown in Figure 2C (Appleby et al., 1996). In the yeast osmolarity-response pathway, the phosphorelay begins with a hybrid HPK, SLN1, which is considered to be a transmembrane osmosensor. SLN1 is thought to undergo His autophosphorylation in low-osmolarity conditions (Maeda et al., 1994). Similar to theSynechocystis Cph1 phytochrome, SLN1 has His autokinase activity in the absence of the apparent signal (high osmolarity), suggesting that the SLN1 HPK is inactivated by the signal. In the next step of the phosphorelay, the phosphate is transferred from the His to an Asp in the SLN1 receiver module. The phosphate is then transferred to a His residue on a small intermediary protein called YPD1, and finally the phosphate is transferred to an Asp residue on a separate RR called SSK1 (Posas et al., 1996). Such an elaboration on the basic two-component system may allow for additional regulation, including the integration of different signals. The output activity of SSK1 is the regulation of a MAPK cascade (Maeda et al., 1994, 1995). Under low-osmolarity conditions, the phosphorylation described above renders SSK1 inactive; under high-osmolarity conditions, SSK1 is unphosphorylated and activates two redundant MAPKKKs, SSK2 and SSK22. SSK1 is known to physically interact with the regulatory domains of both of these MAPKKKs, although the mechanism of stimulation is unclear. Next, SSK2 and SSK22 activate the MAPKK PBS2, which in turn activates the MAPK HOG1. The action of this MAPK pathway results in the expression of GPD1, which encodes a key enzyme in glycerol biosynthesis, leading to adaptive responses to high osmolarity (Wurgler-Murphy and Saito, 1997). In S. pombe, a similar story is unfolding for a MAPK pathway that is activated by a range of stresses, including osmotic stress, oxidative stress, UV light, heat shock, and the protein-synthesis inhibitor anisomycin. This MAPK pathway, comprised of Wak1 (MAPKKK), Wis1 (MAPKK), and StyI (MAPK), was found to regulated by an RR, Mcs4 (Shieh et al., 1997). Msc4 and Wak1 are structurally and functionally homologous to the SSK1 RR and the SSK2/SSK22 MAPKKKs, respectively. These parallels with the S. cerevisiaeosmolarity-response pathway suggest that there may be one or more two-component sensors controlling the S. pombe pathway. In addition to this stress-activated pathway, Mcs4 controls the timing of mitotic initiation via an StyI-independent pathway that has yet to be defined (Shieh et al., 1997). Another example of possible two-component regulation of the MAPK pathway is the Arabidopsis ethylene-response pathway. Based on genetic-epistasis analysis, the ethylene receptors act upstream of CTR1. CTR1 is a negative regulator of ethylene responses and encodes a Ser/Thr protein kinase most similar to the Raf family of MAPKKKs (Kieber et al., 1993). Thus, it is likely that the ethylene-response pathway contains a MAPK cascade controlled by the two-component ethylene receptors. So far, a MAPKK and MAPK for this pathway have not been conclusively identified. There is evidence that the putative regulatory domain of CTR1 can physically associate with the transmitter domains of ETR1 and ERS, as well as with the receiver domain of ETR1, raising the possibility that the regulation of CTR1 activity involves direct interaction of CTR1 with the receptors (Clark et al., 1998). It remains to be seen whether the receptors provide direct “output” to CTR1 or whether additional two-component proteins such as RRs are involved. However, in view of the remarkable adaptability of the basic two-component elements, it would not be surprising if ethylene signal transduction reveals yet another variation on two-component signaling pathways. Other Pathways Given the above examples of MAPK regulation by eukaryotic two-component systems, it is important to point out that this is not always the case and may not even be a common situation. Other familiar eukaryotic signaling cascades may also be regulated by two-component systems. For example, the DhkA-RegA two-component system in the slime mold D. discoideum regulates cAMP phosphodiesterase activity of RR RegA (Shaulsky et al., 1998). Adjustments of cAMP levels via DhkA-RegA are responsible for controlling the activity of a cAMP-dependent protein kinase, which plays a key role in controlling the complex morphogenetic events that result in sporulation (Shaulsky et al., 1996, 1998). Another two-component system that points to diversity in signaling output is the osmotic-response system ofD. discoideum. In this system, the hybrid HPK DokA may regulate events that are quite different from those described above for the yeast osmosensor SLN1. This slime mold does not appear to cope with conditions of high osmolarity by accumulating compatible osmolytes such as glycerol, but by events involving the cytoskeleton (Schuster et al., 1996). The pathway linking DokA to such events remains to be determined, but may provide yet another example of the diversity of signaling output regulated by two-component systems in eukaryotes. SUMMARY The basic two-component system involves two large families of signaling modules that build upon a His-to-Asp phosphotransfer theme. Bacteria display numerous variations on this theme, illustrating the flexibility of the system. There is growing evidence, including a number of unpublished reports, that two-component regulators and distant relatives play important sensory-response roles in eukaryotes. These eukaryotic systems reveal further diversification of the two-component-based circuitry, most notably in the regulation of MAPK modules. Although quite a lot has been learned about how two-component systems operate, there remain numerous fundamental questions in both eukaryotic and prokaryotic systems; for example: How is HPK activity regulated by sensory input? What is the nature of the structural change resulting from receiver module phosphorylation, and how does this change result in the activation/deactivation of output activity? Are there “one-component” systems in which an “orphan” receiver module or transmitter module operates without a partner? In cells containing multiple two-component systems that respond to different stimuli, how is specificity maintained so as to minimize inappropriate “cross-talk”? Are there examples of two-component systems in which the transmitter and receiver modules direct protein-protein interactions but do not involve protein phosphorylation? As more and more two-component systems are discovered, and as the number of researchers in this field grows, we look forward to the resolution of these issues, as well as to further surprises from these versatile signaling modules. Abbreviations: HPK His protein kinase MAP mitogen-activated protein MAPK MAP kinase NR nitrogen regulatory protein RR response-regulator protein LITERATURE CITED 1 Alex LA Borkovich KA Simon MI Hyphal development in Neurospora crassa: involvement of a two-component histidine kinase. Proc Natl Acad Sci USA 93 1996 3416 3421 Google Scholar Crossref Search ADS PubMed WorldCat 2 Appleby JL Parkinson JS Bourret RB Signal transduction via the multi-step phosphorelay: not necessarily a road less traveled. Cell 86 1996 845 848 Google Scholar Crossref Search ADS PubMed WorldCat 3 Atkinson MR Kamberov ES Weiss RL Ninfa AJ PII signal transduction protein regulates its ability to stimulate the dephosphorylation of the transcription factor nitrogen regulator I (NRI or NtrC) J Biol Chem 269 1994 28288 28293 4 Avruch J Zhang X-F Kyriakis JM Raf meets Ras: completing the framework of a signal transduction pathway. Trends Biochem Sci 19 1994 279 283 Google Scholar Crossref Search ADS PubMed WorldCat 5 Baikalov I Schroder I Kaczor-Grzeskowiak M Gresckowiak K Gunsalus RP Dickerson RE Structure of the Escherichia coli response regulator NarL. Biochemistry 35 1996 11053 11061 Google Scholar Crossref Search ADS PubMed WorldCat 6 Blumer KJ Johnson GL Diversity in function and regulation of MAP kinase pathways. Trends Biochem Sci 19 1994 236 240 Google Scholar Crossref Search ADS PubMed WorldCat 7 Borkovich KA Simon MI The dynamics of protein phosphorylation in bacterial chemotaxis. Cell 63 1990 1339 1348 Google Scholar Crossref Search ADS PubMed WorldCat 8 Bourret RB Borkovich KA Simon MI Signal transduction pathways involving protein phosphorylation in prokaryotes. Annu Rev Biochem 60 1991 401 441 Google Scholar Crossref Search ADS PubMed WorldCat 9 Brown JL Bussey H Stewart RC Yeast Skn7p functions in a eukaryotic two-component regulatory pathway. EMBO J 13 1994 5186 5194 Google Scholar Crossref Search ADS PubMed WorldCat 10 Brown JL North S Bussey H SKN7, a yeast multicopy suppressor of a mutation affecting cell wall β-glucan assembly, encodes a product with domains homologous to prokaryotic two-component regulators and to heat shock transcription factors. J Bacteriol 175 1993 6908 6915 Google Scholar Crossref Search ADS PubMed WorldCat 11 Chang C Kwok SF Bleecker AB Meyerowitz EM Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators. Science 262 1993 539 544 Google Scholar Crossref Search ADS PubMed WorldCat 12 Clark KL Larsen PB Wang X Chang C Association of the Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS ethylene receptors. Proc Natl Acad Sci USA 95 1998 5401 5406 Google Scholar Crossref Search ADS PubMed WorldCat 13 Drummond MH Contreras A Mitchenall LA Mol Microbiol 4 1990 29 37 Crossref Search ADS PubMed 14 Feher VA Zapf JW Hoch JA Whiteley JM McIntosh LP Rance M Skelton NJ Dahlquist FW Cavanagh J High-resolution NMR structure and backbone dynamics of the Bacillus subtilis response regulator, Spo0F: implications for phosphorylation and molecular recognition. Biochemistry 36 1997 10015 25 Google Scholar Crossref Search ADS PubMed WorldCat 15 Hakenbeck R Stock JB Analysis of two-component signal transduction systems involved in transcriptional regulation. Methods Enzymol 273 1996 281 300 Google Scholar Crossref Search ADS PubMed WorldCat 16 Hoch JA (1995) Control of cellular development in sporulating bacteria by the phosphorelay two-component signal transduction system.In J Hoch, T Silhavy, eds, Two-Component Signal Transduction. ASM Press, Washington, DC, pp 129–144 17 Hoch JA, Silhavy TJ (1995) Two-Component Signal Transduction. ASM Press, Washington, DC 18 Hsing W Silhavy TJ Function of conserved histidine-243 in phosphatase activity of EnvZ, the sensor for porin osmoregulation in Escherichia coli. J Bacteriol 179 1997 3729 3735 Google Scholar Crossref Search ADS PubMed WorldCat 19 Hua J Chang C Sun Q Meyerowitz EM Ethylene insensitivity conferred by Arabidopsis ERS gene. Science 269 1995 1712 1714 Google Scholar Crossref Search ADS PubMed WorldCat 20 Hua J, Sakai H, Meyerowitz EM (1997) The ethylene receptor gene family in Arabidopsis. In AK Kanellis, C Chang, H Kende, D Grierson, eds, Biology and Biotechnology of the Plant Hormone Ethylene. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp 71–76 21 Hughes J Lamparter T Mittman F Hartmann E Gärtner W Wilde A Börner T A prokaryotic phytochrome. Nature 386 1997 663 Google Scholar Crossref Search ADS PubMed WorldCat 22 Igo M Ninfa AJ Stock JB Silhavy TJ Phosphorylation and dephosphorylation of a bacterial transcriptional activator by a transmembrane receptor. Genes Dev 3 1989 1725 1734 Google Scholar Crossref Search ADS PubMed WorldCat 23 Kahn D Ditta G Modular structure of FixJ: homology of the transcriptional activator domain with the −35 binding domain of sigma factors. Mol Microbiol 5 1991 987 997 Google Scholar Crossref Search ADS PubMed WorldCat 24 Kakimoto T CKI1, a histidine kinase homolog implicated in cytokinin signal transduction. Science 274 1996 982 985 Google Scholar Crossref Search ADS PubMed WorldCat 25 Kehoe DM Grossman AR Similarity of chromatic adaptation sensor to phytochrome and ethylene receptors. Science 273 1996 1409 1412 Google Scholar Crossref Search ADS PubMed WorldCat 26 Kieber JJ Rothenberg M Roman G Feldmann KA Ecker JR CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72 1993 427 441 Google Scholar Crossref Search ADS PubMed WorldCat 27 Krems B Charizanis C Entian K-D The response regulator-like protein Pos9/Skn7 of Saccharomyces cerevisiae is involved in oxidative stress response. Curr Genet 29 1996 327 334 Google Scholar Crossref Search ADS PubMed WorldCat 28 Loomis WF Shaulsky G Wang N Histidine kinases in signal transduction pathways of eukaryotes. J Cell Sci 110 1997 1141 1145 Google Scholar PubMed OpenURL Placeholder Text WorldCat 29 Lowry DF Roth AF Rupert PB Dahlquist FW Moy FJ Domaille PJ Matsumura P Signal transduction in chemotaxis: a propagating conformational change upon phosphorylation of CheY. J Biol Chem 269 1994 26358 26362 Google Scholar Crossref Search ADS PubMed WorldCat 30 Lupas A Stock JB Phosphorylation of an N-terminal regulatory domain activates the CheB methylesterase in bacterial chemotaxis. J Biol Chem 264 1989 17337 17342 Google Scholar Crossref Search ADS PubMed WorldCat 31 Maeda T Takekawa M Saito H Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH3-containing osmosensor. Science 269 1995 554 558 Google Scholar Crossref Search ADS PubMed WorldCat 32 Maeda T Wurgler-Murphy SM Saito H A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369 1994 242 245 Google Scholar Crossref Search ADS PubMed WorldCat 33 Makino K Shinagawa H Amamura M Kawamoto T Yamada M Nakata A Signal transduction in the phosphate regulon of Escherichia coli involves phosphotransfer between PhoR and PhoB proteins. J Mol Biol 210 1989 551 559 Google Scholar Crossref Search ADS PubMed WorldCat 34 Min K-T Hilditch CM Diederich B Errington J Yudkin MD ςF, the first compartment-specific transcription factor of B. subtilis, is regulated by an anti-ς factor that is also a protein kinase. Cell 74 1993 735 742 Google Scholar Crossref Search ADS PubMed WorldCat 35 Morgan BA Banks GR Toone WM Raitt D Kuge S Johnson LH The Skn7 response regulator controls gene expression in the oxidative stress response of the budding yeast Saccharomyces cerevisiae. EMBO J 16 1997 1035 1044 Google Scholar Crossref Search ADS PubMed WorldCat 36 Morgan BA Bouquin N Merrill GF Johnston LH A yeast transcription factor bypassing the requirement for SBF and DSC1/MBF in budding yeast has homology to bacterial signal transduction proteins. EMBO J 14 1995 5679 5689 Google Scholar Crossref Search ADS PubMed WorldCat 37 Ninfa AJ Magasanik B Covalent modification of the glnG product, NRI, by the glnL product, NRII, regulates the transcription of the glnALG operon in Escherichia coli. Proc Natl Acad Sci USA 83 1986 5909 5913 Google Scholar Crossref Search ADS PubMed WorldCat 38 Nixon BT Ronson CW Ausubel FM Two-component regulatory systems responsive to environmental stimuli share strongly conserved domains with nitrogen assimilation regulatory genes ntrB and ntrC. Proc Natl Acad Sci USA 83 1986 7850 7854 Google Scholar Crossref Search ADS PubMed WorldCat 39 Ota IM Varshavsky A A yeast protein similar to bacterial two-component regulators. Science 262 1993 566 569 Google Scholar Crossref Search ADS PubMed WorldCat 40 Page N Sheraton J Brown JL Stewart RC Bussey H Identification of ASK10 as a multicopy activator of Skn7p-dependent transcription of a HIS3 reporter gene. Yeast 12 1996 267 272 Google Scholar Crossref Search ADS PubMed WorldCat 41 Parkinson JS Kofoid EC Communication modules in bacterial signaling proteins. Annu Rev Genet 26 1992 71 112 Google Scholar Crossref Search ADS PubMed WorldCat 42 Perego M Hoch JA Protein aspartate phosphatases control the output of two-component signal transduction systems. Trends Genet 12 1996 97 101 Google Scholar Crossref Search ADS PubMed WorldCat 43 Popov KM Kedishvili NY Zhao Y Shimomura Y Crabb DW Harris RA Primary structure of pyruvate dehydrogenase kinase establishes a new family of eukaryotic protein kinases. J Biol Chem 268 1993 26602 26606 Google Scholar Crossref Search ADS PubMed WorldCat 44 Posas F Wurgler-Murphy SM Maeda T Witten EA Thai TC Saito H Yeast HOG1 MAP kinase cascade is regulated by a multistep phosphorelay mechanisms in the SLN1-YPD1-SSK1 ‘two-component’ osmosensor. Cell 86 1996 865 875 Google Scholar Crossref Search ADS PubMed WorldCat 45 Pratt LA, Silhavy TJ (1995) Porin regulation of Escherichia coli. In J Hoch, T Silhavy, eds, Two-Component Signal Transduction. ASM Press, Washington, DC, pp 105–128 46 Pratt LA Silhavy TJ The response regulator SprE controls the stability of RpoS. Proc Natl Acad Sci USA 93 1996 2488 2492 Google Scholar Crossref Search ADS PubMed WorldCat 47 Quail PH The phytochromes: a biochemical mechanism of signaling in sight? Bioessays 19 1997 571 579 Google Scholar Crossref Search ADS PubMed WorldCat 48 Sakakibara H, Suzuki M, Takei K, Deji A, Taniguchi M, Sugiyama T(1998) A response-regulator homolog possibly involved in nitrogen signal transduction mediated by cytokinin in maize. Plant J (in press) 49 Schaller GE Bleecker AB Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR1 gene. Science 270 1995 1809 1811 Google Scholar Crossref Search ADS PubMed WorldCat 50 Schneider-Poetsch HAW Braun B Marx S Schaumburg A Phytochromes and bacterial sensor proteins are related by structural and functional homologies. FEBS Lett 281 1991 245 249 Google Scholar Crossref Search ADS PubMed WorldCat 51 Schuster SC Noegel AA Oehme F Gerisch G Simon MI The hybrid kinase DokA is part of the osmotic response system of Dictyostelium. EMBO J 15 1996 3880 3889 Google Scholar Crossref Search ADS PubMed WorldCat 52 Shaulsky G Escalante R Loomis WF Developmental signal transduction pathways uncovered by genetic suppressors. Proc Natl Acad Sci USA 93 1996 15260 15265 Google Scholar Crossref Search ADS PubMed WorldCat 53 Shaulsky G Fuller D Loomis WF A cAMP-phospho-diesterase controls PKA-dependent differentiation. Development 125 1998 691 699 Google Scholar PubMed OpenURL Placeholder Text WorldCat 54 Shieh J-C Wilkinson MG Buck W Morgan BA Makio K Millar JBA The Mcs4 response regulator coordinately controls the stress-activated Wak1-Wis1-Sty1 MAP kinase pathway and fission yeast cell cycle. Genes Dev 11 1997 1008 1022 Google Scholar Crossref Search ADS PubMed WorldCat 55 Stock AM Mottonen JM Stock JB Schutt CE Three-dimensional structure of CheY, the response regulator of bacterial chemotaxis. Nature 337 1989 745 749 Google Scholar Crossref Search ADS PubMed WorldCat 56 Stock JB Lukat GS Stock AM Bacterial chemotaxis and the molecular logic of intracellular signal transduction metworks. Annu Rev Biophys Biophys Chem 20 1991 109 136 Google Scholar Crossref Search ADS PubMed WorldCat 57 Stock JB Stock AM Mottonen JM Signal transduction in bacteria. Nature 344 1990 395 400 Google Scholar Crossref Search ADS PubMed WorldCat 58 Stock JB, Surette MG, Levit M, Park P (1995) Two-component signal transduction systems: structure-function relationships and mechanisms of catalysis. In J Hoch, T Silhavy, eds, Two-Component Signal Transduction. ASM Press, Washington, DC, pp 25–51 59 Tsuzuki M Aiba H Mizuno T Gene activation by the Escherichia coli positive regulator OmpR: phosphorylation-independent mechanism of activation by an OmpR mutant. J Mol Biol 242 1994 607 613 Google Scholar Crossref Search ADS PubMed WorldCat 60 Uhl MA Miller JF Integration of multiple domains in a two-component sensor protein: the Bordetella pertussis BvgAS phosphorelay. EMBO J 15 1996 1028 1036 Google Scholar Crossref Search ADS PubMed WorldCat 61 Volz K Structural conservation in the CheY superfamily. Biochemistry 32 1993 11741 11753 Google Scholar Crossref Search ADS PubMed WorldCat 62 Volz K Matsumura P Crystal structure of Escherichia coli CheY refined at 1.7-A resolution. J Biol Chem 266 1991 15511 15519 Google Scholar Crossref Search ADS PubMed WorldCat 63 Wang N Shaulsky G Escalante R Loomis WF A two component histidine kinase gene that functions in Dictyostelium development. EMBO J 15 1996 3890 3898 Google Scholar Crossref Search ADS PubMed WorldCat 64 Wanner BL (1994) Multiple controls of the Escherichia coli Pho regulon by the Pi sensor PhoR, the catabolite regulatory sensor CreC, and acetyl phosphate. In A Torriani-Gorini, E Yagil, S Silver, eds, Phosphate in Microorganisms: Cellular and Molecular Biology. ASM Press, Washington, DC, pp 12–21 65 Ward MJ Zusman DR Regulation of directed motility in Myxococcus xanthus. Mol Microbiol 24 1997 885 893 Google Scholar Crossref Search ADS PubMed WorldCat 66 Wilkinson JQ Lanahan MB Yen H-C Giovannoni JJ Klee HJ Science 270 1995 1807 1809 Crossref Search ADS PubMed 67 Wurgler-Murphy SM Saito H Two-component signal transducers and MAPK cascades. Trends Biochem Sci 22 1997 172 176 Google Scholar Crossref Search ADS PubMed WorldCat 68 Yeh K-C Wu S-H Murphy JT Lagarias JC A cyanobacterial phytochrome two-component light sensory system. Science 277 1997 1505 1508 Google Scholar Crossref Search ADS PubMed WorldCat 69 Yen H-C Lee S Tanksley SD Lanahan MB Klee HJ Giovannoni JJ The tomato Never-ripe locus regulates ethylene-inducible gene expression and is linked to a homolog of the Arabidopsis ETR1 gene. Plant Physiol 107 1995 1343 1353 Google Scholar Crossref Search ADS PubMed WorldCat 70 Zhou D Kalaitzis P Mattoo AK Tucker ML The mRNA for an ETR1 homologue in tomato is constitutively expressed in vegetative and reproductive tissues. Plant Mol Biol 30 1996 1331 1338 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 Supported by the U.S. Department of Agriculture National Research Initiative Competitive Grants Program (grant no. 95-37304-2218 to C.C.) and by Public Health Service (grant no. GM52583 to R.C.S.). * Corresponding author; e-mail [email protected]; fax 1–301–314–9082. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Drincovich, Maria F.; Casati, Paula; Andreo, Carlos S.; Chessin, Saul J.; Franceschi, Vincent R.; Edwards, Gerald E.; Ku, Maurice S.B.

doi: 10.1104/pp.117.3.733pmid: 9662516

Abstract NADP-malic enzyme (NADP-ME, EC 1.1.1.40), a key enzyme in C4 photosynthesis, provides CO2 to the bundle-sheath chloroplasts, where it is fixed by ribulose-1,5-bisphosphate carboxylase/oxygenase. We characterized the isoform pattern of NADP-ME in different photosynthetic species ofFlaveria (C3, C3-C4intermediate, C4-like, C4) based on sucrose density gradient centrifugation and isoelectric focusing of the native protein, western-blot analysis of the denatured protein, and in situ immunolocalization with antibody against the 62-kD C4 isoform of maize. A 72-kD isoform, present to varying degrees in all species examined, is predominant in leaves of C3Flaveria spp. and is also present in stem and root tissue. By immunolabeling, NADP-ME was found to be mostly localized in the upper palisade mesophyll chloroplasts of C3 photosynthetic tissue. Two other isoforms of the enzyme, with molecular masses of 62 and 64 kD, occur in leaves of certain intermediates having C4 cycle activity. The 62-kD isoform, which is the predominant highly active form in the C4species, is localized in bundle-sheath chloroplasts. AmongFlaveria spp. there is a 72-kD constitutive form, a 64-kD form that may have appeared during evolution of C4metabolism, and a 62-kD form that is necessary for the complete functioning of C4 photosynthesis. Most land plants use the C3 pathway for carbon fixation, in which each photosynthetic cell uses Rubisco to fix CO2 directly into C-3 compounds. In C4 plants, fully differentiated mesophyll and bundle-sheath cells cooperate to fix CO2 by the C4 pathway (Edwards and Walker, 1983; Hatch, 1987). In these plants, atmospheric CO2 is first incorporated into C-4 acids in the mesophyll cells, which are then transported to bundle-sheath cells, where they are decarboxylated and the released CO2 is incorporated into organic phosphate by the C3 cycle. The C4 system is more efficient under some environmental conditions due to CO2 being concentrated in bundle-sheath cells that suppresses the oxygenase activity of Rubisco and, thus, photorespiration. C3-C4 intermediate species are thought to represent a stage in the evolutionary transition from the C3 photosynthetic mechanism to C4 photosynthesis (Monson et al., 1984; Raws-thorne, 1992). In C3-C4 species, two mechanisms are proposed to account for the low apparent photorespiration (Monson et al., 1984; Rawsthorne, 1992). In all intermediates, Rubisco is found in both mesophyll and bundle-sheath cells. The mesophyll cells function as in C3plants in the fixation of atmospheric CO2 by RuBP carboxylase via the C3 pathway, and in the RuBP oxygenase reaction, which is the first step in generating C-2 compounds for the photosynthetic oxidation cycle. In one mechanism of reducing photorespiration that may be common to all intermediates, photorespiratory metabolites generated as a consequence of the RuBP oxygenase reaction in mesophyll cells, glycolate and Gly, are transported to bundle-sheath cells, metabolized through mitochondrial Gly decarboxylase, and the CO2 released is refixed by Rubisco in bundle-sheath chloroplasts. Through this means, reduced photorespiratory CO2 evolution occurs without the operation of a C4 cycle. In some intermediates, the operation of a limited C4cycle between the mesophyll and bundle-sheath cells contributes to the further reduction of photorespiration. These plants exhibit elevated activities and partial cellular compartmentation of key enzymes of C4 photosynthesis. The genus Flaveria contains not only C3 and C4 species, but also a number of C3-C4intermediates that have different capacities to reduce photorespiration by the above mechanisms (Ku et al., 1991). The C4Flaveria spp. have been classified as the NADP-ME subtype, since this is the major enzyme for decarboxylation of C4 acids (Ku et al., 1983). Full-length cDNA clones encoding the enzyme have been isolated from the C4 species Flaveria trinervia (Borsch and Westhoff, 1990) and the C3 speciesFlaveria pringlei (Lipka et al., 1994). Both cDNA clones encode proteins of 71 kD in size, which contain 7.9-kD putative transit peptide sequences for chloroplast targeting of the preproteins. The size of both mature proteins is about 62 kD. In addition, a partial cDNA clone has been reported for the C3-C4 intermediateFlaveria linearis (Rajeevan et al., 1991). Lipka et al. (1994) concluded that the gene encoding the C4NADP-ME isoform descended from a common ancestral gene already present in C3 species. More recently, Marshall et al. (1996) isolated three genomic clones of NADP-ME from the C4 species Flaveria bidentis and concluded from Southern-blot analysis and sequence comparison with NADP-ME cDNA clones from other plants that Flaveria spp. contain three and possibly four NADP-ME genes. They proposed that the NADP-ME gene family is more complex than previously thought; the two genomic clones characterized encode two highly similar forms of the enzyme, one being expressed in C4 photosynthetic tissue (Me1), whereas the other (Me2) appears to be constitutively expressed. Genomic Southern blotting with gene-specific probes showed that both Me1 and Me2are found in C3 and C4Flaveria spp., and it was suggested that the genes may have arisen by gene duplication in a common ancestral species. The sizes of proteins encoded by these two genes have not been determined (W.C. Taylor, personal communication). Since some evidence exists for a multigene family for NADP-ME in Flaveria spp., it is important to evaluate the presence of different isoforms that are produced in different photosynthetic types of Flaveria at the protein level, and their tissue- and cell-specific localization. In the present study we detected three isoforms of the enzyme in variousFlaveria spp. One of them, a 72-kD monomer, is found to be constitutively expressed in photosynthetic and nonphotosynthetic tissues of the different photosynthetic types examined, whereas two other isoforms, 64- and 62-kD monomers, are only abundant in photosynthetic tissue having partial or complete C4 photosynthesis. MATERIALS AND METHODS The species used in the study were Flaveria pringlei,Flaveria robusta, and Flaveria cronquistii(C3); Flaveria sonorensis,Flaveria oppositifolia, Flaveria angustifolia,Flaveria linearis, Flaveria floridana, andFlaveria ramosissima(C3-C4); Flaveria brownii and Flaveria vaginata(C4-like); and Flaveria bidentis andFlaveria trinervia (C4). The species were propagated vegetatively from shoot cuttings or germinated from seeds and grown in a compost:sand:perlite mixture (2:1:1, v/v). The plants were grown in a greenhouse at a 25/18°C day/night thermoperiod and a 13- to 16-h photoperiod. Maximum illumination on a clear day during the summer months provided a PPFD of 1750 μmol m−2 s−1.Supplemental light from metal-halide lamps provided a PPFD of 350 μmol m−2 s−1 on cloudy days. Plants were fertilized twice per week with Peter's fertilizer supplemented with micronutrients. The third and fourth pairs of leaves from the apex were used for protein preparations. Extraction and Assay of NADP-ME For assay of NADP-ME activity, leaves were excised during the middle of the light period, immediately plunged into liquid nitrogen, and ground to a fine powder using a chilled mortar and pestle. Extraction medium (50 mm Hepes-KOH, pH 7.5, 1 mm MgCl2, 1 mmMnCl2, 5 mm DTT, 2 mmPMSF, and 2% [w/v] insoluble PVP) was added (10 mL g−1 fresh weight) and grinding was continued until total maceration. Crude extracts were filtered through a layer of Miracloth (Calbiochem) and centrifuged at 15,000g for 5 min. The supernatant fluid was immediately desalted through a Sephadex G-25 column pre-equilibrated with the extraction medium without PVP. The desalted extracts were used for enzyme assay. NADP-ME was assayed spectrophotometrically at 30°C in a mixture containing 50 mm Tris-HCl, pH 8.0, 2.5 mm DTT, 20 mm MgCl2, 0.4 mm NADP, and 25 to 50 μL of enzyme extract. The reaction was initiated by adding 5 mm malate (pH 7.8), and the increase inA340 was recorded. Suc Density Gradient Centrifugation For experiments using Suc density centrifugation, leaf protein was extracted from F. cronquistii (9 g), F. brownii (5 g), F. ramosissima, and F. trinervia (both 2 g) as described above. Clarified extracts were obtained by centrifugation at 15,000g for 1 h. The supernatant fraction was brought to 80% saturation with ammonium sulfate at 4°C, stirred for 1 h, and recentrifuged for 15 min. The pellet was resuspended in 2 mL of extraction buffer without PVP and centrifuged at 15,000g for 10 min. The supernatant fluid was diluted with an equal volume of extraction buffer (minus PVP), and 2 mL was loaded onto a 35-mL 10 to 30% (w/v) linear Suc density gradient. The Suc gradient was prepared from 10 and 30% (w/v) stock solutions containing 25 mm Tris-HCl, pH 8.0, 5 mm DTT, 2.5 mm MgCl2, and 0.2 mmEDTA. The gradients were centrifuged at 110,000g for 40 h, and after centrifugation 1-mL fractions were collected and assayed for NADP-ME activity. Peak fractions were pooled for kinetic studies. Suc concentrations were determined using a refractometer. IEF and Activity Staining For IEF analysis of NADP-ME, leaf protein samples were prepared by grinding the tissue in 100 mm Tris-HCl, pH 7.0, 1 mm EDTA, 10 mm MgCl2, 10 mm 2-mercaptoethanol, 10% (v/v) glycerol, and 2 mm PMSF. Nondenaturing IEF was performed using a 5% (w/v) acrylamide gel with a pH range from 5.0 to 7.0 (samples were loaded on the surface of the gel using small pieces of filter paper). The gels were run for 3 h at 6°C (constant voltage of 0.6 kV) in a LKB 2117 Multiphor system. The pH gradient on the gels was determined by employing a surface pH electrode. NADP-ME on the gels was detected by incubating in a solution containing 50 mmTris-HCl, pH 7.5, 10 mml-malate, 10 mg of MgCl2, 0.5 mm NADP, 0.1 mg mL−1 nitroblue tetrazolium, and 5 μg mL−1 phenazine methosulfate at room temperature. SDS-PAGE and Immunoblotting For western immunoblot studies, total protein from the different tissues was extracted using a phenol extraction procedure according to the work of van Etten et al. (1979). The extraction buffer contained 0.7 m Suc, 0.5 m Tris, 30 mm HCl, 50 mm EDTA, 0.1 m KCl, 2% (v/v) 2-mercaptoethanol, 10% (w/v) insoluble PVP, 2 mm PMSF, and 10 μm leupeptin. After total maceration in extraction buffer, an equal volume of water-saturated phenol was added and mixed. Protein that partitioned to the phenol phase was separated from the aqueous phase by centrifugation and precipitated by methanol. Protein was dissolved in 0.25 m Tris-HCl, pH 7.5, 2% (w/v) SDS, 0.5% (v/v) 2-mercaptoethanol and boiled for 2 min prior to being loaded onto the gel. For analysis of protein samples by western blotting, 7.5 to 15% (w/v) linear gradient polyacrylamide gels containing SDS were used. After electrophoretic separation, proteins on the gels were electroblotted onto a nitrocellulose membrane for immunoblotting according to the work of Burnette (1981). Anti-maize 62-kD NADP-ME IgG (diluted 1:100), affinity-purified according to the method of Plaxton (1989), was used for detection (Maurino et al., 1996, 1997). Bound antibodies were visualized by linking to alkaline phosphatase-conjugated goat anti-rabbit IgG according to the manufacturer's instructions (Promega). The molecular masses of the polypeptides were estimated from a plot of the log of molecular mass of the prestained marker standards versus migration distance (a linear relationship). The markers and the samples were run on the same gel. For comparison of the relative abundance of different isoforms of NADP-ME among the Flaveria spp., western blots were scanned with a densitometer. The peak area for each form for a given species was determined and expressed as a percentage of the maximum of that isoform among the species examined. In Situ Immunolocalization Transmission Electron Microscopy Samples for microscopy were fixed for 12 to 24 h at 4°C in 2% (v/v) paraformaldehyde and 1.25% (v/v) glutaraldehyde in 50 mm Pipes buffer, pH 7.2. The samples were dehydrated with a graded ethanol series and embedded in London Resin White acrylic resin. Thin sections on uncoated nickel grids were incubated for 1 h in TBST (10 mm Tris-HCl, pH 7.2, 150 mm NaCl, and 0.1% [v/v] Tween 20 [v/v] plus 1% [w/v] BSA) to block nonspecific protein binding on the sections. The sections were then incubated for 16 h with either preimmune serum (without dilution) or affinity purified anti-maize leaf 62-kD NADP-ME IgG (1:10 dilution). After extensive washing with TBST/BSA, the sections were incubated for 1 h with protein A-gold (15 nm) (Amersham) diluted 1:100 with TBST/BSA. The sections were washed with TBST/BSA, TBST, and distilled water prior to poststaining with a 1:4 mixture of 1% (w/v) potassium permanganate and 2% (w/v) aqueous uranyl acetate. Light Microscopy Sections (1 μm thick) from the same samples prepared for transmission electron microscopy were dried onto gelatin-coated slides and blocked for 1 h with TBST/BSA. They were then incubated 16 h with the purified antibody or preimmune serum with TBST/BSA. The slides were washed and then treated for 1 h with protein A-gold. The sections were subsequently exposed to a silver enhancement reagent according to the manufacturer's directions (Amersham), stained with 1% (w/v) Safranin O, and photographed using an Aristoplan microscope (Leitz). Assays of Protein and Chlorophyll Protein concentration was determined by the method of Sedmak and Grossberg (1977) using BSA as a standard. Chlorophyll was determined after extraction in 96% (v/v) ethanol according to the method ofWintermans and De Mots (1965). RESULTS NADP-ME Activity in Leaves of Flaveria spp. Leaf extracts from Flaveria spp. representing the different photosynthetic types were assayed for NADP-ME activity. There was a progressive increase in activity from C3 to C3-C4, C4-like, and C4 with average values of 131, 188, 870, and 1224 μmol mg−1 chlorophyll h−1, respectively (data for individual species not shown). However, there was a range of activities among the intermediate species from C3-like values to higher values (ranging from 85–359 μmol mg−1 chlorophyll h−1). Among the C3-C4 intermediates having the lowest activity, F. sonorensis did not have a functional C4 cycle, and F. angustifolia andF. linearis had very low C4 cycle activity; the highest NADP-ME activity occurred in F. ramosissima, which had the highest degree of function of a limited C4 cycle in this photosynthetic group (Monson et al., 1986; Moore et al., 1987; Ku et al., 1991). The data, combined with that of Ku et al. (1991), show a clear relationship between the level of NADP-ME activity and other characters that define the degree of C4 photosynthesis in the differentFlaveria spp. Separation of NADP-ME by Suc Density Gradient Centrifugation A representative species of each photosynthetic type (C3, F. cronquistii; C3-C4,F. ramosissima; C4-like, F. brownii; and C4, F. trinervia) was used for separation of leaf-soluble protein on Suc density gradients and subsequent fractionation and assay of NADP-ME activity (Fig.1). After centrifugation, proteins with higher molecular masses resided at higher Suc densities. Although resolution of proteins with small differences in mass were limited by this technique, there was evidence for multiple forms of NADP-ME. In C3F. cronquistii, two peaks of NADP-ME activity appeared, with the higher mass form (peak fraction 19 at 19.5% Suc) being predominant compared with the lower- mass form (peak fraction 13 at about 16.5% Suc), whereas in C4F. trinervia there was a major lower-mass form (peak fraction 12 at about 16.5% Suc) and a small shoulder of activity appearing at a higher density. In the C3-C4F. ramosissima,there was evidence for two dominant forms (around 19.5 and 16.5% Suc), whereas in the C4-like species F. brownii, only one major peak was apparent, with maximum activity occurring in fraction 15 (17.5% Suc). These results suggest that isoforms of NADP-ME with different molecular masses likely exist among the Flaveria spp., and that the relative abundance of the isoforms may vary between the different photosynthetic types. Fig. 1. Open in new tabDownload slide Resolution of leaf NADP-ME from representative species of different photosynthetic types of Flaveriaspp. by Suc density gradient centrifugation. A, F. cronquistii (C3); B, F. ramosissima(C3-C4); C, F. brownii(C4-like); and D, F. trinervia(C4). The activity of NADP-ME (•) is shown on the lefty-axes and the percent Suc in the gradient (Δ) is shown on the right y-axes. Fig. 1. Open in new tabDownload slide Resolution of leaf NADP-ME from representative species of different photosynthetic types of Flaveriaspp. by Suc density gradient centrifugation. A, F. cronquistii (C3); B, F. ramosissima(C3-C4); C, F. brownii(C4-like); and D, F. trinervia(C4). The activity of NADP-ME (•) is shown on the lefty-axes and the percent Suc in the gradient (Δ) is shown on the right y-axes. Km for NADP and malate as substrates for NADP-ME were determined on selected gradient fractions for the various species. The most apparent differences were in theKm for NADP. The higher-mass forms ofF. cronquistii and F. ramosissima hadKm values for NADP (average of two replications) of 150 and 110 μm, respectively (from fractions 18–22), whereas the lower-mass forms hadKm values of 11 and 20 μm, respectively (from fractions 12–14). The major lower-mass form inF. trinervia (from fractions 11–13) had aKm value of 35 μm compared with a value of 45 μm for F. brownii (from fractions 14–16). Although detailed analyses of purified isoforms are needed, these results further implicate the existence of different forms of NADP-ME in Flaveria spp., since the peak fractions at different densities exhibit different apparent affinities for NADP and possibly malate. Immunoblot Analysis of NADP-ME in Different Flaveria spp. Total proteins from leaves of 13 species ofFlaveria were extracted by a phenol procedure in the presence of two proteinase inhibitors and a sulfhydryl reagent to minimize proteolytic cleavage during preparation. These protein extracts were electrophoretically separated in SDS gels, transferred onto nitrocelluose membranes, and probed with affinity-purified antibody prepared against NADP-ME from maize leaves. The maize NADP-ME purified from green leaves is specific for C4photosynthesis and has a molecular mass of 62 kD (Maurino et al., 1996). This antibody reacts against the photosynthetic isoform of NADP-ME (62-kD monomeric molecular mass) and a nonphotosynthetic isoform (72-kD monomeric molecular mass) present in green and etiolated maize leaves, in maize roots, and in C3 plants such as wheat (Maurino et al., 1996, 1997). The results with Flaveria spp. show that the antibody reacts with up to three different monomeric molecular forms of NADP-ME in the different species examined (Fig. 2). In the three C3 species, a major reactive band of 72 kD was present (Fig. 2, lanes 12–14). These species have non-Kranz leaf anatomy and are classified as C3 plants based on a number of physiological and biochemical criteria related to photosynthesis (Powell, 1978; Ku et al., 1983; Edwards and Ku, 1987). In the C3-C4 intermediateFlaveria spp., the antibody reacted with one to three different molecular mass monomers of 72, 64, and 62 kD, which was species dependent, with all species having a 72-kD isoform. In the case of F. sonorensis, the only reactive band was at 72 kD (Fig.2, lane 6). This plant has low apparent photorespiration without C4 photosynthesis, and Rubisco and the C3 pathway are considered to function in mesophyll cells in the same way as in C3 plants, with refixation of photorespired CO2 by Rubisco in bundle-sheath cells (Ku et al., 1991). The other five C3-C4 intermediate plants that exhibit a varying capacity for C4photosynthesis (Ku et al., 1991) have in addition to the 72-kD form of the enzyme, a 62- and/or a 64-kD reactive form. F. angustifolia (Fig. 2, lane 8) had the 72- and 62-kD forms. All three forms, 72, 64, and 62 kD, are apparent in F. oppositifolia (Fig. 2, lane 7), F. floridana (Fig. 2, lane 10), and F. linearis (Fig. 2, lane 11). F. ramosissima expressed the 72- and the 64-kD forms, with a low level of the 62-kD form (Fig. 2, lane 9). Fig. 2. Open in new tabDownload slide Immunoblot analysis of leaf total proteins extracted from different Flaveria spp. Leaf proteins ofFlaveria spp. (60 μg) and maize (10 μg) were separated by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with purified anti-maize 62-kD NADP-ME IgG. The lines indicate the position of the 72-, 64-, and 62-kD immunoreactive bands. The species used were C4: maize (lane 1); F. trinervia (lane 2); F. bidentis (lane 3). C4-like: F. brownii (lane 4); F. vaginata (lane 5). C3-C4: F. sonorensis (lane 6); F. oppositifolia (lane 7);F. angustifolia (lane 8); F. ramosissima(lane 9); F. floridana (lane 10); F. linearis (lane 11). C3: F. cronquistii (lane 12); F. pringlei (lane 13);F. robusta (lane 14). Fig. 2. Open in new tabDownload slide Immunoblot analysis of leaf total proteins extracted from different Flaveria spp. Leaf proteins ofFlaveria spp. (60 μg) and maize (10 μg) were separated by SDS-PAGE, transferred onto nitrocellulose membranes, and probed with purified anti-maize 62-kD NADP-ME IgG. The lines indicate the position of the 72-, 64-, and 62-kD immunoreactive bands. The species used were C4: maize (lane 1); F. trinervia (lane 2); F. bidentis (lane 3). C4-like: F. brownii (lane 4); F. vaginata (lane 5). C3-C4: F. sonorensis (lane 6); F. oppositifolia (lane 7);F. angustifolia (lane 8); F. ramosissima(lane 9); F. floridana (lane 10); F. linearis (lane 11). C3: F. cronquistii (lane 12); F. pringlei (lane 13);F. robusta (lane 14). The C4-like species F. brownii (Fig.2, lane 4) strongly expressed the 64- and 62-kD forms and had a faint 72-kD form. F. vaginata (Fig. 2, lane 5) had a faint 72-kD form, and two strongly expressed smaller forms, which have a somewhat lower kD than the 64- and 62-kD forms in F. brownii. Since the 62- and 64-kD forms in F. brownii are similar in size, the major activity of NADP-ME in this species appeared in one peak following Suc density gradient centrifugation (Fig. 1C) at a density intermediate to those of the major peaks for the C3 (Fig. 1A) and C4Flaverias spp. (Fig. 1D). The 72-kD band was relatively much fainter than that in the C3-C4 intermediates. These C4-like species have high levels of C4 enzymes but lack a strict compartmentalization of Rubisco and PEPCase in bundle-sheath and mesophyll cells as compared with their C4 counterparts (Reed and Chollet, 1985; Moore et al., 1989). In the C4 speciesF. trinervia (Fig. 2, lane 2) and F. bidentis(Fig. 2, lane 3), the most reactive band was the 62-kD monomer. Nevertheless, a faint 72-kD form was still present and the 64-kD form was expressed at very low levels. The isoform pattern of NADP-ME in C4Flaveria spp. is similar to that of maize, which has a predominant 62-kD form and little or no 64-kD form. The western blots shown in Figure 2 were scanned and comparisons were made between the different photosynthetic groups for the relative abundance of each isoform (Fig. 3). The same amount of protein was added to the gel, which allowed for an estimate of the relative amount of each form between the photosynthetic types. The results show that from C3 to C3-C4, C4-like, and C4 species there was a progressive decrease in the relative abundance of the 72-kD isoform (100, 56, 19, and 16%, respectively), whereas there was a progressive increase in the relative level of the 62-kD isoform (8 [visible in gel scans but not in Fig. 2], 39, 47, and 100%, respectively). On the other hand, the 64-kD form was most abundant in C4-like and certain C3-C4 species (15 [visible in gel scans but not in Fig. 2], 45, 100, and 15% for the four photosynthetic groups, respectively). Quantitative estimates of the relative amounts of the different forms within a species cannot be made from this analysis since the antibody used may not have the same degree of cross-reactivity with different isoforms (see Maurino et al., 1997). However, the results show a preferential expression of the three isoforms of NADP-ME with different photosynthetic mechanisms inFlaveria spp. Fig. 3. Open in new tabDownload slide Relative abundance of the three monomeric isoforms of NADP-ME in the different photosynthetic types ofFlaveria spp.. The western blots from the results in Figure 2 were scanned, the areas of the peaks corresponding to the monomeric forms were determined, the average of each form within each photosynthetic type was calculated, and the relative abundance was determined. Immunoblots were repeated three times with the same phenol extract for all species; duplicate extracts from separate leaves with a species representing each photosynthetic type gave similar results. The results are presented for each form as a percentage of the maximum, with the photosynthetic group having the maximum amount of that form taken as 100%. Very low levels of the 62-kD (black columns) and 64-kD (striped columns) forms were detected in scans of the C3species, although they are not apparent in the immunoblots in Figure 2(lanes 12–14). The white columns represent 72-kD forms. Fig. 3. Open in new tabDownload slide Relative abundance of the three monomeric isoforms of NADP-ME in the different photosynthetic types ofFlaveria spp.. The western blots from the results in Figure 2 were scanned, the areas of the peaks corresponding to the monomeric forms were determined, the average of each form within each photosynthetic type was calculated, and the relative abundance was determined. Immunoblots were repeated three times with the same phenol extract for all species; duplicate extracts from separate leaves with a species representing each photosynthetic type gave similar results. The results are presented for each form as a percentage of the maximum, with the photosynthetic group having the maximum amount of that form taken as 100%. Very low levels of the 62-kD (black columns) and 64-kD (striped columns) forms were detected in scans of the C3species, although they are not apparent in the immunoblots in Figure 2(lanes 12–14). The white columns represent 72-kD forms. When the total protein extracts from different tissues of F. pringlei (C3), F. floridana(C3-C4), and F. trinervia (C4) (leaf, stem, and root) were tested with the maize NADP-ME antibody, only the 72-kD form was found in stems and roots (data not shown). On the other hand, the 62-kD form was found in large amounts in the leaves of F. trinervia and both the 62- and 64-kD forms in leaves ofF. floridana(C3-C4) versus trace amounts in leaves of F. pringlei(C3) (data not shown; see Fig. 2). Again, these results indicate that there are three major isoforms of NADP-ME inFlaveria spp. when examined at the monomeric level and they are expressed in tissue-specific and photosynthetic- mechanism-specific manners. Isoform Pattern of NADP-ME as Resolved by IEF Since three monomeric forms of NADP-ME were observed in variousFlaveria spp. on western blots, the isoform pattern of NADP-ME in leaf extracts of C3F. pringlei, C3-C4F. floridana, and C4F. trinervia was determined by nondenaturing IEF. The results show that based on pI and activity data, there were three native NADP-ME isoforms of roughly similar activity inF. floridana (Fig. 4, lane 2), which corresponds to the amounts of the three monomeric forms as revealed by western analysis (Figs. 2 and 3). By comparison, the C4 species F. trinervia, which has a dominant 62-kD monomeric form and low levels of the 72- and 64-kD forms (Figs. 2 and 3), had major activity on native IEF gels at a pI of 5.5, along with two relatively minor bands (Fig. 4, lane 3). On the other hand, the C3 speciesF. pringlei, which has a predominant 72-kD monomeric form, had a major band of activity that corresponds to the minor, more alkaline band in the C4 and C3-C4 extracts on native IEF gels (Fig. 4, lane 1). The pI of these forms were between 5.3 and 5.8. Taken together, these results suggest that three active isoforms of NADP-ME with different monomeric sizes and pI are expressed inFlaveria spp. at different levels. In addition, comparisons of the three isoforms on native IEF gels (Fig. 4) with those on SDS gels (Fig. 2) for the three species suggest that the most alkaline form on the native IEF gel is the 72-kD form (constitutively expressed in all species), with the middle band being the 62-kD form (highly expressed only in C4 species), and the most acidic form being the 64-kD form (highly expressed in some C3-C4 and C4-like species). Fig. 4. Open in new tabDownload slide Activity staining of leaf NADP-ME from F. pringlei (C3), F. floridana(C3-C4 intermediate), and F. trinervia (C4) on native IEF gels. The pH gradient used for IEF was from 5.0 to 7.0. The calculated native pI of the reactive bands are between 5.3 and 5.8. Leaf protein extracts were made from F. pringlei (lane 1),F. floridana (lane 2), and F. trinervia (lane 3). The amount of protein loaded was equivalent to 1 milliunit of NADP-ME activity. Fig. 4. Open in new tabDownload slide Activity staining of leaf NADP-ME from F. pringlei (C3), F. floridana(C3-C4 intermediate), and F. trinervia (C4) on native IEF gels. The pH gradient used for IEF was from 5.0 to 7.0. The calculated native pI of the reactive bands are between 5.3 and 5.8. Leaf protein extracts were made from F. pringlei (lane 1),F. floridana (lane 2), and F. trinervia (lane 3). The amount of protein loaded was equivalent to 1 milliunit of NADP-ME activity. Immunolocalization Studies Immunolocalization with the antibody against the 62-kD NADP-ME from maize leaves was studied by light (Fig.5) and electron microscopy (Fig.6) to analyze the distribution of NADP-ME among leaf cell types in different Flaveria spp. The background labeling with preimmune serum was very low in all cases (data not shown). In F. bidentis (C4), where the majority of the enzyme was the 62-kD monomeric form (Fig. 2, lane 3), immunolocalization at the light microscope level showed that there was very strong labeling in the bundle-sheath cells and little labeling in the mesophyll cells (Fig. 5). Electron microscopy shows that the gold particles were largely localized in bundle-sheath chloroplasts (Fig. 6, A and C). Whereas the bundle-sheath plastid is heavily labeled, the plastid in the companion cell had little labeling (Fig. 6C). In the mesophyll cell of F. trinervia(C4) there was little labeling in the chloroplasts, whereas no labeling was observed in the nucleus or the cytosol (Fig. 6B). Fig. 5. Open in new tabDownload slide Light microscopy of in situ immunolocalization of NADP-ME in leaves of F. bidentis (C4, upper panel), F. robusta (C3, lower left panel), and F. ramosissima (C3-C4, lower right panel). Fig. 5. Open in new tabDownload slide Light microscopy of in situ immunolocalization of NADP-ME in leaves of F. bidentis (C4, upper panel), F. robusta (C3, lower left panel), and F. ramosissima (C3-C4, lower right panel). Fig. 6. Open in new tabDownload slide Electron microscopy of in situ immunolocalization of NADP-ME in leaves of Flaveria spp. A to C, F. bidentis (C4); D, F. robusta(C3); E and F, F. ramosissima(C3-C4). bsc, Bundle-sheath cell; mc, mesophyll cell; cc, companion cell. Fig. 6. Open in new tabDownload slide Electron microscopy of in situ immunolocalization of NADP-ME in leaves of Flaveria spp. A to C, F. bidentis (C4); D, F. robusta(C3); E and F, F. ramosissima(C3-C4). bsc, Bundle-sheath cell; mc, mesophyll cell; cc, companion cell. In F. robusta (C3), where the 72-kD monomer was the main immunoreactive form (Fig. 2, lane 14), the heaviest labeling appeared in the upper layer of palisade mesophyll cells (Fig. 5). High-resolution immunolocalization by electron microscopy shows that labeling occurred in the plastids of the mesophyll cells (Fig. 6D). In the case of F. ramosissima(C3-C4 intermediate), which expresses the 72- and 64-kD forms of NADP-ME, with a very faint band of 62 kD (Fig. 2, lane 9), labeling occurred in both mesophyll and bundle-sheath cells, with strong labeling in the latter (Fig. 5). Moreover, the majority of the label in both bundle-sheath (Fig. 6E) and mesophyll cells (Fig. 6F) was associated with plastids, although some label occurred outside the chloroplast. These in situ results (Fig. 6) indicate that the three isoforms of NADP-ME in Flaveria spp. are all located largely, if not exclusively, in chloroplasts. DISCUSSION Isoforms of NADP-ME in Flaveria spp. C4 and C3 Species The C3 species of Flaveria have low activities of NADP-ME, which are largely attributed to a higher-molecular- mass native form of the enzyme on Suc density gradients, with a minor peak of activity for a lower-molecular-mass form (Fig. 1A). On the other hand, the C4Flaveria spp. have very high activities of NADP-ME in leaves, which appears as a major, lower-mass native form (Fig. 1D). This difference between C3 and C4 species in molecular mass of NADP-ME within the genus Flaveria is analogous to intergenus differences that we observed earlier: the native form of NADP-ME in wheat, a C3 species, has a higher mass/lower activity than the native form in green maize leaves, which is utilized in C4 photosynthesis (Casati et al., 1997; Maurino et al., 1997). Maize leaves also have a native form of higher mass that is constitutively expressed in roots, etiolated leaves, and at low levels in green leaves, and this form corresponds to the higher-mass form in wheat (Maurino et al., 1997). The higher-mass form of the enzyme in C3 species of Flaveriaappears to have a higher Km value for NADP than the lower-mass form in C4 species ofFlaveria, which is consistent with reports that the enzyme from leaves of C3 and C4 species has different kinetic properties (seeEdwards and Andreo, 1992). Immunoblots of denatured C3Flaverialeaf protein, probed with antibody to the maize 62-kD C4 form of the enzyme, show that the only immunoreactive band is a 72-kD monomer (Fig. 2). Only very low levels of the smaller-molecular-mass forms (62 and 64 kD) were detected in scans of the western blots (Fig. 3). This result is consistent with the observation that the major leaf NADP-ME in F. cronquistiihas a higher density on a Suc gradient and thus a higher mass (Fig.1A). This high-molecular-mass (72-kD) monomer in C3 species ofFlaveria corresponds in size to the 72-kD monomer of NADP-ME in the C3 species wheat (Maurino et al., 1997) and to the larger molecular mass, constitutive 72-kD monomer of the enzyme that occurs in maize roots, etiolated leaves, and at low levels in green leaves (Maurino et al., 1997). Previously, Cameron et al. (1989) reported no immunoreactivity of NADP-ME in leaf extracts of C3F. pringleiin western blots using antibodies against the maize enzyme, which may be due to differences in the epitopes that the antibodies prepared with the maize 62-kD protein can recognize (also see Maurino et al., 1997). On the other hand, the C4Flaveria spp. show a very reactive 62-kD band of NADP-ME and minor bands at 64 and 72 kD (Fig. 3). Again, this is consistent with the notion that the major NADP-ME in leaves of C4F. trinerviaresides at a lower density on Suc gradients and thus has a lower mass (Fig. 1D). This 62-kD form also corresponds in size and abundance to the major form of the enzyme in maize leaves, which is involved in C4 photosynthesis. The 72-kD monomer is constitutively expressed in leaves, stems, and roots of C3 and C4 species ofFlaveria, whereas the 62-kD monomer and a minor 64-kD monomer occur only in green leaves of the C4 species. As in maize, these data suggest that the 72-kD NADP-ME isoform is not involved in photosynthetic carbon metabolism, whereas the 62-kD form participates in carbon fixation via the C4 pathway. Two forms of NADP-ME with different molecular masses were previously observed in leaves of C4 species of F. trinervia in western blots with maize NADP-ME antibody, including a predominant, low-mass form (Cameron and Basset, 1988). The sizes of the monomeric forms were not determined in this latter study. Previous studies showed that the native, active form of plant NADP-ME is a homotetramer (Edwards and Andreo, 1992; Maurino et al., 1997). Thus, in leaves, stems, and roots of C3 species ofFlaveria and in stems and roots of C4Flaveria spp., the apparent predominant form of the enzyme may consist of a homotetramer of 72-kD subunits, whereas in leaves of C4Flaveria spp. the apparent predominant form of the enzyme may be a homotetramer of 62-kD polypeptides. These results are consistent with the native form of the enzyme existing as one dominant band of activity in nondenaturing IEF gels in C3 and C4 species of Flaveria, but with different pI (Fig. 4). So far inFlaveria spp., NADP-ME genes have been cloned from the C3F. pringlei (Lipka et al., 1994) and the C4F. trinervia (Borsch and Westhoff, 1990), and both encode a subunit with deduced molecular mass of 62 kD. The genomic clones of NADP-ME isolated from another C4 species, F. bidentis, remain to be characterized in terms of the sizes of their protein products (Marshall et al., 1996). C3-C4 Species There appeared to be at least two forms of native NADP-ME in leaves of the C3-C4intermediate species F. ramosissima when examined on Suc density gradients (Fig. 1B). Western-blot analysis indicated that depending upon the species, there are up to three monomeric forms of the enzyme, 62, 64, and 72 kD, occurring among the intermediates (Figs.2 and 3). For example, F. floridana showed three isoforms on a western blot of denatured protein (Fig. 2) and on a native IEF gel with activity staining (Fig. 4). This indicates that as many as three NADP-ME isoforms occur among intermediate species. It is apparent that the relative quantity of these products varies among the intermediates (Fig. 2). In leaves of the C3-C4 intermediate F. sonorensis, which does not have a functional C4 cycle (Ku et al., 1991), the 72-kD form is predominant, which is similar to the situation in C3 species. In other intermediates, where there is evidence for a limited degree of functioning of C4 photosynthesis, such as F. ramosissima, F. linearis, and F. floridana (Monson et al., 1986; Moore et al., 1987; Ku et al., 1991), multiple forms of NADP-ME are present. Previously, Cameron and Basset (1988) suggested from western analysis that there is only one form of NADP-ME in leaves of intermediates (F. floridana, F. oppositifolia, and F. linearis), but these results were inconclusive due to the poor reactivity of their antibody. C4-Like Species In leaves of the C4-like species F. brownii, there was one major band of NADP-ME activity on a Suc density gradient (Fig. 1C); however, two major bands of 62 and 64 kD were revealed on western blots of SDS gels (Fig. 2, lane 4). Thus, this C4-like species has a significant amount of the 64-kD form, which occurs to a lesser extent in intermediates (Fig. 3), and a 62-kD form, which is the major form in C4species. The C4-like species F. vaginata also has two major forms on SDS gels; however, these are slightly smaller than the 64- and 62-kD forms in F. brownii. Collectively, these data demonstrate the presence of three NADP-ME isoforms of different molecular masses and pI in Flaveriaspp., with a progressive increase in expression of the 64-kD form from C3 to intermediate to C4-like, and an increase in expression of the 62-kD form and a decrease in expression of the 72-kD form from C3 to C3-C4, C4-like and C4 species ofFlaveria. Localization of NADP-ME in Flaveria spp. Leaves C4 and C3 Species Immunolocalization studies of leaves of C4species of Flaveria show that the major labeling occurs in bundle-sheath chloroplasts, with minor labeling in mesophyll chloroplasts (Figs. 5 and 6). This is consistent with the C4 form of the enzyme having an essential function in the bundle-sheath cells of certain C4plants in donating CO2 to RuBP carboxylase. In studies with isolated mesophyll and bundle-sheath protoplasts of C4F. trinervia, it was shown that high NADP-ME activity occurs in bundle-sheath protoplasts (40-fold higher activity than in mesophyll protoplasts), with compartmentation of the enzyme in the chloroplast (Moore et al., 1984); recently it was shown that isolated bundle-sheath chloroplasts of F. bidentis have high activity of NADP-ME (Meister et al., 1996). In maize, bundle-sheath chloroplasts have high levels of the 62-kD form, which provides direct evidence for its role in C4photosynthesis, whereas the mesophyll chloroplasts have only low levels of the constitutive 72-kD form (Maurino et al., 1997). Thus, by analogy, the low level of labeling in the mesophyll chloroplasts ofF. trinervia may be attributed to the constitutive 72-kD form. In the C3 species ofFlaveria, which have the 72-kD NADP-ME form, labeling occurs predominantly in the chloroplasts of the upper palisade cells (Figs. 5 and 6). This is consistent with results with wheat in which labeling occurred mainly in mesophyll chloroplasts. The constitutive form may be involved in providing NADPH for synthesis of lipids or isoprenoids in plastids (see Maurino et al., 1997). C3-C4 Intermediate Species Evidence that intermediates have incomplete development of C4 photosynthesis at the biochemical level was previously shown by immunocytochemical studies with several C3-C4Flaveria spp. (F. linearis, F. floridana, and F. chloraefolia). Neither Rubisco nor PEPCase was specifically located in one cell type, as is the case in C4species, but rather they each occurred in both mesophyll and bundle-sheath cells (Reed and Chollet, 1985). In the present study, major immunolabeling of NADP-ME was found in bundle-sheath chloroplasts, whereas significant labeling also occurred in mesophyll chloroplasts of the C3-C4intermediate F. ramosissima (Figs. 5 and 6), a species that has substantial C4 cycle function (see Ku et al., 1991). The distribution of the three forms identified on western blots between the two cell chloroplast types is not known. It was previously reported (Moore et al., 1988) that within the leaf of this C3-C4 plant there is a gradation of decreasing PEPCase activity along with increasing NADP-ME and Gly decarboxylase activities from the peripheral mesophyll cells to the bundle-sheath cells. In this way, apparent photorespiration may be reduced by two mechanisms in this species, one through concentrating CO2 by C4 acid decarboxylation in the bundle-sheath and the other through refixation of the photorespired CO2 in the bundle-sheath cells. Although the compartmentation of the different forms of NADP-ME in the leaves of C3-C4intermediate and C4-like Flaveria spp. is uncertain, if the 62- and 64-kD forms are associated with the C4 cycle they may be enriched in the bundle-sheath chloroplasts. Finally, since immunolocalization studies were performed with antibody raised against a chloroplast-specific isoform of NADP-ME from maize, it is possible that nonchloroplastic forms exist in Flaveriaspp. that have low homology to the chloroplast forms and thus were not detected by the antibody. If so, these are likely low-abundance, low-activity forms, since cellular fractionation studies show that association of NADP-ME activity with chloroplasts is correlated with immunolocalization analysis (analysis of compartmentation of enzyme activity in C4 species ofFlaveria by Moore et al. [1984] and Meister et al. [1996], versus the immunological results of the present study, and analysis of activity versus immunoblot reactivity of fractionated mesophyll protoplasts of wheat by Maurino et al. [1997]). Isoforms and Gene Family of NADP-ME in Flaveria spp. Marshall et al. (1996) showed that the C3F. pringlei and the C4F. bidentis andF. trinervia have at least three and perhaps four NADP-ME genes. In examining two of these genes from F. bidentis,Me1 and Me2, in detail, they concluded that these genes are very similar in sequence, that both are present in C3 and C4 species ofFlaveria, and that they both encode putative transit peptide sequences for targeting their preproteins into chloroplasts. They suggested that these are paralogous genes arising by gene duplication from a common ancestral species. Also, from examination of Me1 and Me2 mRNA levels there was evidence that Me1 encodes the C4 form of the enzyme in leaves (leaf-specific, light-dependent expression in C4 plants only) and that Me2 is constitutively expressed (lack of organ specificity in expression, low level of expression). The 5′ and 3′ flanking regions of theMe1 gene are important for bundle-sheath specificity and high-level expression in leaves, respectively (Marshall et al., 1997). Thus, at least two chloroplastic forms of NADP-ME might be expected to occur in Flaveria spp. It is reasonable to suggest from the results of the present study that Me1 encodes the 62-kD form that is targeted to bundle-sheath chloroplasts in C4 species and that Me2 encodes the constitutive 72-kD form that is targeted to leaf plastids and stem and root tissues of both C3 and C4 species. In addition, the present study identified a third form of the enzyme in Flaveria spp., a 64-kD form that is most abundant in C4-like and certain C3-C4 intermediate species and occurs in green leaf tissue but not in roots and stems of the intermediate species examined. Thus, this may be the product of a third NADP-ME gene, which is more actively expressed during evolutionary transition from C3 to C4 photosynthesis. Sequencing of these three different monomeric forms will be required to match proteins to the NADP-ME genes and cDNAs that have been isolated. The preferential expression of the 64-kD NADP-ME isoform in C4-like and certain C3-C4 intermediateFlaveria spp. and the 62-kD form in C4Flaveria spp. is noteworthy. Perhaps these isoforms have different kinetic properties with respect to substrates or cofactors that may reflect metabolic adaptations to differences in C4 capacity in the different photosynthetic types. An examination of the strategies employed by C4 plants to acquire the various components of C4 photosynthesis during their evolution from C3 plants show that different mechanisms were utilized (Ku et al., 1996). These include changes in cell-specific expression (e.g. carbonic anhydrase), gene duplication coupled with acquisition of strong promoters for high-level expression (e.g. PEPCase), and acquisition of strong promoters for high-level expression of chloroplast-specific isoforms in a cell-specific manner (e.g. pyruvate, Pi dikinase). In this study we have demonstrated the presence of three chloroplastic NADP-ME isoforms, presumably encoded by three different isogenes, in leaves of all types of photosyntheticFlaveria spp. (C3, C3-C4, C4-like, and C4), but differing in relative abundance (Figs. 3, 5, and 6). These results suggest that a differential expression of the existing NADP-ME genes encoding the chloroplastic forms in a tissue- and cell-specific manner was involved in the evolution of C4photosynthesis in the genus Flaveria. The genes encoding the 62- and 64-kD forms must have been altered for increased expression during the evolution of C4 photosynthesis, and in the case of the 62-kD form, it is also clear that these alterations must have also included an element for bundle-sheath-specific expression. Abbreviations: NADP-ME NADP-malic enzyme PEPCase PEP carboxylase RuBP ribulose 1,5-bisphosphate LITERATURE CITED 1 Borsch D Westhoff P Primary structure of NADP-dependent malic enzyme in the dicotyledonous Flaveria trinervia. FEBS Lett 273 1990 111 115 Google Scholar Crossref Search ADS PubMed WorldCat 2 Burnette WN “Western blotting”: electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem 112 1981 195 203 Google Scholar Crossref Search ADS PubMed WorldCat 3 Cameron RG Bassett CL Inheritance of C4 enzymes associated with carbon fixation in Flaveria species. Plant Physiol 88 1988 532 536 Google Scholar Crossref Search ADS PubMed WorldCat 4 Cameron RG Bassett CL Bouton JH Brown RH Transfer of C4 photosynthetic characters through hybridization of Flaveria species. Plant Physiol 90 1989 1538 1545 Google Scholar Crossref Search ADS PubMed WorldCat 5 Casati P Spampinato CP Andreo CS Characteristics and physiological function of NADP-malic enzyme from wheat. Plant Cell Physiol 38 1997 928 934 Google Scholar Crossref Search ADS WorldCat 6 Edwards GE Andreo CS NADP-malic enzyme from plants. Phytochemistry 31 1992 1845 1857 Google Scholar PubMed OpenURL Placeholder Text WorldCat 7 Edwards GE, Ku MSB (1987) The biochemistry of C3-C4 intermediates.In MD Hatch, K Boardman, eds, The Biochemistry of Plants, Vol 14. Academic Press, New York, pp 275–325 8 Edwards GE, Walker DA (1983) C3, C4: Mechanisms, and Cellular and Environmental Regulation of Photosynthesis. Blackwell Scientific Publishers, Oxford, UK 9 Hatch MD C4 photosynthesis: a unique blend of modified biochemistry, anatomy and ultrastructure. Biochim Biophys Acta 895 1987 81 106 Google Scholar Crossref Search ADS WorldCat 10 Ku MSB Kano-Murakami Y Matsuoka M Evolution and expression of C4 photosynthesis genes. Plant Physiol 111 1996 949 957 Google Scholar Crossref Search ADS PubMed WorldCat 11 Ku MSB Monson RK Littlejohn RO Nakamoto H Fisher DB Edwards GE Photosynthetic characteristics of C3-C4 intermediate Flaveria species. I. Leaf anatomy, photosynthetic responses to O2 and CO2, and activities of key enzymes in the C3 and C4 pathways. Plant Physiol 71 1983 944 948 Google Scholar Crossref Search ADS PubMed WorldCat 12 Ku MSB Wu J Dai Z Scott RA Chu C Edwards GE Photosynthetic and photorespiratory characteristics of Flaveria species. Plant Physiol 96 1991 518 528 Google Scholar Crossref Search ADS PubMed WorldCat 13 Lipka B Steinmuller K Rosche E Borsch D Westhoff P The C3 plant Flaveria pringlei contains a plastidic NADP-malic enzyme which is orthologous to the C4 isoform of the C4 plant F. trinervia. Plant Mol Biol 26 1994 1775 1783 Google Scholar Crossref Search ADS PubMed WorldCat 14 Marshall JS Stubbs JD Chitty JA Surin B Taylor WC Expression of the C4 Me1 gene from Flaveria bidentis requires an interaction between 5′ and 3′ sequences. Plant Cell 9 1997 1515 1525 Google Scholar Crossref Search ADS PubMed WorldCat 15 Marshall JS Stubbs JD Taylor WC Two genes encode highly similar chloroplastic NADP-malic enzymes in Flaveria. Plant Physiol 111 1996 1251 1261 Google Scholar Crossref Search ADS PubMed WorldCat 16 Maurino VG Drincovich MF Andreo CS NADP-malic enzyme isoforms in maize leaves. Biochem Mol Biol Int 38 1996 239 250 Google Scholar PubMed OpenURL Placeholder Text WorldCat 17 Maurino VG Drincovich MF Casati P Andreo CS Edwards GE Ku MSB Gupta SK Franceschi VR NADP-malic enzyme: immunolocalization in different tissues of the C4 plant maize and the C3 plant wheat. J Exp Bot 48 1997 799 811 Google Scholar Crossref Search ADS WorldCat 18 Meister M Agostino A Hatch MD The roles of malate and aspartate in C4 photosynthetic metabolism of Flaveria bidentis (L.). Planta 199 1996 262 269 Google Scholar Crossref Search ADS WorldCat 19 Monson RK Edwards GE Ku MSB C3-C4 intermediate photosynthesis in plants. BioSci 34 1984 563 574 Google Scholar Crossref Search ADS WorldCat 20 Monson RK Moore Bd Ku MSB Edwards GE Co-function of C3 and C4-photosynthetic pathways in C3, C4 and C3-C4 Flaveria species. Planta 168 1986 493 502 Google Scholar Crossref Search ADS PubMed WorldCat 21 Moore Bd Ku MSB Edwards GE Isolation of leaf bundle-sheath protoplasts from C4 dicot species and intracellular location of selected enzymes. Plant Sci Lett 35 1984 127 138 Google Scholar Crossref Search ADS WorldCat 22 Moore Bd Ku MSB Edwards GE C4 photosynthesis and light dependent accumulation of inorganic carbon in leaves of C3-C4 and C4 Flaveria species. Aust J Plant Physiol 14 1987 657 668 Google Scholar OpenURL Placeholder Text WorldCat 23 Moore Bd Ku MSB Edwards GE Expression of C4-like photosynthesis in several species of Flaveria. Plant Cell Environ 12 1989 541 549 Google Scholar Crossref Search ADS WorldCat 24 Moore Bd Monson RK Ku MSB Edwards GE Plant Cell Physiol 29 1988 999 1006 25 Plaxton WC Molecular and immunological characterization of plastid and cytosolic pyruvate kinase isozymes from castor-oil plant endosperm and leaf. Eur J Biochem 181 1989 443 451 Google Scholar Crossref Search ADS PubMed WorldCat 26 Powell AM Systematics of Flaveria (Flaveriinae-Asteraceae). Ann Missouri Bot Garden 65 1978 591 636 Google Scholar Crossref Search ADS WorldCat 27 Rajeevan MS Basset CL Hughes DW Isolation and characterization of cDNA clones for NADP-malic enzyme from leaves of Flaveria: transcript abundance distinguishes C3, C3-C4 and C4 photosynthetic types. Plant Mol Biol 17 1991 371 383 Google Scholar Crossref Search ADS PubMed WorldCat 28 Rawsthorne S C3-C4 intermediate photosynthesis: linking physiology to gene expression. Plant J 2 1992 267 274 Google Scholar Crossref Search ADS WorldCat 29 Reed JE Chollet R Immunofluorescent localization of phophoenolpyruvate carboxylase and ribulose 1,5-bisphosphate carboxylase proteins in leaves of C3, C4 and C3-C4 intermediate Flaveria species. Planta 165 1985 439 445 Google Scholar Crossref Search ADS PubMed WorldCat 30 Sedmak JJ Grossberg SE A rapid, sensitive, and versatile assay for protein using Coomassie brillant blue G250. Anal Biochem 79 1977 544 552 Google Scholar Crossref Search ADS PubMed WorldCat 31 Van Etten JL Freer SN McCune BK J Bacteriol 138 1979 650 652 Crossref Search ADS PubMed 32 Wintermans JFGM De Mots A Spectrophotometric characteristics of chlorophylls and their pheophytins in ethanol. Biochim Biophys Acta 109 1965 448 453 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This research was supported by the National Science Foundation (grant no. IBN 93-17756 to G.E.E.) and by grants from the Consejo Nacional de Investigaciones Cientı́ficas y Técnicas and Fundación Antorchas (to C.S.A.). * Corresponding author; e-mail [email protected]; fax 1–509–335–3517. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Zheng, Shao Jian; Ma, Jian Feng; Matsumoto, Hideaki

doi: 10.1104/pp.117.3.745pmid: 9662517

Abstract High Al resistance in buckwheat (Fagopyrum esculentum Moench. cv Jianxi) has been suggested to be associated with both internal and external detoxification mechanisms. In this study the characteristics of the external detoxification mechanism, Al-induced secretion of oxalic acid, were investigated. Eleven days of P depletion failed to induce secretion of oxalic acid. Exposure to 50 μmLaCl3 also did not induce the secretion of oxalic acid, suggesting that this secretion is a specific response to Al stress. Secretion of oxalic acid was maintained for 8 h by a 3-h pulse treatment with 150 μm Al. A nondestructive method was developed to determine the site of the secretion along the root. Oxalic acid was found to be secreted in the region 0 to 10 mm from the root tip. Experiments using excised roots also showed that secretion was located on the root tip. Four kinds of anion-channel inhibitors showed different effects on Al-induced secretion of oxalic acid: 10 μm anthracene-9-carboxylic acid and 4,4′-diisothiocyanatostilbene-2,2′-disulfonate had no effect, niflumic acid stimulated the secretion 4-fold, and phenylglyoxal inhibited the secretion by 50%. Root elongation in buckwheat was not inhibited by 25 μm Al or 10 μm phenylglyoxal alone but was inhibited by 40% in the presence of Al and phenylglyoxal, confirming that secretion of oxalic acid is associated with Al resistance. Al toxicity is a serious agricultural problem in acid soils, which make up about 40% of the world's arable land (Foy et al., 1978). Al3+, the phytotoxic species, inhibits root growth and the uptake of water and nutrients, which ultimately results in a production decrease, although the toxicity mechanism is poorly understood (Kochian, 1995). On the other hand, some plant species and cultivars of the same species have developed strategies to avoid or tolerate Al toxicity. For the selection and breeding of plants resistant to Al toxicity, an economic and sustainable approach for improving crop production on acid soils, it is also useful to gain an understanding of the mechanisms used by plants for Al resistance. The proposed mechanisms of Al resistance can be classified into exclusion mechanisms and internal tolerance mechanisms (Taylor, 1991; Kochian, 1995). The main difference between these two mechanisms is in the site of Al detoxification: symplasm (internal) or apoplasm (exclusion). The exclusion mechanism prevents Al from crossing the plasma membrane and entering the symplasm, reaching sensitive intracellular sites (Taylor, 1991). By contrast, the internal tolerance mechanism immobilizes, compartmentalizes, or detoxifies Al entering the symplasm. One of the proposed exclusion mechanisms is the secretion of Al-chelating substances, because the chelated form of Al is less phytotoxic than the ionic form, Al3+ (Hue et al., 1986). Because some organic acids such as citric acid can form a stable complex with Al, their secretion has been reported to be involved in the exclusion mechanism. Miyasaka et al. (1991) presented evidence that an Al-resistant cultivar of snapbean (Phaseolusvulgaris) exuded higher levels of citric acid into the rhizosphere than an Al-sensitive cultivar in response to Al stress.Delhaize et al. (1993) used near-isogenic wheat lines differing in Al resistance at the Al-resistance locus (Alt 1) and found that Al-resistant genotypes excreted 5- to 10-fold more malic acid than Al-sensitive genotypes. After investigating a wide range of wheat genotypes differing in Al resistance, Ryan et al. (1995b) suggested that Al-induced secretion of malic acid is a general Al-resistance mechanism in wheat. Citric acid secretion was also found to be stimulated in an Al-resistant maize line (Pellet et al., 1995). Recently, Ma et al. (1997c) reported that specific secretion of citric acid was induced by Al in Cassia tora L., an Al-resistant species. In addition, transgenic tobacco and papaya plants have been altered genetically by introducing a citrate synthase gene fromPseudomonas aeruginosa in their cytoplasm (Fuente et al., 1997), and overproduction of citric acid resulted in increased Al resistance in these two plants. These results confirmed that the secretion of organic acids is related to Al resistance. Buckwheat (Fagopyrum esculentum Moench. cv Jianxi) shows high Al resistance (Zheng et al., 1998). Ten days of intermittent exposure to Al (1 d in 0.5 mm CaCl2containing 50 μm AlCl3 at pH 4.5 alternating with 1 d in nutrient solution without Al) hardly affected root growth of the buckwheat but inhibited root growth by 65% in an Al-sensitive cultivar of wheat (Tritium aestivum L. cv Scout 66) and by 25% to 50% in two cultivars of oilseed rape (Brassica rapus L. cvs 94008 and H166), two cultivars of oat (Avena sativa L. cvs Tochiyutaka and Heoats), and an Al-tolerant cultivar of wheat (cv Atlas 66). Recently, we found that oxalic acid, the simplest dicarboxylic acid, was secreted by the roots of buckwheat in response to Al stress (Ma et al., 1997b). Furthermore, Al was found to be accumulated in the leaves without toxicity. Oxalic acid is known to be a strong Al chelator (Hue et al., 1986), and therefore both external and internal detoxification of Al by oxalic acid may be involved in the high Al resistance of buckwheat. In the present study the characteristics of Al-induced secretion of oxalic acid were investigated in terms of the specificity, location, and effects of anion-channel inhibitors. The role of oxalic acid in detoxifying Al is also discussed. MATERIALS AND METHODS Buckwheat (Fagopyrum esculentum Moench. cv Jianxi) seeds were collected from an acid-soil area of southern China. Seeds were soaked in distilled water overnight and then germinated on a net tray in the dark at 25°C. On d 2 the tray was put on a plastic container filled with 0.5 mm CaCl2solution at pH 4.5. The solution was renewed every day. On d 4 or 5, seedlings of similar size were transplanted into a 1-L plastic pot (eight seedlings per pot) containing aerated nutrient solution. One-fifth-strength Hoagland solution was used, which contained the macronutrients KNO3 (1.0 mm), Ca(NO3)2 (1.0 mm), MgSO4 (0.4 mm), and (NH4)H2PO4(0.2 mm) and the micronutrients NaFeEDTA (20 μm), H3BO3 (3 μm), MnCl2 (0.5 μm), CuSO4 (0.2 μm), ZnSO4 (0.4 μm), and (NH4)6Mo7O24(1 μm). The solution was adjusted to pH 4.5 with 1m HCl and renewed every other day. After 8 to 10 d of culture in the above-described nutrient solution, the plants were subjected to the treatments described below. Plants were grown in a controlled-environment growth cabinet (TGE-9 h-S, TABAI Espec, Hiroshima, Japan) with a 14-h/25°C day and a 10-h/20°C night regime and a light intensity of 40 W m−2. Each experiment was conducted three times. Al Resistance in Buckwheat To confirm the Al resistance of buckwheat, the effect of Al treatment on root elongation was investigated. An Al-tolerant cultivar of wheat (Triticum aestivum L. cv Atlas 66), was used as a reference. Three-day-old seedlings of buckwheat or wheat, prepared as described above, were exposed to a 0.5 mmCaCl2, pH 4.5, solution with 25 μmAlCl3 or without Al. Ten replicates were made for each treatment. Root lengths were measured with a ruler before and after treatments (16 h). Collection of Root Exudates and Treatment Solutions Before collection of root exudates, the roots were cleaned by placing them in 0.5 mm CaCl2 at pH 4.5 overnight. To avoid interaction between Al and other nutrients such as P, a simple salt solution containing 0.5 mmCaCl2 was used as the basal treatment. The Al solution consisted of 50 μm AlCl3, except in pulse treatment and excised-root-tip experiments, when the concentration of AlCl3 was 150 μm. The pH of all solutions was adjusted to 4.5 with 1 m HCl. To check the effect of the lack of aseptic conditions on the concentration of oxalic acid in root exudates, the following methods were used: First, roots were exposed to the Al solution for 6 h and then removed from the solution. At 0, 3, 7, and 24 h after the collection of root exudates, the concentration of oxalic acid was determined by HPLC as described below. Second, oxalic acid (3 μmol L−1) was added to the root exudates collected by exposing the roots to the solution without Al for 6 h, and the concentration of oxalic acid was monitored at different times as described above. Specificity Studies To investigate whether the secretion of oxalic acid is specific to Al stress, the secretion induced by Al stress was compared with that induced by P deficiency and La3+ exposure. Twelve-day-old seedlings prepared as described above were grown in the above-described nutrient solution devoid of P. Root exudates were collected for 6 h every other day by immersing the seedlings in 0.5 mm CaCl2 solution at pH 4.5. On d 12 after P depletion, the seedlings were immersed in the Al-treatment solution and the root exudates were collected for 6 h. Treatment with La3+ was performed by exposing the seedlings to 0.5 mm CaCl2 solution containing 50 μm LaCl3 (Nacalai Tesque, Kyoto, Japan), and root exudates were collected for 6 h. Seedlings of the same age were also exposed to Al treatment. A pulse treatment was conducted by first exposing the seedlings to 0.5 mm CaCl2 solution containing 150 μm AlCl3, pH 4.5, for 3 h and then to 0.5 mm CaCl2 solution, pH 4.5, without Al. Root exudates were collected 0 to 3, 3 to 7, 7 to 11, and 27 to 31 h after treatment. Location of Secretion Site To determine the location of oxalic acid secretion from the roots, two different methods were used with excised roots and intact roots. The amount of secretion from excised roots was compared between sections 0 to 5 and 5 to 10 mm from the root tip according to the method of Ryan et al. (1995a), with some modifications. One hundred segments for each measurement were collected in a 9-cm Petri dish containing 0.5 mm CaCl2 solution at pH 4.5 (control solution) with three replicates. The Petri dish was placed on a shaker (60 rpm) for 30 min. The root segments were washed with 20 mL of the same solution three times to remove any oxalic acid released from the wounded tissue and then transferred into a 15-mL plastic centrifuge tube containing the control solution. Treatment was initiated by replacing the solution (10 mL) with 0.5 mmCaCl2 solution containing 150 μmAl, pH 4.5, or control solution, and the tube was placed on a shaker (60 rpm). After 3 h the root exudate was collected. Endogenous soluble oxalic acid in different sections of the roots was extracted three times with distilled water at 55°C. The extracts were applied to cation- and anion-exchange resins as described below. A nondestructive technique was developed to locate the site of secretion by modification of the method for determining Al-chelating activity reported by Ma et al. (1997c). Chromatography filter paper (no. 50, Advantec, Tokyo, Japan; 10 × 5 cm) was soaked in AlCl3 solution prepared by mixing 25 mL of 5 mm AlCl3, 4 mL of 2 mHCl, 67 mL of distilled water, and 120 mL of acetone. The paper was then immersed in phosphate buffer solution, pH 6.86 (Wako, Tokyo, Japan), for 3 min, followed by washing in deionized water three times to remove excess phosphate solution. The paper was then placed onto a layer of sponge (10 × 8 × 1 cm). Fifteen seedlings previously exposed to 0.5 mm CaCl2solution containing 0 or 150 μm Al at pH 4.5 for 3 h were arranged on the paper. The root tips were placed on the same line and then covered by half of the paper. Another sponge (8 × 8 × 1 cm) was placed on the top and then the plants were incubated in a growth chamber at 25°C. After 8 h the seedlings were removed and the paper was washed in deionized water for 1 min. Finally, the paper was placed in pyrocatechol violet solution (37.5 mg dissolved in 100 mL of pH 5.6 acetate buffer) (Dojindo, Kumamoto, Japan) for 3 min and washed in deionized water for approximately 2 min to remove excess dye, and photographs were taken on Fuji (Tokyo, Japan) 400 color film. To estimate the amount of oxalic acid secreted, a solution of 5 μL of oxalic acid (1–4 mm) was spotted on the chromatography filter paper and assayed by the same procedures as described above. Effect of Anion-Channel Inhibitors To examine the effect of four anion-channel inhibitors on Al-induced secretion of oxalic acid, roots were treated with a solution containing 50 μm AlCl3 in 0.5 mm CaCl2 and 10 μm NIF (Sigma) or A-9-C (Aldrich) dissolved in ethanol or PG (Katayama Chemical, Osaka, Japan) or DIDS (Dojindo) dissolved in distilled water. Root exudates were collected for 6 h during the treatment. The effect of PG on the root elongation of buckwheat was investigated in the presence and absence of Al. Three-day-old seedlings of similar size were selected and subjected to the following treatments for 16 h in 0.5 mm CaCl2 solution at pH 4.5: control (−Al), 10 μm PG, 25 μm Al (+Al), and 10 μm PG plus 25 μm Al. The root length was measured with a ruler before and after treatment. Determination of Organic Acids The root exudates and root extracts were passed through a cation-exchange column (16 × 14 mm) filled with 5 g of Amberlite IR-120B resin (H+ form, Muromachi Chemical, Tokyo, Japan), followed by an anion-exchange column (16 × 14 mm) filled with 2 g of Dowex 1X8 resin (100–200 mesh, format form) in a cold room. The organic acids retained on anion-exchange resin were eluted by 1 m HCl, and the eluate was concentrated to dryness by a rotary evaporator (40°C). After the residue was redissolved in dilute HClO4 solution, pH 2.1, the concentration of organic acids was analyzed by HPLC (Ma et al., 1997c) Bioassay of Toxicity of Different Al-Oxalate Complexes The toxicity of Al-oxalate complexes with different ratios of Al to oxalic acid was assayed using corn (Zea mays L. cv Golden Cross Bantam). Seeds were soaked in water for 10 h and then germinated on moist filter paper in an incubator at 30°C. After 1 d the seedlings were transplanted into a net tray containing 100 μm CaCl2 solution at pH 4.5 in a growth chamber under the following conditions: 25°C day and 20°C night, 65% RH, light intensity 40 W m−2, and a 14-h photoperiod. After a further 2 d seedlings of similar size were selected and subjected to the following treatments in 100 μm CaCl2 solution at pH 4.5 (six replicates): (a) −Al (control, no Al addition), (b) +Al (20 μm as AlCl3), (c) +Al-oxalate at a 2:1 molar ratio, (d) +Al-oxalate at 1:1, and (e) +Al-oxalate at 1:2. The Al concentration in all treatment solutions was adjusted to 20 μm. Different Al-oxalate complexes were prepared by mixing AlCl3 and sodium oxalate at different molar ratios. Root length was measured with a ruler before and after treatment. The treatment period was 22 h. RESULTS To confirm Al resistance of buckwheat, the effect of Al on root elongation was compared between buckwheat and an Al-tolerant cultivar of wheat, Atlas 66 (Fig. 1). Twenty-five-micromolar Al treatment hardly inhibited the root elongation of buckwheat but inhibited the root elongation of cv Atlas 66 by about 35% during 16 h. This result was consistent with those obtained in relatively long-term treatment of buckwheat with Al (Zheng et al., 1998), which showed high Al resistance. Fig. 1. Open in new tabDownload slide Effect of Al on root elongation in buckwheat and wheat. Three-day-old seedlings were exposed to 0.5 mmCaCl2 solution, pH 4.5, containing no Al (white bars) or 25 μm AlCl3 (black bars) for 16 h. Error bars represent ±sd (n = 10). Fig. 1. Open in new tabDownload slide Effect of Al on root elongation in buckwheat and wheat. Three-day-old seedlings were exposed to 0.5 mmCaCl2 solution, pH 4.5, containing no Al (white bars) or 25 μm AlCl3 (black bars) for 16 h. Error bars represent ±sd (n = 10). One of the mechanisms responsible for this high Al resistance has been suggested to be the secretion of oxalic acid from the roots (Ma et al., 1997b). For collection of root exudates in the present study, although the plants were not grown under aseptic conditions, careful attention was always paid to keeping the roots clean by frequent renewal of solution and by immersing the roots in Ca solution overnight before the collection of root exudates. By monitoring the concentration of oxalic acid in the root exudates (both −Al and +Al) at different times, we found that the lack of aseptic conditions did not affect the concentration of oxalic acid (data not shown). The specificity of Al-induced secretion of oxalic acid was investigated by comparing it with the root's responses to P deficiency and La3+ treatment. Oxalic acid in root exudates was monitored every other day after the initiation of P-deficiency treatment, but no significant amount was secreted up to 11 d (Fig.2). When Al was added to the P-deficient roots on d 12 after the treatment, a significant amount of oxalic acid was secreted. Exposure to 50 μmLa3+ did not induce significant secretion of oxalic acid (Fig. 3), whereas Al at the same concentration induced secretion of oxalic acid at 0.70 ± 0.08 μmol h−1 g−1 root dry weight. Combined treatment with Al3+ and La3+ did not affect the secretion of oxalic acid induced by Al. Fig. 2. Open in new tabDownload slide Effect of P deficiency followed by Al treatment on the secretion of oxalic acid by buckwheat roots. Ten-day-old seedlings were grown in nutrient solution devoid of P, and root exudates were collected every other day in 0.5 mm CaCl2solution at pH 4.5 for 6 h. On d 12 and 14 after P deficiency, the roots were exposed to 50 μm Al solution, and the root exudates were collected for 6 h. After passage of the root exudates through a cation-exchange resin column followed by an anion-exchange resin column, the anionic fraction was eluted using 1m HCl and concentrated. Organic acids were analyzed by HPLC. Error bars represent ±sd (n = 3). Fig. 2. Open in new tabDownload slide Effect of P deficiency followed by Al treatment on the secretion of oxalic acid by buckwheat roots. Ten-day-old seedlings were grown in nutrient solution devoid of P, and root exudates were collected every other day in 0.5 mm CaCl2solution at pH 4.5 for 6 h. On d 12 and 14 after P deficiency, the roots were exposed to 50 μm Al solution, and the root exudates were collected for 6 h. After passage of the root exudates through a cation-exchange resin column followed by an anion-exchange resin column, the anionic fraction was eluted using 1m HCl and concentrated. Organic acids were analyzed by HPLC. Error bars represent ±sd (n = 3). Fig. 3. Open in new tabDownload slide Effect of La3+ and Al3+ on the secretion of oxalic acid by buckwheat roots. Seedlings were exposed to 0.5 mm CaCl2 solution, pH 4.5, containing 50 μm AlCl3, 50 μmLaCl3, or both. After 6 h the root exudates were collected and organic acids were analyzed as described in Figure 1. Error bars represent ±sd (n = 3). Fig. 3. Open in new tabDownload slide Effect of La3+ and Al3+ on the secretion of oxalic acid by buckwheat roots. Seedlings were exposed to 0.5 mm CaCl2 solution, pH 4.5, containing 50 μm AlCl3, 50 μmLaCl3, or both. After 6 h the root exudates were collected and organic acids were analyzed as described in Figure 1. Error bars represent ±sd (n = 3). A 3-h pulse with 150 μm Al induced secretion of oxalic acid at 0.93 ± 0.12 μmol h−1g−1 root dry weight during the first 3 h (Fig. 4). This level was maintained for 8 h in control solution without Al and then gradually decreased to the control level (−Al). In contrast, roots exposed to Al continued to secrete oxalic acid at a high level (Fig. 4). There are two possibilities for the pulse result. One is that Al might activate some biochemical process such that the secretion of oxalic acid was able to continue for several hours regardless of the Al concentration in the external solution or in the cell wall. The other is that when the roots were transferred from the Al solution to the Al-free solution, sufficient Al was left in the cell wall to trigger the secretion of oxalic acid for several hours. Since the roots were rinsed with 0.5 mm Ca solution, pH 4.5, several times and the solution was changed twice with the Ca solution during the collection of root exudates after pulse treatment, it is unlikely that sufficient Al was left in the cell wall. Fig. 4. Open in new tabDownload slide Effect of a 3-h pulse of 150 μm Al on the secretion of oxalic acid (□). Seedlings were exposed to 0.5 mm CaCl2 solution, pH 4.5, containing 150 μm AlCl3 for 3 h and subsequently to 0.5 mm CaCl2 solution, pH 4.5, without Al. Root exudates were collected during the periods 0 to 3, 3 to 7 , 7 to 11, and 27 to 31 h. For comparison, exudates of roots continuously exposed to 150 μm Al (○) or 0 μm (⋄) were also collected at the same interval. Organic acids were analyzed as described in Figure 1. Error bars represent ±sd(n = 3). Fig. 4. Open in new tabDownload slide Effect of a 3-h pulse of 150 μm Al on the secretion of oxalic acid (□). Seedlings were exposed to 0.5 mm CaCl2 solution, pH 4.5, containing 150 μm AlCl3 for 3 h and subsequently to 0.5 mm CaCl2 solution, pH 4.5, without Al. Root exudates were collected during the periods 0 to 3, 3 to 7 , 7 to 11, and 27 to 31 h. For comparison, exudates of roots continuously exposed to 150 μm Al (○) or 0 μm (⋄) were also collected at the same interval. Organic acids were analyzed as described in Figure 1. Error bars represent ±sd(n = 3). The concentration of oxalic acid was similar in both the 0- to 5- and the 5- to 10-mm sections in excised roots (Fig.5). When the 0- to 5-mm root segments were exposed to Al solution, a significant amount of oxalic acid was detected in the treatment solution compared with those exposed to control solution without Al (Fig. 5). A high amount of oxalic acid was released from the 5- to 10-mm root segments regardless of Al treatment. Only one peak corresponding to oxalic acid was observed on the HPLC chart in the exudates from the 0- to 5-mm root segments, whereas several peaks were observed in the exudates from 5- to 10-mm segments. This suggests that the high release of oxalic acid from the 5- to 10-mm segments resulted from wounded tissues, although the segments were washed three times with control solution before treatment. In net amount of oxalic acid secreted (the −Al treatment value subtracted from the value for +Al treatment), the amount secreted from the 0- to 5-mm section (0.46 nmol tip−1) was 3 times more than that from the 5- to 10-mm section (0.15 nmol tip−1). About 15.1 and 5.0% of soluble oxalic acid in the 0- to 5- and 5- to 10-mm segments were secreted during 3 h, respectively (Fig. 5). Fig. 5. Open in new tabDownload slide Al-induced secretion of oxalic acid from a different section of buckwheat roots. Excised root segments 0 to 5 and 5 to 10 mm from root tips were incubated in 0.5 mmCaCl2 solution, pH 4.5, containing 0 or 150 μm AlCl3 after washing. After 3 h the root exudates were collected. Soluble oxalic acid in the 0- to 5- and the 5- to 10-mm root segments were extracted with distilled water at 55°C. Organic acids were analyzed as described in Figure 1. Shown are the oxalic acid content in roots (white bars), oxalic acid excreted by the roots not treated with Al (black bars), and oxalic acid secreted by roots treated with Al (shaded bars). Error bars represent ±sd (n = 3). Fig. 5. Open in new tabDownload slide Al-induced secretion of oxalic acid from a different section of buckwheat roots. Excised root segments 0 to 5 and 5 to 10 mm from root tips were incubated in 0.5 mmCaCl2 solution, pH 4.5, containing 0 or 150 μm AlCl3 after washing. After 3 h the root exudates were collected. Soluble oxalic acid in the 0- to 5- and the 5- to 10-mm root segments were extracted with distilled water at 55°C. Organic acids were analyzed as described in Figure 1. Shown are the oxalic acid content in roots (white bars), oxalic acid excreted by the roots not treated with Al (black bars), and oxalic acid secreted by roots treated with Al (shaded bars). Error bars represent ±sd (n = 3). To avoid the release of organic acid from wounded tissue of excised roots, a nondestructive method was developed to determine the site of the secretion using intact roots. This method is based on the precipitation between AlCl3 and P at a neutral pH and the subsequent reaction of this Al-P complex with pyrocatechol violet (Ma et al., 1997c). The oxalic acid secreted by the roots chelates Al from the Al-P complex, and Al is removed by washing from the filter paper, resulting in a white spot. A white spot was observed when the roots were exposed to Al previously but not in the roots without Al treatment (Fig. 6). The secretion position was limited to 10 mm from the root tip. The amount of oxalic acid secreted was estimated to be 0.67 nmol root−1 from the standard solution of oxalic acid (Fig. 6). Fig. 6. Open in new tabDownload slide Location of secretion of oxalic acid (OX) along buckwheat roots. Fifteen roots exposed to 0 or 150 μm Al for 3 h were placed on the filter paper. After 8 h the amount of oxalic acid was assayed by the method described in Methods. For quantification, 5 μL of a 1- to 4-mmoxalic acid solution was spotted onto the filter paper and assayed by the same procedures as intact roots (top). Fig. 6. Open in new tabDownload slide Location of secretion of oxalic acid (OX) along buckwheat roots. Fifteen roots exposed to 0 or 150 μm Al for 3 h were placed on the filter paper. After 8 h the amount of oxalic acid was assayed by the method described in Methods. For quantification, 5 μL of a 1- to 4-mmoxalic acid solution was spotted onto the filter paper and assayed by the same procedures as intact roots (top). The effect of different anion-channel inhibitors on the secretion of oxalic acid in the presence of Al was examined. Neither DIDS nor A-9-C affected the Al-induced secretion of oxalic acid (Fig.7). However, PG decreased the amount of oxalic acid secreted by about 50%. It is noteworthy that the amount of oxalic acid secreted was enhanced 4-fold by NIF. Fig. 7. Open in new tabDownload slide Effect of anion-channel inhibitors on Al-induced secretion of oxalic acid. Seedlings were exposed to 0.5 mmCaCl2 solution, pH 4.5, containing 50 μm Al in the presence or absence of each inhibitor (10 μm). After 6 h root exudates were collected, and organic acids were analyzed as described in Figure 1. Error bars represent ±sd (n = 3). Fig. 7. Open in new tabDownload slide Effect of anion-channel inhibitors on Al-induced secretion of oxalic acid. Seedlings were exposed to 0.5 mmCaCl2 solution, pH 4.5, containing 50 μm Al in the presence or absence of each inhibitor (10 μm). After 6 h root exudates were collected, and organic acids were analyzed as described in Figure 1. Error bars represent ±sd (n = 3). Root elongation of buckwheat root during 16 h was not inhibited by either PG (10 μm) or Al (25 μm) addition alone (Fig. 8). However, when the roots were exposed to the Al solution in the presence of PG, the root elongation was inhibited by 40%. Fig. 8. Open in new tabDownload slide Combined effect of Al and PG on root elongation in buckwheat. Seedlings were exposed to 0.5 mmCaCl2 solution, pH 4.5, containing no Al (−Al), 25 μm Al (+Al), 10 μm PG, or 25 μm Al plus 10 μm PG for 16 h. Error bars represent ±sd (n = 10). Fig. 8. Open in new tabDownload slide Combined effect of Al and PG on root elongation in buckwheat. Seedlings were exposed to 0.5 mmCaCl2 solution, pH 4.5, containing no Al (−Al), 25 μm Al (+Al), 10 μm PG, or 25 μm Al plus 10 μm PG for 16 h. Error bars represent ±sd (n = 10). Twenty-micromolar Al3+ inhibited root elongation of corn by about 60% during 22 h (Fig.9), and Al-oxalate at a 2:1 ratio showed the same extent of toxicity. However, when the ratio of Al to oxalic acid changed to 1:1 and 1:2, the inhibition of root elongation was alleviated, with almost no inhibition at the 1:2 ratio. Fig. 9. Open in new tabDownload slide Effect of different molar ratios of Al to oxalic acid on the root elongation of corn. The Al concentration was 20 μm in 0.1 mm CaCl2 solution. Seedlings were exposed to different treatment solutions for 22 h. Error bars represent ±sd (n = 6). Fig. 9. Open in new tabDownload slide Effect of different molar ratios of Al to oxalic acid on the root elongation of corn. The Al concentration was 20 μm in 0.1 mm CaCl2 solution. Seedlings were exposed to different treatment solutions for 22 h. Error bars represent ±sd (n = 6). DISCUSSION Buckwheat shows high Al resistance compared with other species such as wheat, rape, and radish (Fig. 1; Zheng et al., 1998). One of the mechanisms responsible for its high resistance is the secretion of oxalic acid (Ma et al., 1997b) that occurs within 30 min after Al exposure and increases with increasing external Al concentration. In the present study the characteristics of such Al-induced secretion of oxalic acid was investigated. To examine the specificity of secretion, the response of roots to P deficiency and La treatments was compared with the response to Al treatment. La, which has the same charge as Al, is also reported to be toxic to plants (Bennet and Breen, 1992). It inhibits root elongation in both rice and pea more strongly than Al does (Ishikawa et al., 1996). On the other hand, secretion of organic acids has been reported to be a response of plants to P deficiency. White lupin and alfalfa secrete citric acid in response to P deficiency (Gardner et al., 1983; Lipton et al., 1987). Because Al is easily precipitated with P, organic acid secretion may be caused indirectly by Al-induced P deficiency (Miyasaka et al., 1991). However, the results have clearly indicated that neither P deficiency nor La addition induced significant secretion of oxalic acid (Figs. 2 and 3), suggesting that the secretion of oxalic acid is a specific response to Al stress. One day of P deficiency also failed to induce secretion of malic acid in wheat (Delhaize et al., 1993). In Cassia toraL., neither P deficiency nor La and Yb induced secretion of citric acid (Ma et al., 1997c). All of these findings indicate that the secretion of organic acids induced by Al is a response different from that to P deficiency. Usually, induction of organic acid secretion by P deficiency takes longer (more than 10 d; Johnson et al., 1996), but Al-induced secretion of organic acid occurs within several hours (Ryan et al., 1995a; Ma et al., 1997c). Secretion of citric acid and malic acid has been reported to be an important resistance mechanism for Al toxicity (Miyasaka et al., 1991;Delhaize et al., 1993; Pellet et al., 1995; Ma et al., 1997c). However, it is unknown whether the amount of organic acids secreted is sufficient to detoxify Al. The primary site of Al toxicity is localized to the root apex (Ryan et al., 1993); therefore, it is a prerequisite to protect the root apex from Al injury. In wheat and corn the secretion of organic acids was localized to the root apex using the divided-root-chamber technique (Delhaize et al., 1993; Pellet et al., 1995). Using excised roots and a nondestructive method, we also showed that the secretion site of oxalic acid was localized to the root apex (0–10 mm from root tip; Figs. 5 and 6). Some attempts have been made to estimate the concentration of organic acids at the root surface based on data concerning organic acid efflux in the bulk solution. However, such estimation is very difficult because there are many related factors, such as the thickness of the unstirred layer, the length of root apex that should be protected, the diffusion coefficient, mucilage, and so on (Ryan et al., 1995b). In the present study we used an anion-channel inhibitor to demonstrate that the secretion of oxalic acid is associated with Al resistance in buckwheat. One of the anion-channel inhibitors, PG, was found to inhibit secretion of oxalic acid (Fig. 7). When PG or Al alone was added to the solution, the root elongation of buckwheat was not inhibited, but when roots were exposed to Al in the presence of PG, the root elongation of buckwheat was inhibited by 40% (Fig. 8). This result indicates that the secretion of oxalic acid contributes to high Al resistance in buckwheat. In the Al-resistant genotype of wheat, malic acid was secreted from the root apex in response to Al stress (Delhaize et al., 1993), and this secretion was hypothesized to be through an anion channel located on the plasma membrane (Ryan et al., 1995a). In excised wheat roots, the anion-channel inhibitors NIF and A-9-C inhibited malic acid secretion, whereas DIDS had no effect (Ryan et al., 1995a). Recently, the same investigators reported that an anion channel in the apical cells of wheat roots was activated by Al3+ but not by La3+ (Ryan et al., 1997). In the present study we examined the effects of four kinds of anion-channel inhibitors on the secretion of oxalic acid in intact roots. One of them, PG, inhibited the secretion of oxalic acid, but DIDS and A-9-C had no effect on oxalic acid secretion (Fig. 7). NIF stimulated the secretion of oxalic acid. Moreover, the amount of secretion was increased with increasing external NIF concentrations (data not shown). We checked the secretion of oxalic acid when NIF was added alone (since NIF probably caused leakage of organic acids from roots), but none was detected. This result suggests that some interactions among Al, NIF, and anion channels caused enhancement of oxalic acid secretion, although the mechanism is not clear. Oxalic acid can form three species of complexes with Al depending on its concentration. The stability constants for 1:1, 1:2, and 1:3 complexes are 5.0, 9.3, and 12.4, respectively (Nordstrom and May, 1996). The bioassay experiment showed that the 1:2 complex of Al-oxalate was nonphytotoxic for corn (Fig. 9). The Al-citrate complex with a 1:1 ratio was found to be nontoxic to the root growth of corn using the same assay system (Ma et al., 1997a). The Al-citrate (1:1) complex has a stable constant of 10.72, which is close to that of the 1:2 Al-oxalate complex. These findings suggest that both the concentration and stability constant of a chelator are important in detoxifying Al. In conclusion, we found that the secretion of oxalic acid was a specific response to Al stress in buckwheat roots. This secretion occurred at the root apex and was associated with high Al resistance. ACKNOWLEDGMENTS We are grateful to Dr. Ren Fang Sheng at the Soil Research Institute (Academic Sinica of China) for providing buckwheat seeds. Abbreviations: A-9-C anthracene-9-carboxylic acid DIDS 4,4′-diisothiocyanatostilbene-2,2′-disulfonate NIF niflumic acid PG phenylglyoxal LITERATURE CITED 1 Bennet RJ Breen CM The use of lanthanum to delineate the aluminum signalling mechanisms functioning in the roots of Zea mays L. Environ Exp Bot 32 1992 365 376 Google Scholar Crossref Search ADS WorldCat 2 Delhaize E Ryan PR Randall PJ Aluminum tolerance in wheat (Triticum aestivum L.). II. Aluminum-stimulated excretion of malic acid from root apices. Plant Physiol 103 1993 695 702 Google Scholar Crossref Search ADS PubMed WorldCat 3 Foy CD Chaney RL White MC The physiology of metal toxicity in plants. Annu Rev Plant Physiol 29 1978 511 566 Google Scholar Crossref Search ADS WorldCat 4 Fuente JM Ramirez-Rodriguez V Cabrera-Ponce JL Herrera-Estrella L Aluminum tolerance in transgenic plants by alteration of citrate synthesis. Science 276 1997 1566 1568 Google Scholar Crossref Search ADS PubMed WorldCat 5 Gardner WK Barber DA Parberry DG The acquisition of phosphorus by Lupinus albus L. III. The probable mechanism by which phosphorus movement in soil/root interface is enhanced. Plant Soil 70 1983 107 124 Google Scholar Crossref Search ADS WorldCat 6 Hue NV Craddock GR Adams F Effect of organic acids on aluminum toxicity in subsoils. Soil Sci Soc Am J 50 1986 28 34 Google Scholar Crossref Search ADS WorldCat 7 Ishikawa S Wagatsuma T Ikarashi T Comparative toxicity of Al3+, Yb3+ and La3+ to root-tip cells differing in tolerance to high Al3+ in terms of ionic potentials of dehydrated trivalent cations. Soil Sci Plant Nutr 42 1996 613 625 Google Scholar Crossref Search ADS WorldCat 8 Johnson JF Vance CP Allan D Phosphorus deficiency in Lupinus albus. Altered lateral root development and enhanced expression of phosphoenolpyruvate carboxylase. Plant Physiol 112 1996 31 41 Google Scholar Crossref Search ADS PubMed WorldCat 9 KochianLV Cellular mechanisms of aluminum toxicity and resistance in plants. Annu Rev Plant Physiol Plant Mol Biol 46 1995 237 260 Google Scholar Crossref Search ADS WorldCat 10 Lipton DS Blanchar RW Blevins DG Citrate, malate, and succinate concentration in exudates from P-sufficient and P-stressed Medicago sativa L. seedlings. Plant Physiol 85 1987 315 317 Google Scholar Crossref Search ADS PubMed WorldCat 11 Ma JF Hiradate S Nomoto K Iwashita T Matsumoto H Internal detoxification mechanism of Al in hydrangea. Identification of Al form in the leaves. Plant Physiol 113 1997a 1033 1039 Google Scholar Crossref Search ADS WorldCat 12 Ma JF Zheng SJ Hiradate S Matsumoto H Detoxifying aluminum with buckwheat. Nature 390 1997b 569 570 Google Scholar Crossref Search ADS WorldCat 13 Ma JF Zheng SJ Matsumoto H Specific secretion of citric acid induced by Al stress in Cassia tora L. Plant Cell Physiol 38 1997c 1019 1025 Google Scholar Crossref Search ADS WorldCat 14 Miyasaka SC Bute JG Howell RK Foy CD Mechanism of aluminum tolerance in snapbean, root exudation of citric acid. Plant Physiol 96 1991 737 743 Google Scholar Crossref Search ADS PubMed WorldCat 15 Nordstrom DK May HM Aqueous equilibrium data for mononuclear aluminum species. Sposito G Environment Chemistry of Aluminum. 1996 39 80 CRC Press Boca Raton, FL 16 Pellet DM Grunes DL Kochian LV Organic acid exudation as an aluminum-tolerance mechanism in maize (Zea mays L.). Planta 196 1995 788 795 Google Scholar Crossref Search ADS WorldCat 17 Ryan PR Delhaize E Randall PJ Characterisation of Al-stimulated efflux of malate from the apices of Al-tolerant wheat roots. Planta 196 1995a 103 110 Google Scholar Crossref Search ADS WorldCat 18 Ryan PR Delhaize E Randall PJ Malate efflux from root apices and tolerance to aluminum are highly correlated in wheat. Aust J Plant Physiol 22 1995b 531 536 Google Scholar OpenURL Placeholder Text WorldCat 19 Ryan PR DiTomaso JM Kochian LV Aluminum toxicity in roots: an investigation of spatial sensitivity and the role of the root cap. J Exp Bot 44 1993 437 446 Google Scholar Crossref Search ADS WorldCat 20 Ryan PR Skerrett M Findlay GP Delhaize E Tyerman SD Aluminum activates an anion channel in the apical cells of wheat roots. Proc Natl Acad Sci USA 94 1997 6547 6552 Google Scholar Crossref Search ADS PubMed WorldCat 21 Taylor GJ Current views of the aluminum stress response: the physiological basis of tolerance. Curr Top Plant Biochem Physiol 10 1991 57 93 Google Scholar OpenURL Placeholder Text WorldCat 22 Zheng SJ, Ma JF, Matsumoto H (1998) Continuous secretion of organic acid is related to aluminum resistance in relatively long-term exposure to aluminum stress. Physiol Plant (in press) Author notes 1 This study was supported in part by a grant-in-aid for Scientific Research, for Encouragement of Young Scientists, for Creative Basic Research, for Japan Society for the Promotion of Science Fellows, and for Scientific Research on Priority Areas from the Ministry of Education, Science, Sports and Culture of Japan, by a Sunbor grant, and by the Ohara Foundation for Agricultural Sciences. 2 Present address: College of Resources and Environment, Nanjing Agricultural University, Nanjing 210095, Peoples' Republic of China. * Corresponding author; e-mail [email protected]; fax 81–86–434–1249. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Inoue, Kentaro; Sewalt, Vincent J.H.; Murray Ballance, G.; Ni, Weiting; Stürzer, Cornelia; Dixon, Richard A.

doi: 10.1104/pp.117.3.761pmid: 9662519

Abstract The biosynthesis of monolignols can potentially occur via two parallel pathways involving free acids or their coenzyme A (CoA) esters. Caffeic acid 3-O-methyltransferase (COMT) and caffeoyl CoA 3-O-methyltransferase (CCOMT) catalyze functionally identical reactions in these two pathways, resulting in the formation of mono- or dimethoxylated lignin precursors. The activities of the two enzymes increase from the first to the sixth internode in stems of alfalfa (Medicago sativa L.), preceding the deposition of lignin. Alfalfa CCOMT is highly similar at the amino acid sequence level to the CCOMT from parsley, although it contains a six-amino acid insertion near the N terminus. Transcripts encoding both COMT and CCOMT are primarily localized to vascular tissue in alfalfa stems. Alfalfa CCOMT expressed in Escherichia coli catalyzesO-methylation of caffeoyl and 5-hydroxyferuloyl CoA, with preference for caffeoyl CoA. It has low activity against the free acids. COMT expressed in E. coli is active against both caffeic and 5-hydroxyferulic acids, with preference for the latter compound. Surprisingly, very little extractableO-methyltransferase activity versus 5-hydroxyferuloyl CoA is present in alfalfa stem internodes, in which relativeO-methyltransferase activity against 5-hy-droxyferulic acid increases with increasing maturity, correlating with increased lignin methoxyl content. Lignin is a complex phenylpropanoid polymer that is located in the cell walls of conducting and supporting tissues such as vascular elements and phloem fibers, where it provides hydrophobicity and mechanical strength. It is also utilized by plants as an inducible physical barrier against pathogen infection (Vance et al., 1980). The chemical treatments needed to remove lignin during the paper- pulping process are expensive and environmentally unfriendly (Boudet and Grima-Pettenati, 1996). Lignin also negatively affects forage digestibility (Albrecht et al., 1987; Sewalt et al., 1997c), the extent of which depends on its monomeric composition (Buxton and Russell, 1988), tissue distribution (Akin, 1989), and phenolic functionality (Sewalt et al., 1997a). Thus, there is currently considerable interest in the prospects for altering lignin quantity or quality by genetic engineering (Boudet and Grima-Pettenati, 1996; Campbell and Sederoff, 1996; Sewalt et al., 1997b, 1997c). The building blocks of lignin are hydroxylated and methoxylated monomers derived from cinnamic acid. In dicotyledonous angiosperms, the major precursors are coniferyl and sinapyl alcohols, giving rise to the G (monohydroxy, monomethoxy) and S (monohydroxy, dimethoxy) components of the copolymer. A well-accepted pathway for the synthesis of these monomers involves methylation of caffeic acid to yield ferulic acid, followed by 5-hydroxylation of ferulate and a second methylation to yield sinapate (Fig.1). In angiosperms, a bifunctional OMT appears to be involved in these conversions (Davin and Lewis, 1992), catalyzing the methylation of both caffeic and 5-hydroxyferulic acids, although it is generally referred to as COMT (EC 2.1.1.6). COMT has been purified from a wide range of plant species, including alfalfa (Medicago sativa L.) and poplar (Edwards and Dixon, 1991; Van Doorsselaere et al., 1993), and has been cloned from alfalfa, aspen, corn, tobacco, poplar, eucalyptus, and zinnia (Bugos et al., 1991; Gowri et al., 1991; Collazo et al., 1992;Dumas et al., 1992; Jaeck et al., 1992; Poeydomenge et al., 1994; Ye and Varner, 1995). COMT transcripts are present at highest levels in organs containing vascular tissue (Bugos et al., 1991; Gowri et al., 1991; Collazo et al., 1992). OMTs active against caffeic acid are induced at the onset of lignification in plants responding to infection by viruses (Jaeck et al., 1992) and fungi (Maule and Ride, 1976). Reduction of COMT activity by antisense expression in transgenic plants results in changes in lignin content and/or composition (Dwivedi et al., 1994; Ni et al., 1994; Atanassova et al., 1995; Van Doorsselaere et al., 1995; Sewalt et al., 1997c). Brown-mid-rib mutants of maize and sorghum, which have altered lignin composition and reduced lignin concentration, have been shown to be deficient in COMT (Grand et al., 1985; Vignols et al., 1995) or COMT and cinnamyl alcohol dehydrogenase (Pillonel et al., 1991). Thus, a considerable body of evidence implicates COMT as an important enzyme of lignin biosynthesis. Fig. 1. Open in new tabDownload slide Alternative pathways for the methylation of monolignols. The enzymes are: PAL, l-phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; C3H, coumarate 3-hydroxylase; COMT, bispecific caffeic acid/5-hydroxyferulic acidO-methyltransferase; F5H, ferulate 5-hydroxylase; CC3H, coumaroyl CoA 3-hydroxylase; CCOMT, bispecific caffeoyl/5-hydroxyferuolyl CoA O-methyltransferase; 4CL, coumarate (hydroxycinnamate) CoA ligase; CCR, cinnamoyl CoA reductase; and CAD, coniferyl alcohol dehydrogenase. Dashed arrows represent reactions that have yet to be clearly demonstrated in vitro. cDNA clones encoding enzymes marked in bold were obtained from alfalfa. In some species, 4CL has very little activity with sinapate as substrate. Fig. 1. Open in new tabDownload slide Alternative pathways for the methylation of monolignols. The enzymes are: PAL, l-phenylalanine ammonia-lyase; C4H, cinnamate 4-hydroxylase; C3H, coumarate 3-hydroxylase; COMT, bispecific caffeic acid/5-hydroxyferulic acidO-methyltransferase; F5H, ferulate 5-hydroxylase; CC3H, coumaroyl CoA 3-hydroxylase; CCOMT, bispecific caffeoyl/5-hydroxyferuolyl CoA O-methyltransferase; 4CL, coumarate (hydroxycinnamate) CoA ligase; CCR, cinnamoyl CoA reductase; and CAD, coniferyl alcohol dehydrogenase. Dashed arrows represent reactions that have yet to be clearly demonstrated in vitro. cDNA clones encoding enzymes marked in bold were obtained from alfalfa. In some species, 4CL has very little activity with sinapate as substrate. Work with parsley and carrot cell-suspension cultures has drawn attention to an alternative pathway for methylation of hydroxycinnamic acid derivatives. An enzyme that converts caffeoyl CoA to feruloyl CoA (CCOMT, EC 2.1.1.104; Fig. 1) was shown to be induced by elicitor treatment in both systems (Kühnl et al., 1989; Pakusch et al., 1989). This enzyme was proposed to be involved in the synthesis of wall-esterified ferulic acid as a component of the plant's defense response (Kühnl et al., 1989; Pakusch et al., 1989). More recently, however, studies of vascular differentiation in isolated mesophyll protoplasts of zinnia have shown that CCOMT transcripts and activity are highly induced during appearance of tracheary elements, whereas COMT activity did not correlate with lignification of these elements in this system (Ye et al., 1994). COMT transcripts appeared to be localized to phloem and xylem fibers rather than to tracheary elements in zinnia stems (Ye and Varner, 1995). Strong down-regulation of bispecific COMT by antisense expression in tobacco and poplar leads to the production of lignin with a decreased S:G ratio that also contains 5-hydroxy-G residues (Atanassova et al., 1995; Van Doorsselaere et al., 1995). This suggests that COMT and CCOMT may be functionally redundant with respect to methylation of the caffeate moiety but that CCOMT does not effectively methylate the 5-hydroxyferulate moiety in vivo. Clearly, more studies of the biochemical properties of CCOMT and its expression relative to that of COMT are needed. Little is known about the comparative developmental expression of both COMT and CCOMT in the same species. Although it has been shown that the two enzymes are differentially expressed in zinnia stems (Ye and Varner, 1995), this study did not address how the enzymes change during stem development in relation to changes in lignin content and composition. After characterizing and cloning alfalfa COMT (Edwards and Dixon, 1991; Gowri et al., 1991), we have now isolated and functionally characterized a cDNA clone encoding the alfalfa CCOMT. We present here a comparative study of the developmental expression and catalytic properties of alfalfa COMT and CCOMT. These studies provide a basis for the targeted genetic manipulation of lignin biosynthesis in a key forage crop by altering expression of multiple OMTs. MATERIALS AND METHODS Sampling of Alfalfa (Medicago sativaL.) Tissue Internodes from greenhouse-grown alfalfa plants (cv Apollo) were ground under liquid nitrogen and part of the powdered tissue was stored at −70°C for enzyme assays. The remaining portion was freeze dried for lignin analyses. Chemicals 5-Hydroxyferulic acid was synthesized via 5-hydroxyvanillin by the methods of Banerjee et al. (1962) and Pearl and Beyer (1951). Its structure was confirmed by 1H- and13C-NMR analysis. CoA esters of caffeic and 5-hydroxyferulic acids were prepared according to the method ofStöckigt and Zenk (1975), and identified and quantified spectrophotometrically as described by Lüderitz et al. (1982). Enzyme Extraction and Assay Powdered plant tissue was extracted for 20 min at 4°C in extraction buffer (100 mm Tris-HCl, 0.2 mmMgCl2, 2.0 mm DTT, and 10% [v/v] glycerol). The extraction buffers for COMT and CCOMT differed in pH (7.2 for COMT, 7.5 for CCOMT). After the sample was centrifuged (12,000g, 4°C, 10 min), extracts were desalted on a PD-10 column (Pharmacia). Soluble-protein concentration in the enzyme extracts was determined using the Bradford dye-binding reagent (Bio-Rad) with BSA as the standard. Enzyme activities were assayed as described previously for COMT (Gowri et al., 1991) and CCOMT (Ni et al., 1996). When reaction products were monitored by HPLC, nonlabeledS-adenosyl l-Met was used as a methyl donor. The reaction was terminated by addition of 10 μL of 1 n HCl. After the insoluble material was removed by centrifugation at 10,000g for 5 min, 20 μL of supernatant was subjected directly to HPLC as follows: column, ODS2 (Waters, 5 μm, 250 × 4.6 mm); gradient elution, solvent A (1% H3PO4) and solvent B (CH3CN) (gradient: 0–5 min, 5% solvent B; 5–10 min, 5–10% solvent B; 10–25 min, 10–17% solvent B; 25–35 min, 17–29% solvent B; 35–36 min, 29–100% solvent B); flow rate, 1.0 mL/min; detection, diode array. Determination of Lignin Concentration Powdered tissue was freeze dried, ground to pass a 1-mm sieve, and extracted with boiling neutral detergent (Van Soest et al., 1991) using filter bags in a batch fiber analyzer (ANKOM, Fairport, NY). The residual neutral detergent fiber, a pectin-free cell wall preparation, was oven dried (55°C) and used for quantitation of Klason lignin according to the work of Kaar et al. (1991), modified for microanalytical scale. Briefly, 100 mg of neutral detergent fiber was suspended in 1 mL of 72% H2SO4 in 50-mL reaction tubes kept in a water bath at 30°C for 1 h. The initial hydrolysis was followed by dilution to 4% H2SO4 and autoclaving at 121°C for 1 h. The hydrolysis mixture was passed through a previously tared glass-fiber filter (Whatman grade 934 AH, particle retention 1.5 mm) in a tared 30-mL gooch crucible of medium porosity (pore size, 4–5.5 μm). The residue (Klason lignin) and filter were oven dried overnight (105°C) and weighed. Acid-soluble lignin was estimated in the filtrate by UV absorption at 205 nm (Technical Association of the Pulp and Paper Industry, 1989). Determination of Lignin Methoxyl Content Lignin methoxyl groups were determined by reaction of Klason lignin with 3 mL of hydriodic acid (57%) in 22-mL vials equipped with Teflon-lined valves and heated for 25 to 30 min at 130°C in a dry bath (Baker, 1996). After the sample was cooled on ice an appropriate amount of internal standard (ethyl iodide) and 3 mL of pentane were added (through the valve). The mixture was vortexed and placed on ice for 2 min to minimize volatilization, and 1 mL of the pentane phase was placed in glass vials for GC analysis of methyl iodide (released from lignin methoxyl groups) and ethyl iodide (internal standard). The GC column and conditions were as described by Baker (1996) with the following adaptations: the column temperature was 40°C for 2 min, then increased to 80°C (10°C/min), and then held at 80°C for 1 min; the run time was 7 min. Accuracy of the quantitation was confirmed by comparison of the GC method with standard T 209 su-72 (Technical Association of the Pulp and Paper Industry, 1972), using a mixed hardwood lignin sample. RNA-Blot Analysis RNA was prepared according to the method of Chomczynski and Sacchi (1987). Samples of total RNA (10 μg) were fractionated on a formaldehyde/denaturing gel according to standard procedures (Sambrook et al., 1989) and blotted to a Hybond N nylon membrane (Amersham) according to the manufacturer's instructions. Blots were probed with32P-labeled alfalfa COMT and CCOMT cDNAs and washed at high stringency (final wash 0.2× SSC and 0.1% SDS at 68°C). Tissue Print Analysis Plants with at least eight internodes were sampled. Counting from the top (the youngest internode), tissue prints and corresponding stem sections were prepared for the second, third, fifth, and seventh internodes. Nylon membranes (GeneScreen, DuPont) were used without pretreatment. The membrane was placed on top of three layers of Whatman 1MM paper. The face of the stem freshly cut with a double-edge razor blade was printed onto a membrane for 15 to 30 s. After printing, the stem was sectioned to a 100-mm thickness and then stained for 1 min with 1% aqueous safranin O for observation of stem anatomy. The printed membrane was UV illuminated using a UV Stratalinker (Stratagene), air dried overnight, washed in 0.2× SSC and 1% SDS for 2 h at 65°C, and prehybridized for 2 h at 68°C in DIG Easy Hyb (Boehringer Mannheim). Plasmids containing alfalfa COMT and CCOMT cDNAs in pBluescript SK(−) were linearized by digestion with either HindIII orSmaI and used as templates for the in vitro synthesis of digoxigenin-labeled sense and antisense RNA probes. The probes were synthesized according to the manufacturer's protocol (Boehringer Mannheim). Hybridization of the probes to the membrane was carried out at 68°C for 16 h. The membrane was washed two times for 10 min each in 2× SSC and 0.1% SDS at room temperature and then two times for 20 min each in 0.2× SCC and 0.1% SDS at 68°C. Immunological color detection of digoxigenin-labeled probes was performed using anti-digoxigenin-alkaline phosphatase and nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate p-toluidine salt (Boehringer Mannheim) according to the manufacturer's instructions. Expression of COMT and CCOMT in E. coli COMT and CCOMT cDNAs were expressed in E. coli from the pBluescript SK(−) (Stratagene) vector, as described previously for alfalfa COMT (Gowri et al., 1991). The polylinker region at the 5′ end of the pCCOMT1 open reading frame was modified by the addition of 4 bp to place the CCOMT-coding sequence in-frame with the lacZ initiation codon, with no intervening stop codons. This was done by filling inBamHI recessed ends followed by blunt- end re-ligation. All procedures were performed at 4°C unless otherwise stated.E. coli DH5α transformed with pBluescript SK(−), pCOMT1, or pCCOMT1 was grown at 37°C in Luria-Bertani medium (Bio101, Inc., Vista, CA) with 50 μg/mL ampicillin until the culture reached stationary phase. The cells were harvested by centrifugation for 15 min at 3,800g and resuspended in a buffer containing 100 mm Tris-HCl, pH 7.5, 2.0 mm DTT, 0.20 mm MgCl2, and 10% glycerol. Insoluble materials were removed by centrifugation at 10,000g for 5 min. The resultant supernatant was desalted on a PD-10 column (Pharmacia) and then concentrated using Centricon-10 (Amicon, Beverly, MA). OMT activities of the protein solution were examined as described above with the following modifications: the reaction was performed for 20 min at 30°C, and the reaction mixtures (50 μL) contained 100 mm Tris-HCl, pH 7.5, 2.0 mm DTT, 0.20 mm MgCl2, 10% glycerol, 0.1 mm each phenolic substrate, 0.06 mm [14C]S-adenosyll-Met (13 mCi/mmol), and 20 μg of protein. RESULTS AND DISCUSSION Activity of COMT and CCOMT in Relation to Lignification Individual alfalfa internodes of progressive maturity were assayed for COMT, CCOMT, and Klason lignin. A typical profile is shown in Figure 2, in which total amounts of enzyme activity per internode are compared with total lignin accumulation (in milligrams) per internode. A large increase in activity of both COMT and CCOMT occurred before complete elongation (in the third visible internode) and was maintained during active lignification. Apparently, the first large increment in lignin accumulation lags behind the initial increase in activity of methylating enzymes by about 36 to 48 h (the approximate time difference in development of consecutive internodes). CCOMT activity appeared to be higher than that of COMT in this experiment, although activities of the two enzymes were more similar to each other in subsequent experiments (see below). This apparent discrepancy might be due to the fact that the concentration of caffeic acid in the COMT assay was 0.5 mm in the experiment shown in Figure 2but 0.1 mm (the concentration of caffeoyl CoA in both experiments) in the experiment shown in Figure 7. Fig. 2. Open in new tabDownload slide Activities of OMTs in developing alfalfa stem internodes. Total activities of COMT (white bars) and CCOMT (shaded bars) are shown in individual alfalfa internodes in relation to the total amount of lignin (line) per internode. Fig. 2. Open in new tabDownload slide Activities of OMTs in developing alfalfa stem internodes. Total activities of COMT (white bars) and CCOMT (shaded bars) are shown in individual alfalfa internodes in relation to the total amount of lignin (line) per internode. Fig. 7. Open in new tabDownload slide OMT substrate preference in alfalfa stem internodes in relation to lignin composition. A, Lignin content in individual internodes (counting from the top). DM, Dry matter. B, Lignin methoxyl content. C, OMT activity against free acid substrates. ○, Activity against caffeic acid; •, activity against 5-OH ferulic acid. D, OMT activity against CoA esters. ○, Activity against caffeoyl CoA; •, activity against 5-hydroxyferuloyl CoA. Error bars represent sd above and below the mean (n = 3 individual plants). Fig. 7. Open in new tabDownload slide OMT substrate preference in alfalfa stem internodes in relation to lignin composition. A, Lignin content in individual internodes (counting from the top). DM, Dry matter. B, Lignin methoxyl content. C, OMT activity against free acid substrates. ○, Activity against caffeic acid; •, activity against 5-OH ferulic acid. D, OMT activity against CoA esters. ○, Activity against caffeoyl CoA; •, activity against 5-hydroxyferuloyl CoA. Error bars represent sd above and below the mean (n = 3 individual plants). Molecular Cloning of Alfalfa CCOMT PCR amplification of parsley genomic DNA was used to obtain a partial-length CCOMT sequence for screening an alfalfa cDNA library prepared from RNA isolated from elicited cell cultures (Dalkin et al., 1990). The primers used for PCR amplification corresponded to nucleotides 470 to 490 and 896 to 916 of the parsley CCOMT sequence (Schmitt et al., 1991) and resulted in the amplification of a 900-bp fragment, as opposed to the predicted 446-bp fragment, suggesting the presence of an intron. After the identity was confirmed by sequence analysis of 3′ and 5′ ends, the partial clone was used to screen the alfalfa cDNA library. A single, full-length alfalfa CCOMT cDNA was isolated, which was 83% identical and 93% similar to the parsley CCOMT at the amino acid level (Fig. 3). The nucleotide sequence of the alfalfa CCOMT cDNA can be found in the GenBank database, accession no. U20736. The alfalfa CCOMT had a six-amino acid insertion in the N-terminal region compared with the parsley enzyme. This insertion is not present in CCOMT from zinnia (Ye et al., 1994) or Stellaria longipes (Zhang et al., 1995). Its presence in alfalfa CCOMT was confirmed by sequencing two additional independent clones from the cDNA library. Fig. 3. Open in new tabDownload slide Comparison of the deduced amino acid sequences of alfalfa (Ms) and parsley (Pc) CCOMT. Six additional amino acids were found in the N-terminal region of the alfalfa sequence. Asterisks indicate nonconservative differences. Fig. 3. Open in new tabDownload slide Comparison of the deduced amino acid sequences of alfalfa (Ms) and parsley (Pc) CCOMT. Six additional amino acids were found in the N-terminal region of the alfalfa sequence. Asterisks indicate nonconservative differences. Southern-blot analysis indicated three hybridizing fragments recognized by the CCOMT probe in alfalfa genomic DNA digested withDraI, three fragments in EcoRI digests, and six fragments in EcoRV digests (data not shown). None of these enzymes cuts within the CCOMT open reading frame. In view of the tetraploid nature of alfalfa, CCOMT is probably encoded by at least two genes in the alfalfa genome. Developmental Expression of COMT and CCOMT Transcripts in Alfalfa The expression patterns of CCOMT transcripts in tissues of developing alfalfa plants were first determined using RNA-blot analysis (Fig. 4). CCOMT transcripts were most strongly expressed in stems, roots, and petioles, with low expression in nodules, flowers, and leaves. Maximal levels in stems were observed at 3 to 4 weeks of development, and the highest level of transcripts in stem tissue appeared to be in the third and fourth internodes. Measurement of CCOMT activities in the same internode samples as analyzed in Figure 4 gave values (pkat/mg protein) of 6.9 (internodes 1 and 2), 20.7 (internodes 3 and 4), 19.6 (internodes 5 and 6), and 17.4 (internodes 7 and 8), showing a good correlation between enzyme activity and transcript level except in internodes 5 and 6. Probing the same blot with a COMT probe revealed a nearly identical pattern of developmental expression, with highest levels of expression in stems and roots after 3 to 4 weeks of development (data not shown). These observations confirm the results of previous alfalfa COMT transcript expression studies of Gowri et al. (1991). Fig. 4. Open in new tabDownload slide Tissue distribution of CCOMT transcripts in developing alfalfa seedlings. Total RNA from various alfalfa organs harvested from plants grown for the number of weeks shown was subjected to northern-blot analysis, using the full-length alfalfa CCOMT sequence as probe. The numbers for stem segments indicate internode number from the top of the plant. The blot was reprobed with an rRNA sequence to check for loading and transfer efficiency. pt., Point. Fig. 4. Open in new tabDownload slide Tissue distribution of CCOMT transcripts in developing alfalfa seedlings. Total RNA from various alfalfa organs harvested from plants grown for the number of weeks shown was subjected to northern-blot analysis, using the full-length alfalfa CCOMT sequence as probe. The numbers for stem segments indicate internode number from the top of the plant. The blot was reprobed with an rRNA sequence to check for loading and transfer efficiency. pt., Point. In zinnia, COMT and CCOMT transcripts are differentially localized to different cell types during vascular development (Ye and Varner, 1995). To examine the cellular distribution of COMT and CCOMT transcripts in alfalfa stems, tissue prints were made of alfalfa stem internodes at different developmental stages. The location of the hybridization signal was determined by superimposition of the signals on the tissue prints with sections stained to show the cellular anatomy. Transcripts encoding both COMT and CCOMT were localized to the vascular tissue where lignin is deposited (Fig. 5). However, the temporal and spatial expression of the OMT transcripts was not identical. In the second internode, both COMT and CCOMT transcripts were localized to xylem tissue, most probably in the region in which xylem was differentiating. In contrast, COMT transcripts in the third and fifth internodes were mainly localized to xylem, whereas CCOMT transcripts were detected in both xylem and phloem. Signals for both COMT and CCOMT transcripts were faint in tissue prints of the seventh internode but were still clearly localized to xylem (data not shown). Control hybridizations with COMT and CCOMT sense RNA probes gave no signal on prints of any of the internodes. Fig. 5. Open in new tabDownload slide Tissue print localization of COMT and CCOMT transcripts in alfalfa stem internodes. Pictures indicate anatomy and COMT and CCOMT transcript distribution in the second (A–C), third (D–F), and fifth (G–I) internodes from the top of the stem. A, D, and G show sections stained with safranin O. B, E, and H are corresponding tissue prints hybridized with a COMT antisense probe, and C, F, and I are prints hybridized with a CCOMT antisense probe. p, Phloem; and x, xylem. Bars = 1.0 mm. Fig. 5. Open in new tabDownload slide Tissue print localization of COMT and CCOMT transcripts in alfalfa stem internodes. Pictures indicate anatomy and COMT and CCOMT transcript distribution in the second (A–C), third (D–F), and fifth (G–I) internodes from the top of the stem. A, D, and G show sections stained with safranin O. B, E, and H are corresponding tissue prints hybridized with a COMT antisense probe, and C, F, and I are prints hybridized with a CCOMT antisense probe. p, Phloem; and x, xylem. Bars = 1.0 mm. The above localization pattern is different from that reported in zinnia, where COMT transcripts were predominantly localized to phloem fibers and CCOMT transcripts were mainly present in the xylem of the younger internodes (Ye and Varner, 1995). However, in addition to demonstrating that both COMT and CCOMT can be expressed in the same cell types in alfalfa, our data are also consistent with the hypothesis of Ye and Varner (1995) that the two enzymes may be involved in the formation of different types of lignin in different cell types. Substrate Specificities of Alfalfa COMT and CCOMT Expression studies in E. coli were performed for two reasons: first, to provide functional evidence for the identity of the presumed CCOMT cDNA, especially in view of the sequence insertion at the N terminus, and second, to obtain information concerning the relative substrate specificities of COMT and CCOMT. In particular, the activities of the two enzymes against 5-hydroxyferuloyl CoA had not been tested until now. Alfalfa COMT (Gowri et al., 1991) and CCOMT cDNAs were engineered into the pBluescript E. coliexpression vector. The target protein accumulation in the bacterial cell lysate was not induced significantly by addition of isopropyl-β-thiogalactopyranoside (up to 1 mm) as previously demonstrated (Gowri et al., 1991). Therefore, stationary-phase culture without isopropyl-β-thiogalactopyranoside treatment was used as an enzyme source. The protein extracts from E. coli harboring pCCOMT1 methylated CoA esters efficiently (TableI). The activity was absent in controls using the cell lysate from E. coli transformed with the vector pBluescript SK(−). The CCOMT-mediated reaction was also monitored by HPLC (Fig. 6). A small but significant conversion of the CoA esters to free acids was observed, which might be due to esterases present in the protein extracts. However, the UV/visible spectrum of the compound corresponding to product peak C in Figure 6 confirmed that it was indeed a CoA ester (sinapoyl CoA, data not shown). These results confirm that the pCCOMT1 cDNA clone encodes a protein with CCOMT activity. Table I. Relative activities of E. coli expressed alfalfa COMT and CCOMT against hydroxycinnamic acids and their corresponding CoA esters Plasmid . Substrate . Caffeic acid . 5-Hydroxyferulic acid . Caffeoyl CoA . 5-Hydroxyferuloyl CoA . pBluescript SK(−) 0.0  ± 0.0 0.0  ± 0.0 0.1  ± 0.0 0.1  ± 0.0 pCOMT1 8.8  ± 0.6 (1)a 19.5  ± 0.4 (2.2) 3.8  ± 0.0 (0.4) 10.1  ± 0.9 (1.1) pCCOMT1 0.4  ± 0.0 (1) 5.4  ± 0.4 (15.5) 46.0  ± 1.0 (131) 26.5  ± 1.7 (75) Plasmid . Substrate . Caffeic acid . 5-Hydroxyferulic acid . Caffeoyl CoA . 5-Hydroxyferuloyl CoA . pBluescript SK(−) 0.0  ± 0.0 0.0  ± 0.0 0.1  ± 0.0 0.1  ± 0.0 pCOMT1 8.8  ± 0.6 (1)a 19.5  ± 0.4 (2.2) 3.8  ± 0.0 (0.4) 10.1  ± 0.9 (1.1) pCCOMT1 0.4  ± 0.0 (1) 5.4  ± 0.4 (15.5) 46.0  ± 1.0 (131) 26.5  ± 1.7 (75) Activities are expressed as specific activities (pkat/mg protein), means ± sd (n = 2). F0-a Numbers in parentheses indicate activities relative to that for caffeic acid. Open in new tab Table I. Relative activities of E. coli expressed alfalfa COMT and CCOMT against hydroxycinnamic acids and their corresponding CoA esters Plasmid . Substrate . Caffeic acid . 5-Hydroxyferulic acid . Caffeoyl CoA . 5-Hydroxyferuloyl CoA . pBluescript SK(−) 0.0  ± 0.0 0.0  ± 0.0 0.1  ± 0.0 0.1  ± 0.0 pCOMT1 8.8  ± 0.6 (1)a 19.5  ± 0.4 (2.2) 3.8  ± 0.0 (0.4) 10.1  ± 0.9 (1.1) pCCOMT1 0.4  ± 0.0 (1) 5.4  ± 0.4 (15.5) 46.0  ± 1.0 (131) 26.5  ± 1.7 (75) Plasmid . Substrate . Caffeic acid . 5-Hydroxyferulic acid . Caffeoyl CoA . 5-Hydroxyferuloyl CoA . pBluescript SK(−) 0.0  ± 0.0 0.0  ± 0.0 0.1  ± 0.0 0.1  ± 0.0 pCOMT1 8.8  ± 0.6 (1)a 19.5  ± 0.4 (2.2) 3.8  ± 0.0 (0.4) 10.1  ± 0.9 (1.1) pCCOMT1 0.4  ± 0.0 (1) 5.4  ± 0.4 (15.5) 46.0  ± 1.0 (131) 26.5  ± 1.7 (75) Activities are expressed as specific activities (pkat/mg protein), means ± sd (n = 2). F0-a Numbers in parentheses indicate activities relative to that for caffeic acid. Open in new tab Fig. 6. Open in new tabDownload slide O-Methylation of hydroxycinnamoyl CoA esters by alfalfa CCOMT expressed in E. coli. HPLC chromatogram of the OMT reaction mixture using 5-hydroxyferuloyl CoA as substrate. For conditions, see Methods. Each peak was identified by direct comparison with authentic standards (B and D) and/or its UV/visible spectrum. A, 5-Hydroxyferuloyl CoA; B, 5-hydroxyferulic acid; C, sinapoyl CoA; and D, sinapic acid. No free acids (B and D) or sinapoyl CoA (C) were detected when the assay mixture was incubated without protein solution (upper trace). Fig. 6. Open in new tabDownload slide O-Methylation of hydroxycinnamoyl CoA esters by alfalfa CCOMT expressed in E. coli. HPLC chromatogram of the OMT reaction mixture using 5-hydroxyferuloyl CoA as substrate. For conditions, see Methods. Each peak was identified by direct comparison with authentic standards (B and D) and/or its UV/visible spectrum. A, 5-Hydroxyferuloyl CoA; B, 5-hydroxyferulic acid; C, sinapoyl CoA; and D, sinapic acid. No free acids (B and D) or sinapoyl CoA (C) were detected when the assay mixture was incubated without protein solution (upper trace). Cell-free extracts of the CCOMT-expressing bacteria also methylated free hydroxycinnamic acids. The activity with caffeic acid was less than 1% of that with caffeoyl CoA, whereas activity with 5-hydroxyferulic acid was about 20% of that with the corresponding CoA ester. The ratio of methylation of caffeoyl CoA to 5-hydroxyferuloyl CoA in the extracts of pCCOMT1-transformed E. coli was 1.7, whereas that of caffeic acid to 5-hydroxyferulic acid in pCOMT1-transformed bacteria was 0.45 (Table I). Thus, CCOMT preferentially methylates at the caffeoyl level, and COMT preferentially methylates at the 5-hydroxyferuloyl level. The cell-free extracts of E. coli transformed with pCOMT1 showed significant activity with the CoA esters (Table I), in good agreement with previous results (Meng and Campbell, 1996). However, no CoA ester products could be detected by HPLC (data not shown). Therefore, the substrates that are methylated by COMT in assays in which products are not individually separated are most likely the free acids formed by hydrolysis of the CoA esters in the protein extracts. Few studies have determined the relative substrate preferences of COMT and CCOMT against both caffeic and 5-hydroxyferulic acids and their CoA esters. Aspen lignin OMT purified after expression in E. coli has relative activity ratios of 100:220:36 against caffeic acid, 5-hydroxyferulic acid, and caffeoyl CoA, respectively (Meng and Campbell, 1996), similar to the results reported here for alfalfa COMT. In contrast, a novel multifunctional OMT has recently been cloned from loblolly pine (Li et al., 1997). This enzyme, when expressed in yeast, catalyzes the O-methylation of caffeic acid, 5-hydroxyferulic acid, caffeoyl CoA, and 5-hydroxyferuloyl CoA in relative activity ratios of 100:76:86:68. Developmental Patterns of OMT Substrate Preference in Alfalfa Stem Tissue in Relation to Lignin Composition Protein extracts from individual internodes of young alfalfa stems were assayed for OMT activity using caffeic acid, 5-hydroxyferulic acid, caffeoyl CoA, and 5-hydroxyferuloyl CoA as substrates under the appropriate assay conditions for COMT or CCOMT. Activities with caffeic acid and caffeoyl CoA were similar in this experiment (in contrast to the results shown in Fig. 2) and increased in parallel, preceding the changes in lignin deposition as shown in Figure 2. However, the highest activity occurred with 5-hydroxyferulic acid, and the ratio of activity with 5-hydroxyferulic acid to that with caffeic acid increased with increasing developmental age (Fig.7). This correlated with a steady increase in overall lignin methoxyl group content in successive internodes, suggesting an increased lignin S:G ratio, in agreement with the results of recent detailed analyses of lignin deposition during alfalfa stem differentiation (Vallet et al., 1996). Surprisingly, however, in view of the activity of both COMT and CCOMT with 5-hydroxyferuloyl CoA when expressed in E. coli, only very low activity with this compound was observed in alfalfa stem extracts, and this did not change significantly with developmental age. This contrasts with the situation in loblolly pine stem extracts, in which activity with 5-hydroxyferuloyl CoA is higher than with either caffeic or 5-hydroxyferulic acids (Li et al., 1997). In zinnia cells differentiating tracheary elements, OMT activity with 5-hydroxyferuloyl CoA is approximately one-half that with caffeoyl CoA, but both activities increase in parallel during vascular differentiation (Ye et al., 1994). It was recently demonstrated that another enzyme of lignin biosynthesis, 4-coumarate:CoA ligase, has a different substrate specificity for the (hydroxy) cinnamate moiety when expressed inE. coli than it does when assayed in stem extracts (Lee and Douglas, 1996), and it was suggested that additional cellular factors may be involved in controlling the substrate specificity of this enzyme. It is therefore now important to re-evaluate the substrate specificity of COMT and CCOMT following exhaustive purification from alfalfa stem extracts. In developing wheat seedlings, OMT activity against caffeic acid peaks early in development, prior to lignin deposition, and then declines, whereas OMT activity against 5-hydroxyferulic acid parallels the later process of lignification (Lam et al., 1996). In monocots, early esterification of cell wall arabinoxylans with ferulate residues may require a different OMT from that involved in lignification. Although the ratio of OMT activity with 5-hydroxyferulic acid compared with caffeic acid increases during development in alfalfa stems, the coordinated increase in both activities is still consistent with the involvement of a single class of bifunctional OMT for methylation of caffeic and 5-hydroxyferulic acids. Implications for the Genetic Engineering of Lignin The data indicating that CCOMT activity is at least as high as COMT activity throughout development in alfalfa stems and that both COMT and CCOMT are preferentially expressed in stem vascular tissue point to the probable importance of both OMTs in lignification. These observations also suggest the possible operation of a metabolic grid for the formation of monolignols. For example, 5-hy-droxyferulate could in theory be converted to sinapoyl CoA through the COMT reaction or, following CoA esterification, via the CCOMT reaction. Such a metabolic grid would provide a route for by-passing a metabolic block imposed via antisense down-regulation of one of the OMTs in transgenic plants. Experiments in which COMT has been down-regulated by antisense technology have sometimes, but not always, resulted in a decrease in the lignin S:G ratio (Dwivedi et al., 1994; Ni et al., 1994; Atanassova et al., 1995; Van Doorsselaere et al., 1995; Sewalt et al., 1997c). The differences in the results of different groups might be explained on the basis of different relative activities of COMT and CCOMT in the species under study or in tissues of the same species examined at different developmental stages. Our observation of the different substrate (caffeate moiety versus 5-hydroxyferulate moiety) preferences for COMT compared with CCOMT predicted a decrease in the S:G ratio on down-regulation of COMT in transgenic alfalfa, in view of the preferential activity of COMT in the production of the S moiety. The relatively poor utilization of the CoA ester pathway for the formation of S lignin that would be predicted from our results is consistent with the observation that a mutation in ferulate 5-hydroxylase in Arabidopsis leads to formation of lignin lacking S units (Chapple et al., 1992). Experiments are now in progress that utilize antisense strategies to down-regulate COMT and CCOMT singly and in combination. These studies should confirm whether each enzyme can compensate for reduced expression of the other, and whether they make identical or different contributions to the final pattern of lignin methoxylation. ACKNOWLEDGMENTS We thank Drs. San-Jung Lee and Tom Mabry for synthesis of 5-hydroxyferulic acid, David Huhman for assistance with GC analyses, Ralph Kowatsch for technical assistance, Cuc Ly and Darla Boydstone for help with graphics, and Drs. Dusty Post-Beittenmiller and William Schneider for critical reading of the manuscript. The nucleotide sequence data reported will appear in the EMBL, GenBank, and DDBJ nucleotide sequence databases under the accession no. U20736(alfalfaS-adenosyl-1-Met:trans-caffeoyl CoA 3-O-methyltransferase). Abbreviations: CCOMT caffeoyl CoA 3-O-methyltransferase COMT caffeic acid 3-O-methyltransferase G guaiacyl OMT O-methyltransferase S syringyl LITERATURE CITED 1 Akin DE Histological and physical factors affecting digestibility of forages. Agron J 81 1989 17 25 Google Scholar Crossref Search ADS WorldCat 2 Albrecht KA Wedin WF Buxton DR Cell-wall composition and digestibility of alfalfa stems and leaves. Crop Sci 27 1987 735 741 Google Scholar Crossref Search ADS WorldCat 3 Atanassova R Favet N Martz F Chabbert B Tollier M-T Monties B Fritig B Legrand M Altered lignin composition in transgenic tobacco expressing O-methyltransferase sequences in sense and antisense orientation. Plant J 8 1995 465 477 Google Scholar Crossref Search ADS WorldCat 4 Baker SM Rapid methoxyl analysis of lignins using gas chromatography. Holzforschung 50 1996 573 574 Google Scholar OpenURL Placeholder Text WorldCat 5 Banerjee SK Manolopoulo M Pepper JM The synthesis of lignin model substances: 5-hydroxyvanillin and 5-hydroxyacetoguaiacone. Can J Chem 40 1962 2175 2177 Google Scholar Crossref Search ADS WorldCat 6 Boudet AM Grima-Pettenati J Lignin genetic engineering. Mol Breeding 2 1996 25 39 Google Scholar Crossref Search ADS WorldCat 7 Bugos RC Chiang VLC Campbell WH cDNA cloning, sequence analysis and seasonal expression of lignin-bispecific caffeic acid/5-hydroxyferulic acid O-methyl-transferase of aspen. Plant Mol Biol 17 1991 1203 1215 Google Scholar Crossref Search ADS PubMed WorldCat 8 Buxton DR Russell JR Lignin constituents and cell-wall digestibility of grass and legume stems. Crop Sci 28 1988 553 558 Google Scholar Crossref Search ADS WorldCat 9 Campbell MM Sederoff RR Variation in lignin content and composition. Mechanisms of control and implications for the genetic improvement of plants. Plant Physiol 110 1996 3 13 Google Scholar Crossref Search ADS PubMed WorldCat 10 Chapple CCS Vogt T Ellis BE Somerville CR An Arabidopsis mutant defective in the general phenylpropanoid pathway. Plant Cell 4 1992 1413 1424 Google Scholar PubMed OpenURL Placeholder Text WorldCat 11 Chomczynski P Sacchi N Single step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction. Anal Biochem 162 1987 156 159 Google Scholar Crossref Search ADS PubMed WorldCat 12 Collazo P Montoliu L Puigdoménech P Rigau J Structure and expression of the lignin O-methyl-transferase gene from Zea mays L. Plant Mol Biol 20 1992 857 867 Google Scholar Crossref Search ADS PubMed WorldCat 13 Dalkin K Jorrin J Dixon RA Stress responses in alfalfa (Medicago sativa L.). VII. Induction of defense-related mRNAs in elicitor-treated cell suspension cultures. Physiol Mol Plant Pathol 37 1990 293 307 Google Scholar Crossref Search ADS WorldCat 14 Davin LB Lewis NG Phenylpropanoid metabolism: biosynthesis of monolignols, lignans and neolignans, lignins and suberins. Rec Adv Phytochem 26 1992 325 375 Google Scholar OpenURL Placeholder Text WorldCat 15 Dumas B Van Doorsselaere J Gielen J Legrand M Fritig B Van Montagu M Inzé D Nucleotide sequence of a complementary DNA encoding O-methyltransferase from poplar. Plant Physiol 98 1992 796 797 Google Scholar Crossref Search ADS PubMed WorldCat 16 Dwivedi UN Campbell WH Yu J Datla RSS Bugos RC Chiang VL Podila GK Modification of lignin biosynthesis in transgenic Nicotiana through expression of an antisense O-methyltransferase gene from Populus. Plant Mol Biol 26 1994 61 71 Google Scholar Crossref Search ADS PubMed WorldCat 17 Edwards R Dixon RA Purification and characterization of S-adenosyl-1-methionine: caffeic acid 3-O-methyl-transferase from suspension cultures of alfalfa (Medicago sativa L.). Arch Biochem Biophys 287 1991 372 379 Google Scholar Crossref Search ADS PubMed WorldCat 18 Gowri G Bugos RC Campbell WH Maxwell CA Dixon RA Stress responses in alfalfa (Medicago sativa L.). X. Molecular cloning and expression of S-adenosyl-1-methionine: caffeic acid 3-O-methyltransferase, a key enzyme of lignin biosynthesis. Plant Physiol 97 1991 7 14 Google Scholar Crossref Search ADS PubMed WorldCat 19 Grand CP Parmentier P Boudet A Boudet AM Comparison of lignins and of enzymes involved in lignification in normal and brown midrib (bm3) mutant corn seedlings. Physiol Veg 23 1985 905 911 Google Scholar OpenURL Placeholder Text WorldCat 20 Jaeck E Dumas B Geoffroy P Favet N Inzé D Van Montagu M Fritig B Legrand M Regulation of enzymes involved in lignin biosynthesis: induction of O-methyltransferase mRNAs during the hypersensitive reaction of tobacco to tobacco mosaic virus. Mol Plant-Microbe Interact 5 1992 294 300 Google Scholar Crossref Search ADS PubMed WorldCat 21 Kaar WE Cool LG Merriman MM Brink DL The complete analysis of wood polysaccharides using HPLC. J Wood Chem Technol 11 1991 447 463 Google Scholar Crossref Search ADS WorldCat 22 Kühnl T Koch U Heller W Wellmann E Elicitor induced S-adenosyl-1-methionine: caffeoyl-CoA 3-O-methyltransferase from carrot cell suspension cultures. Plant Sci 60 1989 21 25 Google Scholar Crossref Search ADS WorldCat 23 Lam TBT Iiyama K Stone BA Caffeic acid: O-me-thyltransferases and the biosynthesis of ferulic acid in primary cell walls of wheat seedlings. Phytochemistry 41 1996 1507 1510 Google Scholar OpenURL Placeholder Text WorldCat 24 Lee D Douglas CJ Two divergent members of a tobacco 4-coumarate: coenzyme A ligase (4CL) gene family. cDNA structure, gene inheritance and expression, and properties of recombinant proteins. Plant Physiol 112 1996 193 205 Google Scholar Crossref Search ADS PubMed WorldCat 25 Li L Popko JL Zhang X-H Osakabe K Tsai C-J Joshi CP Chiang VL A novel multifunctional O-methyltransferase implicated in a dual methylation pathway associated with lignin biosynthesis in loblolly pine. Proc Natl Acad Sci USA 94 1997 5461 5466 Google Scholar Crossref Search ADS PubMed WorldCat 26 Lüderitz T Shatz G Grisebach H Enzymic synthesis of lignin precursors. Purification and properties of 4-coumarate: CoA ligase from cambial sap of spruce (Picea abies L.). Eur J Biochem 123 1982 583 586 Google Scholar Crossref Search ADS PubMed WorldCat 27 Maule AJ Ride JP Ammonia-lyase and O-methyl transferase activities related to lignification in wheat leaves infected with Botrytis. Phytochemistry 15 1976 1661 1664 Google Scholar Crossref Search ADS WorldCat 28 Meng H Campbell WH Characterization and site-directed mutagenesis of aspen lignin-specific O-methyltransferase expressed in Escherichia coli. Arch Biochem Biophys 330 1996 329 341 Google Scholar Crossref Search ADS PubMed WorldCat 29 Ni W Paiva NL Dixon RA Reduced lignin in transgenic plants containing an engineered caffeic acid O-methyltransferase antisense gene. Transgenic Res 3 1994 120 126 Google Scholar Crossref Search ADS WorldCat 30 Ni W Sewalt VJH Korth KL Blount JW Ballance GM Dixon RA Stress responses in alfalfa (Medicago sativa L.). XXI. Activation of caffeic acid 3-O-methyltransferase and caffeoyl CoA 3-O-methyltransferase genes does not contribute to changes in metabolite accumulation in elicitor-treated cell suspension cultures. Plant Physiol 112 1996 717 726 Google Scholar Crossref Search ADS PubMed WorldCat 31 Pakusch AE Kneusel RE Matern U S-Adenosyl-1-methionine: trans-caffeoyl-coenzyme A 3-O-methyltransferase from elicitor-treated parsley cell suspension cultures. Arch Biochem Biophys 271 1989 488 494 Google Scholar Crossref Search ADS PubMed WorldCat 32 Pearl IA Beyer DL Reactions of vanillin and its derived compounds. XI. cinnamic acids derived from vanillin and its related compounds. J Org Chem 16 1951 216 221 Google Scholar Crossref Search ADS WorldCat 33 Pillonel C Mulder MM Boon JJ Forster B Binder A Involvement of cinnamyl-alcohol dehydrogenase in the control of lignin formation in Sorghum bicolor L. Moench. Planta 185 1991 538 544 Google Scholar Crossref Search ADS PubMed WorldCat 34 Poeydomenge O Boudet AM Grima-Pettenati J A cDNA encoding S-adenosyl-1-methionine: caffeic acid 3-O-methyltransferase from Eucalyptus. Plant Physiol 105 1994 749 750 Google Scholar Crossref Search ADS PubMed WorldCat 35 Sambrook J Fritsch EF Maniatis T Molecular Cloning: A Laboratory Manual, Ed 2. 1989 Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 36 Schmitt D Pakusch A-E Matern U Molecular cloning, induction, and taxonomic distribution of caffeoyl-CoA 3-O-methyltransferase, an enzyme involved in disease resistance. J Biol Chem 266 1991 17416 17423 Google Scholar Crossref Search ADS PubMed WorldCat 37 Sewalt VJH Beauchemin KA Glasser WG Lignin impact on fiber degradation. 3. Reversal of inhibition of enzymatic hydrolysis by chemical modification of lignin and by additives. J Agric Food Chem 45 1997a 1823 1828 Google Scholar Crossref Search ADS WorldCat 38 Sewalt VJH Ni W Blount JW Jung HG Howles PA Masoud S Lamb C Dixon RA Reduced lignin content and altered lignin composition in transgenic tobacco down-regulated in expression of phenylalanine ammonia-lyase or cinnamate 4-hy-droxylase. Plant Physiol 115 1997b 41 50 Google Scholar Crossref Search ADS WorldCat 39 Sewalt VJH Ni W Jung H Dixon RA Lignin impact on fiber degradation: increased enzymatic digestibility of genetically engineered tobacco (Nicotiana tabacum) stems reduced in lignin content. J Agric Food Chem 45 1997c 1977 1983 Google Scholar Crossref Search ADS WorldCat 40 Srebotnik E Messner K A simple method that uses differential staining and light microscopy to assess the selectivity of wood delignification by white rot fungi. Appl Environ Microbiol 60 1994 1383 1386 Google Scholar Crossref Search ADS PubMed WorldCat 41 Stöckigt J Zenk MH Chemical synthesis and properties of hydroxycinnamoyl-coenzyme A derivatives. Z Naturforsch 30c 1975 352 358 Google Scholar OpenURL Placeholder Text WorldCat 42 Technical Association of the Pulp and Paper Industry (1972) Methoxyl content of pulp and wood. TAPPI standard method 209 su-72. Technical Association of the Pulp and Paper Industry, Atlanta, GA 43 Technical Association of the Pulp and Paper Industry(1989) Acid-soluble lignin in wood and pulp. TAPPI useful method 250. Technical Association of the Pulp and Paper Industry, Atlanta, GA 44 Vallet C Chabbert B Czaninski Y Monties B Histochemistry of lignin deposition during sclerenchyma differentiation in alfalfa stems. Ann Bot 78 1996 625 632 Google Scholar Crossref Search ADS WorldCat 45 Vance CP Kirk TK Sherwood RT Lignification as a mechanism of disease resistance. Annu Rev Phytopathol 18 1980 259 288 Google Scholar Crossref Search ADS WorldCat 46 Van Doorsselaere J Baucher M Chognot E Chabbert B Tollier M-T Petit-Conil M Leplé J-C Pilate G Cornu D Monties B and others A novel lignin in poplar trees with a reducedcaffeic acid/5-hydroxyferulic acid O-methyltransferase activity. Plant J 8 1995 855 864 Google Scholar Crossref Search ADS WorldCat 47 Van Doorsselaere J Dumas B Baucher M Fritig B Legrand M Van Montagu M Inzé D One-step purification and characterization of a lignin-specific O-methyltransferase from poplar. Gene 133 1993 213 217 Google Scholar Crossref Search ADS PubMed WorldCat 48 Van Soest PJ Robertson JB Lewis BA Methods for dietary fiber, neutral detergent fiber, and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci 74 1991 3583 3597 Google Scholar Crossref Search ADS PubMed WorldCat 49 Vignols F Rigau J Torres MA Capellades M Puigdoménech P The brown midrib3 (bm3) mutation in maize occurs in thegene encoding caffeic acid O-methyltransferase. Plant Cell 7 1995 407 416 Google Scholar PubMed OpenURL Placeholder Text WorldCat 50 Ye ZH Kneusel RE Matern U Varner JE An alternative methylation pathway in lignin biosynthesis in Zinnia. Plant Cell 6 1994 1427 1439 Google Scholar PubMed OpenURL Placeholder Text WorldCat 51 Ye Z-H Varner JE Differential expression of two O-methyltransferases in lignin biosynthesis in Zinnia elegans. Plant Physiol 108 1995 459 467 Google Scholar Crossref Search ADS PubMed WorldCat 52 Zhang XH, Dickson EE, Chinnappa CC (1995) Nucleotide sequence of a cDNA clone encoding caffeoyl-coenzyme A 3-O-methyltransferase of Stellaria longipes(Caryophyllaceae). Plant Physiol 108:429–430 Author notes 1 This work was supported by the Samuel Roberts Noble Foundation. 2 These authors contributed equally to this work. 3 Present address: Research Center, Pioneer Hi-Bred International, 7300 N.W. 62nd Avenue, Johnston, IA 50131. 4 Permanent address: Department of Plant Science, University of Manitoba, Winnipeg, Manitoba, Canada R3T 2N2. 5 Present address: U.S. Department of Agriculture-Agricultural Research Service, Department of Agronomy and Genetics, University of Minnesota, St. Paul, MN 55108. 6 Present address: Technical University Carolo Wilhelmina, Braunschweig, Germany. * Corresponding author; e-mail [email protected]; fax 1–580–221–7380. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Janssen, Bart-Jan; Lund, Lance; Sinha, Neelima

doi: 10.1104/pp.117.3.771pmid: 9662520

Abstract The cultivated tomato (Lycopersicon esculentum) has a unipinnate compound leaf. In the developing leaf primordium, major leaflet initiation is basipetal, and lobe formation and early vascular differentiation are acropetal. We show that engineered alterations in the expression of a tomato homeobox gene, LeT6, can cause dramatic changes in leaf morphology. The morphological states are variable and unstable and the phenotypes produced indicate that the tomato leaf has an inherent level of indeterminacy. This is manifested by the production of multiple orders of compounding in the leaf, by numerous shoot, inflorescence, and floral meristems on leaves, and by the conversion of rachis-petiolule junctions into “axillary” positions where floral buds can arise. Overexpression of a heterologous homeobox transgene,kn1, does not produce such phenotypic variability. This indicates that LeT6 may differ from the heterologouskn1 gene in the effects manifested on overexpression, and that 35S-LeT6 plants may be subject to alterations in expression of both the introduced and endogenous LeT6genes. The expression patterns of LeT6 argue in favor of a fundamental role for LeT6 in morphogenesis of leaves in tomato and also suggest that variability in homeobox gene expression may account for some of the diversity in leaf form seen in nature. During vegetative growth most higher plants are indeterminate. The SAM produces a radially symmetrical, acropetally differentiating shoot axis (stem) and determinate, bilaterally symmetrical lateral organs (leaves). Leaves can be one of two types, simple or compound, and the nature of these has been a matter of debate. The ontogenetic relationship of the dicot compound leaf to the simple leaf is unclear (Merrill, 1986), with various researchers concluding that the basic leaf form is simple (Eames, 1961) or compound pinnate (Hagemann, 1984), or that compound leaves have some shoot-like features and may represent a continuum between shoots and leaves (Sattler and Rutishauser, 1992;Lacroix and Sattler, 1994). To determine morphogenetic patterns and the level of indeterminacy in compound leaves, we have used homeobox genes that were cloned from tomato (Lycopersicon esculentum) (Chen et al., 1997; Janssen et al., 1998). Homeobox genes encode transcription factors that control the regulation of cell fate (McGinnis et al., 1984; Scott et al., 1989). The first plant homeobox gene cloned was the maizeknotted1 (kn1) gene (Vollbrecht et al., 1991).kn1-like homeobox (knox) genes have been placed into two classes (Kerstetter et al., 1994). Although no specific function has as yet been ascertained for class II knox genes (Serikawa et al., 1997), class I knox genes play a role in meristem maintenance and leaf and flower determination at the shoot apex. Class I knox genes are not expressed in initiating organ primordia, mature leaves, or floral organs in simple-leaved species (Smith et al., 1992; Jackson et al., 1994; Long et al., 1996). We have cloned a class I knox gene, LeT6(L.esculentumT6), and shown that it is expressed in floral and vegetative shoot apices and also in leaf and floral organ primordia (Chen et al., 1997; Janssen et al., 1998). This gene has also been referred to as Tomato knotted2 (Tkn2) by Parnis and coworkers (1997). The Tkn1 gene, also a class Iknox gene, similarly shows expression in leaf and floral organ primordia of tomato (Hareven et al., 1996). Thus, in maize (Zea mays) and Arabidopsis thaliana, which have simple leaves, the class I knox genes are not expressed in initiating leaf primordia, whereas in tomato, which has a compound leaf, they are (Sinha, 1997). The tomato leaf primordium produces major leaflet primordia in a basipetal sequence, and these give rise to lobed leaflets (Dengler, 1984; Coleman and Grayson, 1976). Minor leaflets are produced nonbasipetally, and early vascular differentiation follows an acropetal sequence (Coleman and Grayson, 1976). We see LeT6 expression in the preprimordium stage and in the initiating leaf primordia at the shoot apex (Chen et al., 1997). If class I knox genes are involved in morphogenesis of the compound leaf through their expression in developing leaf primordia, what might be the consequences of expressing a class I knox gene in mature leaves? Overexpression of the maize kn1 gene leads to lobed leaves in tobacco (Nicotiana tabacum) (Sinha et al., 1993) and Arabidopsis (Lincoln et al., 1994), and causes excessive leaflet proliferation in tomato (Hareven et al., 1996). When the Arabidopsis class I knox gene Knat1 is overexpressed in Arabidopsis, stipules are produced in the sinuses of highly lobed leaves, and ectopic shoots or floral primordia are seen (Chuck et al., 1996). Our phylogenetic analyses indicate that LeT6 is a possible ortholog of the stm1 gene, whereas neither Tkn1nor stm1 are orthologous to kn1 (G. Bharathan, B.-J. Janssen, E.A. Kellogg, and N. Sinha, unpublished data). It was unclear if there would be phenotypic differences between 35S-LeT6 and 35S-kn1overexpression in tomato, since one is a class I knox gene from a compound-leaved plant (LeT6), whereas the other originates from a simple-leaved plant (kn1). The fact that these are not orthologous genes and that expression of a homologous transgene (LeT6) could result in cosuppression phenotypes suggested that we might find novel morphological consequences from overexpression of LeT6. Therefore, we generated transgenic tomato plants that overexpressed LeT6. The phenotypes in 35S-LeT6 tomato plants showed great variability. Novel phenotypes not described for 35S-kn1 tomato plants (Hareven et al., 1996) were seen. These phenotypes not only indicated a role for LeT6 in leaf morphogenesis, but also revealed the possible morphogenetic potential of the tomato compound leaf. MATERIALS AND METHODS Transgenic Methods LeT6 cDNA was cloned between the “double” CaMV 35S5′ region and the polyadenylation region from the Tml gene in the vector pCGN2187 (Comai et al., 1990). This chimeric gene was then cloned into the binary vector pCGN1549. pCGN1549 differs from pCGN1547 only in the direction of transcription of the NptIIgene and in the order of sites in the polylinker. The empty pCGN1547 vector has been used in control tomato (Lycopersicon esculentum cv NC8276) transformations (McBride and Summerfelt, 1990). The LeT6 construct in pCGN1549 was transformed intoAgrobacterium tumefaciens strain LBA4404 (Hoekema et al., 1983) using the freeze/thaw method (An et al., 1988). Maize Kn1 cDNA was cloned between the 430-bp CaMV 35S promoter and nopaline synthase termination sequences, as described previously (Sinha et al., 1993), and used in tomato transformations. Tomato cotyledons were transformed and transgenic plants were regenerated as described byFillatti et al. (1987). 35S-kn1 tomato transformants utilizing this construct have also been described previously by Hareven and coworkers (1996). Some of the phenotypes that we observed in the 35S-LeT6 transgenics were also described by Parnis and coworkers (1997). Note, however, that theLeT6 gene was called the Tkn2 gene in that previous study. Tobacco (Nicotiana tabacum) leaf segments were transformed according to the method of Sinha et al. (1993). Histology and SEM Fixed leaf tissue for thin-section examinations (8–10 μm) was processed according to the method of Chen and coworkers (1997). For SEM fresh tissue was fixed overnight in 3% glutaraldehyde in 0.02m sodium phosphate buffer, pH 7.2 to 7.4, postfixed in 1% osmium tetroxide, dehydrated in a graded ascending series of ethanol, and critical point dried with CO2. Samples were mounted on SEM stubs with epoxy and sputter coated with a 25-nm layer of gold. Samples were viewed with a scanning electron microscope (model pSEM 501, Philips, Eindhoven, The Netherlands) at an accelerating voltage of 15 kV. Micrographs were taken on Polaroid 55 film directly from the microscope. RNA and DNA Gel Blots Fresh tomato leaf tissue was collected and frozen in liquid nitrogen. Total RNA was extracted as described by Chomczynski and Sacchi (1987). The RNA was further purified using standard ethanol precipitation. RNA samples were resolved on a 1% phosphate glyoxal gel, transferred to Hybond-N+ membranes (Amersham), and hybridized as described previously (Sambrook et al., 1989). Loading of RNA was estimated by hybridization with a labeled Arabidopsis 18S rDNA probe (Pruitt and Meyerowitz, 1986) or a cDNA clone of the tomato plastocyanin gene (kindly provided by Neil Hoffman, Carnegie Institute of Washington, Stanford, CA). DNA was extracted using the method of Dellaporta and coworkers (1983), with certain modifications (Chen et al., 1997). When necessary, DNA was further purified by phenol/chloroform extraction and reprecipitation. For DNA gel blots, genomic DNA (20 μg) was digested with restriction enzymes in a large volume (400 μL) and then ethanol precipitated before separation on a 0.8% agarose gel. The LeT6 probe was a PCR fragment containing the entire LeT6 cDNA and was amplified using T3 and T7 primers. Probes were32P-labeled using a labeling system (Prime-a-Gene, Promega) according to the manufacturer's instructions. Hybridization, washes, and autoradiography for DNA and RNA gel blots were as described previously (Chen et al., 1997). The RNA gel blots were hybridized at approximately 15°C below the Tm, whereas the washes were done at 5°C to 7°C above the calculated Tm (Sambrook et al., 1989). RNA in Situ Localizations Slides for RNA in situ hybridization were labeled using35S-riboprobes (Meyerowitz, 1987) and digoxigenin-labeled riboprobes (Coen et al., 1990) according to previous methods with some modifications. After anti-digoxigenin antibody labeling and washes, slides were left from overnight to 2 d in wash buffer A (Coen et al., 1990) at 4°C before proceeding to the detection steps. Sections were dehydrated through a graded-ethanol series, cleared in Histoclear (National Diagnostics, Atlanta, GA), and mounted in Permount (Fisher Scientific). Hybridization temperatures were at or 8°C below the Tm, whereas washes were at 12°C above the calculated Tm (Sambrook et al., 1989). RESULTS Development of the Wild-Type Leaf in Tomato Tomato has a unipinnate compound leaf, and the presence of an axillary bud demarcates the leaf base from the stem that bears it (Figs. 1A and 2A). A compound leaf has been considered a lateral determinate organ rather than a branched, stem-like organ because axillary buds are only seen in the junction between the petiole and the stem (the axil). The junction between the rachis and the petiolule, for which we suggest the name “pseudoaxil,” does not normally bear axillary buds (Fig. 1A). Certain aspects of development of the wild-type tomato leaf have been described previously by Coleman and Grayson (1976), Dengler (1984), andChandra Shekhar and Sawhney (1990). Fig. 1. Open in new tabDownload slide Wild-type leaf development in tomato. A, Diagram showing the principal features of simple and compound leaves. B, Wild-type SAM with developing leaves. Leaf primordia are marked 1 through 4, from youngest to oldest. Leaflet primordia arise in basipetal succession on leaves 3 and 4. Leaf 4 shows the formation of two pairs of lateral leaflets (LL1 and LL2) in basipetal succession. The terminal leaflet (TL) on leaves 3 and 4 is shown producing lobes (white arrowheads), which occurred in acropetal succession on the terminal leaflet of leaf 4. C, Older wild-type leaf showing two lateral leaflet pairs with lobes (arrows) initiating in a primarily acropetal order. Leaflets are numbered LL2 (oldest) or LL3 (youngest). Leaflet pair 1 and the terminal leaflet are not shown. A smaller minor leaflet (sl) is seen to be arising at the base of the leaf, and another one can be seen between leaflets 2 and 3. Size bars = 100 μm. Fig. 1. Open in new tabDownload slide Wild-type leaf development in tomato. A, Diagram showing the principal features of simple and compound leaves. B, Wild-type SAM with developing leaves. Leaf primordia are marked 1 through 4, from youngest to oldest. Leaflet primordia arise in basipetal succession on leaves 3 and 4. Leaf 4 shows the formation of two pairs of lateral leaflets (LL1 and LL2) in basipetal succession. The terminal leaflet (TL) on leaves 3 and 4 is shown producing lobes (white arrowheads), which occurred in acropetal succession on the terminal leaflet of leaf 4. C, Older wild-type leaf showing two lateral leaflet pairs with lobes (arrows) initiating in a primarily acropetal order. Leaflets are numbered LL2 (oldest) or LL3 (youngest). Leaflet pair 1 and the terminal leaflet are not shown. A smaller minor leaflet (sl) is seen to be arising at the base of the leaf, and another one can be seen between leaflets 2 and 3. Size bars = 100 μm. In the present study, tomato leaf primordia exhibited a basipetal order of maturation. Leaflets arose as bumps on the adaxial marginal face of the leaf primordium in a basipetal sequence (Fig. 1B). After the upper pair of major lateral leaflet primordia was initiated, the middle pair arose below it. A pair of bumps arose on the terminal leaflet, representing the basal lobes. Smaller minor lateral leaflets (Fig. 1C) are produced between the three large leaflet pairs in a nonbasipetal sequence (Coleman and Grayson, 1976; Dengler, 1984). Our results indicate that individual leaflets show a largely acropetal gradient of morphogenesis, and that, although younger lobes can often be larger than older lobes, lobes arise in acropetal succession on both the terminal and the lateral leaflets (Fig. 1C). An early marked basipetal gradient delimited the terminal leaflet and produced major lateral leaflet primordia. A later acropetal gradient, perhaps coincident with the gradient of early vascular differentiation in the leaf (Coleman and Grayson, 1976), led to the production of marginal lobes on the leaflets. Therefore, the wild-type tomato leaf exhibits several developmental gradients that are not unidirectional. Transgenic Plant Production and Phenotypic Analysis A total of 27 independent tomato transformants for the 35S-kn1 construct (Fig.2B) and 23 for the 35S-LeT6 construct were analyzed (Fig. 2, C–H; Table I). The 35S-LeT6 transformed tobacco plants generated resembled those transformed with 35S-kn1 (Sinha et al., 1993), and our 35S-kn1-transformed tomato plants resembled those described by Hareven and coworkers (1996; Fig.2B). However, the 35S-LeT6 transgenic tomato plants exhibited many phenotypic differences from the 35S-kn1 tomato plants. Often, multiple plants were generated from each callus, and these were given an alphabetical designation within the number (Table I); therefore, “1a” and “1b” represent two individual plants regenerated from callus no. 1. We monitored the phenotype of plants that arose from the same callus (“clonal plants”) and, presumably, from the same transformation event. This presumption was confirmed for most of the plants by DNA gel-blot analysis using a probe specific to the NptII gene to determine the number of Kan loci in the plant (Table I). We saw one instance of two independent transformation events from a “single” callus (Table I; compare 9c with 9a and 9b). Fig. 2. Open in new tabDownload slide Comparison of 35S-kn1 and 35S-LeT6 phenotypes in tomato. A, Wild-type tomato leaf showing a terminal leaflet and two pairs of major lateral leaflets. These leaflets are all lobed. In addition, smaller leaflets are seen between the major leaflets. B, A typical 35S-kn1 tomato leaf showing excessive orders of pinnation. C to H, Phenotypes produced by 35S-LeT6 plants. C, Type I plant showing leaf-like structures with no expanded blade. D, Type II plant showing excessive branching and proliferation of floral meristems. E, Type III leaf showing the staghorn-fern-like shape. F, Type IV leaf showing no expanded leaf blades. G, Type V leaf showing expanded blades on leaf segments. H, Type VI leaf showing multiple phenotypes on a single leaf. Size bars = 1 cm. Fig. 2. Open in new tabDownload slide Comparison of 35S-kn1 and 35S-LeT6 phenotypes in tomato. A, Wild-type tomato leaf showing a terminal leaflet and two pairs of major lateral leaflets. These leaflets are all lobed. In addition, smaller leaflets are seen between the major leaflets. B, A typical 35S-kn1 tomato leaf showing excessive orders of pinnation. C to H, Phenotypes produced by 35S-LeT6 plants. C, Type I plant showing leaf-like structures with no expanded blade. D, Type II plant showing excessive branching and proliferation of floral meristems. E, Type III leaf showing the staghorn-fern-like shape. F, Type IV leaf showing no expanded leaf blades. G, Type V leaf showing expanded blades on leaf segments. H, Type VI leaf showing multiple phenotypes on a single leaf. Size bars = 1 cm. Table I. Categories of 35S-LeT6 tomato transformants Late Phenotype . Transformant . Early Phenotype . Ectopic Meristems . Copy No. . Type I (Bladeless, simple) 1a, 1b NA-a +-b ND-c 3a NA + ND 4a NA + ND 7a NA + ND 13a NA + ND 14a NA + ND Type II (Branched floral) 1b NA + ND 2a, 2b NA + ND 13b NA + ND 22a, 22a NA + ND 32a NA + ND 42a, 42b NA + ND Type III (Staghorn leaf) 13b Staghorn –-e 4  25a *-d – 1  Type IV (Bladeless, compound) 4b * – 4–5  11b * – 1  14b * – 2–3  16a Staghorn – 2  19a Staghorn – 4  21a Same + 1  Type V (Bladed, compound) 4c, 4d, 4e Same – 4–5  6a, 6b Same – 2  10a * – 1  11a Staghorn – 1  12a Bladeless compound – ND 23a, 23b Same – ND 24a Same – ND 9a, 9b * – 1-f Type VI (Multiple leaf types) 2c Bladeless compound + 2  9c Bladed compound – 3-f 12b Bladed compound – 1  31a * – 1  26a Bladed compound + 3  Late Phenotype . Transformant . Early Phenotype . Ectopic Meristems . Copy No. . Type I (Bladeless, simple) 1a, 1b NA-a +-b ND-c 3a NA + ND 4a NA + ND 7a NA + ND 13a NA + ND 14a NA + ND Type II (Branched floral) 1b NA + ND 2a, 2b NA + ND 13b NA + ND 22a, 22a NA + ND 32a NA + ND 42a, 42b NA + ND Type III (Staghorn leaf) 13b Staghorn –-e 4  25a *-d – 1  Type IV (Bladeless, compound) 4b * – 4–5  11b * – 1  14b * – 2–3  16a Staghorn – 2  19a Staghorn – 4  21a Same + 1  Type V (Bladed, compound) 4c, 4d, 4e Same – 4–5  6a, 6b Same – 2  10a * – 1  11a Staghorn – 1  12a Bladeless compound – ND 23a, 23b Same – ND 24a Same – ND 9a, 9b * – 1-f Type VI (Multiple leaf types) 2c Bladeless compound + 2  9c Bladed compound – 3-f 12b Bladed compound – 1  31a * – 1  26a Bladed compound + 3  Copy number was determined by DNA gel-blot analysis ofHindIII-digested DNA probed with the NptII probe. F0-a NA, Not applicable because plants did not survive transplantation. F0-b +, Present. F0-c ND, Not determined. F0-d *, Early phenotype not determined. F0-e –, Not present. F0-f Nonclonal plants from “one” callus. Open in new tab Table I. Categories of 35S-LeT6 tomato transformants Late Phenotype . Transformant . Early Phenotype . Ectopic Meristems . Copy No. . Type I (Bladeless, simple) 1a, 1b NA-a +-b ND-c 3a NA + ND 4a NA + ND 7a NA + ND 13a NA + ND 14a NA + ND Type II (Branched floral) 1b NA + ND 2a, 2b NA + ND 13b NA + ND 22a, 22a NA + ND 32a NA + ND 42a, 42b NA + ND Type III (Staghorn leaf) 13b Staghorn –-e 4  25a *-d – 1  Type IV (Bladeless, compound) 4b * – 4–5  11b * – 1  14b * – 2–3  16a Staghorn – 2  19a Staghorn – 4  21a Same + 1  Type V (Bladed, compound) 4c, 4d, 4e Same – 4–5  6a, 6b Same – 2  10a * – 1  11a Staghorn – 1  12a Bladeless compound – ND 23a, 23b Same – ND 24a Same – ND 9a, 9b * – 1-f Type VI (Multiple leaf types) 2c Bladeless compound + 2  9c Bladed compound – 3-f 12b Bladed compound – 1  31a * – 1  26a Bladed compound + 3  Late Phenotype . Transformant . Early Phenotype . Ectopic Meristems . Copy No. . Type I (Bladeless, simple) 1a, 1b NA-a +-b ND-c 3a NA + ND 4a NA + ND 7a NA + ND 13a NA + ND 14a NA + ND Type II (Branched floral) 1b NA + ND 2a, 2b NA + ND 13b NA + ND 22a, 22a NA + ND 32a NA + ND 42a, 42b NA + ND Type III (Staghorn leaf) 13b Staghorn –-e 4  25a *-d – 1  Type IV (Bladeless, compound) 4b * – 4–5  11b * – 1  14b * – 2–3  16a Staghorn – 2  19a Staghorn – 4  21a Same + 1  Type V (Bladed, compound) 4c, 4d, 4e Same – 4–5  6a, 6b Same – 2  10a * – 1  11a Staghorn – 1  12a Bladeless compound – ND 23a, 23b Same – ND 24a Same – ND 9a, 9b * – 1-f Type VI (Multiple leaf types) 2c Bladeless compound + 2  9c Bladed compound – 3-f 12b Bladed compound – 1  31a * – 1  26a Bladed compound + 3  Copy number was determined by DNA gel-blot analysis ofHindIII-digested DNA probed with the NptII probe. F0-a NA, Not applicable because plants did not survive transplantation. F0-b +, Present. F0-c ND, Not determined. F0-d *, Early phenotype not determined. F0-e –, Not present. F0-f Nonclonal plants from “one” callus. Open in new tab Our 35S-LeT6 transgenic tomato plants fell into six phenotypic categories (Table I; Fig. 2, C–H) that differed from wild type (Fig. 2A): Type I, plants that produced simple leaves without any blade expansion whatsoever (Fig. 2C); Type II, plants that produced excessively branched axes that terminated in floral structures (Fig.2D); Type III, staghorn-fern-like leaves with little demarcation between blade and rachis (Fig. 2E); Type IV, compound leaves with no blade expansion (Fig. 2F); Type V, bladed compound leaves (Fig. 2G); and Type VI, variable leaf phenotypes on an individual plant (Fig. 2H). A total of 33 plants represented 23 independent transformation events (Table I). This was based on each primary callus being considered one event (with the exception of callus no. 9). We noticed that clonal plants exhibited enough differences in phenotype to be placed in different categories and often showed different phenotypes during development. Based on the early and late phenotypic scores (as listed in Table I) the bladed compound leaf category (Type V) was the most stable and had the highest number of independent transformation events. The mature leaves of these plants showed a high degree of compounding, rounded leaflet bases, approximately palmate venation, and multiple leaflet primordia on the rachis. In these aspects the leaves resembled most closely leaves seen in a dominant leaf mutation in tomato calledMouse ears (Me). Me plants have leaves with 2 to 3 orders of compounding, rounded leaflet bases, and palmate venation. We have shown that this mutation is caused by the ectopic overexpression of a fusion between LeT6 and the pyrophosphate-dependent phosphofructokinase gene (Chen et al., 1997). Similar phenotypes to the Type V described here have been reported in another study (Parnis et al., 1997). The first two phenotypic categories (Types I and II) did not survive transplantation. However, we were able to analyze RNA, DNA, and tissue samples from a few representative individuals. The complete range of variability between the individual transgenic plants (Types I–V) could be seen within some of the multiple-phenotype plants in Type VI. Segments from one leaf on such a multiple-phenotype plant (26a) are shown in Figure 3. Portions of leaves on plant 26a developed relatively normal, unlobed leaflets with pinnate venation (Fig. 3A). Some of the leaflets developed a fasciated rachis and produced leaf-like primordia from the edges of the leaflets and rachis (Fig. 3, B and C; this phenotype was also described by Parnis and coworkers [1997]). Portions of the leaf showed a marked difference in complexity between the pairs of leaflets arising on opposite sides of a rachis (Fig. 3D). Staghorn-fern-like leaves with no distinction between petiolule and leaflet were often seen as well (Fig. 3E). Segments bearing leaflets often showed a fiddlehead-fern-like structure, with immature regions of the leaf segment at the tip (Figs. 3F and 6C). Gel-blot analysis of DNA from four phenotypically distinct portions of plant 26a confirmed that all regions of this plant contained the same T-DNA (data not shown). Fig. 3. Open in new tabDownload slide Details of leaf phenotypes seen on a single multiple-phenotype leaf. A, Bladed compound part showing leaflets with very reduced marginal lobes (arrow). B, The margin of a leaflet producing leaflet primordia (arrow). C, Close-up of leaflet in B showing foliar primordia arising at the edge of the blade (arrows). D, Terminal segment showing leaflets (L) developing on one side of the rachilla, whereas on the other side segments are undergoing further orders of leaflet production. E, Staghorn-fern-like segment on the leaf with no distinction between blade and rachis. F, Pinnate segments arising in a coiled manner from the edge of the rachis (arrows). Fig. 3. Open in new tabDownload slide Details of leaf phenotypes seen on a single multiple-phenotype leaf. A, Bladed compound part showing leaflets with very reduced marginal lobes (arrow). B, The margin of a leaflet producing leaflet primordia (arrow). C, Close-up of leaflet in B showing foliar primordia arising at the edge of the blade (arrows). D, Terminal segment showing leaflets (L) developing on one side of the rachilla, whereas on the other side segments are undergoing further orders of leaflet production. E, Staghorn-fern-like segment on the leaf with no distinction between blade and rachis. F, Pinnate segments arising in a coiled manner from the edge of the rachis (arrows). Fig. 6. Open in new tabDownload slide SEM of 35S-LeT6 phenotypes in tomato. A, Bladed compound leaf with a leaflet primordium (lp; arrow) developing from the mature region of the rachis. B, Compounded leaf structure arising from a pseudoaxil. The first-order branch on the left shows acropetal differentiation; the tip is still immature and has smaller cells. The compounded structure arising from the pseudoaxil also has an acropetal differentiation of segments. C, Fiddlehead-fern-like structure with delayed differentiation at the tip (arrows). D, Stomata on raised columns of cells (arrows) on the adaxial leaf surface. E, Wild-type SAM (meri) producing leaf primordia in succession. A differentiating trichome is seen at the tip of the plastochron 2 leaf (arrowhead). F and G, Meristems on 35S-LeT6 plants producing leaf primordia in succession. The leaf primordium in F does not show basipetal differentiation, whereas the leaf primordium in G does. Differentiating trichomes are marked (arrowheads). H, Leaf blade of wild type showing elongated cells in the leaf margin (m) and over the vasculature (v). Arrows point to stomata on the blade. I, Leaf blade of a 35S-Kn plant showing small epidermal cells with angular margins. Arrows point to stomata on the blade. J, Leaf blade of a 35S-LeT6 plant showing elongated cells in the margin and blade regions. Arrows point to the stomata interspersed between these cells. Scale bars = 100 μm (except in G, which is 15 μm). Fig. 6. Open in new tabDownload slide SEM of 35S-LeT6 phenotypes in tomato. A, Bladed compound leaf with a leaflet primordium (lp; arrow) developing from the mature region of the rachis. B, Compounded leaf structure arising from a pseudoaxil. The first-order branch on the left shows acropetal differentiation; the tip is still immature and has smaller cells. The compounded structure arising from the pseudoaxil also has an acropetal differentiation of segments. C, Fiddlehead-fern-like structure with delayed differentiation at the tip (arrows). D, Stomata on raised columns of cells (arrows) on the adaxial leaf surface. E, Wild-type SAM (meri) producing leaf primordia in succession. A differentiating trichome is seen at the tip of the plastochron 2 leaf (arrowhead). F and G, Meristems on 35S-LeT6 plants producing leaf primordia in succession. The leaf primordium in F does not show basipetal differentiation, whereas the leaf primordium in G does. Differentiating trichomes are marked (arrowheads). H, Leaf blade of wild type showing elongated cells in the leaf margin (m) and over the vasculature (v). Arrows point to stomata on the blade. I, Leaf blade of a 35S-Kn plant showing small epidermal cells with angular margins. Arrows point to stomata on the blade. J, Leaf blade of a 35S-LeT6 plant showing elongated cells in the margin and blade regions. Arrows point to the stomata interspersed between these cells. Scale bars = 100 μm (except in G, which is 15 μm). In addition to kanamycin resistance, DNA gel-blot analysis was used to confirm the presence and copy number of the transgene in the plants we analyzed (Fig. 4). Digestion of genomic DNA with HindIII was used to estimate copy number by hybridization with the NptII probe, and the results were confirmed by stripping and rehybridizing the blots with an LeT6 probe (Fig. 4B). Using this probe the intensity of the T-DNA-specific 0.3-kb band (Fig. 4C) could be compared with the intensity of the endogenous 0.8-kb LeT6 band (Fig. 4D) to give an estimate of copy number. One to five copies of the T-DNA were present in the 20 plants examined, and there was no consistent correlation between phenotypic stability or severity and locus copy number (Table I; Fig. 4, A and B). We reasoned that the unstable phenotypes could be the result of cosuppression phenomena or of regeneration of chimeric plants. Fig. 4. Open in new tabDownload slide DNA gel-blot analysis of the 35S-LeT6 plants. A, NptII gene used as a probe.NptII-hybridizing bands correspond to the number of integrated copies of T-DNA. B, Same blot as in A stripped and rehybridized with an LeT6 probe. DNA size markers (in kilobases) are on the right. LeT6 probe hybridizes to both the endogenous LeT6 (bands at 800 bp, 5.5 kb, 9 kb, and 11 kb) and the introduced gene (bands at 300 bp and 2.2 kb). The DNA was digested with HindIII and DNA from an untransformed (UT) plant shows only the endogenous bands. A comparison of band intensity differences between the 0.8-kb endogenous and 0.3-kb transgene HindIII fragments correlates with transgene copy number in the transformants. C and D, Map of the transgene locus (C) and the LeT6 locus (D) in tomato. Restriction sites for HindIII are shown. Fig. 4. Open in new tabDownload slide DNA gel-blot analysis of the 35S-LeT6 plants. A, NptII gene used as a probe.NptII-hybridizing bands correspond to the number of integrated copies of T-DNA. B, Same blot as in A stripped and rehybridized with an LeT6 probe. DNA size markers (in kilobases) are on the right. LeT6 probe hybridizes to both the endogenous LeT6 (bands at 800 bp, 5.5 kb, 9 kb, and 11 kb) and the introduced gene (bands at 300 bp and 2.2 kb). The DNA was digested with HindIII and DNA from an untransformed (UT) plant shows only the endogenous bands. A comparison of band intensity differences between the 0.8-kb endogenous and 0.3-kb transgene HindIII fragments correlates with transgene copy number in the transformants. C and D, Map of the transgene locus (C) and the LeT6 locus (D) in tomato. Restriction sites for HindIII are shown. The analysis of DNA from individual parts of the plants confirmed that plants were not chimeric and that clonal plants derived from the same callus showed identical restriction patterns for the transgene (data not shown). For these plants the phenotypic instability could be the result of variation in tissue- or age-specific transgene expression, or it could be caused by an interaction between the endogenous and introduced LeT6 gene at either the posttranscriptional (Flavell, 1994; Jorgensen, 1995; Que et al., 1997) or the DNA level (Jorgensen, 1995; Matzke and Matzke, 1995; Park et al., 1996). Levels of LeT6 Expression in Leaves of Transformed Tomato Plants To determine if transgenic phenotypes correlated with levels of transgene expression, we analyzed the expression ofLeT6 RNA in mature leaves of our transformants using RNA gel blots. LeT6 transcript is not detected in mature wild-type leaves (Chen et al., 1997; Janssen et al., 1998), but we found LeT6 transcript in leaves from 27 transformed plants (Fig. 5A). Our RNA gel blots showed multiple LeT6-hybridizing bands that did not result from general RNA degradation (plastocyanin [Fig. 5B], 18S rDNA, and LeT12 [not shown] hybridized to single bands of RNA). We used a tomato plastocyanin cDNA as a control probe to determine the levels of RNA loaded on the gel (Fig. 5B). In general, we did not notice any strict correlation between transcript levels and phenotypes or between transcript levels and T-DNA copy number. However, the simple midrib (Type I) and the branched floral (Type II; Fig. 5A, lane 42b) phenotypes showed very high levels of LeT6 RNA. We concluded from our RNA gel-blot analysis that variability in phenotypes between individuals could not simply be attributed to overall levels ofLeT6 RNA. Fig. 5. Open in new tabDownload slide RNA gel-blot analysis of mature leaf tissue from various 35S-LeT6 transgenic plants. The blots shown in A and B were hybridized first with a PCR-labeled fragment specific to the LeT6 gene (A), then stripped and rehybridized with a tomato plastocyanin probe (B) to determine the amount of RNA loaded. Leaf RNA from an untransformed, wild-type plant (UT WT) does not show any LeT6-hybridizing transcript. The type classification for the individuals used in RNA extraction is indicated at the top of the lanes. The sizes are in kilobases. Fig. 5. Open in new tabDownload slide RNA gel-blot analysis of mature leaf tissue from various 35S-LeT6 transgenic plants. The blots shown in A and B were hybridized first with a PCR-labeled fragment specific to the LeT6 gene (A), then stripped and rehybridized with a tomato plastocyanin probe (B) to determine the amount of RNA loaded. Leaf RNA from an untransformed, wild-type plant (UT WT) does not show any LeT6-hybridizing transcript. The type classification for the individuals used in RNA extraction is indicated at the top of the lanes. The sizes are in kilobases. Leaf Maturation Is Altered in 35S-LeT6 Leaves Four of the six phenotypic categories in our transgenic plants produced leaves with many orders of compounding. In one instance we saw 6 orders of pinnation in a leaf. Mature leaflets had very reduced or no marginal lobes (Fig. 3A) and often showed aberrant vasculature, including the absence of a prominent midvein (Fig. 3B). Mature leaves continued to produce leaflet primordia, which often arose either on the leaflet margin or on the rachis (Fig. 3, B–F). SEM analysis revealed that these primordia were regions of immature, undifferentiated cells in an otherwise differentiated region of the leaf (Fig. 6, A–C). This would indicate that even mature 35S-LeT6 leaves retain a potential for organogenesis. The leaflets produced often showed marked coiling like that seen in fern fiddleheads (Figs. 3F and 6, B and C), with a markedly acropetal mode of differentiation and a persistent apical meristematic zone. Initiating wild-type tomato leaves showed a basipetal maturation gradient (Figs. 1B and 6E). Ectopic expression of LeT6 (andkn1 [Hareven et al., 1996]) in tomato sometimes enhanced the late, acropetal maturation pattern, with the basal region maturing first while the apical (terminal) region remained immature and devoid of trichomes for long periods of time (Figs. 3F, 6B, 6C, and 6F). Such a reversal in leaf maturation is also seen in a naturally occurring gene fusion that causes LeT6 overexpression (Chen et al., 1997). However, meristems bearing leaf primordia with early basipetal differentiation were also seen on 35S-LeT6 plants (Fig. 6G). Meristems in all transgenic plants appeared flattened compared with wild type, regardless of the kind of leaf primordia they had (compare Fig. 6E with 6F and 6G). The leaves on the 35S-LeT6 plants lacked marginal lobes. When observed under a scanning electron microscope, lobe-like structures were seen to initiate, but these structures matured into leaflets rather than lobes (Figs. 3D and 6B). This suggests that there was no fundamental difference between lobe and leaflet initiation. Delayed differentiation was also seen in cells surrounding the stomata. The last cell divisions in the leaf occur when guard cells are formed in the stomatal complexes (Coleman and Grayson, 1976). In the 35S-LeT6 plants, stomata on the adaxial surface were raised on mounds of cells several layers high (Fig. 6D), presumably as a result of LeT6 expression delaying differentiation and prolonging cell division in the adaxial subepidermal and epidermal layers. Furthermore, cell shapes and arrangements were perturbed in these plants. Wild-type leaves had elongated epidermal cells in the margins and above veins, whereas the region of the blade had large cells shaped like pieces of a puzzle and with interspersed stomata (Fig. 6H). In contrast, 35S-Kn plants had very small cells with angular margins (Fig. 6I). In the 35S-LeT6 transgenics, leaf epidermal cells either resembled the 35S-Kntype (but with stomata raised on mounds; Fig. 6D) or consisted mostly of narrow, elongated cells (Fig. 6J), indicating the presence of a more extended, margin-like domain in these leaves. Ectopic Meristems Are Initiated on 35S-LeT6 Leaves Leaves on 35S-LeT6 plants often produced ectopic meristems. In Type I and Type II plants these meristems were made early in development and often formed floral primordia (Fig.7, A and D). In Type I plants, the SAM terminated early, and axillary meristems were therefore also precociously activated (Fig. 7, B and C). Leaves on these plants were bladeless and simple, with their normal phyllotactic patterns appearing disrupted prior to SAM termination (Fig. 7C), and ectopic sympodial meristems bearing floral meristems being produced on some leaves (Fig.7A). Leaves on Type IV and Type VI plants could also produce ectopic meristems on the blade (Fig. 7E) in a manner similar to that described for the 35S-Kn “shooty” phenotype in tobacco (Sinha et al., 1993). Very rarely, leaflet primordia would also bear meristems along their margins. These appeared flattened, as described earlier (Fig. 6, F and G), and produced leaf primordia in succession (Fig. 7F). In addition, a subset of plants produced meristems in the axils of leaflets (pseudoaxils), which sometimes bore leaf primordia (Fig. 7G), but more often produced inflorescence or floral structures (Fig.8, A and B). Fig. 7. Open in new tabDownload slide A through C, Type I plant showing leaves with no blade expansion. A, Shoot apex region showing three radial leaf primordia (a, b, and c) and a floral meristem (d) on the left. Sympodial meristems (m) arise on the adaxial surface of older leaf primordia. B and C, Other views of the same shoot apex as in A showing absence of the SAM at the predicted position (arrowhead). Axillary meristems (am) develop precociously. The corresponding structures have the same identifying letters in A, B, and C. The floral meristem (d) is part of an inflorescence meristem produced from the sympodium (m) on the adaxial face of the leaf primordium. D, Type II phenotype showing clusters of meristems developing into mostly solitary flowers (f). E, Vegetative meristem (arrow) arising from the surface of a leaflet (lf). F, Leaflet (lf) bearing meristems (m) on its margin that are producing leaf primordia (lp). G, Leaflet (lf) bearing a pseudoaxillary meristem (px) at the junction with the rachis (r). The meristem is shown producing leaf primordia. Size bars = 100 μm. Fig. 7. Open in new tabDownload slide A through C, Type I plant showing leaves with no blade expansion. A, Shoot apex region showing three radial leaf primordia (a, b, and c) and a floral meristem (d) on the left. Sympodial meristems (m) arise on the adaxial surface of older leaf primordia. B and C, Other views of the same shoot apex as in A showing absence of the SAM at the predicted position (arrowhead). Axillary meristems (am) develop precociously. The corresponding structures have the same identifying letters in A, B, and C. The floral meristem (d) is part of an inflorescence meristem produced from the sympodium (m) on the adaxial face of the leaf primordium. D, Type II phenotype showing clusters of meristems developing into mostly solitary flowers (f). E, Vegetative meristem (arrow) arising from the surface of a leaflet (lf). F, Leaflet (lf) bearing meristems (m) on its margin that are producing leaf primordia (lp). G, Leaflet (lf) bearing a pseudoaxillary meristem (px) at the junction with the rachis (r). The meristem is shown producing leaf primordia. Size bars = 100 μm. Fig. 8. Open in new tabDownload slide Reproductive structures in 35S-LeT6 tomato transgenics. A, Leaf with several floral inflorescences (arrowheads) developing in the pseudoaxils. B, An inflorescence with two floral buds (arrow) arising from the pseudoaxil of a leaf. C, Wild-type tomato flower with an outer whorl of green sepals, a whorl of yellow petals, and a column of anthers (arrowhead). D, Fasciated flower with normal sepals, a large number of petals (p), very few stamens (arrowhead), and a cluster of sepaloid organs in the center (arrow). E, Bifurcated fasciated fruit developing from an abnormal flower. Arrow points to a notch in the fruit. F and G, SEM image of a leaflet (L) showing clusters of developing flowers. F, These flowers show the normal order of organ production, with outer sepals (s) and an inner ring of petals (p), but the sizes and numbers are abnormal. A central bifurcation into two units (arrow) is visible in each flower. G, Leaflet showing proliferation of ectopic inflorescence meristems (im) on its surface. These meristems are shown generating floral buds (f). Fig. 8. Open in new tabDownload slide Reproductive structures in 35S-LeT6 tomato transgenics. A, Leaf with several floral inflorescences (arrowheads) developing in the pseudoaxils. B, An inflorescence with two floral buds (arrow) arising from the pseudoaxil of a leaf. C, Wild-type tomato flower with an outer whorl of green sepals, a whorl of yellow petals, and a column of anthers (arrowhead). D, Fasciated flower with normal sepals, a large number of petals (p), very few stamens (arrowhead), and a cluster of sepaloid organs in the center (arrow). E, Bifurcated fasciated fruit developing from an abnormal flower. Arrow points to a notch in the fruit. F and G, SEM image of a leaflet (L) showing clusters of developing flowers. F, These flowers show the normal order of organ production, with outer sepals (s) and an inner ring of petals (p), but the sizes and numbers are abnormal. A central bifurcation into two units (arrow) is visible in each flower. G, Leaflet showing proliferation of ectopic inflorescence meristems (im) on its surface. These meristems are shown generating floral buds (f). In Type II plants these leaf-borne meristems were often determined to be inflorescence meristems (Figs. 7D and 8G). Meristems in the later plastochrons of Type IV and Type VI plants were also shown to be inflorescence meristems (Fig. 8, A and B). The inflorescence meristems formed flower primordia that produced floral organs in the normal sequence. However, the flowers were not normal (Fig. 8D), often having larger meristems that produced more organ primordia than normal and that rarely attained full maturity or fertility. Flowers produced in the normal location on these plants also showed similar defects. Alterations in meristem size, fractionation, and organ differentiation, rather than ectopic location, were the likely causes of abnormal flower structures in 35S-LeT6 plants. On the floral meristems five to six sepal-like structures enclosed a large number of petaloid and green sepaloid organs (Fig. 8D), reminiscent of mutations in C function genes in Arabidopsis (Bowman et al., 1991). Often, the central whorls were bifurcated into two units (Fig. 8, D and F). Upon fertilization, these produced fasciated double or multiple fruit (Fig. 8E) reminiscent of the clavataphenotypes in Arabidopsis (Clark et al., 1993). Thus, overexpression ofLeT6 appeared to enhance the phase of SAM proliferation in relation to lateral organ inception so that when organs finally formed, the meristem was able to produce more organs than normal. Extra organs were produced on the majority of 35S-LeT6 leaves. When these organs were present on the leaflet margins or on the rachis they usually differentiated into leaflets. However, when they were produced at the junction between the petiolule and the rachis (the pseudoaxil), they often resulted in meristems that produced organs (Fig. 8, A and B). There must be an inherent difference between the organogenic potential in the leaflet margin and the rachis compared with the pseudoaxil. The former usually produced determinate, lateral structures (although meristems were seen in rare instances, Fig. 7F), whereas the latter gave rise to indeterminate meristems. Patterns of LeT6 Expression in Wild-Type and Transgenic Leaves In situ hybridization was used to determine whetherLeT6 expression was localized to specific regions of the developing leaves and leaflets in wild-type and 35S-LeT6 plants. LeT6 is expressed in the SAM and initiating leaf primordia (Chen et al., 1997). In older wild-type leaf primordia we saw high LeT6 expression in initiating leaflet primordia (Fig. 9A), indicating that the leaf and leaflet primordium could be equivalent structures. Vascular tissue in leaves and the subtending axis also showed strong expression of LeT6 (Fig. 9A). Expression in the axis vascular tissue has also been seen for kn1 (Smith et al., 1992; Jackson et al., 1994) and Knat1 (Lincoln et al., 1994; Chuck et al., 1996). In addition, the developing leaflet margin showed high levels of LeT6 expression (Fig. 9B), a feature not seen in simple-leaved plants. Analysis of the transgenic leaves revealed high levels of expression in vascular tissue in the marginal blastozone regions (Hagemann and Gleissberg, 1996) (Fig. 9C), and in the junctions between the rachis and petiolule, the pseudoaxils (Fig. 9D). Fig. 9. Open in new tabDownload slide Analysis of expression patterns of homeobox genes in wild-type and 35S-LeT6 tomato. A and B, Expression of LeT6 in developing leaves. A, Longitudinal section through a developing leaf primordium (Lf) on the right shows a basipetal order of leaflet production. Each leaflet primordium (Lp) has high levels of LeT6expression (arrows). Expression is also high in the vascular trace (V) in the leaf. B, Transverse section through an older wild-type leaf shows the basal rachis and three pairs of lateral leaflet primordia. Expression (arrows) is seen in the vascular traces and developing leaflet blade margins (m). The region of high expression on the rachis (arrow) probably represents a site of minor leaflet initiation. C and D, Expression of LeT6 in 35S-LeT6 developing leaves. C, Transverse section through rachis of a multiple-phenotype leaf showing a developing leaflet on the left and a developing compound-leaf-like structure with leaflet primordia in the center. Expression (arrows) is seen in the vascular tissue and in the marginal blastozones (m) from which blades will develop. D, Transverse section through the rachis and leaflet primordia of a multiple-phenotype leaf showing regions of high expression in the pseudoaxils (Px), vascular traces, and edges of the leaf blade (arrow). E, Expression of LeT12 in a tissue section adjacent to that shown in D. Transverse section through the rachis and leaflet primordia of a multiple-phenotype leaf showing regions of high expression in the pseudoaxils, vascular traces, and edges of the leaf blade (arrow). Fig. 9. Open in new tabDownload slide Analysis of expression patterns of homeobox genes in wild-type and 35S-LeT6 tomato. A and B, Expression of LeT6 in developing leaves. A, Longitudinal section through a developing leaf primordium (Lf) on the right shows a basipetal order of leaflet production. Each leaflet primordium (Lp) has high levels of LeT6expression (arrows). Expression is also high in the vascular trace (V) in the leaf. B, Transverse section through an older wild-type leaf shows the basal rachis and three pairs of lateral leaflet primordia. Expression (arrows) is seen in the vascular traces and developing leaflet blade margins (m). The region of high expression on the rachis (arrow) probably represents a site of minor leaflet initiation. C and D, Expression of LeT6 in 35S-LeT6 developing leaves. C, Transverse section through rachis of a multiple-phenotype leaf showing a developing leaflet on the left and a developing compound-leaf-like structure with leaflet primordia in the center. Expression (arrows) is seen in the vascular tissue and in the marginal blastozones (m) from which blades will develop. D, Transverse section through the rachis and leaflet primordia of a multiple-phenotype leaf showing regions of high expression in the pseudoaxils (Px), vascular traces, and edges of the leaf blade (arrow). E, Expression of LeT12 in a tissue section adjacent to that shown in D. Transverse section through the rachis and leaflet primordia of a multiple-phenotype leaf showing regions of high expression in the pseudoaxils, vascular traces, and edges of the leaf blade (arrow). LeT12 Expression in Transgenic and Wild-Type Leaves Since animal homeobox genes have been shown to be coordinately regulated (Magli et al., 1991) and also to regulate other homeobox genes (Carroll and Vavra, 1989), we used a class IIknox gene, LeT12, as a hybridization probe on RNA gel blots and in situ-hybridization experiments to determine if similar events occur in plant tissues. The LeT12 transcript is 200 bases larger than the LeT6 transcript (1600 bp) and present at moderately high levels in all wild-type tissues we have examined (Janssen et al., 1998). On RNA gel blots we saw a moderate up-regulation of LeT12 levels in transgenic leaves that also showed high levels of LeT6 (data not shown). We used in situ-hybridization experiments to see if the two homeobox genes were expressed in similar regions of the adjacent tissue sections in these leaves. Regions of elevated LeT6 expression also showed elevated LeT12 expression. These were vascular regions in the rachis and blade, pseudoaxillary locations, and leaflet margins (compare Fig. 9, D and E). Our results suggest that in the 35S-LeT6 plants, either LeT6overexpression led to LeT12 overexpression, or these two genes were coordinately regulated and LeT12 also had a role in morphogenetic events in the tomato leaf. DISCUSSION Equivalence of Leaflets and Lobes The tomato leaf is unipinnately compound, producing a terminal leaflet and usually three pairs of lobed, lateral major leaflets. An early basipetal gradient leads to the production of major leaflet primordia, and a later acropetal gradient leads to the production of marginal lobes and early vascular differentiation. Engineered or natural perturbations in growth and differentiation in this system can interplay with the potential for phenotypic plasticity and lead to complex morphologies. Leaflet primordia arise from previously undifferentiated basal regions of the leaf and retain the morphogenetic potential to produce lobes, whereas lobe primordia form on regions with reduced morphogenetic potential and quickly form a differentiated blade edge. We hypothesize that leaflets and leaflet lobes are equivalent structures that take on different morphogenetic trajectories by virtue of their position on the leaf (i.e. lobes are prematurely differentiated leaflets). If this is indeed the case, then delaying differentiation in the leaf as a whole should allow initiating lobe primordia to take on a leaflet fate. This seems to be one of the consequences of 35S-LeT6(and 35S-kn1) overexpression in tomato. These transgenic plants produce leaves with numerous orders of unlobed leaflets. Leaflets beyond the first order (i.e. those produced over and above the “normal” number) are produced in acropetal succession, just as leaflet lobes are, and lobing is usually missing or reduced on these leaves. Furthermore, the initial basipetal gradient indicates that regions closer to the base of the tomato leaf may be the last to differentiate and may retain morphogenetic potential. If this is indeed the case, then one would expect more than just three major ranks of secondary lateral branching in the leaf (the three pairs of leaflets seen in the wild type). This is seen in a number of transformants, indicating that leaflets (or secondary lateral branches) continue to arise from the base of the leaf. Indeterminate Features in the Tomato Leaf The compound leaf has sometimes been equated to a structure intermediate between a stem and a leaf (Sattler and Rutishauser, 1992;Lacroix and Sattler, 1994). Although this proposal may have to be evaluated on a case-by-case basis, we have analyzed the complex morphologies produced in our 35S-LeT6 plants for similarities to shoot systems. The junction between the rachis and the petiolule on these transgenic leaves often takes on a measure of indeterminacy and shows axillary characteristics. In the more extreme phenotypes, these pseudoaxils produce floral and vegetative meristems, a characteristic feature of leaf axils. In the less-extreme phenotypes, unipinnate or multipinnate, determinate, leaf-like structures are produced from these locations. Incidentally, mutations in tomato that fail to produce axillary meristems often cause the production of ectopic shoots in pseudoaxillary locations on an otherwise normal leaf (Rick and Butler, 1956). A similar difference in organogenic potential was seen between the sinus region and the rest of the leaf in Arabidopsis plants overexpressing knat1 (Chuck et al., 1996). We have two alternate explanations for these phenotypes. Either these locations have some atavistic axillary features that are enhanced by 35S-LeT6 overexpression or there is some special characteristic in these locations that allows for elevatedLeT6 expression, leading to the production of meristems or leaf-like organs. Since the CaMV 35S promoter causes high levels of expression in vascular tissues (Benfey et al., 1989), vascular junctions at these pseudoaxils might have levels ofLeT6 above the threshold required for development of shoots. Phenotypic Variability and Cosuppression When comparing the results of overexpression of the maizekn1 gene in tomato with overexpression of the endogenousLeT6 gene, the extreme variability of phenotypes observed in the 35S-LeT6 plants stands out. This phenotypic variability is probably the result of several factors acting individually or in combination. Variability of expression from the CaMV 35S promoter and tissue or cell-type specificity of RNA expression may have contributed to these phenotypes. The endogenous gene LeT6 could have unique features that result in phenotypic changes, such as the initiation of meristems at the leaf margins, that are not seen with overexpression of the maizekn1 gene. Phenotypic instability in these transgenic plants may be the result of threshold-dependent cosuppression, a phenomenon dependent on a high level of sequence identity between the transgene and the endogenous gene (de Carvahlo Niebel et al., 1995). Because maize kn1 has only 49% similarity to LeT6 at the nucleotide level, and the Arabidopsis ortholog stm1 is only 65% similar to LeT6, it is unlikely that the 35S-kn1 plants would be able to show such cosuppression of LeT6, Tkn1, or some otherknox class I gene. We suggest that endogenous gene effects such as silencing and cosuppression, rather than differences in the constructs, may play a role in the phenotypic effects ofLeT6 overexpression in tomato. Distinct roles for the various class I knox genes have also been postulated elsewhere based on transgenic data (Parnis et al., 1997). Two phenotypic classes of 35S-LeT6 plants are suggestive of cosuppression. The Type I plants show suppression of the SAM and their leaf blades fail to expand. In these plants expression of the endogenous LeT6 gene in the SAM combined with expression of the 35S-LeT6 transgene may result in cosuppression, leading to failure of SAM maintenance. In this respect these plants are strongly reminiscent of the stm mutation in Arabidopsis (Long et al., 1996). The bladeless leaves produced in the Type I plants may result from cosuppression in the edge domain, where both endogenous and 35S-LeT6 gene expression would be expected to be high. Petunia flowers show a similar variation of cosuppression between the edge and internal domains (Que et al., 1997). Type II plants show suppression of the vegetative stage of SAM activity and an almost complete loss of leaf-like structures. Because expression from the 35S promoter is known to be weak in meristems (H. Klee, personal communication) and higher in differentiating tissues, cosuppression phenomena may be different in these two regions. As the leaf primordium begins to form, 35S-LeT6 expression may increase to a level sufficient to trigger cosuppression, halting cell division and completing differentiation before the leaf primordium can completely form. In these differentiated tissues the endogenous LeT6expression level would decrease, perhaps below the threshold required for cosuppression, causing induction of a new meristem by overexpression of the 35S-LeT6 transgene. Complete suppression of the vegetative meristem program may cause the plant to shift to the production of floral meristems (Shannon and Meeks-Wagner, 1993). Coordinate Regulation of Homeobox Genes Although class I knox genes are expressed at high levels in meristems of Arabidopsis (Lincoln et al., 1994; Long et al., 1996), the class II knox gene Knat 3 has been shown to be expressed at low levels in the SAM and is postulated to have diverse roles in the plant (Serikawa et al., 1997). In contrast, the expression patterns of LeT6, a class I knoxgene, and LeT12, a class II knox gene, appear to be very similar in wild-type reproductive structures in tomato (Janssen et al., 1998). This could be due to coincidence, to coordinate regulation of these two genes in the organs examined, or to regulation of expression of one gene by the other. Expression in ectopic locations by the CaMV 35S promoter has allowed us to monitor the expression patterns of LeT12 relative to LeT6 in adjacent tissue sections. High levels of LeT6 expression are coincident with high levels of LeT12 expression in 35S-LeT6plants. Either the 35S-LeT6 plants produce ectopic organs and both genes are expressed in these organs (as they would be in wild-type organs of a similar nature) orLeT6 overexpression leads to LeT12 overexpression as part of a developmental cascade of events. This indicates that, as has previously been observed in animal systems (Carroll and Vavra, 1989; Magli et al., 1991), plant homeobox genes may participate in morphogenetic events through an interrelated regulatory network. This may be a way to fine-tune expression patterns and morphogenetic fields. Previous attempts at identifying such regulatory relationships have utilized probes from the class I knox genes only (Jackson et al., 1994). Our results hint that there may be regulation of a class II gene by a class I gene. The nature of this regulation, i.e. direct or indirect, and the consequence of coordinate expression of the two genes in tomato remains to be explored. Evolutionary Considerations Compound leaves may have arisen multiple times in the dicots. Leaf morphology seems to be evolutionarily plastic, with variations in degree of pinnation and the order of initiation of leaflets. We see that alterations in levels of a class I knox gene can lead not only to increased orders of pinnation, but can also alter the order in which leaflets are generated. This suggests that some of the natural variation in compound leaf morphology could be explained by alterations in the expression patterns of the class I knox genes. The Type II transgenic class bears resemblance to genera in the aquatic Angiosperm family Podostemaceae, in which most members have “thalloid” bodies that produce clusters of floral branches (Rutishauser, 1995). Analysis of homeobox gene expression in these genera and in organisms with leaves bearing ectopic meristems (e.g.Kalanchoe) may be useful in elucidating the causes of these unique morphologies. Overexpression of the class I knox gene LeT6 in tomato has revealed an important role for this gene in morphogenesis of the compound leaf. These transgenic leaves produce meristems in ectopic locations analogous to axils between the junction of the leaf and the stem. In addition, gradients of maturation are altered in these leaves, leading to conversion of lobes into leaflets. These features indicate that the tomato leaf has some indeterminate stem-like features, and that leaves, leaflets, and lobes all represent a continuum of structures that are distinguishable only by virtue of timing and maturation patterns of the organ as a whole. The phenotypes that we observed, as well as the changes in determinacy in the transgenic plants, suggest that alterations in homeobox gene expression may provide one explanation for the natural range of variability in leaf shape and plant form. ACKNOWLEDGMENTS We are grateful to John Harada for advice and encouragement, to Rich Jorgensen for helpful discussions on cosuppression, and to Sharon Kessler, Tom Goliber, and Kim Snowden for critical reading of the manuscript. We thank Dr. Charlie Rick and the Tomato Genetics Resource Center, University of California, Davis (UCD), for seed stocks, and we are especially grateful to Virginia Ursin and Maureen Daley of Calgene, Inc., for allowing us to perform the tomato transformations at their facility with assistance from Danny Lee, Huy Nguyen, and Joy Philipson. We also thank Andrina Williams for help with the SEM and in situ analyses, and Vivek Pai (National Science Foundation Young Scholars Program at UCD) and Bhaskar Sinha for help with the tobacco transformations. Abbreviations: CaMV cauliflower mosaic virus SAM shoot apical meristem SEM scanning electron microscopy LITERATURE CITED 1 An G Ebert PR Mitra A Ha SB Binary vectors. Gelvin SB Schilperoort RA Plant Molecular Biology Manual. 1988 1 19 Kluwer Academic Publishers Dordrecht, The Netherlands 2 Benfey PN Ren L Chua N-H The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns. EMBO J 8 1989 2195 2202 Google Scholar Crossref Search ADS PubMed WorldCat 3 Bowman JL Smyth DR Meyerowitz EM Genetic interactions among floral homeotic genes of Arabidopsis. Development 112 1991 1 20 Google Scholar PubMed OpenURL Placeholder Text WorldCat 4 Carrol SB Vavra SH The zygotic control of Drosophila pair-rule gene expression: spacial repression by gap and pair rule gene products. Development 107 1989 673 683 Google Scholar PubMed OpenURL Placeholder Text WorldCat 5 Chandra Shekhar KN Sawhney VK Leaf development in the normal and solanifolia mutant of tomato (Lycopersicon esculentum). Am J Bot 77 1990 46 53 Google Scholar Crossref Search ADS WorldCat 6 Chen J-J Janssen B-J Williams A Sinha N A gene fusion at a homeobox locus: alterations in leaf shape and implications for morphological evolution. Plant Cell 9 1997 1289 1304 Google Scholar PubMed OpenURL Placeholder Text WorldCat 7 Chomczynski P Sacchi N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162 1987 156 159 Google Scholar Crossref Search ADS PubMed WorldCat 8 Chuck G Lincoln C Hake S KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8 1996 1277 1289 Google Scholar PubMed OpenURL Placeholder Text WorldCat 9 Clark SE Running MP Meyerowitz EM CLAVATA1, a regulator of meristem and flower development in Arabidopsis. Development 119 1993 397 418 Google Scholar PubMed OpenURL Placeholder Text WorldCat 10 Coen ES Romero JM Doyle S Elliott R Murphy G Carpenter R Floricaula: a homeotic gene required for flower development in Antirrhinum majus. Cell 63 1990 1311 1322 Google Scholar Crossref Search ADS PubMed WorldCat 11 Coleman WK Greyson RI The growth and development of the leaf in tomato (Lycopersicon esculentum) II: leaf ontogeny. Can J Bot 54 1976 2704 2717 Google Scholar Crossref Search ADS WorldCat 12 Comai LC Moran P Maslyar D Novel and useful properties of a chimeric plant promoter combining CaMV 35S and MAS elements. Plant Mol Biol 15 1990 373 381 Google Scholar Crossref Search ADS PubMed WorldCat 13 de Carvahlo Niebel F Frendo P van Montagu M Cornelissen M Post-transcriptional cosuppression of β-1,3-glucanase genes does not affect accumulation of transgene nuclear mRNA. Plant Cell 7 1995 347 358 Google Scholar PubMed OpenURL Placeholder Text WorldCat 14 Dellaporta SJ Wood J Hicks JB A plant DNA minipreparation, version II. Plant Mol Biol Rep 1 1983 19 21 Google Scholar Crossref Search ADS WorldCat 15 Dengler NG Comparison of leaf development in normal (+/+), entire (e/e), and Lanceolate (La/+) plants of tomato, Lycopersicon esculentum “Ailsa Craig.” Bot Gaz 145 1984 66 77 Google Scholar Crossref Search ADS WorldCat 16 Eames AJ Morphology of Angiosperms. 1961 McGraw-Hill Co., New York 17 Fillatti JJ Kiser J Rose R Comai L Efficient transfer of a glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Bio/Technology 5 1987 726 730 Google Scholar OpenURL Placeholder Text WorldCat 18 Flavell RB Inactivation of gene expression in plants as a consequence of specific sequence duplication. Proc Natl Acad Sci USA 91 1994 3490 3496 Google Scholar Crossref Search ADS PubMed WorldCat 19 Hagemann W (1984) Morphological aspects of leaf development in ferns and angiosperms. In RA White, WC Dickison, eds, Contemporary Problems in Plant Anatomy. Academic Press, New York, pp 301–349 20 Hagemann W Gleissberg S Organogenetic capacity of leaves: the significance of marginal blastozones in angiosperms. Plant Syst Evol 199 1996 121 152 Google Scholar Crossref Search ADS WorldCat 21 Hareven D Gutfinger T Parnis A Eshed Y Lifschitz E The making of a compound leaf: genetic manipulation of leaf architecture in tomato. Cell 84 1996 735 744 Google Scholar Crossref Search ADS PubMed WorldCat 22 Hoekema A Hirsch PR Hooykaas PJJ Schilperoort RA A binary vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303 1983 179 180 Google Scholar Crossref Search ADS WorldCat 23 Jackson D Veit B Hake S Expression of maize KNOTTED-1 related homeobox genes predicts patterns of morphogenesis in the vegetative shoot. Development 120 1994 405 413 Google Scholar OpenURL Placeholder Text WorldCat 24 Janssen B-J Williams A Chen J-J Mathern J Hake S Sinha N Isolation and characterization of two knotted-like homeobox genes from tomato. Plant Mol Biol 36 1997 417 425 Google Scholar Crossref Search ADS WorldCat 25 Jorgensen RA Cosuppression, flower color patterns, and metastable gene expression states. Science 268 1995 686 691 Google Scholar Crossref Search ADS PubMed WorldCat 26 Kerstetter R Vollbrecht E Lowe B Veit B Yamaguchi J Hake S Sequence analysis and expression patterns divide the maize knotted1-like homeobox genes into two classes. Plant Cell 6 1994 1877 1887 Google Scholar PubMed OpenURL Placeholder Text WorldCat 27 Lacroix CR Sattler R Expression of shoot features in early leaf development of Murraya paniculata (Rutaceae). Can J Bot 76 1994 678 687 Google Scholar OpenURL Placeholder Text WorldCat 28 Lincoln C Long J Yamaguchi J Serikawa K Hake S A knotted1-like homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6 1994 1859 1876 Google Scholar PubMed OpenURL Placeholder Text WorldCat 29 Long JA Moan EI Medford JI Barton MK A member of the KNOTTED class of homeodomain proteins encoded by the STM1 gene of Arabidopsis. Nature 379 1996 66 69 Google Scholar Crossref Search ADS PubMed WorldCat 30 Magli MC Barba P Celetti A De Vita G Cillo C Boncinelli E Coordinate regulation of HOX genes in human hematopoietic cells. Proc Natl Acad Sci USA 88 1991 6348 6352 Google Scholar Crossref Search ADS PubMed WorldCat 31 Matzke MA Matzke AJM How and why do plants inactivate homologous (trans)genes? Plant Physiol 107 1995 679 685 Google Scholar Crossref Search ADS PubMed WorldCat 32 McBride KE Summerfelt KR Improved binary vectors for Agrobacterium-mediated plant transformation. Plant Mol Biol 14 1990 269 276 Google Scholar Crossref Search ADS PubMed WorldCat 33 McGinnis W Levine MS Hafen E Kuroiwa A Gehring WJ A conserved DNA sequence in homeotic genes of the Drosophila antennapedia and bithorax complexes. Nature 308 1984 428 433 Google Scholar Crossref Search ADS PubMed WorldCat 34 Merrill EK Heteroblastic seedlings of green ash. I. Predictability of leaf form and primordial length. Can J Bot 64 1986 2645 2649 Google Scholar Crossref Search ADS WorldCat 35 Meyerowitz EM In situ hybridization to RNA in plant tissue. Plant Mol Biol Rep 5 1987 242 250 Google Scholar Crossref Search ADS WorldCat 36 Park Y-D Papp I Moscone EA Iglesias VA Vaucheret H Matzke AJM Matzke MA Gene silencing mediated by promoter homology occurs at the level of transcription and results in meiotically heritable alterations in methylation and gene activity. Plant J 9 1996 183 194 Google Scholar Crossref Search ADS PubMed WorldCat 37 Parnis A Cohen O Gutfinger T Hareven D Zamir D Lifschitz E The dominant developmental mutants of tomato, Mouse-ear and Curl, are associated with distinct modes of abnormal transcriptional regulation of a Knotted gene. Plant Cell 9 1997 2143 2158 Google Scholar PubMed OpenURL Placeholder Text WorldCat 38 Pruitt RE Meyerowitz EM Characterization of the genome of Arabidopsis thaliana. J Mol Biol 187 1986 169 183 Google Scholar Crossref Search ADS PubMed WorldCat 39 Que Q Wang H-Y English J Jorgensen RA The frequency and degree of cosuppression by sense chalcone synthase transgenes are dependent on transgene promoter strength and are reduced by premature nonsense codons in the transgene coding sequence. Plant Cell 9 1997 1357 1368 Google Scholar Crossref Search ADS PubMed WorldCat 40 Rick CM Butler L Cytogenetics of the tomato. Adv Genet 7 1956 267 382 Google Scholar OpenURL Placeholder Text WorldCat 41 Rutishauser R Developmental patterns of leaves in Podostemaceae compared with more typical flowering plants: saltational evolution and fuzzy morphology. Can J Bot 73 1995 1305 1317 Google Scholar Crossref Search ADS WorldCat 42 Sambrook J Fritsch EF Maniatis T Molecular Cloning: A Laboratory Manual. 1989 Cold Spring Harbor Laboratory Press Cold Spring Harbor, NY 43 Sattler R Rutishauser R Partial homology of pinnate leaves and shoots: orientation of leaflet inception. Bot Jahrb Syst Pflanzengesch pflanzengeogr 114 1992 61 79 Google Scholar OpenURL Placeholder Text WorldCat 44 Scott MP Tamkun JW Hartzell GW III The structure and function of the homeodomain. Biochim Biophys Acta 989 1989 25 48 Google Scholar PubMed OpenURL Placeholder Text WorldCat 45 Serikawa K Martinez-Laborda A Kim H-S Zambryski P Localization of expression of KNAT3, a class 2 knotted1-like gene. Plant J 11 1997 853 861 Google Scholar Crossref Search ADS PubMed WorldCat 46 Shannon S Ry Meeks-Wagner D Genetic interactions that regulate inflorescence development in Arabidopsis. Plant Cell 5 1993 639 655 Google Scholar Crossref Search ADS PubMed WorldCat 47 Sinha N Williams R Hake S Overexpression of the maize homeobox gene, KNOTTED-1, causes a switch from determinate to indeterminate cell fates. Genes Dev 7 1993 787 795 Google Scholar Crossref Search ADS PubMed WorldCat 48 Sinha N Simple and compound leaves: reduction or multiplication? Trends Plant Sci 2 1997 396 402 Google Scholar Crossref Search ADS WorldCat 49 Smith LG Greene B Veit B Hake S A dominant mutation in the maize homeobox gene, Kn1, causes its ectopic expression in leaf cells with altered fates. Development 116 1992 21 30 Google Scholar PubMed OpenURL Placeholder Text WorldCat 50 Vollbrecht E Veit B Sinha N Hake S The developmental gene Knotted-1 is a member of a maize homeobox gene family. Nature 350 1991 241 243 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 This work was funded by the National Science Foundation (grant no. IBN-96-32013). * Corresponding author; e-mail [email protected]; fax 1–530–752–5410. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Pearce, Roger S.; Houlston, Claire E.; Atherton, Kathryn M.; Rixon, Jane E.; Harrison, Paul; Hughes, Monica A.; Alison Dunn, M.

doi: 10.1104/pp.117.3.787pmid: 9662521

Abstract Tissues expressing mRNAs of three cold-induced genes, blt101, blt14, andblt4.9, and a control gene, elongation factor 1α, were identified in the crown and immature leaves of cultivated barley (Hordeum vulgare L. cv Igri). Hardiness and tissue damage were assessed. blt101 and blt4.9mRNAs were not detected in control plants; blt14 was expressed in control plants but only in the inner layers of the crown cortex. blt101 was expressed in many tissues of cold-acclimated plants but most strongly in the vascular-transition zone of the crown; blt14 was expressed only in the inner layers of the cortex and in cell layers partly surrounding vascular bundles in the vascular-transition zone; expression ofblt4.9, which codes for a nonspecific lipid-transfer protein, was confined to the epidermis of the leaf and to the epidermis of the older parts of the crown. None of the cold-induced genes was expressed in the tunica, although the control gene was most strongly expressed there. Thus, the molecular aspects of acclimation differed markedly between tissues. Damage in the vascular-transition zone of the crown correlated closely with plant survival. Therefore, the strong expression of blt101 and blt14 in this zone may indicate a direct role in freezing tolerance of the crown. Freezing is one of the most widespread environmental stresses. Plants able to overwinter in temperate and colder regions acclimate, i.e. they respond to low temperatures by increasing the frost intensity that they can survive. The expression of numerous genes is greatly increased during acclimation, but the biochemical and physiological functions of many of them are unknown. In nature freezing can be accompanied by other winter stresses, including water-logging and ice encasement, which cause anaerobic stress, and wind and direct sunlight, which, if the soil is frozen, can cause shoot dehydration. Plants adapted to these environments will acclimate to tolerate these stresses as well as the direct effects of freezing. In addition, growth and primary metabolism acclimate to cold (Guy, 1990); this allows the plant to compensate slightly for the adverse effect of cold on the growth rate and helps to provide the metabolic support essential for acclimation to frost and other winter stresses. It is possible that genes expressed during acclimation have a function related to any of these adaptations to winter. Identifying the tissues in which cold-induced genes are expressed would be an important step toward understanding their possible functions, since this will eliminate some functional associations from consideration and will suggest others. This is best done in a heterogeneous organ in which the different parts are functionally distinct and some parts are likely to be more frost sensitive than others. The cereal crown is particularly appropriate. It includes the shoot apex, leaf and tiller initials, bases of the unemerged leaves and of still-growing leaf sheaths, and the subtending stem, including root initials and newly emerging roots. Within the crown, the following tissues can be identified: vascular bundles that develop in the newly forming tissues, servicing the older organs and forming the vascular-transition zone; the epidermis and cortex; stem tissue surrounding vascular bundles in the transition zone; the tunica, comprising several cell layers at the apex; and the pith meristem and subapical meristems. These parts differed in sensitivity to frost when tested in other Gramineae (Tanino and McKersie, 1985; Shibata and Shimada, 1986). In addition, the crown is the part of the barley (Hordeum vulgare) plant in which survival has the most impact on survival of the plant as a whole (Olien, 1967). Although most of our experiments focused on the crown, expression in leaves was also examined for comparison. We cloned and characterized a number of cold-induced genes expressed in the crown of the barley cv Igri. blt4.9 and closely related genes form a small multigene family with members coding for nsLTPs (Dunn et al., 1991; White et al., 1994). In barley some nsLTPs are expressed in response to drought and some in response to cold (Molina and Garcı́a-Olmedo, 1993; White et al., 1994). blt14is also a member of a small multigene family but has no similarity to any sequence of known function; expression of all of the known members of this multigene family is strongly up-regulated in response to cold (Dunn et al., 1990; Phillips et al., 1997); other stresses, including drought, had a lesser effect on expression (Pearce et al., 1996).blt101 is one of two closely related genes in barley that have no similarity to any sequence of known function (Goddard et al., 1993); its expression is strongly up-regulated in response to cold but not in response to drought (Pearce et al., 1996). These genes, or closely related sequences, are all expressed in response to cold in the mature shoot tissues, and two (blt14 and blt101) are also expressed in the roots of cold-grown barley (Dunn et al., 1990; Goddard et al., 1993). The mechanisms by which their mRNA levels are controlled differ: the cold up-regulation of blt4.9 andblt101 mRNAs is transcriptionally controlled, whereas the cold up-regulation of blt14 is posttranscriptionally controlled (Dunn et al., 1994). Overall, the three genes, although all cold up-regulated, are representative of different expression patterns and mechanisms. A control gene coding for EF-1α (blt63), which has high sequence similarity to other EF-1α genes (Dunn et al., 1993), was also included in the experiments. The objectives of the experiments were (a) to use in situ hybridization of mRNA to determine in which tissues of the cold-acclimating barley crown meristem and developing leaves the three cold up-regulated genes (blt101, blt14, and blt4.9) are expressed, (b) to compare these expression patterns with the frost susceptibility of the tissues, and (c) to use this as a basis for drawing conclusions about possible functional relationships of the genes. MATERIALS AND METHODS Plant Material and Growth Environments Seeds of cultivated barley (Hordeum vulgare L. cv Igri) were sown in John Innes no. 2 potting compost (12 seeds/10-cm pot) and germinated in a controlled-environment room set at 20/15°C (day/night), a 10-h photoperiod, and 175 μmol m−2 s−1 photon flux density (400–700 nm). This was designated the control environment. When the third leaf had emerged in 50 to 75% of plants (about 14 d after sowing), plants for cold acclimation were transferred to a controlled environment set at 6/2°C (day/night) and with the other environmental parameters the same as the control; control plants remained in the 20/15°C environment. Both control and cold-grown plants were analyzed when the fourth leaf was emerging in about 50% of the plants, by which time frost tolerance in the cold-acclimated plants was approaching the maximum for this cultivar and environment (Pearce et al., 1996). Harvesting and Fixation of the Plant Samples and Processing to Prepare Sections for Hybridization The plants were washed free of soil, dabbed dry, and the outer, fully emerged leaf blades and sheaths were stripped off. Leaf material 5 mm above the base and emerged roots were cut off and discarded, and the resultant plant piece was transferred to fixative on ice while further samples were collected. Leaf blades almost emerging or just emerged from enclosing sheaths were also collected and fixed. To protect the samples against exogenous RNase during the procedure, solutions were treated with diethyl pyrocarbonate and autoclaved, and glassware and metal items were baked. The method for fixation and processing for hybridization was modified from Gurr et al. (1992) as follows (all percentages are weight per volume): Plant pieces were fixed in 4% formaldehyde using vacuum infiltration for 20 min at room temperature and then kept in the fixative overnight at 4°C. They were then dehydrated and transferred via Histoclear (National Diagnostics, Hull, UK) to wax and vacuum embedded. Eight-micrometer sections were cut and floated on sterile distilled water heated to 50°C and then transferred onto poly l-Lys-coated slides. The sections were rehydrated and transferred sequentially to PBS (0.13 mNaCl, 0.007 mNa2HPO4, and 0.003m NaH2PO4) for 2 min, to a 125-μg/mL solution of a protease from Streptomyces griseus (Sigma) in buffer (0.05 m Tris-HCl and 0.005m EDTA, pH 7.5) for 10 min, to Gly (0.2% in PBS), and then to PBS, refixed in 4% paraformaldehyde in PBS for 10 min, washed in PBS, transferred to 0.85% NaCl, and dehydrated. Some sections were treated with RNase type 1-A (Sigma; 20 μg/μL in 0.5 mNaCl, 10 mm Tris-HCl, pH 7.5, and 1 mm EDTA, at 37°C for 30 min) immediately after the Gly step, after which they were treated in the same way as other sections . Preparation of Riboprobes, in Situ Hybridization, and Probe Detection Gene sequences were subcloned into pGEM-5Zf (Promega). The SP6 and T7 RNA polymerase promoters on complementary strands were used to promote transcription of either the sense or antisense RNA strand. Digoxigenin-labeled RNA was synthesized using a kit (Boehringer Mannheim). Before use the riboprobe was heated for 2 min at 80°C and then cooled on ice and centrifuged. The supernatant was added to hybridization buffer (final composition: 1 m NaCl, 0.033m Tris-HCl, 0.033 mNaH2PO4, 16.7 mm EDTA, pH 6.8, 30% formamide, 3.3 mg/mL tRNA, and 3.3× Denhardt's solution; all solutions used in preparation were treated with diethyl pyrocarbonate) to make the hybridization mixture. The probe was used in the concentration range of 0.1 to 0.3 ng μL−1 kb−1. Hybridization was carried out overnight at 50°C and the samples were washed with shaking in sequence as follows: first with 2× SSC buffer, 50% formamide for 30 min at 50°C; then twice with 2× SSC buffer for 1.5 h at 50°C; twice with 0.5 m NaCl, 10 mm Tris-HCl, pH 7.5, and 1 mm EDTA (NTE buffer) for 5 min each at 37°C; once with RNase A (20 μg/mL RNase A in NTE buffer) for 30 min at 37°C; twice with NTE buffer for 5 min at 37°C; once with 2× SSC buffer for 1 h at 50°C; and, finally, once with PBS for 2 min. A digoxigenin-detection kit (Boehringer Mannheim) was used to detect the probe. When development had taken place, the sections were washed in sterile distilled water, dehydrated, and mounted in Canada balsam (Sigma). The result was recorded on tungsten-balanced transparency film (RTP, ASA 64, Fuji, Tokyo, Japan). Tests of Plant and Tissue Tolerance of Freezing Stress To test frost survival directly by a regrowth test after freezing, plants were trimmed to remove roots and leaf blades, placed in tubes, immersed in an alcohol bath with ice added to initiate freezing, exposed to subfreezing temperatures, thawed, planted in John Innes no. 2 potting compost, and returned to the control environment, as described previously (Pearce et al., 1996). Survival was judged after 7 and 28 d by continued regrowth above 3 mm. For the tests of tissue damage, plants were exposed to frost, thawed, and planted in compost in the same way as for the regrowth test described above. After 1 d in the control environment the tillers were removed from soil and washed, and the bases were bisected. These were then immersed in 0.5% TTC in 50 mm Hepes, pH 7.4, at room temperature in the dark for 1.5 h, and then rinsed in water (Tanino and McKersie, 1985). With this test, formazan, the reduction product of TTC, stains red in living tissue, whereas nonliving tissue remains white. Staining of different parts exposed at the cut surface was assessed microscopically using a low-power binocular microscope to identify which regions were alive and which were dead (figures inTanino and McKersie, 1985, illustrate the appearance), and the appearance was photographed (Kodak Gold 200 ASA color-negative film). The regions documented were leaf sheaths surrounding apex and stem, the apex, the inner part of the subapical region, the inner part of the base, and the cortex. Statistical tests of differences between the results for tiller survival (by the regrowth test) and tissue survival (by the TTC test) were determined by ascribing confidence intervals to the individual percent-survival values, taking account of the sample sizes (table 41 in Pearson and Hartley, 1956) and using correlation analysis. RESULTS Controls for the in Situ Hybridization Methodology Treatment of sections with RNase before hybridization, exclusion of the probe from the normal procedure, and the use of the sense probe gave no signal. Figure 1, A and B, substantiates the last point for the crown tip and the vascular-transition zone for two sense sequences, blt63 andblt101; blt14 and blt4.9 sense sequences were also tested and also gave no signal either with tissue from control (20/15°C) or from cold-grown (6/2°C) plants. These tests showed that the positive signals obtained with the sections given the normal procedure and using the antisense sequences were attributable to mRNA rather than to nonspecific binding or endogenous phosphatase activity. Fig. 1. Open in new tabDownload slide Sections of barley crown hybridized with sense (A and B) or antisense (C–I) digoxigenin-labeled sequences. A blue-purple color indicates a positive signal. A and B, Longitudinal sections of the basal (A) and apical (B) region of the crown from cold-grown plants, hybridized with sense blt101 (A) or senseblt63 (B). Stars, Vascular bundles; ▵, tissue within the apical tip. C to E, Longitudinal sections of crowns from control (C) or cold-grown (D and E) plants hybridized with antisenseblt63 (C and D) or antisense blt101 (E). Stars, Base; thick arrows, apex; thin arrows, stain (blt63) around developing vascular tissue. F, Longitudinal section of a subsidiary apex in the crown of a cold-grown plant hybridized with antisense blt14. Double arrow, Stain in the inner region of the cortex. G to I, Transverse sections of the apical regions of crowns from cold-grown plants hybridized with antisense blt63 (G), blt101 (H), orblt4.9 (I). ▵, Tissue within the apical tip; double arrowheads, stain (blt63) within vascular bundles in leaf initials; thin arrows, stain (blt101) around vascular bundles in leaf initials; arrowheads, stain (blt4.9) in one epidermis. C and G, Bright-field microscopy; A, B, D–F, H, and I, Interference contrast microscopy. Bars in A, C, and F = 200 μm (A and B are same scale; C to E are same scale; and F to I are same scale). Fig. 1. Open in new tabDownload slide Sections of barley crown hybridized with sense (A and B) or antisense (C–I) digoxigenin-labeled sequences. A blue-purple color indicates a positive signal. A and B, Longitudinal sections of the basal (A) and apical (B) region of the crown from cold-grown plants, hybridized with sense blt101 (A) or senseblt63 (B). Stars, Vascular bundles; ▵, tissue within the apical tip. C to E, Longitudinal sections of crowns from control (C) or cold-grown (D and E) plants hybridized with antisenseblt63 (C and D) or antisense blt101 (E). Stars, Base; thick arrows, apex; thin arrows, stain (blt63) around developing vascular tissue. F, Longitudinal section of a subsidiary apex in the crown of a cold-grown plant hybridized with antisense blt14. Double arrow, Stain in the inner region of the cortex. G to I, Transverse sections of the apical regions of crowns from cold-grown plants hybridized with antisense blt63 (G), blt101 (H), orblt4.9 (I). ▵, Tissue within the apical tip; double arrowheads, stain (blt63) within vascular bundles in leaf initials; thin arrows, stain (blt101) around vascular bundles in leaf initials; arrowheads, stain (blt4.9) in one epidermis. C and G, Bright-field microscopy; A, B, D–F, H, and I, Interference contrast microscopy. Bars in A, C, and F = 200 μm (A and B are same scale; C to E are same scale; and F to I are same scale). The blt63 antisense probe (Fig. 1, C, D, and G) hybridized with every living cell, although with varying intensity, and thus was used as a positive control for the method. This positive signal showed that the absence of a signal from any section or from any particular tissue in the section, when probed with the antisense strand of one of the other genes, was due to the absence of sufficient corresponding mRNA to generate a signal and was not an artifact (such as from local impenetrability). The blt63 probe was also used to indicate areas of probable active protein synthesis and thus the areas that were metabolically most active. Localization of Expression in Crowns The pattern of blt63 signal intensity was the same for both cold-acclimated and control plants: the signal was strongest at the apex and weakest at the base of the crown (Fig. 1, C and D). In contrast to this pattern, the blt101 signal in the cold-acclimated plants was weakest at the apex and strongest at the base (Fig. 1E). In the apex the blt63 signal was strongest in the outermost cell layers of the shoot meristem tip and weaker in the pith (Fig. 1, C and D). Again, in contrast to this, there was noblt101 signal from the peripheral cell layers at the apex, but there was a distinct but weak signal from the adjacent core of the apex (Fig. 1E). The contrast was even greater with blt14, which gave no signal from any part of the apex from cold-acclimated plants but gave a strong signal from the inner layers of the cortex and other tissues lower in the crown (Fig. 1F). The contrasting patterns of expression at the apex of cold-acclimated plants are shown in greater detail by transverse sections (Fig. 1, G–I; control plants gave no signal for blt101,blt14, or blt4.9 [not shown]). There was a strong blt63 signal from the youngest leaf initials and from vascular bundles in younger and older organs, a weaker signal from other tissues in the more developmentally advanced leaf tissue, and, again, a weaker signal from the core of the apex (Fig. 1G). In contrast, there was a detectable but weak blt101 signal only from the core of the apex and from the cells immediately surrounding but not in the vascular bundles in the developing leaves (Fig. 1H). In contrast to both, blt4.9 gave a signal only from the epidermis of the oldest leaf in the section shown, subtending the main apex, but not from the surface cell layers of any of the younger organs (Fig. 1I); there was no blt4.9 signal from the corresponding epidermis in control plants (not shown). Only the abaxial epidermis gave a signal, illustrating a remarkable difference in response within a single organ between the two surfaces; however, in older leaves the adaxial as well as the abaxial epidermis gave a signal (not shown). These comparisons make it clear that, whereas blt63 gave signals from all living cell types and tissues, blt101,blt14, and blt4.9 did not. There were also many detailed differences in patterns of expression in the basal regions of the crown. Control plants gave noblt101 or blt4.9 signals (Fig.2, A and B); however, the inner region of the cortex (but no other tissue) did give a blt14 signal (Fig. 2C). The inner region of the crown cortex from cold-grown plants gave signals for blt101 and blt14 as well as forblt63 (Fig. 2, D–F). Cell layers immediately surrounding but not in the vascular bundles in this basal region gave strongblt101 and blt14 signals (Fig. 2, D and E). A detailed comparison between the patterns of expression of theblt63 and blt101 sequences revealed clear differences: an arc of tissue immediately surrounding part of the vascular bundles gave a strong blt101 signal but very faintblt63 signal, whereas cell layers between these gave noblt101 signal but did give a clear blt63 signal (Fig. 2, D and F). Again, unlike the other sequences, ablt4.9 signal was given only by the epidermis (Fig. 2G). Fig. 2. Open in new tabDownload slide Sections of barley crown and leaves hybridized with antisense digoxigenin-labeled sequences. A blue-purple color indicates a positive signal. A and B, Longitudinals sections from the basal region of crowns from control plants hybridized with antisense blt101 (A) or blt4.9 (B). Stars, Vascular bundles; arrowheads, epidermis. C, Transverse section from the basal region of a control crown hybridized with antisense blt14. Stars, Vascular bundles; double arrows, stain in the inner region of the cortex. D to F, Longitudinal sections from the basal regions of crowns from cold-grown plants hybridized with antisense blt101 (D),blt14 (E), or blt63 (F). Large stars, Vascular bundles; double arrows, stain in the cortex; single arrows, tissue around part of each vascular bundle either stained (blt101 and blt14) or not stained (blt63); small stars, tissue layers between vascular bundles either not stained (blt101) or stained (blt63). G, Transverse section from the basal region of a crown from a cold-grown plant hybridized with antisenseBLT4.9. Stars, Vascular bundles; arrowheads, stain in the epidermis. H, Glancing longitudinal section of a developing leaf initial from a cold-grown plant hybridized with antisenseblt14. Double arrows, Stain between developing vascular bundles. I and J, Transverse section of emerging leaf blades from cold-grown plants hybridized with blt101 (I) orblt4.9 (J). Double arrowheads, Stain (blt101) in cells within a vascular bundle; single arrowheads, stain (blt4.9) in epidermis. All sections viewed using interference contrast microscopy. Bar in B = 200 μm (A–H are the same scale); bar in J = 50 μm (I and J are the same scale). Fig. 2. Open in new tabDownload slide Sections of barley crown and leaves hybridized with antisense digoxigenin-labeled sequences. A blue-purple color indicates a positive signal. A and B, Longitudinals sections from the basal region of crowns from control plants hybridized with antisense blt101 (A) or blt4.9 (B). Stars, Vascular bundles; arrowheads, epidermis. C, Transverse section from the basal region of a control crown hybridized with antisense blt14. Stars, Vascular bundles; double arrows, stain in the inner region of the cortex. D to F, Longitudinal sections from the basal regions of crowns from cold-grown plants hybridized with antisense blt101 (D),blt14 (E), or blt63 (F). Large stars, Vascular bundles; double arrows, stain in the cortex; single arrows, tissue around part of each vascular bundle either stained (blt101 and blt14) or not stained (blt63); small stars, tissue layers between vascular bundles either not stained (blt101) or stained (blt63). G, Transverse section from the basal region of a crown from a cold-grown plant hybridized with antisenseBLT4.9. Stars, Vascular bundles; arrowheads, stain in the epidermis. H, Glancing longitudinal section of a developing leaf initial from a cold-grown plant hybridized with antisenseblt14. Double arrows, Stain between developing vascular bundles. I and J, Transverse section of emerging leaf blades from cold-grown plants hybridized with blt101 (I) orblt4.9 (J). Double arrowheads, Stain (blt101) in cells within a vascular bundle; single arrowheads, stain (blt4.9) in epidermis. All sections viewed using interference contrast microscopy. Bar in B = 200 μm (A–H are the same scale); bar in J = 50 μm (I and J are the same scale). Localization of Expression in Leaves In the older leaf initials from cold-acclimated plants there was ablt14 signal from cells between but not in the vascular bundles (Fig. 2H). However, cells throughout the emerging leaf blades and surrounding sheaths of cold-acclimated plants probed withblt101 gave a signal, including cells within the vascular bundles (Fig. 2I). The absence of signal from some cells could reflect the apparent absence of cytoplasm in the section of that cell, and, similarly, variation in signal between individual cells could at least partly reflect variations in the amount and local thickness of cytoplasm remaining after sectioning had removed part. As in the crown, only the epidermal cells gave a blt4.9 signal (Fig. 2J). Noblt14, blt101, or blt4.9 signals were detectable in leaf sections from control plants (not shown). Hardiness of Crown Parts After the TTC test, controls were stained red throughout, indicating that all tissues were alive. Specimens exposed to freezing temperatures were generally less intensely red after exposure to progressively lower temperatures (not shown). The parts that were colorless at the warmest damaging freezing temperatures were the apex and central area of the base, indicating that these areas were the parts that were the most sensitive to freezing temperatures. At lower temperatures other tissues were also colorless and, therefore, dead. The results of the TTC test for tissue damage in the central area of the base, together with the results of the regrowth test of tiller frost survival for control and acclimated material, are summarized in Figure 3. The relationship between survival and damage to the central area of the base of the crown was similar in both nonacclimated and acclimated plants. Putting the results for control and acclimated material together and including one each, only, of the extreme values (100% survival with 100% stained red and 0% survival with 0% stained red) indicated that there was a correlation between tiller survival and survival of the central area of the base (P < 0.001 for the null hypothesis; correlation coefficient = 0.88; n = 7). Fig. 3. Open in new tabDownload slide Tiller survival and tissue damage in the vascular-transition zone of barley following exposure to frost. Young barley cv Igri plants were acclimated (ACC) or not acclimated (NA) to cold. Survival, Percentage of tillers regrowing after exposure to freezing temperatures (n = 12 for each point). TTC, Percentage of center bases of main axes alive after testing for reduction of TTC (n = 11–12 for acclimated plants and 7–10 for nonacclimated plants for each point). Survival and TTC reduction were tested on tillers grown at the same time in the same environments and then exposed at the same time to the same freezing stresses. Fig. 3. Open in new tabDownload slide Tiller survival and tissue damage in the vascular-transition zone of barley following exposure to frost. Young barley cv Igri plants were acclimated (ACC) or not acclimated (NA) to cold. Survival, Percentage of tillers regrowing after exposure to freezing temperatures (n = 12 for each point). TTC, Percentage of center bases of main axes alive after testing for reduction of TTC (n = 11–12 for acclimated plants and 7–10 for nonacclimated plants for each point). Survival and TTC reduction were tested on tillers grown at the same time in the same environments and then exposed at the same time to the same freezing stresses. DISCUSSION The results showed very distinct patterns of expression of the cold-inducible genes at the mRNA level in the cold-acclimated barley crown. Differences in signal intensity between tissues noted inResults for any of the specific mRNAs probed for do not directly indicate differences in specific mRNA content per cell or per unit of cytoplasm, because the cells differ in size and in cytoplasmic content between tissues. Instead, they indicate differences per unit volume of section and hence per unit volume of tissue. Tissues having high expression of the EF-1α mRNA sequence (blt63) were interpreted as indicating areas with a high capacity for protein synthesis and, presumably, high levels of metabolism and total mRNA. blt101 and blt14 were more strongly expressed toward the lower part of the crown, whereasblt63 was more strongly expressed toward the upper part; expression of blt4.9 was confined to the epidermis. Thus, viewed broadly, tissues strongly expressing the cold-induced genes did not correlate with tissues having high metabolic activity. Detailed comparisons confirmed this: (a) none of the three cold-induced genes was detectably expressed in the tunica, although blt63 was most strongly expressed there; (b) the distribution of expression ofblt101, and partly of blt14, in the tissue layers around and between the vascular bundles in the vascular-transition zone was the reverse of the distribution of expression of blt63in this region. This indicates that the cold-induced genes studied here do not have a role in general maintenance of metabolism under stress conditions and, hence, that associations with more specific aspects of acclimation occurring at the tissue level might be detectable. Although metabolic responses are an important component of the response to cold, the results clearly indicate that acclimation-related processes and not a high level of total metabolism is the major activity in those tissues in which these cold-induced genes are most strongly expressed. blt4.9 Some isoforms of nsLTPs are expressed in shoots of nonstressed plants, and these control isoforms and the genes that code for them have been extensively studied (Kader, 1996). The mRNA occurs in the epidermis and the protein is localized extracellularly, in the cuticle and wax layers (Sterk et al., 1991; Clarke and Bohnert, 1993; Thoma et al., 1993; Pyee and Kolattukudy, 1995). Like all other plant nsLTP genes studied so far (Bernhard and Somerville, 1989), the coding region of blt4.9 includes a leader sequence, consistent with an extracellular location for the protein (White et al., 1994). In several members of the Poacea tested the total expression of nsLTP mRNAs is much higher in plants grown in environments imposing cold or dehydrative stresses than in nonstressful environments (H. vulgare: White et al., 1994; Hordeum murinum: Rixon et al., 1994; Lophopyrum elongatum, and Agropyron desertorum: Tabaei Aghdaei, 1997). Clearly, the question arises of whether the stress-associated isoforms have the same function(s) as those suggested for the nonstress-associated isoforms; if they do, a similar location for expression would be predicted. Consistent with this, our results confirm that the site of expression of the cold-inducible nsLTP genes in barley is the epidermis. The functions suggested for the nonstress-associated isoforms of shoot nsLTPs include roles in cuticle formation (Sterk et al, 1991; Meijer et al., 1993) and in resistance to pathogens (Molina et al., 1993). These functions, if correct, may indicate a role for stronger expression under stress conditions. In the case of cold acclimation, the plant can be regarded more accurately as acclimating to winter stress. This can include conditions in which water uptake from the soil is limited because of soil freezing or adverse effects of cold on root-uptake processes, combining with conditions in which the sun, warming the leaf, or high winds cause rapid depletion of shoot moisture. Under these conditions, cuticular properties may contribute to limiting moisture loss from the shoot, helping reduce windburn and sunburn. If the role of nsLTPs is to help reduce stress-induced shoot water loss, then one would expect this function to be applied to all parts of the leaf surface; therefore, all epidermal cells should show up-regulation of stress-induced nsLTP mRNA levels. Consistent with this, blt4.9 mRNA was strongly expressed in all epidermal cells of emerging leaves of the cold-acclimated barley. Experiments with maize and barley have also suggested expression in vascular tissues (Sossountzov et al., 1991; Molina and Garcı́a-Olmedo, 1993). All of the studies designed to test the location of expression have pointed to the epidermis, whereas only some studies have identified expression in vascular tissue. Thus, it is not clear whether this reflects species or cultivar differences or whether, as indicated by Sossountzov et al. (1991), vascular tissue is a site in which only some isoforms are expressed. However, it is clear from the in situ results presented here that, at least in the barley cv Igri, the cold-inducible nsLTP mRNAs detected with theblt4.9 probe are present only in the epidermis. Expression of nsLTP genes in the crown may have a role similar to their expression in the leaf. Snow molds make up a group of pathogens attacking the crown of overwintering cereals and grasses (Gaudet, 1994); therefore, it is possible that genes contributing to pathogen resistance would be expressed in the crown. On the other hand, extraorgan ice can dehydrate cereal crown cells (Pearce and Willison, 1985a); therefore, a role in slowing cell dehydration by slowing water transport through the cuticle (to condense on the extraorgan ice) is also a possibility. blt101 and blt14 The central region of the base of the stem in overwintering grasses and cereals is of particular interest in relation to their susceptibility to frost, because this region, which contains the vascular-transition zone, is relatively susceptible to freezing damage. Both the vascular-transition zone and the apical meristem are more susceptible than other parts of the crown to freezing damage. In wheat the vascular-transition zone is the more susceptible of the two (Tanino and McKersie, 1985), whereas in Dactylis glomerata the apex is slightly more susceptible (Shibata and Shimada, 1986). When barley cv Igri was acclimated in our experiments, the central basal region and shoot apex were of similar susceptibility to freezing damage, and all other parts of the crown were more tolerant. blt14 and blt101 were strongly expressed in perivascular cell layers in the vascular-transition zone of the crown of cold-acclimated barley. They were also expressed in the inner regions of the cortex, including the basal part of the crown adjacent to the vascular-transition zone. Thus, it is possible that they have a role in acclimation in this region, which is relatively susceptible to freezing stress. The survival of this part correlates with the survival of the tiller; therefore, the demonstration here of genes expressed in this part could be a key to understanding frost survival of the whole plant. In wheat a late embryogenesis abundant-like protein coded for by the Wcs120 gene is also expressed in or near crown vascular tissue during cold acclimation (Houde et al., 1995). blt14 and blt101 did not have identical patterns of expression. There were only two tissues in the crown in whichblt14 was expressed, in the cortex (especially the inner region) and in an arc of tissue partly surrounding the vascular bundles in the vascular-transition zone. blt101, however, was also expressed more generally in the crown, including in the apical pith. Therefore, the two genes do not necessarily relate to the same aspects of low-temperature acclimation. Both blt14 and blt101 (and Wsc120) are expressed in other tissues and organs apart from their expression in the base of the crown. It follows that the mechanisms of their actions are unlikely to be related to unique features of the vascular-transition zone. Presumably, the genes are strongly expressed in the vascular-transition zone because of its particular susceptibility to freezing damage. However, it is not clear why the vascular-transition zone has more susceptibility than most other parts. Olien (1964) suggested that the crown of barley could be damaged by either direct ice effects, disrupting xylem elements and disrupting tissues within and surrounding the vascular bundles, or indirectly, by freeze-induced dehydration. Which of these predominated, he proposed, depended on the water content of the crown and the consequent difference in ice crystal size and location. Dehydration is probably the most common cause of freeze-induced cell death in plants and is not dependent on specific tissue structures or specific locations. In contrast, direct ice damage, if it occurs, can depend on specific features of the tissue or organ affected. The expression ofblt14 in the crown is confined to the cortex and an arc of tissue surrounding the vascular bundles of the transition zone. In addition, it may code for an extracellular protein (Phillips et al., 1997). Therefore, a role involving direct interaction with ice, as other extracellular proteins are proposed to do (Griffiths and Antikienen, 1996), is possible. However, rather than directly interacting with the ice, it is equally possible that its role could be to influence tissue structure or cell-to-cell contact and thus to contribute to resistance to local tissue disruption by ice. blt101 was expressed, although sometimes at much lower intensity, in most tissues examined. Therefore, it may have a general involvement in tolerance of the cellular dehydration caused by extracellular freezing. The protein it codes for has a leader sequence that may direct it to the secretary pathway, and the mature protein is predicted to be highly hydrophobic (Goddard et al., 1993); therefore, it could be located in the plasma membrane. Membranes, particularly the plasma membrane, are susceptible to damage from freezing-induced dehydration (Pearce and Willison, 1985b) and may well be the limiting factor in cell survival (Steponkus et al., 1990). The outermost cell layers of the shoot apex did not express any of the cold-induced genes. These cell layers, unlike most other shoot cells, are unexpanded and lack large vacuoles, and consequently they may experience a lesser volumetric collapse than expanded cells when exposed to the same extracellular freezing stress. Hence, it is possible that the specific function of blt101 relates to tolerance of the stresses associated with considerable volumetric collapse. CONCLUSIONS Acclimation in the crown is not a single process equally applied in all cells but, rather, involves in different tissues the expression of different cold-inducible genes in different proportions to each other. Suggestions of function must explain this. The cold-induced nsLTP gene is expressed in the epidermis of the leaf and the older parts of the crown and hence has the same location of expression as nsLTPs expressed (at lower levels) in nonstressed plants of other species. Thus, the function of stress-related and nonstress-related expression of nsLTPs may be the same. The strong expression ofblt101 and blt14 in tissues of the vascular-transition zone indicates direct roles in the frost tolerance of the crown and therefore of the plant. Abbreviations: EF elongation factor nsLTP nonspecific lipid-transfer protein TTC 2,3,5-triphenyl tetrazolium chloride LITERATURE CITED 1 Bernhard WR Somerville CR Coidentity of putative amylase inhibitors from barley and finger millet with phospholipid transfer proteins inferred from amino acid sequence homology. Arch Biochem Biophys 269 1989 695 697 Google Scholar Crossref Search ADS PubMed WorldCat 2 Clarke AM Bohnert HJ Epidermis-specific transcript. Nucleotide sequence of a full-length cDNA of EP112, encoding a putative lipid transfer protein. Plant Physiol 103 1993 677 678 Google Scholar Crossref Search ADS PubMed WorldCat 3 Dunn MA Goddard NJ Zhang L Pearce RS Hughes MA Different control mechanisms mediate the low temperature response of genes in barley. Plant Mol Biol 24 1994 879 888 Google Scholar Crossref Search ADS PubMed WorldCat 4 Dunn MA Hughes MA Pearce RS Jack PL Molecular characterisation of a barley gene induced by cold treatment. J Exp Bot 41 1990 1405 1413 Google Scholar Crossref Search ADS WorldCat 5 Dunn MA Hughes MA Zhang L Pearce RS Quigley AS Jack PL Nucleotide sequence and molecular analysis of the low temperature induced cereal gene, BLT4. Mol Gen Genet 229 1991 389 394 Google Scholar Crossref Search ADS PubMed WorldCat 6 Dunn MA Morris A Jack PL Hughes MA A low-temperature-responsive translation elongation factor 1α from barley (Hordeum vulgare L.). Plant Mol Biol 23 1993 221 225 Google Scholar Crossref Search ADS PubMed WorldCat 7 Gaudet DA Progress towards understanding interaction between cold-hardiness and snow mold resistance and development of resistant cultivars. Can J Plant Pathol 16 1994 241 246 Google Scholar Crossref Search ADS WorldCat 8 Goddard NJ Dunn MA Zhang L White AJ Jack PL Hughes MA Molecular analysis and spatial expression pattern of a low-temperature-specific barley gene, blt101. Plant Mol Biol 23 1993 871 897 Google Scholar Crossref Search ADS PubMed WorldCat 9 Griffiths M Antikienen M Extracellular ice formation in freezing-tolerant plants. Adv Low-Temp Biol 3 1996 107 139 Google Scholar Crossref Search ADS WorldCat 10 Gurr SJ McPherson MJ Bowles DJ Molecular Plant Pathology—A Practical Approach, Vol 1. 1992 IRC Press Oxford, UK 11 Guy CL Cold acclimation and freezing stress tolerance: role of protein metabolism. Annu Rev Plant Physiol Plant Mol Biol 41 1990 187 223 Google Scholar Crossref Search ADS WorldCat 12 Houde M Daniel C Lachapelle M Allard F Laliberté S Sarhan F Immunolocalisation of freezing-tolerance-associated proteins in the cytoplasm and nucleoplasm of wheat crown tissues. Plant J 8 1995 583 593 Google Scholar Crossref Search ADS PubMed WorldCat 13 Kader J-C Lipid-transfer proteins in plants. Annu Rev Plant Physiol Plant Mol Biol 47 1996 627 654 Google Scholar Crossref Search ADS PubMed WorldCat 14 Meijer EA de Vries SC Sterk P Gadella DWJ Wirtz KWA Hendriks T Characterisation of the nonspecific lipid transfer protein—EP2 from carrot (Daucus carota L.). Mol Cell Biochem 123 1993 159 166 Google Scholar Crossref Search ADS PubMed WorldCat 15 Molina A Garcı́a-Olmedo F Developmental and pathogen-induced expression of three barley genes encoding lipid transfer proteins. Plant J 4 1993 983 991 Google Scholar Crossref Search ADS PubMed WorldCat 16 Molina A Segura A Garcı́a-Olmedo F Lipid transfer proteins (nsLTPs) from barley and maize leaves are potent inhibitors of bacterial and fungal plant pathogens. FEBS Lett 316 1993 119 122 Google Scholar Crossref Search ADS PubMed WorldCat 17 Olien CR Freezing processes in the crown of Hudson barley, Hordeum vulgare (L. emend. Lam.) Hudson. Crop Sci 4 1964 91 95 Google Scholar Crossref Search ADS WorldCat 18 Olien CR Freezing stresses and survival. Annu Rev Plant Physiol 18 1967 387 408 Google Scholar Crossref Search ADS WorldCat 19 Pearce RS Dunn MA Rixon JE Harrison P Hughes MA Expression of cold-induced genes and frost hardiness in the crown meristem of young barley (Hordeum vulgare L. cv. Igri) plants grown in different environments. Plant Cell Environ 12 1996 275 290 Google Scholar OpenURL Placeholder Text WorldCat 20 Pearce RS Willison JHM Wheat tissues freeze-etched during exposure to extracellular freezing: distribution of ice. Planta 163 1985a 295 303 Google Scholar Crossref Search ADS WorldCat 21 Pearce RS Willison JHM A freeze-etch study of the effect of extracellular freezing on the cellular membranes of wheat. Planta 163 1985b 304 316 Google Scholar Crossref Search ADS WorldCat 22 Pearson ES Hartley HO Biometrika Tables for Statisticians, Vol 1. 1956 Cambridge University Press Cambridge, UK 23 Phillips JR Dunn MA Hughes MA mRNA stability and localization of the low-temperature-responsive barley gene family blt14. Plant Mol Biol 33 1997 1013 1023 Google Scholar Crossref Search ADS PubMed WorldCat 24 Pyee J Kolattukudy PE The gene for the major cuticular wax-associated protein and three homologous genes from broccoli (Brassica oleracea) and their expression patterns. Plant J 7 1995 49 59 Google Scholar Crossref Search ADS PubMed WorldCat 25 Rixon JE Pearce RS Dunn MA Hughes MA Atherton KM Cairns PM Expression of low temperature induced genes in different cultivars and populations of Hordeum (supplement). J Exp Bot 45 1994 21 Google Scholar OpenURL Placeholder Text WorldCat 26 Shibata S Shimada T Anatomical observation of the development of freezing injury in orchardgrass crown. J Jpn Grass Sci 32 1986 197 204 Google Scholar OpenURL Placeholder Text WorldCat 27 Sossountzov L Riz-Avila L Vignols F Jolliot A Arondel V Tchang F Grosbois M Guerbette F Miginiac E Delseny M and others Spatial and temporal expression of a maize lipid transfer protein gene. Plant Cell 3 1991 923 933 Google Scholar PubMed OpenURL Placeholder Text WorldCat 28 Steponkus PL Lynch DV Uemura M The influence of cold-acclimation on the lipid-composition and cryobehavior of the plasma-membrane of isolated rye protoplasts. Philos Trans R Soc Lond-Biol Sci 326 1990 571 583 Google Scholar OpenURL Placeholder Text WorldCat 29 Sterk P Booij H Schellekens GA Van Kammen A de Vries SC Cell-specific expression of the carrot EP2 lipid transfer protein gene. Plant Cell 3 1991 907 921 Google Scholar PubMed OpenURL Placeholder Text WorldCat 30 Tabaei Aghdaei SR (1997) Studies of stress responses in Gramineae (Poaceae) using biotechnological methods. PhD thesis. University of Newcastle upon Tyne, UK 31 Tanino KK McKersie BD Injury within the crown of winter wheat seedlings after freezing and icing stress. Can J Bot 63 1985 432 436 Google Scholar Crossref Search ADS WorldCat 32 Thoma S Kaneko Y Somerville C A nonspecific lipid transfer protein from Arabidopsis is a cell wall protein. Plant J 3 1993 427 436 Google Scholar Crossref Search ADS PubMed WorldCat 33 White AJ Dunn MA Brown K Hughes MA Comparative analysis of genomic sequence and expression of a lipid transfer protein gene family in winter barley. J Exp Bot 45 1994 1885 1892 Google Scholar Crossref Search ADS WorldCat Author notes 1 The research was supported by the Biotechnological and Biological Sciences Research Council of the UK (grant no. 13/A000191). * Corresponding author; e-mail [email protected]; fax 44–191–222–8684. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Peters, Janny L.; Széll, Márta; Kendrick, Richard E.

doi: 10.1104/pp.117.3.797pmid: 9662522

Abstract Three light-regulated genes, chlorophyll a/b-binding protein (CAB), ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit, and chalcone synthase (CHS), are demonstrated to be up-regulated in the high-pigment-1 (hp-1) mutant of tomato (Lycopersicon esculentum Mill.) compared with wild type (WT). However, the pattern of up-regulation of the three genes depends on the light conditions, stage of development, and tissue studied. Compared with WT, the hp-1 mutant showed higher CAB gene expression in the dark after a single red-light pulse and in the pericarp of immature fruits. However, in vegetative tissues of light-grown seedlings and adult plants, CAB mRNA accumulation did not differ between WT and the hp-1mutant. The ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit mRNA accumulated to a higher level in thehp-1 mutant than WT under all light conditions and tissues studied, whereas CHS gene expression was up-regulated in de-etiolated vegetative hp-1-mutant tissues only. The CAB and CHS genes were shown to be phytochrome regulated and both phytochrome A and B1 play a role in CAB gene expression. These observations support the hypothesis that the HP-1 protein plays a general repressive role in phytochrome signal transduction. Light controls many aspects of plant morphogenesis and provides energy for photosynthesis. Different regions of the spectrum are perceived by different photoreceptor molecules: the B photoreceptors, the UV photoreceptors, and the R-/FR-sensitive phytochromes. Phytochromes were physiologically identified 50 years ago, and in the last two decades different phytochrome types have been purified and cloned from several plant species. Mutants deficient in specific phytochrome family members have been isolated from several species: e.g. Arabidopsis (for review, see Smith, 1995), tomato (Lycopersicon esculentum Mill.) (van Tuinen et al., 1995a,1995b), and pea (Weller et al., 1995). These mutants are excellent tools for studying the functions of the different members of the phytochrome family. Although there is information about photoperception by phytochromes, little is known about the signal transduction pathways linking these receptors with gene expression. Several approaches have been used to study phytochrome signal transduction pathways. First, using microinjection, Neuhaus et al. (1993) identified several molecules that participate in phytochrome-signal transduction. The existence of two separate pathways was proposed: the cGMP-mediated pathway that leads to the regulation of CHS genes, and the Ca2+-calmodulin mediated pathway that regulates the expression of CAB and RBCS genes. In both pathways the signal is transduced from phytochrome via a heterotrimeric G protein, and subsequently the existence of a reciprocal control mechanism between the pathways has been demonstrated (Bowler et al., 1994a, 1994b). A second approach to identify and characterize components and regulators of phytochrome-signal transduction pathways is the isolation and characterization of mutants with altered light responses. Constitutive-response mutants such as constitutive photomorphogenesis (cop), de-etiolated (det), and fusca (fus) in Arabidopsis (for review, see Wei and Deng, 1996), light-independent (lip) in pea (Frances et al., 1992), andhyp2 in tobacco (Traas et al., 1995) are excellent tools for these studies. These mutants fail to exhibit the characteristics of dark-grown seedlings and show reduced elongation and expanded leaves. Some also accumulate anthocyanin in the dark. The cloning of the corresponding genes from Arabidopsis allowed the biochemical characterization of the affected gene products and provided information about the possible role and function of these components in phytochrome-signal transduction (Wei and Deng, 1996). In addition, mutants in genes affecting phyA and B signaling have been reported (Whitelam et al., 1993; Ahmad and Cashmore, 1996; Wagner et al., 1997; Hoecker et al., 1998). A third approach to identify the components of phytochrome-signal transduction is to screen directly for mutants altered in the regulation of particular light-regulated genes. Li et al. (1994, 1995)isolated Arabidopsis mutants altered in the regulation ofCAB gene expression. These mutants were named doc(for dark overexpression of CAB) and cue1 (forCAB underexpressed). The doc mutation affects the expression of CAB genes and the cue1 mutation affects the expression of both CAB and RBCSgenes. The expression of CHS genes was neither modified indoc nor in cue1 mutant plants. In contrast, the increased CHS expression (icx1) mutant of Arabidopsis shows enhanced induction of CHS gene expression by light, but no alteration in the level of CAB transcript accumulation (Jackson et al., 1995). In this paper we examine a putative phytochrome signal transduction mutant of tomato, the hp-1 (high-pigment-1) mutant. This monogenic recessive hp-1 mutant was first identified in 1917 (Reynard, 1956) and exhibits higher anthocyanin content, shorter hypocotyl (Kerr, 1965; Mochizuki and Kamimura, 1985; Peters et al., 1989), and darker green foliage (Jarret et al., 1984) and fruits (Thompson, 1962) when compared with WT. The HP-1 gene has been recently mapped to chromosome 2 (Yen et al., 1997). Soressi (1975)identified a recessive hp-2 mutant, which is phenotypically similar but nonallelic to hp-1 and maps to chromosome 1 (van Tuinen et al., 1997). Attempts to isolate Arabidopsis counterparts of the tomato hp mutants have been reported (Ichikawa et al., 1996), but await detailed analysis. Although the nature of the hp mutations is still unclear, detailed physiological characterization of the hp-1 mutant provided a valuable insight into phytochrome signal transduction processes. The hp-1 mutant has high levels of anthocyanin and reduced height of light-grown seedlings (Peters et al., 1992a;Kerckhoffs et al., 1997a). Furthermore, the photoinduction of several enzymes in biochemical pathways: Phe ammonia lyase (Goud et al., 1991), nitrate reductase, nitrite reductase, and amylase (Goud and Sharma, 1994), are amplified in the hp-1 mutant compared with WT. All of these features have been shown previously to be phytochrome regulated, and therefore, it was concluded that the hp-1mutant shows exaggerated phytochrome responses (Kerckhoffs and Kendrick, 1997). The apparent phenocopying of the hp-1mutant's phenotype and immature fruit color as a result of phyA overexpression in tomato (Boylan and Quail, 1989) is consistent with this idea. However, in vivo spectrophotometric and immunochemical analysis failed to provide evidence that the hp-1 mutant is a photoreceptor mutant (Peters et al., 1992b; Kerckhoffs et al., 1997a). Therefore, it was proposed that the hp-1 mutation is associated with an amplification step in the phytochrome-transduction chain (Peters et al., 1992b; Kerckhoffs et al., 1997a; Kerckhoffs and Kendrick, 1997). This conclusion is supported by the recent observation using specific phytochrome family-member-deficient mutants, that it is phyA and phyB1 that play a dominant role in the seedling anthocyanin response (Kerckhoffs et al., 1997b). In the phytochrome-amplification model, phytochrome responses are envisaged to be under the constraint of the HP-1 gene product. Both B and the hp-1 mutation appear to be able to relieve this constraint (Peters et al., 1989, 1992b). The dark-green immature fruit color of the hp-1 mutant compared with WT is due to higher chlorophyll levels (Sanders et al., 1975; Kerckhoffs, 1996) and the mature hp-1-mutant fruits have a higher lycopene and carotene content and increased levels of ascorbic acid than those of WT (Thompson, 1962). Recently, the plastid copy number in the hypocotyls and the Suc and flavonoid contents of ripe fruits have been reported to be elevated in the hp-1mutant compared with WT (Yen et al., 1997). In this paper we characterize the effect of the hp-1mutation on CAB, RBCS, and CHS gene expression at different developmental stages using the most extreme allele available (hp-1w). MATERIALS AND METHODS Plant Material and Growth Conditions The tomato (Lycopersicon esculentum Mill.) genotypes used in the experiments were hp-1w (Peters et al., 1989);hp-1w,fri1(far-red light insensitive), deficient in phyA (Kerckhoffs et al., 1997b);hp-1w,tri1(temporarily red-lightinsensitive), deficient in phyB1 (Kerckhoffs et al., 1997b) in the genetic backgrounds MoneyMaker (MM) or breeding line GT. For the experiments with seedlings, seeds were surface sterilized for 3 min in a 1% (v/v) dilution of commercial bleach and rinsed for 5 min in Milli-Q water (Milli-RO 8 water purification system, Millipore). Seeds were sown at noon on 0.6% (w/v) agar medium containing 0.46 g L−1 Murashige-Skoog basal salts (Murashige-Skoog, 1962) in plastic tissue culture containers (Plantcon, Flow Laboratories Inc., McLean, VA) and germinated in a FR-6113A growth chamber (Koito, Tokyo, Japan) at 25°C. To germinate seedlings in absolute darkness, tissue culture containers were wrapped in aluminum foil, put in a black velvet sack, and grown in a dark room at 25°C. In the light-pulse experiments R (27 μmol m−2s−1) was obtained from FL20SRF fluorescent tubes (National, Osaka, Japan) filtered through a red, plastic filter (Shinkolite A no. 102, Mitsubishi Rayon Corp., Tokyo, Japan) and FR (33 μmol m−2s−1) from FL20S–FR74 fluorescent tubes (Toshiba) wrapped with one layer of Polycolor no. 22 and one layer of Polycolor no. 72 film (Tokyo Butai Shomei Co., Tokyo, Japan). B (11 μmol m−2 s−1) was obtained from FL20S.B fluorescent tubes (Toshiba). WL-grown seedlings were germinated in 16-h WL (120 μmol m−2s−1 PAR) 8-h dark cycles at 25°C. WL was obtained from FL20SD SDL fluorescent tubes (National). For the experiments with adult plants and fruits, seeds were sown in the greenhouse in a 4:1 vermiculite/granular-clay-based compost mixture. After 1 month plants were transplanted to pots (19 cm [diameter] × 15 cm [height] for vegetative tissues of adult plants and 27.1 cm × 28.6 cm for fruits) containing 2:1 vermiculite/granular-clay based compost mixture and transferred to a phytotron KG-206HL-D (Koito) with 16-h WL (250 μmol m−2 s−1 PAR) 8-h dark cycles at 25°C. Vegetative plant material was harvested 2 months after sowing and frozen in liquid nitrogen. The frozen material was stored in a −135°C freezer until use. After the first fruit(s) on a plant became red, all fruits of that particular plant were harvested. Harvest was always at noon because of diurnal mRNA fluctuations ofCAB genes in tomato fruits (Piechulla and Gruissem, 1987). Directly after harvest a picture was taken of the fruits from one plant. The age, diameter, length, and weight of each fruit were measured and samples were taken for the chlorophyll assay. The remaining material was separated into pericarp (the outer wall of the pericarp including the epidermis) and the inner section (radial and inner wall of the pericarp, placental tissue, and locular cavity with seeds), and frozen in liquid nitrogen. The frozen material was stored in a −135°C freezer until use. Chlorophyll Assay To determine the chlorophyll content in the fruits, samples were taken from the equator of the fruits using an 11-mm cork borer. From this sample the pericarp and about 5 mm of the inner section (for definition, see above) directly bordering the pericarp were cut. For each fruit the chlorophyll was extracted from one pericarp and one inner-section disc. The fruit discs were placed in 15-mL tubes (Falcon) and incubated in darkness for at least 48 h at 65°C in DMSO (after the work of Hiscox and Israelstam, 1979). Samples were re-extracted with DMSO until no extra chlorophyll could be extracted, and the samples were always kept in the dark. When the samples were cooled to room temperature, A649 andA665 were determined spectrophotometrically. Chlorophyll a and b were calculated on a gram fresh weight basis, using the equations for ethanol published by Lichtenthaler and Wellburn (1983). Anthocyanin Assay Anthocyanin was extracted from cotyledons and hypocotyls of seedlings with 0.6 mL of acidified (0.3% HCl, v/v) methanol for 48 h. The extraction was carried out by shaking the samples in darkness at room temperature for 48 h. At the end of the extraction 0.45 mL of water and 1.2 mL of chloroform were added. Samples were vortexed and centrifuged for 20 min at 4500g. The A535 of the upper anthocyanin-containing phase was determined spectrophotometrically (DU650, Beckman). RNA Gel-Blot Analysis Total RNA was isolated by a modification of the method of Loening (1969) and was previously described by Peters and Silverthorne (1995). RNA was electrophoresed in 1% (w/v) agarose gels containing Mops buffer (20 mm Mops, 1 mm EDTA, and 5 mm sodium acetate, pH 7.0) and 6.7% (v/v) formaldehyde. Gels were soaked in distilled water to remove the formaldehyde (three changes of 20 min each) and visualized by staining with ethidium bromide (1 μg/mL) prior to blotting onto Hybond N+membranes (Amersham). Protocol no. 4 of the VacuGene XL blotting system (Pharmacia LKB Biotechnology, Bromma, Sweden) was used for vacuum transfer of RNA. The blots were prehybridized overnight at 42°C in 50% (v/v) formamide, 5× Denhardt's reagent (1× Denhardt's reagent is 0.02% [w/v] Ficoll Type 400 Sigma, 0.02% [w/v] PVP, and 0.02% [w/v] bovine albumin Fraction V, Sigma), 0.1% (w/v) SDS, 5× SSC (1× SSC is 150 mm NaCl and 15 mm sodium citrate, pH 7.0), and 50 μg/mL salmon sperm DNA (0.5 mL per cm2blot). The coding region of the tomato CAB-1 (Pichersky et al., 1985) and RBCS-2 (Pichersky et al., 1986) andCHS1 (O'Neill et al., 1990) genes were used to synthesize DNA probes by random priming using the Rediprime DNA labeling system (Amersham). To remove unincorporated nucleotides 1 μL of 10% SDS and 2 μL of denatured salmon sperm (10 mg/mL) were added to the 50-μL reaction mix in an ultra-free microcentrifuge tube (Ultrafree-C3 TGC, Nihon Millipore Ltd., Tokyo, Japan) and spun at room temperature (5 min, 5000g). After washing the labeled DNA with 100 μL of sterile water, the probe was recovered from the upper part of the Millipore tube, denatured (by boiling for 5 min), and put on ice until use. For hybridization, the appropriate probe (specific activity 0.5 dpm/μg) was added to the hybridization buffer (0.1 mL of prehybridization buffer per cm2 blot). Hybridizations were carried out overnight at 42°C. As a loading control each blot was rehybridized with a 17-base oligonucleotide complementary to the 18S rRNA (Gallo-Meager et al., 1992). The oligonucleotide was labeled by phosphorylation with T4 polynucleotide kinase and the hybridization was carried out as described byGallo-Meager et al. (1992). Washes of nylon membranes (Hybond N+, Amersham) were performed in 2× SSC, 0.1% SDS (3 × 10 min at room temperature), and 0.1× SSC, 0.1% SDS (2 times for 30 min at 65°C). The signals were visualized and quantitated with a phosphor imager (Fujix BAS 2000, Fuji, Japan). RESULTS Effect of a Single R Pulse on CAB andRBCS Gene Expression In tomato seedlings the expression of CAB genes is controlled by phytochrome (Sharrock et al., 1988; Wehmeyer et al., 1990). Wehmeyer et al. (1990) showed that CAB mRNA accumulation reached a maximum 4 h after a R pulse. In contrast toCAB mRNA, they could not easily demonstrate phytochrome regulation of RBCS mRNA. To determine whether theCAB and RBCS gene expression in thehp-1w-mutant seedlings is controlled by phytochrome, we first studied the kinetics of expression of both genes after a single R pulse. To this end, 4-d-old etiolated seedlings were irradiated with a 10-min saturating R pulse and returned to the dark. Samples were collected immediately (0 h) and at 1, 2, 4, 6, and 8 h after the R pulse. Control seedlings were maintained in continuous darkness and harvested simultaneously with the seedlings harvested immediately after the R pulse. Very low levels of CAB gene expression were detectable in dark-grown WT seedlings (Fig.1). In contrast to WT, thehp-1w-mutant seedlings exhibited a substantial level of CAB gene expression in the dark. A R pulse induced CAB mRNA accumulation in both WT andhp-1w-mutant seedlings and maximum expression occurred 4 h after the light-pulse treatment. However, at this time point the hp-1w mutant accumulated more transcript than WT. The RBCS mRNA accumulation in dark-grown hp-1w-mutant seedlings was about 3-fold higher than the levels observed in WT. Although a R pulse slightly induced RBCS gene expression in WT seedlings, no induction was observed inhp-1w-mutant seedlings. Fig. 1. Open in new tabDownload slide Effect of a 10-min R pulse on theCAB and RBCS mRNA abundance in etiolated 4-d-old WT and hp-1w-mutant tomato seedlings. A, For the RNA blots shown, RNA was extracted directly (0 h), 1, 2, 4, 6, and 8 h after onset of the R pulse. The control (lanes C) represents the CAB mRNA amount in seedlings that did not receive a R pulse but were kept in continuous darkness. As a loading control the blots were probed with an 18S rRNA probe. B, TheCAB and RBCS mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown for CAB andRBCS, respectively. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Fig. 1. Open in new tabDownload slide Effect of a 10-min R pulse on theCAB and RBCS mRNA abundance in etiolated 4-d-old WT and hp-1w-mutant tomato seedlings. A, For the RNA blots shown, RNA was extracted directly (0 h), 1, 2, 4, 6, and 8 h after onset of the R pulse. The control (lanes C) represents the CAB mRNA amount in seedlings that did not receive a R pulse but were kept in continuous darkness. As a loading control the blots were probed with an 18S rRNA probe. B, TheCAB and RBCS mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown for CAB andRBCS, respectively. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Phytochrome Regulation of CAB Gene Expression in Photomorphogenic Mutants Figure 1 showed that in hp-1w-mutant seedlings CAB but not RBCS gene expression could be induced by a single R pulse. Therefore, we limited our experiment to study the involvement of phytochrome in light-regulated gene expression to CAB gene expression. Since various photomorphogenic mutants of tomato are available, we used phyA-deficient,hp-1w,fri1,and phyB1-deficient,hp-1w,tri1,double mutants in addition to the hp-1wmutant and WT. All genotypes were grown in continuous darkness for 4 d and exposed to a 10-min R pulse, 15-min FR pulse, or 10-min R pulse followed by a 15-min FR pulse. Control seedlings were kept in continuous darkness during the experiment. Whole seedlings were harvested 4 h after the light pulse(s) when maximum response occurs (Fig. 1). In WT, CAB mRNA accumulation was induced by a 10-min R pulse and could be partially reversed by a FR pulse (Fig.2). This incomplete reversal can be explained by a partial escape from FR reversibility during the R pretreatment. The response after FR alone probably reflects the VLFR component of CAB mRNA accumulation (Sharrock et al., 1988). Recently, a similar VLFR component of CAB gene expression was shown for Arabidopsis (Hamazato et al., 1997). In agreement with the data in Figure 1, a substantial level of CAB gene expression was detected in dark-grownhp-1w-mutant seedlings (Fig. 2). Due to thehp-1w mutation, thehp-1w,fri1 andhp-1w,tri1 double mutants also showed CAB gene expression in the dark, although at a reduced level compared with thehp-1w monogenic mutant. To account for the possible effect of harvest under green safe light on CABgene expression, the seedlings were also harvested in total darkness (in Fig. 2, DD) and compared with samples harvested under green safe light (Fig. 2, D). Figure 2 shows that when seedlings were harvested in complete darkness, the hp-1w mutation resulted in significant CAB mRNA accumulation. Moreover, thehp-1w mutant exhibited a higher response to all light-pulse treatments. The phyA-deficienthp-1w,fri1double mutant exhibited approximately 30% of the CAB gene expression induced by a single R pulse in thehp-1w mutant. A similar reduction inCAB mRNA accumulation could be seen when thefri1 mutant was compared with WT (data not shown). This implies a role for phyA in the low fluence response, either directly or indirectly. The effect of FR and R/FR treatments are markedly reduced in thehp-1w,fri1mutant compared with the hp-1w mutant, which verifies the role of phyA in the VLFR proposed previously (Casal et al., 1994; Botto et al., 1996; Shinomura et al., 1996). In the phyB1-deficienthp-1w,tri1double mutant, the CAB gene expression induced by a R pulse was also reduced (about 50%) compared with thehp-1w mutant. This clearly indicates that phyB1 also plays a role in the regulation of CAB gene expression. Fig. 2. Open in new tabDownload slide Effect of no light pulse (lanes D), a 10-min R, 15-min FR, and 10-min R followed by 15-min FR pulse (R/FR) on theCAB mRNA abundance in etiolated 4-d-old tomato seedlings. The genotypes used were WT, hp-1wmutant,hp-1w,fri1, andhp-1w,tri1 double mutants. A, For the RNA gel blots shown, RNA was isolated 4 h after the light pulse(s) and probed with a CAB cDNA probe. As a loading control the blots were probed with an 18S rRNA probe. B, The CAB mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Fig. 2. Open in new tabDownload slide Effect of no light pulse (lanes D), a 10-min R, 15-min FR, and 10-min R followed by 15-min FR pulse (R/FR) on theCAB mRNA abundance in etiolated 4-d-old tomato seedlings. The genotypes used were WT, hp-1wmutant,hp-1w,fri1, andhp-1w,tri1 double mutants. A, For the RNA gel blots shown, RNA was isolated 4 h after the light pulse(s) and probed with a CAB cDNA probe. As a loading control the blots were probed with an 18S rRNA probe. B, The CAB mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Phytochrome Regulation of CHS Gene Expression Although a single R pulse could induce CAB gene expression (Figs. 1 and 2), the same light treatment was ineffective for the induction of CHS gene expression (data not shown). Therefore, an irradiation schedule used by Peters et al. (1992b), which is efficient in inducing phytochrome regulation of anthocyanin biosynthesis, was applied to determine if phytochrome regulatesCHS gene expression. The WT andhp-1w-mutant seedlings were grown in darkness for 4 d and exposed to a 12-h R or B pretreatment followed by no pulse, a 10-min R pulse, 15-min FR pulse, or a 10-min R pulse followed by a 15-min FR pulse. Control seedlings were kept in darkness during the experiment. Figure 3shows that neither WT nor hp-1w-mutant seedlings accumulated detectable levels of CHS mRNA when grown in complete darkness. In seedlings that were given R and B pretreatments, a R pulse induced high levels of CHSexpression in the WT. This effect could be reversed by FR. In thehp-1w mutant R and B pretreatments followed by a R pulse resulted in a significant amplification of CHSgene expression compared with WT, and a FR pulse could not reverse the level of expression to the same extent as in the WT. In summary, the total level of response is enhanced in thehp-1w mutant compared with WT for all treatments. Thus, by using light pretreatments, CHS gene expression was shown to be regulated by phytochrome in tomato. Moreover, the phytochrome-induced, R/FR reversible, CHS mRNA accumulation response is significantly enhanced in thehp-1w mutant compared with WT after R pretreatment, but not significantly affected after B pretreatment. This indicates that B alone can enhance the phytochrome response in WT to an amount similar to that in the hp-1w mutant. Fig. 3. Open in new tabDownload slide Effect of a 12-h R or B pretreatment terminated with no light pulse (lanes D), a 10-min R, 15-min FR, and 10-min R followed by 15-min FR pulse (R/FR) on the CHS mRNA abundance in etiolated 4-d-old WT andhp-1w-mutant seedlings of tomato. A, For the RNA gel blots shown, RNA was isolated 4 h after the light pulse(s) and probed with a CHS1 cDNA probe. As a loading control the blots were probed with an 18S rRNA probe. B, The CHSmRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Fig. 3. Open in new tabDownload slide Effect of a 12-h R or B pretreatment terminated with no light pulse (lanes D), a 10-min R, 15-min FR, and 10-min R followed by 15-min FR pulse (R/FR) on the CHS mRNA abundance in etiolated 4-d-old WT andhp-1w-mutant seedlings of tomato. A, For the RNA gel blots shown, RNA was isolated 4 h after the light pulse(s) and probed with a CHS1 cDNA probe. As a loading control the blots were probed with an 18S rRNA probe. B, The CHSmRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Circadian Rhythm of CAB Gene Expression Accumulation of CAB mRNA shows a circadian rhythm in tomato with a maximum level of expression at noon (Kellman et al., 1993). A difference in the circadian rhythm of CAB mRNA accumulation of WT and hp-1w-mutant plants could result in misleading conclusions when studying tomato plants grown in light/dark cycles. Therefore, we studied the effect of thehp-1w mutation on the circadian rhythm. Seedlings were grown in 16-h WL, 8-h dark cycles (lights on at 6am; light off at 10 pm) and transferred to continuous darkness at 8 am of d 5 (Fig.4, WL/D → D/D). Control seedlings were kept in WL/D cycles and showed diurnal oscillations (Fig. 4, WL/D). Whole seedlings were harvested every 4 h for 3 d, starting at 8 am on the 4th d after sowing. No differences in the diurnal oscillations of CAB gene expression of WT andhp-1w-mutant seedlings were observed (Fig.4, WL/D). The brief, 2-h exposure to WL before the transfer to continuous darkness resulted in a phase shift, and the subsequent peak of CAB gene expression occurred at 8 am instead of at noon in both WT and hp-1w mutant (Fig. 4, WL/D → D/D). Although a slight difference in dampening of the CAB gene expression between WT andhp-1w-mutant seedlings may exist, the pattern and quantitative level of CAB mRNA accumulation in the two genotypes is very similar. Fig. 4. Open in new tabDownload slide Circadian rhythmic CAB mRNA accumulation in WT and hp-1w-mutant seedlings of tomato. A, For the RNA gel blots shown, seedlings were grown in 16-h WL (WL, 6 am–10 pm), 8-h dark (lanes D, 10 pm–6 am) cycles. To describe the diurnal CAB transcript oscillations (WL/D), samples were collected every 4 h starting with 4-d-old seedlings at 8am. To study the circadian rhythm of CABgenes (WL/D → D/D), seedlings were transferred to darkness on d 5 at 8 am. As a loading control the blots were probed with an 18S rRNA probe. B, The CAB mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the mRNA abundance detected on d 4 at noon. {/ANNT;;;left;top} Fig. 4. Open in new tabDownload slide Circadian rhythmic CAB mRNA accumulation in WT and hp-1w-mutant seedlings of tomato. A, For the RNA gel blots shown, seedlings were grown in 16-h WL (WL, 6 am–10 pm), 8-h dark (lanes D, 10 pm–6 am) cycles. To describe the diurnal CAB transcript oscillations (WL/D), samples were collected every 4 h starting with 4-d-old seedlings at 8am. To study the circadian rhythm of CABgenes (WL/D → D/D), seedlings were transferred to darkness on d 5 at 8 am. As a loading control the blots were probed with an 18S rRNA probe. B, The CAB mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the mRNA abundance detected on d 4 at noon. {/ANNT;;;left;top} Organ-Specific Expression of CAB, RBCS, andCHS Genes At least one of the light-regulated genes studied, theRBCS gene family, exhibits organ-specific expression in tomato (Sugita and Gruissem, 1987; Wanner and Gruissem, 1991). Since the hp-1w-mutant seedlings showed elevated responses for the genes studied, it is important to compare the organ-specific expression patterns of these genes in seedlings and adult plants of the WT and hp-1w mutant. Such a comparison can answer the question of whether more mRNA accumulates in the same organs or whether the distribution patterns also change due to the hp-1w mutation. Seedlings were grown in either continuous darkness or in 16-h WL, 8-h dark cycles for 4 d. The CAB, RBCS, andCHS mRNA accumulation in cotyledons and hypocotyls is shown in Figure 5. None of the genes were expressed in the roots (data not shown). The patterns of mRNA accumulation in hp-1w-mutant seedlings differ from that of WT in several aspects. CAB mRNA in dark-grown hypocotyls and cotyledons and RBCS mRNA in dark-grown hypocotyls accumulated to a much higher level in thehp-1w mutant than WT (Fig. 5). Moreover, a higher CHS mRNA accumulation was observed in WL/D-grownhp-1w-mutant seedlings compared with WT. The CHS mRNA accumulation was significantly increased in cotyledons of the hp-1w mutant compared with WT (Fig. 5), which correlates well with the anthocyanin accumulation data for the WT and hp-1wmutant (A535 per three cotyledon pairs was 0.065 ± 0.004 and 0.449 ± 0.015 for WT andhp-1w mutant, respectively;A535 per three hypocotyls was 0.323 ± 0.022 and 0.600 ± 0.038 for WT andhp-1w mutant, respectively). TheRBCS gene expression was always higher in thehp-1w mutant, irrespective of the light conditions under which the plants were grown (Fig. 5). As in the R and B pretreatment experiment (Fig. 3), no CHS mRNA accumulation was observed in the dark. Accumulation of CHS mRNA reached a higher level in WL/D-grown hp-1w-mutant seedlings than in WT. In contrast to RBCS andCHS, CAB gene expression was only higher in seedlings grown in darkness. Fig. 5. Open in new tabDownload slide CAB, RBCS, andCHS mRNA abundance in cotyledons (lanes Cot) and hypocotyls (lanes Hyp) of 4-d-old WT andhp-1w-mutant seedlings of tomato. A, For the RNA gel blots shown, RNA was isolated from seedlings grown in dark (D) or 16-h WL, 8-h dark cycles (WL/D). As a loading control the blots were probed with a 18S rRNA probe. B, The CAB,RBCS, and CHS mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Fig. 5. Open in new tabDownload slide CAB, RBCS, andCHS mRNA abundance in cotyledons (lanes Cot) and hypocotyls (lanes Hyp) of 4-d-old WT andhp-1w-mutant seedlings of tomato. A, For the RNA gel blots shown, RNA was isolated from seedlings grown in dark (D) or 16-h WL, 8-h dark cycles (WL/D). As a loading control the blots were probed with a 18S rRNA probe. B, The CAB,RBCS, and CHS mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. To investigate the CAB, RBCS, and CHSmRNA levels in the leaves, stems, and roots of adult plants, plants were grown under 16-h WL, 8-h dark cycles for 8 weeks. None of the genes were expressed in the roots of adult WT andhp-1w-mutant plants (Fig.6). As in 4-d-old, WL/D-grown seedlings (Fig. 5), the CAB mRNA accumulation in adult plant parts was not higher in the hp-1w mutant than WT. However, both RBCS and CHS gene expression were significantly higher in stems of the hp-1wmutant compared with WT. These data on the organ-specific expression of light-regulated genes in seedling and adult plants show that the three genes studied are differentially affected by thehp-1w mutation. Fig. 6. Open in new tabDownload slide Abundance of CAB,RBCS, and CHS mRNA in young leaves (lanes Le), stems (lanes St), and roots (lanes Ro) of 8-month-old WT andhp-1w-mutant tomato plants. A, For the RNA gel blots shown, RNA was isolated from adult plants grown in 16-h WL, 8-h dark cycles. As a loading control the blots were probed with a 18S rRNA probe. B, The CAB, RBCS, andCHS mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. Fig. 6. Open in new tabDownload slide Abundance of CAB,RBCS, and CHS mRNA in young leaves (lanes Le), stems (lanes St), and roots (lanes Ro) of 8-month-old WT andhp-1w-mutant tomato plants. A, For the RNA gel blots shown, RNA was isolated from adult plants grown in 16-h WL, 8-h dark cycles. As a loading control the blots were probed with a 18S rRNA probe. B, The CAB, RBCS, andCHS mRNA abundance was quantified using a phosphor imager and the mean values (±se) are shown. A value of 100% on the ordinate represents the maximum steady-state mRNA detected within the experiment. To investigate CAB and RBCS gene expression and chlorophyll content during fruit development, we analyzed fruits at seven different physiological ages. The levels of CAB andRBCS expression in the pericarp were found to be highest in young fruits and they both gradually declined during fruit development (Fig. 7A). The expression level of bothCAB and RBCS was amplified in thehp-1w-mutant fruits compared with those of WT. The increased level of CAB and RBCSexpression in the pericarp correlates well with its approximate 5-fold higher chlorophyll content (25-d-old fruits contain 100 and 25 μg chlorophyll g−1 fresh weight in thehp-1w mutant and WT, respectively; Fig.7B). Fig. 7. Open in new tabDownload slide A, The CAB and RBCSmRNA accumulation in the pericarp of thehp-1w-mutant and WT tomato fruit during fruit ripening. For both CAB and RBCSmRNA accumulation, the amount of mRNA in the pericarp of the youngesthp-1w-mutant fruit was set at 100%. As a loading control the blots were probed with a 18S rRNA probe. B, A truss of WT (left) and hp-1w-mutant (right) immature tomato fruits. The fruits of thehp-1w mutant are darker green and have an elongated shape when compared with WT. Fig. 7. Open in new tabDownload slide A, The CAB and RBCSmRNA accumulation in the pericarp of thehp-1w-mutant and WT tomato fruit during fruit ripening. For both CAB and RBCSmRNA accumulation, the amount of mRNA in the pericarp of the youngesthp-1w-mutant fruit was set at 100%. As a loading control the blots were probed with a 18S rRNA probe. B, A truss of WT (left) and hp-1w-mutant (right) immature tomato fruits. The fruits of thehp-1w mutant are darker green and have an elongated shape when compared with WT. DISCUSSION The results presented indicate that CAB,RBCS, and CHS gene expression is up-regulated in the hp-1w mutant compared with WT. Two of these genes, CAB and CHS, were shown to be phytochrome regulated in the hp-1w mutant (Figs. 2 and 3). However, their pattern of up-regulation is different and dependent on the stage of development and tissue studied. For instance, if we had only investigated gene expression in WL-grown seedlings, we would have only seen up-regulation of RBCS andCHS, but not CAB, compared with WT in thehp-1w mutant (Figs. 4-6). In other words, in WL-grown seedlings, CAB gene expression appears to be saturated and is comparable in WL-grown WT andhp-1w-mutant seedlings (Figs. 4-6). In contrast, dark-grown hp-1w-mutant seedlings accumulate higher levels of CAB (and RBCS) transcripts than WT. In dark-grown seedlings of hp-1,up-regulation of enzyme activity for Phe ammonia lyase (Goud et al., 1991), nitrate reductase, nitrite reductase, and amylase (Goud and Sharma, 1994) have been previously reported. All of these enzymes have been shown to be phytochrome regulated (Goud et al., 1991; Goud and Sharma, 1994). Taken together, these findings indicate that thehp-1 mutation causes changes in the dark at the molecular level. Unlike the dark “de-etiolated” Arabidopsis mutants such ascop, det, and fus, there are no visible differences between dark-grown WT andhp-1-mutant seedlings. Therefore, the hp-1mutation appears to affect only a subset of responses regulated bycop, det, and fus genes. TheCAB mRNA measured in dark-grownhp-1w-mutant seedlings could be due to an amplification of the response to the residual Pfr available in the seeds, and probably reflects a phyA-mediated VLFR, which is very difficult to test experimentally. The results with the phyA-deficienthp-1w,fri1 double mutant suggest that this is the case. R induction of CAB was similar in thehp-1w-mutant and WT seedlings (Fig. 1) and confirms the observation of Wehmeyer et al. (1990). However, the difference between hp-1w and WT observed in darkness was retained. The RBCS gene expression level was always higher in hp-1w seedlings than those of WT, regardless of the conditions under which they were grown. In fact, the high RBCS gene expression in the dark could not be further enhanced by a single pulse of R, whereas in the WT a gradual elevation of expression was observed (Fig. 1), which never attained the level in hp-1w. We can therefore conclude that the hp-1w mutation affects bothCAB and RBCS expression (Figs. 1, 2, 5, and 6). Studies involving doc and cue1 mutants suggested that different biochemical pathways downstream of phytochrome regulateCAB and RBCS gene expression (Li et al., 1994,1995). Therefore, the differential effect of the hp-1mutation on the expression of CAB and RBCS genes may be related to the differences in the role of HP-1 in these pathways. The hp-1-mutant has high anthocyanin levels in both seedlings and adult plants (Kerckhoffs et al., 1997a) and increased flavonoid accumulation in ripe fruits (Yen et al., 1997). TheCHS transcript accumulation of the enzyme that is the first committed step of flavonoid biosynthesis also shows a higher level in the hp-1 mutant than WT (Figs. 3, 5, and 6). Since noCHS gene expression could be observed in dark-grown or single pulse-treated seedlings, a 12-h R or B pretreatment irradiation schedule known to be effective in anthocyanin production (Peters et al., 1989) was used to study CHS gene expression (Fig. 3). Irrespective of whether a R or B pretreatment was given, significantly higher levels of CHS transcripts accumulated in thehp-1w-mutant seedlings compared with WT (Fig. 3). These CHS mRNA accumulation data correlate reasonably well with the anthocyanin accumulation data under the same irradiation conditions (Peters et al., 1989). When WL-grown seedlings were examined, we also found a strong correlation betweenCHS abundance and anthocyanin content (results given in text and Fig. 5). The expression of CAB and RBCS genes decreased with increasing fruit age in both WT andhp-1w-mutant fruits (Fig. 7). In the pericarp these data show a positive correlation with the chlorophyll data (data not shown). The pericarp of green fruits is known to be photosynthetically active, and this activity decreases during chloroplast/chromoplast differentiation (Piechulla and Gruissem, 1987). Earlier work of Piechulla et al. (1985) showed that mRNA for photosynthetic polypeptides disappear during fruit ripening. These changes of mRNA levels correlated with alterations that occur at the photosynthesis and polypeptide level (Piechulla and Gruissem, 1987). Work of Meehan et al. (1996) using Arabidopsis transgenics that expressed a CAB promotor fused to a GUS reporter gene shows that GUS activities were positively correlated with chlorophyll content and cell size. Therefore, the transcription of nuclear genes for chloroplast components could be modulated by chloroplast numbers, which increase with cell size. Our results support the proposal that the hp-1 mutation amplifies phytochrome responses (for review, see Kerckhoffs and Kendrick, 1997): the R induction of both CAB andCHS gene expression was higher in the hp-1 mutant compared with WT and was shown to be mediated by phytochrome (Figs. 2and 3). Since the R induction of CAB gene expression is considerably lower in the phyA-deficient,hp-1w,fri1 mutant than the hp-1w mutant (Fig. 2), phyA appears to modulate the magnitude of the low fluence response. Phytochrome-mediated CAB gene expression in tomato has a VLFR component (Sharrock et al., 1988) and this response, as indicated by the level induced by FR alone, is much reduced in thehp-1w,fri1 mutant compared with the hp-1w mutant (Fig. 2). These data support the conclusion that phyA mediates the VLFR (Casal et al., 1994; Botto et al., 1996; Shinomura et al., 1996). In addition, phyB1 plays a role in CAB gene expression. The induction ofCAB transcript accumulation is reduced in the phyB1-deficient,hp-1w,tri1 mutant compared with the hp-1w mutant (Fig. 2). Thus, both phyA and phyB1 play a role in CAB gene expression in tomato. Reed et al. (1994) and Hamazato et al. (1997) came to a similar conclusion when they studied phyA andphyB mutants in Arabidopsis. The data presented support the hypothesis that the HP-1 protein has a repressive role in phytochrome-signal transduction. The pattern of up-regulation observed for CAB, RBCS, andCHS gene expression depends on the light conditions, stage of development, and tissue studied. To date, hp-like mutations have not been described in other plant species. The dark phenotype of the hp-1 mutant is more subtle compared with de-etiolated mutants such as cop, det, andfus. Considering the higher levels of anthocyanin responses and CHS mRNA accumulation, the tomato hp-1 mutant is somewhat similar to the icx1 mutant of Arabidopsis (Jackson et al., 1995). The major difference between the two mutations is that, whereas the icx1 mutation affects only the signal transduction processes leading to the regulation of CHSexpression, the tomato hp-1 mutation also affects the expression of genes (CAB and RBCS) encoding proteins for the photosynthetic apparatus. This suggests that thehp-1 mutation acts on an upstream signal transduction event(s) that leads to the altered pattern of gene expression. Therefore, HP-1 is proposed to be a fundamental phytochrome signal transduction regulator, and the cloning of its gene and molecular characterization is eagerly awaited. ACKNOWLEDGMENTS We thank Ferenc Nagy for the CAB-1 cDNA clone, William Gruissem for the RBCS-2 cDNA clone, John Yoder for the CHS1 clone, and Shannon Frances for reading the manuscript and making suggestions. The WT and hp-1w-mutant seeds were supplied by Maarten Koornneef and colleagues of the Department of Genetics, Wageningen Agricultural University, The Netherlands. Abbreviations: B blue light CAB chlorophylla/b-binding protein CHS chalcone synthase FR far-red light R red light RBCS ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit VLFR very low fluence response WL white light WT wild type LITERATURE CITED 1 Ahmad M Cashmore AR The pef mutants of Arabidopsis thaliana define lesions early in the phytochrome signaling pathway. Plant J 10 1996 1103 1110 Google Scholar Crossref Search ADS PubMed WorldCat 2 Botto JF Sánchez RA Whitelam GC Casal JJ Phytochrome A mediates the promotion of seed germination by very low fluences of light and canopy shade light in Arabidopsis. Plant Physiol 110 1996 439 444 Google Scholar Crossref Search ADS PubMed WorldCat 3 Bowler C Neuhaus G Yamagata H Chua N-H Cyclic GMP and calcium mediate phytochrome phototransduction. Cell 77 1994a 73 81 Google Scholar Crossref Search ADS WorldCat 4 Bowler C Yamagata H Neuhaus G Chua N-H Phytochrome signal transduction pathways are regulated by reciprocal control mechanisms. Genes Dev 8 1994b 2188 2202 Google Scholar Crossref Search ADS WorldCat 5 Boylan MT Quail PH Oat phytochrome is biologically active in transgenic tomatoes. Plant Cell 1 1989 765 773 Google Scholar Crossref Search ADS PubMed WorldCat 6 Casal JJ Sánchez RA Vierstra RD Avena phytochrome A overexpressed in transgenic tobacco seedlings differentially affects red/far-red reversible and very-low-fluence responses (cotyledon unfolding) during de-etiolation. Planta 192 1994 306 309 Google Scholar Crossref Search ADS WorldCat 7 Frances S White MJ Edgerton MD Jones AM Elliot RC Thompson WF Initial characterization of a pea mutant with light-independent photomorphogenesis. Plant Cell 4 1992 1519 1530 Google Scholar PubMed OpenURL Placeholder Text WorldCat 8 Gallo-Meager M Sowinski DA Elliot RC Thompson WF Both internal and external regulatory elements control expression of the pea Fed-1 gene in transgenic tobacco seedlings. Plant Cell 4 1992 389 395 Google Scholar PubMed OpenURL Placeholder Text WorldCat 9 Goud KV Sharma R Retention of photoinduction of cytosolic enzymes in aurea mutants of tomato (Lycopersicon esculentum). Plant Physiol 105 1994 643 650 Google Scholar Crossref Search ADS PubMed WorldCat 10 Goud KV Sharma R Kendrick RE Furuya M Photoregulation of phenylalanine ammonia lyase is not correlated with anthocyanin induction in photomorphogenetic mutants of tomato (Lycopersicon esculentum). Plant Cell Physiol 32 1991 1251 1258 Google Scholar OpenURL Placeholder Text WorldCat 11 Hamazato F Shinomura T Hanzawa H Chory J Furuya M Fluence and wavelength requirements for Arabidopsis CAB gene induction by different phytochromes. Plant Physiol 115 1997 1533 1540 Google Scholar Crossref Search ADS PubMed WorldCat 12 Hiscox JP Israelstam GF A method for extraction of chlorophyll from leaf tissue without maceration. Can J Bot 57 1979 1332 1334 Google Scholar Crossref Search ADS WorldCat 13 Hoecker U Xu Y Quail PH SPA1: a new genetic locus involved in phytochrome A-specific signal transduction. Plant Cell 10 1998 19 33 Google Scholar PubMed OpenURL Placeholder Text WorldCat 14 Ichikawa H, Tanaka A, Tano S, Nagatani A (1996) Isolation and characterization of photomorphogenic mutants of Arabidopsiswhich promote transduction of light-signal. In Programme and Abstract of Seventh International Conference on ArabidopsisResearch, June 23–27, 1996. University of East Anglia, Norwich, UK, p 190 15 Jackson JA Fuglevand GF Brown BA Shaw MJ Jenkins GI Isolation of Arabidopsis mutants altered in light-regulation of chalcone synthase gene expression using a transgenic screening approach. Plant J 8 1995 369 380 Google Scholar Crossref Search ADS PubMed WorldCat 16 Jarret RL Sayama H Tigchelaar EC Pleiotropic effects associated with the chlorophyll intensifier mutations high pigment and dark green in tomato. J Am Soc Hortic Sci 109 1984 873 878 Google Scholar OpenURL Placeholder Text WorldCat 17 Kellman J-W Merforth N Wiese M Pichersky E Piechulla B Concerted circadian oscillations in transcript levels of nineteen Lha/b (cab) genes in Lycopersicon esculentum (tomato). Mol Gen Genet 237 1993 439 448 Google Scholar Crossref Search ADS PubMed WorldCat 18 Kerckhoffs LHJ (1996) Physiological functions of phytochromes in tomato: a study using photomorphogenic mutants. PhD thesis. Wageningen Agricultural University, Wageningen, The Netherlands 19 Kerckhoffs LHJ de Groot NAMA van Tuinen A Schreuder MEL Nagatani A Koornneef M Kendrick RE Physiological characterization of exaggerated-photoresponse mutants of tomato. J Plant Physiol 150 1997a 578 587 Google Scholar Crossref Search ADS WorldCat 20 Kerckhoffs LHJ Kendrick RE Photocontrol of anthocyanin biosynthesis in tomato. J Plant Res 110 1997 141 149 Google Scholar PubMed OpenURL Placeholder Text WorldCat 21 Kerckhoffs LHJ Schreuder MEL van Tuinen A Koornneef M Kendrick RE Phytochrome control of anthocyanin biosynthesis in tomato seedlings: analysis using photomorphogenic mutants. Photochem Photobiol 65 1997b 374 381 Google Scholar Crossref Search ADS WorldCat 22 Kerr EA Identification of high-pigment, hp, tomatoes in the seedling stage. Can J Plant Sci 45 1965 104 105 Google Scholar Crossref Search ADS WorldCat 23 Li H-M Altschmied L Chory J Arabidopsis mutants define downstream branches in the phototransduction pathway. Genes Dev 8 1994 339 349 Google Scholar Crossref Search ADS PubMed WorldCat 24 Li H-M Culligan K Dixon RA Chory J CUE1: a mesophyll cell-specific positive regulator of light-controlled gene expression in Arabidopsis. Plant Cell 7 1995 1599 1610 Google Scholar Crossref Search ADS PubMed WorldCat 25 Lichtenthaler HK Wellburn AR Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem Soc Trans 11 1983 591 592 Google Scholar Crossref Search ADS WorldCat 26 Loening UE The determination of the molecular weight of ribonucleic acid by polyacrylamide gel electrphoresis. Biochem J 113 1969 131 138 Google Scholar Crossref Search ADS PubMed WorldCat 27 Meehan L Harkins K Chory J Rodermel S Lchb transcription is coordinated with cell size and chlorophyll accumulation. Plant Physiol 112 1996 953 963 Google Scholar Crossref Search ADS PubMed WorldCat 28 Mochizuki T Kamimura S Photoselective method for selection of hp at the cotyledon stage. Tomato Genet Coop Rpt 35 1985 12 13 Google Scholar OpenURL Placeholder Text WorldCat 29 Murashige T Skoog F A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15 1962 473 497 Google Scholar Crossref Search ADS WorldCat 30 Neuhaus G Bowler C Kern R Chua N-H Calcium/calmodulin-dependent and -independent phytochrome signal transduction pathways. Cell 73 1993 937 952 Google Scholar Crossref Search ADS PubMed WorldCat 31 O'Neil SD Tong Y Spörlein B Forkmann G Yoder JI Molecular genetic analysis of chalcone synthase in Lycopersicon esculemtum and an anthocyanin-deficient mutant. Mol Gen Genet 224 1990 279 288 Google Scholar Crossref Search ADS PubMed WorldCat 32 Peters JL Schreuder MEL Heeringa G Wesselius JC Kendrick RE Koornneef M Analysis of the response of photomorphogenetic tomato mutants to end-of-day far-red light. Acta Hortic 305 1992a 67 77 Google Scholar OpenURL Placeholder Text WorldCat 33 Peters JL Schreuder MEL Verduin SJW Kendrick RE Physiological characterization of a high-pigment of tomato. Photochem Photobiol 56 1992b 75 82 Google Scholar Crossref Search ADS WorldCat 34 Peters JL Silverthorne J Organ-specific stability of two Lemna rbcS mRNAs is determined primarily in the nuclear compartment. Plant Cell 7 1995 131 140 Google Scholar Crossref Search ADS PubMed WorldCat 35 Peters JL Van Tuinen A Adamse P Kendrick RE Koornneef M High pigment mutants of tomato exhibit high sensitivity of phytochrome action. J Plant Physiol 134 1989 661 666 Google Scholar Crossref Search ADS WorldCat 36 Pichersky E Bernatzky R Tanksley SD Breidenbach RB Kausch AP Cashmore AR Molecular characterization and genetic mapping of two clusters of genes encoding chlorophyll a/b-binding proteins in Lycopersicon esculentum (tomato). Gene 40 1985 247 258 Google Scholar Crossref Search ADS PubMed WorldCat 37 Pichersky E Bernatzky R Tanksley SD Cashmore AR Evidence for selection as a mechanism in the concerted evolution of Lycopersicon esculentum (tomato) genes encoding the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Proc Natl Acad Sci USA 83 1986 3880 3884 Google Scholar Crossref Search ADS PubMed WorldCat 38 Piechulla B Chonoles-Imlay KR Gruissem W Plastid gene expression during fruit ripening in tomato. Plant Mol Biol 5 1985 373 385 Google Scholar Crossref Search ADS PubMed WorldCat 39 Piechulla B Gruissem W Diurnal mRNA fluctuations of nuclear and plastid genes in developing tomato fruits. EMBO J 6 1987 3593 3599 Google Scholar Crossref Search ADS PubMed WorldCat 40 Reed JW Nagatani A Elich TD Fagan M Chory J Phytochrome A and phytochrome B have overlapping but distinct functions in Arabidopsis development. Plant Physiol 104 1994 1139 1149 Google Scholar Crossref Search ADS PubMed WorldCat 41 Reynard GB Origin of the Webb Special (Black Queen) tomato. Tomato Genet Coop Rpt 6 1956 22 Google Scholar OpenURL Placeholder Text WorldCat 42 Sanders DC Pharr DM Konsler TR Chlorophyll content of a dark green mutant of ‘Manapal’ tomato. HortScience 10 1975 262 264 Google Scholar OpenURL Placeholder Text WorldCat 43 Sharrock RA Parks BA Koornneef M Quail PH Molecular analysis of the phytochrome deficiency in an aurea mutant of tomato. Mol Gen Genet 213 1988 9 14 Google Scholar Crossref Search ADS WorldCat 44 Shinomura T Nagatani A Hanzawa H Kubota M Watanabe M Furaya M Action spectra for phytochrome A- and B-specific photoinduction of seed germination in Arabidopsis thaliana. Proc Natl Acad Sci USA 93 1996 8129 8133 Google Scholar Crossref Search ADS PubMed WorldCat 45 Smith H Physiological and ecological function within the phytochrome family. Annu Rev Plant Physiol Plant Mol Biol 46 1995 289 315 Google Scholar Crossref Search ADS WorldCat 46 Soressi GP New spontaneous or chemically-induced fruit-ripening tomato mutants. Tomato Genet Coop Rpt 25 1975 21 22 Google Scholar OpenURL Placeholder Text WorldCat 47 Sugita M Gruissem W Developmental, organ-specific, and light-dependent expression of the tomato ribulose-1,5-bisphosphate carboxylase small subunit gene family. Proc Natl Acad Sci USA 84 1987 7104 7108 Google Scholar Crossref Search ADS PubMed WorldCat 48 Thompson AE A comparision of fruit quality constituents of normal and high pigment tomatoes. Proc Am Soc Hortic Sci 78 1962 464 473 Google Scholar OpenURL Placeholder Text WorldCat 49 Traas J Laufs P Jullien M Caboche M A mutation affecting etiolation and cell elongation in Nicotiana plumbaginifolia causes abnormal division plane alignement and pattern formation in root meristem. Plant J 7 1995 785 796 Google Scholar Crossref Search ADS WorldCat 50 van Tuinen A Cordonnier-Pratt M-M Pratt LH Verkerk R Zabel P Koornneef M The mapping of phytochrome genes and photomorphogenic mutants of tomato. Theor Appl Genet 94 1997 115 122 Google Scholar Crossref Search ADS PubMed WorldCat 51 van Tuinen A Kerckhoffs LHJ Nagatani A Kendrick RE Koornneef M Far-red light-insensitive, phytochrome A-deficient mutants of tomato. Mol Gen Genet 246 1995a 133 141 Google Scholar Crossref Search ADS WorldCat 52 van Tuinen A Kerckhoffs LHJ Nagatani A Kendrick RE Koornneef M A temporarily red light-insensitive mutant of tomato lacks a light-stable, B-like phytochrome. Plant Physiol 108 1995b 939 947 Google Scholar Crossref Search ADS WorldCat 53 Wagner D Hoecker U Quail PH Red1 is necessary for phytochrome B-mediated red light-specific signal transduction in Arabidopsis. Plant Cell 9 1997 731 743 Google Scholar PubMed OpenURL Placeholder Text WorldCat 54 Wanner LA Gruissem W Expression dynamics of the tomato rbcS gene family during development. Plant Cell 3 1991 1289 1303 Google Scholar PubMed OpenURL Placeholder Text WorldCat 55 Wehmeyer B Cashmore AR Schäfer E Photocontrol of the expression of genes encoding chlorophyll a/b binding proteins and small sununit of ribulose-1,5-bisphosphate carboxylase in etiolated seedlings of Lycopersicon esculentum (L.) and Nicotiana tabacum (L.). Plant Physiol 93 1990 990 997 Google Scholar Crossref Search ADS PubMed WorldCat 56 Wei N Deng X-W The role of COP/DET/FUS genes in light control of Arabidopsis seedling development. Plant Physiol 112 1996 871 878 Google Scholar Crossref Search ADS PubMed WorldCat 57 Weller JL Nagatani A Kendrick RE Murfet IC Reid JB New lv mutants of pea are deficient in phytochrome B. Plant Physiol 108 1995 525 532 Google Scholar Crossref Search ADS PubMed WorldCat 58 Whitelam GC Johnson E Peng J Carol P Anderson ML Cowl JS Harberd NP Phytochrome A null mutants of Arabidopsis display a wild-type phenotype in white light. Plant Cell 5 1993 757 768 Google Scholar PubMed OpenURL Placeholder Text WorldCat 59 Yen HC Shelton BA Howard LR Lee S Vrebalov J Giovannoni JJ The tomato high-pigment (hp) locus maps to chromosome 2 and influences plastome copy number and fruit quality. Theor Appl Genet 95 1997 1069 1079 Google Scholar Crossref Search ADS WorldCat Author notes 1 This work was supported by a Science and Technology Agency fellowship of the Japan International Science and Technology Exchange Center to J.L.P. 2 These two authors contributed equally to this paper. * Corresponding author; e-mail [email protected]; fax 81–48–462–9405. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Honée, Guy; Buitink, Julia; Jabs, Thorsten; De Kloe, José; Sijbolts, Fred; Apotheker, Marion; Weide, Rob; Sijen, Titia; Stuiver, Maarten; De Wit, Pierre J.G.M.

doi: 10.1104/pp.117.3.809pmid: 9662523

Rosche, Elke; Chitty, Julie; Westhoff, Peter; Taylor, William C.

doi: 10.1104/pp.117.3.821pmid: 9662524

Abstract The C4 enzyme pyruvate orthophosphate dikinase is encoded by a single gene, Pdk, in the C4 plantFlaveria trinervia. This gene also encodes enzyme isoforms located in the chloroplast and in the cytosol that do not have a function in C4 photosynthesis. Our goal is to identifycis-acting DNA sequences that regulate the expression of the gene that is active in the C4 cycle. We fused 1.5 kb of a 5′ flanking region from the Pdk gene, including the entire 5′ untranslated region, to the uidA reporter gene and stably transformed the closely related C4 speciesFlaveria bidentis. β-Glucuronidase (GUS) activity was detected at high levels in leaf mesophyll cells. GUS activity was detected at lower levels in bundle-sheath cells and stems and at very low levels in roots. This lower-level GUS expression was similar to the distribution of mRNA encoding the nonphotosynthetic form of the enzyme. We conclude that cis-acting DNA sequences controlling the expression of the C4 form in mesophyll cells and the chloroplast form in other cells and organs are co-located within the same 5′ region of the Pdk gene. PPDK (EC 2.7.9.1) is active in the mesophyll chloroplasts of C4 plants, where it converts pyruvate to PEP, the primary CO2 acceptor (Edwards and Walker, 1983;Hatch, 1987). It has, like the other enzymes of the C4 cycle, evolved from an ancestral C3 form (Moore, 1982). Although the function of PPDK in C3 tissues is not evident yet, it has been suggested that it might be involved in the conversion of the C3 and C4 compounds of amino acids (Aoyagi and Bassham, 1985). Low levels of PPDK have been found in various C3 plants as both chloroplastic and cytoplasmic isoenzymes (Meyer et al., 1982; Aoyagi and Bassham, 1983, 1984a, 1984b; Hata and Matsuoka, 1987). The presence of PPDK in C3 plants and the high similarities of the proteins of C3 and C4plants (about 80% amino acid sequence identity; Matsuoka et al., 1988;Rosche and Westhoff, 1990; Rosche et al., 1994), as well as bacteria (about 53% amino acid identity with the plant enzymes; Pocalyko et al., 1990; Bruchhaus and Tannich, 1993), suggest a housekeeping function for the ancestral form. The presence of low levels of mRNA encoding PPDK in nonphotosynthetic organs of C4plants (Glackin and Grula, 1990; Matsuoka, 1990; Sheen, 1991; Rosche and Westhoff, 1995) suggests that a housekeeping form may perform a similar function in these plants. The gene coding for the C4 form could have arisen by a gene-duplication mechanism that left the original gene coding for the housekeeping form. However, the genes coding for PPDK do not fit in this simple evolutionary scenario (Matsuoka, 1995). Maize has two Pdk genes, one of which encodes a cytoplasmic isoform that is expressed at low levels in all tissues (Sheen, 1991). A second gene encodes both chloroplastic and cytoplasmic forms. A large intron separates the exon encoding the chloroplast transit sequence from the exons encoding the mature polypeptide. An abundant, long transcript encoding the C4 form contains both transit and mature coding regions and is found preferentially in MC. A second transcript containing only the coding region for the mature polypeptide arises from the same gene and was detected in roots at a low level (Hudspeth et al., 1986; Glackin and Grula, 1990). The genus Flaveria has species with C3photosynthesis and C4 photosynthesis and those showing intermediate characteristics (Powell, 1978), making it particularly useful for gene comparisons. Rosche et al. (1994) detected only a single Pdk gene in all Flaveria species tested, regardless of the photosynthetic type. The C4 gene is very similar in structure to the dual-function maize gene and shows a similar expression pattern. In the C4 species Flaveria trinerviatranscription of the entire gene produces a 3.4-kb mRNA, the expression of which is positively light regulated (Rosche and Westhoff, 1995). The 3.4-kb mRNA and the mature protein are found predominantly, but not exclusively, in MC (Höfer et al., 1992; Rosche and Westhoff, 1995). A shorter transcript of 3.0 kb that codes only for the mature polypeptide was detected at low levels in roots and in darkened stems of F. trinervia (Rosche and Westhoff, 1995). The 3.4-kb mRNA was detected in leaves of C3 and C3-C4 intermediate species of Flaveria, its level showing a correlation with the degree of C4 characteristics in the intermediate species (Rosche et al., 1994). Therefore, the single Flaveria Pdk gene encodes PPDKs of different function, location, and abundance. The C4 isoform appears to have arisen from a gene encoding a nonphotosynthetic form by the addition of newcis-acting regulatory sequences while preserving the ancestral gene regulatory sequences. We have begun to localize these regulatory sequences by fusing 1.5 kb of the 5′ end of the F. trinervia (C4 species) to theuidA reporter gene. This has been stably transformed into the genome of Flaveria bidentis, a closely related species also showing full development of C4characteristics. By measuring GUS activities in transgenic plants we can determine whether sequences controlling the expression of the C4 form of PPDK are located within 1.5 kb of the upstream region of the gene. MATERIALS AND METHODS Flaveria bidentis plants were grown in a growth chamber with a light/dark cycle of 14/10 h and temperatures of 28/16°C. The light intensity reached about 300 μE m−2s−1. The plants were watered twice a day and supplied with nutrients every 2nd d. Mature plants used for reillumination experiments were darkened under the same temperature conditions and reilluminated in the same chamber as the light-grown control plants. Cloning of the uidA Fusion Construct The 2.8-kb XbaI fragment of the genomic clone in lnFtrpdkA-F containing 1.2 kb of the 5′ untranscribed region of the single Pdk gene of Flaveria trinervia (Rosche and Westhoff, 1995; EMBL accession no. X79095) was used for the reporter gene fusion. The 1257-bp XbaI/ClaI fragment was ligated to a 237-bp PCR fragment extending from the ClaI site to the amino terminal ATG of Pdk, where an artificialNcoI site was created for ligation to the uidA gene from pKIWI105 (Janssen and Gardner, 1989) with an ocs3′ end. Primers for the PCR reaction were CGTCTGATATGCCCGTAATCTAG (5′) and GCATCCATGGTTCTTCACCTGCTCAATTTCAC (3′). The resulting plasmid was linearized with HindIII and cloned into the binary vector pGA470 (An, 1986). Transformation The transformation of F. bidentis was performed as described by Chitty et al. (1994). GUS Histochemistry Histochemical staining of GUS activity was done by incubating tissue sections in 1 mg mL−1 5-bromo-4-chloro-3 indolyl β-d-glucuronic acid, 0.1 mNa2HPO4 buffer (pH 7.0), 0.5 mmK3(Fe[CN]6), 0.5 mmK4(Fe[CN]6), and 10 mm EDTA. Analysis of Nucleic Acids The preparation of RNA and genomic DNA and its analysis were performed as described earlier (Rosche and Westhoff, 1995), except that Hybond N+ (northern, Amersham) or Hybond N (genomic Southern, Amersham) were used to blot the nucleic acids. Hybridizations were carried out overnight at 64°C in 250 mmNa2HPO4, 2.5 mmEDTA, and 7% (w/v) SDS, pH 7.2 (Church and Gilbert, 1984). Washings were done at hybridization temperature in 5, 2, 1, and 0.5× SSC and 0.1% SDS for 15 to 30 min each. The probes used for the hybridizations of the northern blots were PCR products of the uidA gene in pKIWI105 (1.8 kb), the carboxy-terminal fragment of the PPDK cDNA ofF. trinervia (1.8 kb), and the actin gene of F. bidentis (446 bp). The genomic DNA was cut with HindIII and the blot was probed with the BamHI/EcoRI restriction fragment of pKIWI105 containing the entire uidA gene (1.9 kb). Each T-DNA insert should give a unique band on the Southern blot because one HindIII site will be in the flanking plant DNA. Separation of MC and BSC BSC strands were separated from the MC by differential homogenization steps and extensive washing of the BSC strands using a modification of the method of Agostino et al. (1989). About 3 g of leaf material was cut into 2-mm strips and homogenized for 10 s at low speed (20% line voltage) in 70 mL of buffer A (0.3 msorbitol, 25 mm Hepes-KOH, pH 7.4, 10 mm DTT, and 1 mm MgCl2) in an Omnimixer (Sorvall). From this mixture 5 mL was taken as the WLC extract. An additional 5 mL was filtered through a 20-μm net and the filtrate was collected as the MC fraction. A second homogenization for 40 s at full speed (100% line voltage) detached most of the remaining MC from the BSC strands. The BSC strands were collected on a 20-μm net, washed with 20 to 30 mL of buffer B (50 mm Hepes KOH, pH 7.0, 10 mm MgCl2, 0.5 mmEDTA, 1% PVP-40, 5 mm DTT, 2 mm PMSF, and 2 mm ɛ-aminocapronate), and resuspended in 5 mL of buffer B. The remaining cells in each fraction were broken in a glass homogenizer, aliquots were taken for chlorophyll and protein quantitations, and BSA in a final concentration of 0.1% (w/v) was added to the remaining samples before they were frozen in liquid N2. The relative purity of each fraction was determined by measuring the activities of the marker enzymes PEPC (MC specific) and ME (BSC specific) as described by Ashton et al. (1990). GUS activity was measured in separated cell fractions using the fluorometric assay described by Jefferson et al. (1987). The cell extracts for measuring of GUS in whole leaves, roots, and stems were prepared by grinding the plant material in buffer A with the addition of some sand. Calculation of Cell-Specific GUS Activities To calculate the amount of GUS activity in BSC, we measured the GUS activity in WLC, MC, and BSC strand fractions and then used a linear-regression method similar to that described by Stitt and Heldt (1985) to correct for cross-contamination in the BSC fraction. Here the total GUS activity per fraction is defined as the sum of GUS activities coming from the MC and BSC: GUStotal=GUSMC+GUSBS Because the MC-specific GUS activity is proportional to the activity of the marker enzyme for MC, PEPC (constant a = GUSMC/PEPC), and the GUS activity in BSC preparations is proportional to the activity of ME (constant b = GUSBS/ME), the first equation can be transformed into a function of the form y = a + b(x), where GUStotal/PEPC = y and ME/PEPC = x. The plotting of this function and extrapolation to the axes results in the constants a and b, which can be used to calculate the ratio of MC-specific or BSC-specific GUS activities in each fraction. The reciprocal plot should result in similar values. To minimize errors, we used the activities per volume in each fraction to calculate the linear regressions. RESULTS Transformation of F. bidentis The 5′ region of the F. trinervia Pdk gene extends from position −1212 relative to the start of transcription up to the start of translation at position +279. This includes an exon of 135 bp (exon 1a), an intron of 133 bp in the 5′ untranslated region, and 10 bp of exon 1b in front of the first ATG codon, which initiates translation of the transit peptide (Fig. 1). Thisgus fusion was transformed into hypocotyl explants ofF. bidentis, a species closely related to F. trinervia. Both species exhibit full development of C4 photosynthesis. Fig. 1. Open in new tabDownload slide Schematic representation of the Pdkpromoter/uidA construct used for the transformation ofF. bidentis. Black boxes indicate the 5′ untranslated exon and the first 10 bp of the next exon in front of the translational start codon. The uidA gene and the ocs 3′ terminator are symbolized as gray boxes. Fig. 1. Open in new tabDownload slide Schematic representation of the Pdkpromoter/uidA construct used for the transformation ofF. bidentis. Black boxes indicate the 5′ untranslated exon and the first 10 bp of the next exon in front of the translational start codon. The uidA gene and the ocs 3′ terminator are symbolized as gray boxes. After callus formation on kanamycin-containing medium we obtained 11 shoots, each from a different callus; 8 of these shoots survived to give mature plants. The plants were transferred to soil and grown in the greenhouse until they set seeds. The seeds of two primary transformants did not germinate. The T1generation of the remaining six primary transformants were used for the experiments described here, together with two T0plants, which could be propagated by cuttings. Only one of these T0 plants produced fertile seeds; the resulting T1 plants were included in the analysis. GUS Expression Changes with Leaf Age Prior to comparative measurements between different plants we compared the GUS levels between the leaves of single plants. Using the fluorometric quantitation of the conversion of methylumbelliferyl glucuronide by the GUS protein we found the highest levels in leaves at the third or fourth node when counting from the youngest visible node downward. These leaves were already well developed and at least three-quarters in size compared with the largest leaves of the plant. Older leaf pairs showed a significant decrease in GUS activity per milligram protein. The oldest, but not visibly senescent, leaf displayed GUS levels similar to that in stems (data not shown). Although we tried to use tissues of similar age, we could not exclude some variability due to age. When leaves of the third or fourth node were separated into the top, middle, and basal sections, we obtained the lowest GUS activity in the tip. The levels increased in the middle section and reached 2-fold that of the tip at the basal part, where most of the cell divisions occur (data not shown). To determine the range of GUS activities in different transgenic lines we prepared leaf extracts from the third leaf pair of plants that were 4 to 6 weeks old. The results of these measurements are shown in Figure2. Each dot represents one plant. In five lines of T1 plants the highest activities were 2.5 to 4 times that of the lowest levels measured, about what one would expect from the offspring of a self-fertilized T0plant. One group of T1 plants (217–3) showed considerable variability between 0.3 and 75 nmol methylumbelliferone mg−1 protein min−1. Fig. 2. Open in new tabDownload slide Distribution of GUS activities in leaves of transgenic T1 plants. GUS activities in extracts of the third leaf pairs of 4- to 6-week-old plants were quantified using the fluorometric analysis of the conversion of methylumbelliferyl glucuronide. Each circle represents one plant and each column represents the progeny of one T0 plant. MU, Methylumbelliferyl. Fig. 2. Open in new tabDownload slide Distribution of GUS activities in leaves of transgenic T1 plants. GUS activities in extracts of the third leaf pairs of 4- to 6-week-old plants were quantified using the fluorometric analysis of the conversion of methylumbelliferyl glucuronide. Each circle represents one plant and each column represents the progeny of one T0 plant. MU, Methylumbelliferyl. Two T0 plants as well as five T1 plants of each of the six fertile transgenic lines were analyzed by Southern-blot hybridization to confirm that the chimeric genes were intact and to estimate the number of the integrated copies (Table I). No correlation was found between the copy number, which ranged from one to six, and the levels of GUS expression. Table I. Calculation of GUS activities in MC and BS Plant  . Transgene Copy No. . GUS Activity in Cell Fractions . Purity of the BSC Fraction . Calculated Activity of the Promoter in Pure BSC . WLC . MC . BSC . nmol MU-amin−1 mg−1 protein % % of WL 217-1 T0 1 17.3 28.3 1.4 92 2.7 217-3 T0 6 15.9 40.0 1.5 96 4.8 217-2/3 5 10.1 17.1 0.7 97 0.3 217-2/6 5 36.7 82.6 0.4 97 0.2 217-2/8 5 46.7 116.9 2.3 95 0.7 217-3/1 6 12.0 12.0 0.3 95 1.3 217-3/2 6 9.9 14.1 0.8 98 4.4 217-3/3 6 0.7 1.2 0.1 97 6.1 217-3/12 6 43.9 58.4 4.0 94 1.0 217-5/3 2 36.7 74.0 3.9 97 4.1 217-5/6 2 52.2 108.2 6.3 96 3.5 217-5/8 2 22.4 40.4 2.9 95 5.7 217-5/9 2 27.0 53.9 4.1 94 7.3 217-6/1 5 3.3 4.6 0.2 97 4.9 217-6/4 5 10.4   n.d.-b 0.4 98 4.9 217-6/6 5 11.6 43.6 1.0 96 1.1 217-9/1 1 7.0 16.5 0.7 96 3.8 217-9/2 1 11.9 31.9 1.4 96 7.8 217-9/3 1 24.3 65.3 2.3 98 1.7 217-9/5 1 23.2 36.8 1.4 99 1.5 217-10/1 3 9.1 18.2 0.8 94 3.8 217-10/2 3 14.3 52.9 1.5 96 2.4 217-10/37 3 6.6 10.2 1.2 99 9.9 Plant  . Transgene Copy No. . GUS Activity in Cell Fractions . Purity of the BSC Fraction . Calculated Activity of the Promoter in Pure BSC . WLC . MC . BSC . nmol MU-amin−1 mg−1 protein % % of WL 217-1 T0 1 17.3 28.3 1.4 92 2.7 217-3 T0 6 15.9 40.0 1.5 96 4.8 217-2/3 5 10.1 17.1 0.7 97 0.3 217-2/6 5 36.7 82.6 0.4 97 0.2 217-2/8 5 46.7 116.9 2.3 95 0.7 217-3/1 6 12.0 12.0 0.3 95 1.3 217-3/2 6 9.9 14.1 0.8 98 4.4 217-3/3 6 0.7 1.2 0.1 97 6.1 217-3/12 6 43.9 58.4 4.0 94 1.0 217-5/3 2 36.7 74.0 3.9 97 4.1 217-5/6 2 52.2 108.2 6.3 96 3.5 217-5/8 2 22.4 40.4 2.9 95 5.7 217-5/9 2 27.0 53.9 4.1 94 7.3 217-6/1 5 3.3 4.6 0.2 97 4.9 217-6/4 5 10.4   n.d.-b 0.4 98 4.9 217-6/6 5 11.6 43.6 1.0 96 1.1 217-9/1 1 7.0 16.5 0.7 96 3.8 217-9/2 1 11.9 31.9 1.4 96 7.8 217-9/3 1 24.3 65.3 2.3 98 1.7 217-9/5 1 23.2 36.8 1.4 99 1.5 217-10/1 3 9.1 18.2 0.8 94 3.8 217-10/2 3 14.3 52.9 1.5 96 2.4 217-10/37 3 6.6 10.2 1.2 99 9.9 GUS activities in the actual cell fractions were measured using the fluorescent assay. The purity of the BSC fraction was estimated using activities of the marker enzymes PEPC and ME. The calculated activity of the promoter/GUS construct in pure BSC fractions was determined by the linear-regression method. The copy number of the integrated T-DNA was determined in genomic Southern blots. F0-a MU, Methylumbelliferyl. F0-b n.d., Not detectable. Open in new tab Table I. Calculation of GUS activities in MC and BS Plant  . Transgene Copy No. . GUS Activity in Cell Fractions . Purity of the BSC Fraction . Calculated Activity of the Promoter in Pure BSC . WLC . MC . BSC . nmol MU-amin−1 mg−1 protein % % of WL 217-1 T0 1 17.3 28.3 1.4 92 2.7 217-3 T0 6 15.9 40.0 1.5 96 4.8 217-2/3 5 10.1 17.1 0.7 97 0.3 217-2/6 5 36.7 82.6 0.4 97 0.2 217-2/8 5 46.7 116.9 2.3 95 0.7 217-3/1 6 12.0 12.0 0.3 95 1.3 217-3/2 6 9.9 14.1 0.8 98 4.4 217-3/3 6 0.7 1.2 0.1 97 6.1 217-3/12 6 43.9 58.4 4.0 94 1.0 217-5/3 2 36.7 74.0 3.9 97 4.1 217-5/6 2 52.2 108.2 6.3 96 3.5 217-5/8 2 22.4 40.4 2.9 95 5.7 217-5/9 2 27.0 53.9 4.1 94 7.3 217-6/1 5 3.3 4.6 0.2 97 4.9 217-6/4 5 10.4   n.d.-b 0.4 98 4.9 217-6/6 5 11.6 43.6 1.0 96 1.1 217-9/1 1 7.0 16.5 0.7 96 3.8 217-9/2 1 11.9 31.9 1.4 96 7.8 217-9/3 1 24.3 65.3 2.3 98 1.7 217-9/5 1 23.2 36.8 1.4 99 1.5 217-10/1 3 9.1 18.2 0.8 94 3.8 217-10/2 3 14.3 52.9 1.5 96 2.4 217-10/37 3 6.6 10.2 1.2 99 9.9 Plant  . Transgene Copy No. . GUS Activity in Cell Fractions . Purity of the BSC Fraction . Calculated Activity of the Promoter in Pure BSC . WLC . MC . BSC . nmol MU-amin−1 mg−1 protein % % of WL 217-1 T0 1 17.3 28.3 1.4 92 2.7 217-3 T0 6 15.9 40.0 1.5 96 4.8 217-2/3 5 10.1 17.1 0.7 97 0.3 217-2/6 5 36.7 82.6 0.4 97 0.2 217-2/8 5 46.7 116.9 2.3 95 0.7 217-3/1 6 12.0 12.0 0.3 95 1.3 217-3/2 6 9.9 14.1 0.8 98 4.4 217-3/3 6 0.7 1.2 0.1 97 6.1 217-3/12 6 43.9 58.4 4.0 94 1.0 217-5/3 2 36.7 74.0 3.9 97 4.1 217-5/6 2 52.2 108.2 6.3 96 3.5 217-5/8 2 22.4 40.4 2.9 95 5.7 217-5/9 2 27.0 53.9 4.1 94 7.3 217-6/1 5 3.3 4.6 0.2 97 4.9 217-6/4 5 10.4   n.d.-b 0.4 98 4.9 217-6/6 5 11.6 43.6 1.0 96 1.1 217-9/1 1 7.0 16.5 0.7 96 3.8 217-9/2 1 11.9 31.9 1.4 96 7.8 217-9/3 1 24.3 65.3 2.3 98 1.7 217-9/5 1 23.2 36.8 1.4 99 1.5 217-10/1 3 9.1 18.2 0.8 94 3.8 217-10/2 3 14.3 52.9 1.5 96 2.4 217-10/37 3 6.6 10.2 1.2 99 9.9 GUS activities in the actual cell fractions were measured using the fluorescent assay. The purity of the BSC fraction was estimated using activities of the marker enzymes PEPC and ME. The calculated activity of the promoter/GUS construct in pure BSC fractions was determined by the linear-regression method. The copy number of the integrated T-DNA was determined in genomic Southern blots. F0-a MU, Methylumbelliferyl. F0-b n.d., Not detectable. Open in new tab Organ-Specific GUS Activities in Transgenic Plants The organ specificity of the promoter construct was investigated in T1 plants of each transgenic line as well as in two T0 plants (Fig.3). The line 217–5 is represented by four T1 plants exhibiting different levels of GUS expression in leaves. For the preparation of leaf extracts we used the middle sections of the third-youngest leaf pairs. Stem tissues represent the internodal areas between the second and fifth nodes, which are green in both F. trinervia and F. bidentis. Root material was taken from young roots grown in vermiculite. Fig. 3. Open in new tabDownload slide Organ specificity of the GUS activity in transgenic plants. GUS activities were measured in the middle parts of leaves (white bars), in the internodal areas of stems (gray bars) between the second and fifth node, and in young roots (black bars) of transgenic plants. Data were obtained from two T0 plants (217–1 and 217–3), one representative each of five transgenic lines (showing medium to high GUS activities in leaves; 217–2, 217–3, 217–6, 217–9, and 217–10) and four plants of line 217–5 expressing a range of GUS activities in leaves. MU, Methylumbelliferyl. Fig. 3. Open in new tabDownload slide Organ specificity of the GUS activity in transgenic plants. GUS activities were measured in the middle parts of leaves (white bars), in the internodal areas of stems (gray bars) between the second and fifth node, and in young roots (black bars) of transgenic plants. Data were obtained from two T0 plants (217–1 and 217–3), one representative each of five transgenic lines (showing medium to high GUS activities in leaves; 217–2, 217–3, 217–6, 217–9, and 217–10) and four plants of line 217–5 expressing a range of GUS activities in leaves. MU, Methylumbelliferyl. GUS activities in stems ranged from 12 to 0.01% of that found in leaves. The four T1 plants of line 217–5 showed stem activities ranging from 7 to 12% of that in leaves. The levels in roots were slightly above background, ranging from 0.04 to 1.6% of the activities in leaves. A similar distribution of GUS expression in stems, leaves, and roots was found in 25-d-old T1seedlings (data not shown) as in the more mature plants (analyzed in Fig. 3). The range of the GUS activities in stem tissue relative to the corresponding leaf extracts might be due to high variabilities of the GUS activities at different developmental stages of stems. We tried to circumvent developmental differences by pooling the stem sections between the second and the fifth node. However, we cannot exclude the possibility of varying amounts of lignified material, leading to high variations of the measured GUS activities on a protein basis. The results shown here do prove, however, that the promoter is expressed mainly in leaves and to a lesser degree in stems. The GUS staining in stems was visible mainly in the vascular bundles and a faint staining was seen in the MC between them (Fig.4A). As the stem aged, the pronounced vascular staining decreased. Fig. 4. Open in new tabDownload slide Histochemical analysis of GUS activity. A, Sections of young stems incubated for 2 h. Bar = 1 mm. B, Leaf section incubated for 20 min. C and D, Leaf sections incubated for 2 h viewed under dark-field microscopy. Bars = 100 μm in B, C, and D. M, MC; B, BSC. Fig. 4. Open in new tabDownload slide Histochemical analysis of GUS activity. A, Sections of young stems incubated for 2 h. Bar = 1 mm. B, Leaf section incubated for 20 min. C and D, Leaf sections incubated for 2 h viewed under dark-field microscopy. Bars = 100 μm in B, C, and D. M, MC; B, BSC. GUS Expression in MC and BSC The function of PPDK in the C4 cycle of photosynthesis is restricted to the MC, but small amounts of transcripts and proteins for this enzyme have been found in BSC as well. We determined whether the promoter construct was sufficient to direct a similar distribution of GUS activity. When leaf sections from T0 and T1 plants were incubated in 5-bromo-4-chloro-3 indolyl β-d-glucuronic acid for periods of up to 30 min, the indigo GUS product appeared first in MC, as expected (Fig. 4B). Some indigo was also detected in BSC. Epidermal cells were not stained. However, longer incubation resulted in the accumulation of GUS product (seen as a red birefringence in dark-field microscopy) in both cell types and in most cells of veins (Fig. 4C). Incubation times of several hours or more gave as much GUS product in veins as in MC (Fig. 4D). GUS product was even detectable in epidermal cells. The equivocal results from the histochemical analysis of GUS distribution led us to measure activity directly in isolated cell preparations. In C4 plants the BSC are encased by thick cell walls with no intercellular spaces between adjacent BS. Differential homogenization of leaves allows one to prepare relatively pure bundle-sheath strands consisting of BS and veins (Agostino et al., 1989). However, in C4 plants of the genusFlaveria it is not possible to make MC preparations with a similar degree of purity. The purity of any cell fraction can be accurately determined by measuring the activities of selected C4 enzymes, which have been shown to be cell specific in a wide range of C4 plants (Hatch, 1987). We used PEPC and ME as marker enzymes for MC and BS, respectively, and routinely obtained bundle-sheath preparations, which were about 95% pure. Mesophyll preparations were generally only 60 to 70% pure. We compared the measured GUS activities of bundle-sheath preparations with WL extracts to obtain estimates for MC. For the calculation of GUS activities in pure BS we used the linear-regression method as described in Methods. Since this method is based on the relation of GUS activities to the marker enzymes, it is independent of the purity of the actual cell preparations. The measured GUS activities and calculated values for pure BS are listed in Table I. The results for two T0 plants and three to four T1 plants of each transgenic line are shown in Figure 5. The estimated GUS activities in bundle-sheath strands vary between 0.2 and 10% of the activities in whole leaves. Within each set of T1 siblings the values diverge to a lesser degree. Based on these measurements we deduce that the promoter construct is mainly expressed in MC but that there is also a low level of expression in BS. We have no data that help us to determine whether any of the GUS activity measured in our bundle-sheath strand preparations is due to promoter activity in vein cells. The quantitative measurements show that the high levels of GUS in BS and veins seen in the histochemical analysis are artifacts. Fig. 5. Open in new tabDownload slide Measured GUS activities in extracts of whole leaves (gray bars) compared with BSC (black bars). The BSC preparations were at least 95% pure. The purity was calculated using the activities of the marker enzymes for both cell types. MU, Methylumbelliferyl. Fig. 5. Open in new tabDownload slide Measured GUS activities in extracts of whole leaves (gray bars) compared with BSC (black bars). The BSC preparations were at least 95% pure. The purity was calculated using the activities of the marker enzymes for both cell types. MU, Methylumbelliferyl. Histochemical staining for GUS activity in young F. bidentisleaves has proven to be difficult because of poor substrate penetration. When young leaves were cut into thin sections, we could observe staining at the cut edges and see a good correlation between the degree of vascularization and the amount of GUS activity (data not shown). Because full development of C4 Kranz anatomy is dependent on complete vascularization of the leaf, this correlation suggests that high-level expression of the Pdkpromoter is dependent on cellular differentiation. Light Regulation of the Introduced Promoter Construct The 3.4-kb PPDK transcript in leaves of F. trinervia is positively light regulated (Rosche and Westhoff, 1995). The darkening of mature plants results in a significant decrease of the transcript levels, which increase again after illumination. Because the GUS protein tends to be very stable (Jefferson et al., 1987), we measured transcript levels in the plants 217–1 and 217–3, which were kept in the dark for 3 d prior to reillumination for up to 6 h. Poly(A+) RNA was probed with theuidA gene and Pdk cDNA from F. trinervia. Results for the plant 217–3 are shown in Figure6. The endogenous Pdk mRNA decreased to low levels in the dark and then rapidly increased within 6 h to levels similar to light-grown plants. The uidA mRNA transcribed from the introduced construct showed an increase with reillumination as well. However, this increase seems to be less pronounced than that of the Pdk transcript, possibly due to lower overall transcript levels of the uidA mRNA. Although we used probes of similar lengths and comparable labeling in three independent experiments, the signal strengths of theuidA mRNA were always lower compared with the Pdktranscript. Fig. 6. Open in new tabDownload slide Northern-blot analysis of plants left in the dark and reilluminated plants. The T0 plant 217–3 was left in the dark for 3 d and was subsequently reilluminated in the greenhouse. Leaves were harvested after 0, 3, and 6 h of reillumination, as well as from light-grown control plants. Five micrograms of poly(A+) RNA of each sample was loaded twice onto the same gel, generating two identical patterns. The gel was blotted and hybridized with labeled PCR products of theuidA gene and the Pdk cDNA of F. trinervia. The blots were hybridized a second time with a probe for actin to test for equal loadings. Fig. 6. Open in new tabDownload slide Northern-blot analysis of plants left in the dark and reilluminated plants. The T0 plant 217–3 was left in the dark for 3 d and was subsequently reilluminated in the greenhouse. Leaves were harvested after 0, 3, and 6 h of reillumination, as well as from light-grown control plants. Five micrograms of poly(A+) RNA of each sample was loaded twice onto the same gel, generating two identical patterns. The gel was blotted and hybridized with labeled PCR products of theuidA gene and the Pdk cDNA of F. trinervia. The blots were hybridized a second time with a probe for actin to test for equal loadings. To examine light induction in etiolated seedlings we germinated and grew T1 seeds either in the dark or in constant light. The seeds had been previously illuminated for 1 d to ensure germination. As shown in Table II, cotyledons grown in the light had severalfold greater GUS activity than those grown in the dark. After 10 d of growth in the dark, transfer to light gave a progressive 3-fold increase in GUS. Although we did not determine the extent of leaf-cell development in these seedlings, we conclude that light induces the expression of the reporter gene in both seedlings and in mature plants. Table II. Light induction of GUS activity in seedlings T1Line . Light/Dark Conditions . GUS Activity . nmol MU1-amin−1 mg−1protein 217-5 10 d of dark 8.2 12 d of light 26.6 217-3 7 d of dark 6.9 7 d of light 16.7 10 d of light +3 d of dark 8.5 27-3 10 d of dark 8.9 +0.5 h of light 8.5 +1 h of light 8.0 +1.5 h of light 9.5 +2 h of light 11.0 +2.5 h of light 11.4 +12 h of light 27.2 T1Line . Light/Dark Conditions . GUS Activity . nmol MU1-amin−1 mg−1protein 217-5 10 d of dark 8.2 12 d of light 26.6 217-3 7 d of dark 6.9 7 d of light 16.7 10 d of light +3 d of dark 8.5 27-3 10 d of dark 8.9 +0.5 h of light 8.5 +1 h of light 8.0 +1.5 h of light 9.5 +2 h of light 11.0 +2.5 h of light 11.4 +12 h of light 27.2 GUS activity was measured in cotyledons from individual seedlings. Seedlings were grown for the indicated number of days in either continuous dark or light, or dark-grown seedlings were transferred to continuous light for the indicated number of hours. F1-a MU, Methylumbelliferyl. Open in new tab Table II. Light induction of GUS activity in seedlings T1Line . Light/Dark Conditions . GUS Activity . nmol MU1-amin−1 mg−1protein 217-5 10 d of dark 8.2 12 d of light 26.6 217-3 7 d of dark 6.9 7 d of light 16.7 10 d of light +3 d of dark 8.5 27-3 10 d of dark 8.9 +0.5 h of light 8.5 +1 h of light 8.0 +1.5 h of light 9.5 +2 h of light 11.0 +2.5 h of light 11.4 +12 h of light 27.2 T1Line . Light/Dark Conditions . GUS Activity . nmol MU1-amin−1 mg−1protein 217-5 10 d of dark 8.2 12 d of light 26.6 217-3 7 d of dark 6.9 7 d of light 16.7 10 d of light +3 d of dark 8.5 27-3 10 d of dark 8.9 +0.5 h of light 8.5 +1 h of light 8.0 +1.5 h of light 9.5 +2 h of light 11.0 +2.5 h of light 11.4 +12 h of light 27.2 GUS activity was measured in cotyledons from individual seedlings. Seedlings were grown for the indicated number of days in either continuous dark or light, or dark-grown seedlings were transferred to continuous light for the indicated number of hours. F1-a MU, Methylumbelliferyl. Open in new tab DISCUSSION The genes coding for some C4 enzymes are members of small gene families. Gene duplications created additional gene copies, which subsequently gained the necessarycis-acting regulatory elements that confer high-level, light-regulated, and cell-specific expression that is necessary for the assembly of the C4 pathway. This mechanism preserved the ancestral genes coding for nonphotosynthetic isoforms, which are found in C4 species and which are expressed at levels similar to C3 species. Examples are the gene families coding for PEPC and ME. The C3 species F. pringlei and the C4 species F. trinervia have similar numbers of genes coding for PEPC (Hermans and Westhoff, 1990, 1992). Gene-specific probes identified orthologous Ppc genes in the C3 species that are very similar in sequence to the PpcA genes encoding the C4 isoform in the C4 species. In the C3 species these PpcA genes are expressed at low levels in most organs. Stockhaus et al. (1997) showed that 5′ sequences from the PpcA1 gene of F. pringlei (C3) also directed low-leveluidA gene expression in transgenic F. bidentis(C4) plants, whereas 5′ sequences from theF. trinervia (C4) gene directed high level expression. This result provides evidence for the role of newcis-acting sequences in the C4species. A similar analysis identified two genes encoding chloroplast-localized ME isoforms in Flaveria (Marshall et al., 1996). One gene,Me1, encodes the C4 form in the C4 species. Me1 is present in the C3 species but is expressed at low levels. The second gene, Me2, is expressed at very low levels in all species. The Pdk gene does not fit this simple evolutionary story. In the genus Flaveria it is present as a single-copy gene, which performs both the function of the ancestral nonphotosynthetic gene and the MC-specific C4 gene. We have used a transformation approach to determine the relationship of thecis-acting DNA sequences controlling the different programs of expression of the Pdk gene from F. trinervia, a C4 species. Rosche and Westhoff (1995)previously showed that the 3.4-kb transcript of this gene could be detected not only in MC, where it encodes the enzyme used in the C4 pathway, but also at much lower levels in BSC and in stems. Our data show that 1.5 kb of DNA upstream of the ATG directs similar expression of the uidA reporter gene. Most GUS activity was located in MC, with lower levels in BSC and in stems (Figs. 3 and 5). Although the 3.4-kb transcript was not detected in roots, extremely low amounts of GUS were found in roots, which may be due to the greater sensitivity of the GUS fluorescence assay compared with RNA northern blots. We tried to localize the GUS activity in stem sections by GUS staining and found most of the indigo in the vascular bundles. However, the level of the actual GUS activity in these cells remains to be investigated. In leaves the GUS product accumulated in cells of the veins, although the cell-separation data clearly show a preferred expression in MC. Taken together, it seems that GUS-expression studies based on histochemical data alone can lead to questionable results. The high stability of the GUS product enhances the accumulation in cells with low promoter activity. In addition, diffusion of the initial GUS product via the frequent and large plasmodesmata that occur between the MC and BSC of C4 plants (Robinson-Beers and Evert, 1991) can lead to the precipitation of the insoluble end product in cells where the uidA gene is not expressed. The accumulation in veins indicates a preferred precipitation of the GUS product in this compartment. The histochemical analysis of the GUS expression driven by the Ppc promoter (Stockhaus et al., 1997) indicates that the problems mentioned above are not as evident when the promoter activity is strictly cell specific. The authors report the diffusion of the GUS product in BSC only after longer incubation periods. Our cell-separation data show low GUS activity in BSC, in accordance with the northern data obtained previously for the endogenous Pdk gene (Rosche and Westhoff, 1995). The resulting GUS staining of these cells was not proportional to the actual GUS activity measured in the separated cells. The high level expression of the Pdk gene in MC was also dependent on light and on the stage of leaf development. Here we show that the uidA transcript exhibited a similar response to light in transgenic F. bidentis plants (Fig. 6), indicating that the cis-element responsible for the light-regulated expression is present within the 1.5-kb promoter region. Although the transcripts of the endogenous Pdk gene and the introduceduidA construct in the investigated transplant were not quantified, the level of the GUS mRNA seemed to be significantly lower. Reasons for these differences could be different stabilities of the transcripts or position effects within the genome. In mature leaves the measured GUS activity was found to be greatest in the basal region of the leaf, where most of the cell divisions occur. The activity decreased toward the tip of the leaf, where the cellular development is most advanced. In contrast, the GUS staining of very young leaves indicated a good correlation between the intensity of the color and the cell differentiation. The histochemical results are similar to those found for the ppcA promoter/uidA construct in F. bidentis transplants (Stockhaus et al., 1997). Thus, these C4 promoters seem to be active in developing leaves in correlation with the differentiation of MC and BSC. In mature leaves, however, the oldest regions show the lowest GUS activity. We conclude that DNA sequences sufficient for expression of the C4 form of PPDK in MC and for expression of the chloroplast form in other cells and organs are co-located within the same 5′ region of the F. trinervia Pdk gene. In evolutionary terms, the C4cis-acting sequences appear to have been added to a promoter that was active in a wide range of cells without significantly altering the activity of that promoter. Our next step will be to identify the cis-acting sequences controlling both expression programs and determine their structural and functional relationships to one another. The strong correlation between GUS activity directed by 5′ sequences of the gene and the distribution of Pdk mRNA suggest that these cis-acting sequences control transcription. However, the inclusion of the 5′ untranslated region of the Pdk transcript in our reporter gene construct means that we cannot exclude the involvement of mRNA stability in gene regulation. The dual-function maize Pdk gene has also been analyzed forcis-acting regulatory sequences. Transient expression assays in maize leaf protoplasts (Sheen, 1991) and in microprojectile-bombarded maize leaves (Matsuoka and Numazawa, 1991) identified sequences upstream of the transcription initiation site, which are necessary for high level leaf expression. These analyses were not able to determine whether the promoter constructs were active at lower levels in other cells and organs. Matsuoka et al. (1993) were able to show that the promoter for the chloroplast form of maize PPDK was specifically expressed in transgenic rice leaves and that this expression was at high levels, preferentially in MC. These data strongly suggest that the dual-function maize gene is equivalent to the single Flaveria Pdk gene and that the evolutionary origin of the maize gene may also have been from the addition of C4 regulatory elements to an ancestral gene. However, it is not evident if the chloroplast form of the maize gene is expressed in other cells and organs. The F. bidentis transformation system has been used byStockhaus et al. (1997) to look for regulatory sequences from theF. trinervia (C4) PpcA1gene, which codes for the mesophyll-specific isoform of PEPC. 5′ Sequences, including the entire 5′ untranslated region, directed a pattern of GUS expression that was very similar to the distribution ofPpcA mRNA. The authors draw similar conclusions to ours about the importance of 5′ cis-acting sequences in regulating, most likely through transcriptional control, the expression of a gene coding for a C4 enzyme. In contrast,Marshall et al. (1997) have found that 5′ and 3′ sequences from theMe1 gene of F. bidentis, which codes for the C4 isoform of ME, are required for high-level BSC expression of the uidA reporter gene in transgenic F. bidentis. They have not yet determined the level of this regulation or how 3′ sequences interact with 5′ sequences. 3′ Sequences have also been shown to be important in controlling BSC-specific expression of the maize RbcS-m3 gene (Viret et al., 1994), whereas Ramsperger et al. (1996) have presented evidence that translational regulation may be important in BSC specificity of both Rubisco subunits. Thus, there does not appear to be one single mechanism regulating the expression of genes coding for enzymes of the C4 pathway. ACKNOWLEDGMENTS We thank Tony Agostino for advice concerning cell-separation methods; John Lunn for help with linear-regression analyses; and Brian Surin, Tony Ashton, and Paul Whitfeld for helpful comments about the manuscript. Abbreviations: BSC bundle-sheath cell(s) MC mesophyll cell(s) ME NADP-malic enzyme PEPC PEP carboxylase PPDK pyruvate Pi dikinase WLC whole-leaf cell(s) LITERATURE CITED 1 Agostino A Furbank RT Hatch MD Maximising photosynthetic activity and cell integrity in isolated bundle sheath cell strands from C4 species. Aust J Plant Physiol 16 1989 279 290 Google Scholar OpenURL Placeholder Text WorldCat 2 An G Development of plant promoter expression vectors and their use for analysis of differential activity of nopaline synthase promoter in transformed cells. Plant Physiol 81 1986 86 91 Google Scholar Crossref Search ADS PubMed WorldCat 3 Aoyagi K Bassham JA Pyruvate orthophosphate dikinase in wheat leaves. Plant Physiol 73 1983 853 854 Google Scholar Crossref Search ADS PubMed WorldCat 4 Aoyagi K Bassham JA Pyruvate orthophosphate dikinase mRNA organ specificity in wheat and maize. Plant Physiol 76 1984a 278 280 Google Scholar Crossref Search ADS WorldCat 5 Aoyagi K Bassham JA Pyruvate orthophosphate dikinase of C3 seeds and leaves as compared to the enzyme from maize. Plant Physiol 75 1984b 387 392 Google Scholar Crossref Search ADS WorldCat 6 Aoyagi K Bassham JA Synthesis and uptake of cytoplasmically synthesized pyruvate, Pi dikinase polypeptide by chloroplasts. Plant Physiol 78 1985 661 664 Google Scholar Crossref Search ADS PubMed WorldCat 7 Ashton AR Burnell JN Furbank RT Jenkins CLD Hatch MD Enzymes of C4 photosynthesis. Methods Plant Biochem 3 1990 39 72 Google Scholar Crossref Search ADS WorldCat 8 Bruchhaus I Tannich E Primary structure of the pyruvate phosphate dikinase in Entamoeba histolytica. Mol Biochem Parasitol 62 1993 153 156 Google Scholar Crossref Search ADS PubMed WorldCat 9 Chitty JA Furbank RT Marshall JS Chen Z Taylor WC Genetic transformation of the C4 plant, Flaveria bidentis. Plant J 6 1994 949 956 Google Scholar Crossref Search ADS WorldCat 10 Church GM Gilbert W Genomic sequencing. Proc Natl Acad Sci USA 81 1984 1991 1995 Google Scholar Crossref Search ADS PubMed WorldCat 11 Edwards GE Walker DA C3, C4: Mechanism, and Cellular and Environmental Regulation, of Photosynthesis. 1983 Blackwell Scientific Publications Oxford, London 12 Glackin CA Grula JW Organ-specific transcripts of different size and abundance derive from the same pyruvate, orthophosphate dikinase gene in maize. Proc Natl Acad Sci USA 87 1990 3004 3008 Google Scholar Crossref Search ADS PubMed WorldCat 13 Hata S Matsuoka M Immunological studies on pyruvate orthophosphate dikinase in C3 plants. Plant Cell Physiol 28 1987 635 641 Google Scholar Crossref Search ADS WorldCat 14 Hatch MD C4 photosynthesis: a unique blend of modified biochemistry, anatomy and ultrastructure. Biochim Biophys Acta 895 1987 81 106 Google Scholar Crossref Search ADS WorldCat 15 Hermans J Westhoff P Analysis of expression and evolutionary relationships of phosphoenolpyruvate carboxylase genes in Flaveria trinervia (C4) and F. pringlei (C3). Mol Gen Genet 224 1990 459 468 Google Scholar Crossref Search ADS PubMed WorldCat 16 Hermans J Westhoff P Homologous genes for the C4 isoform of phosphoenolpyruvate carboxylase in a C3- and a C4-Flaveria species. Mol Gen Genet 234 1992 275 284 Google Scholar Crossref Search ADS PubMed WorldCat 17 Höfer MU Santore UJ Westhoff P Differential accumulation of the 10-, 16- and 23-kDa peripheral components of the water-splitting complex of photosystem II in mesophyll and bundle-sheath chloroplasts of the dicotyledonous C4 plant Flaveria trinervia (Spreng.) C. Mohr. Planta 186 1992 304 312 Google Scholar Crossref Search ADS PubMed WorldCat 18 Hudspeth RL Glackin CA Bonner J Grula JW Genomic and cDNA clones for maize phosphoenolpyruvate carboxylase and pyruvate, orthophosphate dikinase: expression of different gene-family members in leaves and roots. Proc Natl Acad Sci USA 83 1986 2884 2888 Google Scholar Crossref Search ADS PubMed WorldCat 19 Janssen BJ Gardner RC Localized transient expression of GUS in leaf discs following co-cultivation with Agrobacterium. Plant Mol Biol 14 1989 61 72 Google Scholar Crossref Search ADS WorldCat 20 Jefferson RA Kavanagh TA Bevan MW GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6 1987 3901 3907 Google Scholar Crossref Search ADS PubMed WorldCat 21 Marshall JS Stubbs JD Chitty JA Surin B Taylor WC Expression of the C4 Me1 gene from Flaveria bidentis requires an interaction between 5′ and 3′ sequences. Plant Cell 9 1997 1515 1525 Google Scholar Crossref Search ADS PubMed WorldCat 22 Marshall JS Stubbs JD Taylor WC Two genes encode highly similar chloroplastic NADP-malic enzymes in Flaveria. Plant Physiol 111 1996 1251 1261 Google Scholar Crossref Search ADS PubMed WorldCat 23 Matsuoka M Structure, genetic mapping, and expression of the gene for pyruvate, orthophosphate dikinase from maize. J Biol Chem 265 1990 16772 16777 Google Scholar Crossref Search ADS PubMed WorldCat 24 Matsuoka M The gene for pyruvate, orthophosphate dikinase in C4 plants—structure, regulation and evolution. Plant Cell Physiol 36 1995 937 943 Google Scholar Crossref Search ADS PubMed WorldCat 25 Matsuoka M Numazawa T Cis-acting elements in the pyruvate, orthophosphate dikinase gene in maize. Mol Gen Genet 228 1991 143 152 Google Scholar Crossref Search ADS PubMed WorldCat 26 Matsuoka M Ozeki Y Yamamoto N Hirano H Kano-Murakami Y Tanaka Y Primary structure of maize pyruvate, orthophosphate dikinase as deduced from cDNA sequence. J Biol Chem 263 1988 11080 11083 Google Scholar Crossref Search ADS PubMed WorldCat 27 Matsuoka M Tada Y Fujimura T Kano-Murakami Y Tissue-specific light-regulated expression directed by the promoter of a C4 gene, maize pyruvate, orthophosphate dikinase, in a C3 plant, rice. Proc Natl Acad Sci USA 90 1993 9586 9590 Google Scholar Crossref Search ADS PubMed WorldCat 28 Meyer AO Kelly GJ Latzko E Pyruvate orthophosphate dikinase from the immature grains of cereal grasses. Plant Physiol 69 1982 7 10 Google Scholar Crossref Search ADS PubMed WorldCat 29 Moore PD Evolution of photosynthetic pathways in flowering plants. Nature 295 1982 647 648 Google Scholar Crossref Search ADS WorldCat 30 Pocalyko DJ Carroll LJ Martin BM Babbitt PC Cunaway-Mariano D Analysis of sequence homologies in plant and bacterial pyruvate phosphate dikinase, enzyme I of the bacterial phosphoenolpyruvate:sugar phosphotransferase system and other PEP-utilizing enzymes. Identification of potential catalytic and regulatory motifs. Biochemistry 29 1990 10757 10765 Google Scholar Crossref Search ADS PubMed WorldCat 31 Powell AM Systematics of Flaveria (Flaveriinae-Asteraceae). Ann Mo Bot Gard 65 1978 590 636 Google Scholar Crossref Search ADS WorldCat 32 Ramsperger VC Summers RG Berry JO Photosynthetic gene expression in meristems and during initial leaf development in a C4 dicotyledonous plant. Plant Physiol 111 1996 999 1010 Google Scholar Crossref Search ADS PubMed WorldCat 33 Robinson-Beers K Evert RF Ultrastructure of and plasmodesmatal frequency in mature leaves of sugarcane. Planta 184 1991 291 306 Google Scholar PubMed OpenURL Placeholder Text WorldCat 34 Rosche E Streubel M Westhoff P Primary structure of the photosynthetic pyruvate orthophosphate dikinase of the C3 plant Flaveria pringlei and expression analysis of pyruvate orthophosphate dikinase sequences in C3, C3-C4 and C4 Flaveria species. Plant Mol Biol 26 1994 763 769 Google Scholar Crossref Search ADS PubMed WorldCat 35 Rosche E Westhoff P Primary structure of pyruvate, orthophosphate dikinase in the dicotyledonous C4 plant Flaveria trinervia. FEBS Lett 273 1990 116 121 Google Scholar Crossref Search ADS PubMed WorldCat 36 Rosche E Westhoff P Genomic structure and expression of the pyruvate, orthophosphate dikinase gene of the dicotyledonous C4 plant Flaveria trinervia (Asteraceae). Plant Mol Biol 29 1995 663 678 Google Scholar Crossref Search ADS PubMed WorldCat 37 Sheen J Molecular mechanisms underlying the differential expression of maize pyruvate, orthophosphate dikinase genes. Plant Cell 3 1991 225 245 Google Scholar PubMed OpenURL Placeholder Text WorldCat 38 Stitt M Heldt HW Control of photosynthetic sucrose synthesis by fructose-2,6-bisphosphate. Planta 164 1985 179 188 Google Scholar Crossref Search ADS PubMed WorldCat 39 Stockhaus J Schlue U Koczor M Chitty JA Taylor WC Westhoff P The promoter of the gene encoding the C4 form of phosphoenolpyruvate carboxylase directs mesophyll specific expression in transgenic C4 Flaveria. Plant Cell 9 1997 479 489 Google Scholar Crossref Search ADS PubMed WorldCat 40 Viret J-F Mabrouk Y Bogorad L Transcriptional photo-regulation of cell-type-preferred expression of maize rbcS-m3: 3′ and 5′ sequences are involved. Proc Natl Acad Sci USA 91 1994 8577 8581 Google Scholar Crossref Search ADS PubMed WorldCat Author notes 1 The isolation of the Pdk promoter was done in Düsseldorf, Germany, and was supported by a grant from the Deutsche Forschungsgemeinschaft via Sonderforschungsbereicht 189. E.R. was supported by a postdoctoral fellowship from the Deutsche Forschungsgemeinschaft. 2 Present address: Department of Biological Sciences, University of Newcastle, Newcastle NSW 2308, Australia. * Corresponding author; e-mail [email protected]; fax 61–2–6246–5000. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Sheveleva, Elena V.; Marquez, Sheila; Chmara, Wendy; Zegeer, Abreeza; Jensen, Richard G.; Bohnert, Hans J.

doi: 10.1104/pp.117.3.831pmid: 9662525

Abstract We analyzed transgenic tobacco (Nicotiana tabacum L.) expressing Stpd1, a cDNA encoding sorbitol-6-phosphate dehydrogenase from apple, under the control of a cauliflower mosaic virus 35S promoter. In 125 independent transformants variable amounts of sorbitol ranging from 0.2 to 130 μmol g−1 fresh weight were found. Plants that accumulated up to 2 to 3 μmol g−1 fresh weight sorbitol were phenotypically normal, with successively slower growth as sorbitol amounts increased. Plants accumulating sorbitol at 3 to 5 μmol g−1 fresh weight occasionally showed regions in which chlorophyll was partially lost, but at higher sorbitol amounts young leaves of all plants lost chlorophyll in irregular spots that developed into necrotic lesions. When sorbitol exceeded 15 to 20 μmol g−1 fresh weight, plants were infertile, and at even higher sorbitol concentrations the primary regenerants were incapable of forming roots in culture or soil. In mature plants sorbitol amounts varied with age, leaf position, and growth conditions. The appearance of lesions was correlated with high sorbitol, glucose, fructose, and starch, and low myo-inositol. Supplementingmyo-inositol in seedlings and young plants prevented lesion formation. Hyperaccumulation of sorbitol, which interferes with inositol biosynthesis, seems to lead to osmotic imbalance, possibly acting as a signal affecting carbohydrate allocation and transport. Under water-stress conditions plants in many families accumulate metabolites that are thought to provide osmotic adjustment, i.e. their presence leads to water retention under water-limiting conditions (LeRudulier and Bouillard, 1983). Another view assumes that the accumulating metabolites might have specific protective functions, e.g. in the protection of membranes or protein complexes, in enzyme stabilization, or in radical scavenging (Smirnoff and Cumbes, 1989;Galinski, 1993; Smirnoff, 1993; Asada, 1994; Papageorgiou and Murata, 1995). These concepts, originally based on correlative evidence and in vitro studies, can now be tested in transgenic plants. The engineered expression of mannitol, ononitol, fructans, Pro, Gly betaine, and trehalose has been reported mostly in transgenic tobacco (Nicotiana tabacum) (Tarczynski et al., 1993; Kishor et al., 1995; Nomura et al., 1995; Pilon-Smits et al., 1995; Holmström et al., 1996; Hayashi et al., 1997). In all cases accumulation of the metabolite had some effect, often monitored as marginal protection of plant performance under water- or salt-stress conditions, but it is unknown by which mechanism(s) the accumulating metabolites function. Considering that many engineered metabolites accumulate to low, osmotically irrelevant amounts, we wanted to explore the effect of an extremely high accumulation of an osmolyte. We studied the consequences of mannitol and ononitol production on plant performance under salt-stress conditions (Tarczynski et al., 1993; Vernon et al., 1993; Shen et al., 1997a; Sheveleva et al., 1997). Transgenic tobacco plants containing mannitol in chloroplasts (1–8 μmol g−1 fresh weight) are phenotypically normal and exhibit rates of photosynthesis identical to those of the wild type (Shen et al., 1997a), but growth seems to decrease as mannitol increases (Karakas et al., 1997). Ononitol-accumulating (up to 10 μmol g−1 fresh weight) plants also display a normal phenotype (Vernon et al., 1993; Sheveleva et al., 1997). When these plants are exposed to drought stress and high salinity, they accumulate even higher amounts of ononitol (up to 35 μmol g−1 fresh weight) as a result of a stress-induced increase of myo-inositol, which then serves as the substrate for additional ononitol production (Sheveleva et al., 1997). Growth of the plants is normal during this stress-inducible accumulation. In this analysis of polyol production we report on the performance of tobacco after the expression of Stpd1, a cDNA encoding sorbitol-6-phosphate dehydrogenase from apple (Kanayama et al., 1992). After analyzing a large number of primary transformants we detected sorbitol accumulation ranging from 0.2 to approximately 130 μmol g−1 fresh weight. Even under the assumption that sorbitol might be at least in part partitioned to the vacuole, the high amounts would be osmotically significant. Within this range, we monitored plant performance under optimal growth conditions and during salt-stress treatment. The results indicated that high amounts of sorbitol reduced growth and led to symptoms similar to those that have been reported for plants expressing extracellular invertase (von Schaewen et al., 1990). However, the symptoms produced by invertase expression, patchiness of photosynthesis, loss of chlorophyll, and necroses, predominantly affected mature source leaves, whereas the symptoms observed with the high sorbitol producers already appeared in immature leaves. Although different foreign polyols might have different effects in transgenic plants, one interpretation is that generating high amounts of osmolytes is not necessarily the best strategy for osmotic stress protection in an organism that is not adapted for the metabolite that accumulates. In another hypothesis, and possibly specific to sorbitol accumulation, the adverse effect of sorbitol could be caused by a disturbance of the Glc-6-P pool by sorbitol-6-phosphate dehydrogenase, which might then affect either UDP-Glc or Glc amounts, leading to altered sugar sensing in the plants. MATERIALS AND METHODS Plant Transformation A plasmid was used containing a cDNA encoding sorbitol-6-phosphate dehydrogenase (Stpd1) from apple (Kanayama et al., 1992). The coding region of Stpd1 was ligated into pBIN19, which contained a CaMV 35S promoter/enhancer fragment (Fig.1). The recombinant plasmid pBIN18/Stl was introduced into Agrobacterium tumefaciens cv LB4404. Tobacco (Nicotiana tabacum cv SR1) leaf disc transformation was carried out as described previously (Tarczynski et al., 1992). Green shoots emerging from leaf discs on agar plates containing 100 μg mL−1 kanamycin were regenerated into plants. More than 120 primary transformants (T0) were analyzed for the presence and amount of sorbitol. Plantlets were transferred to soil. After 14 d of growth, leaf discs were taken for sugar and polyol extraction and analyzed by HPLC (see below). Most experiments were carried out with the segregating T2 generation of tobacco line S5C, which produced amounts of sorbitol ranging from 0.2 to 48 μmol g−1 fresh weight, depending on the individual plant, leaf position, and growth conditions. Fig. 1. Open in new tabDownload slide Schematic presentation of the gene construction leading to the expression of sorbitol-6-phosphate dehydrogenase (S6PDH) in transgenic tobacco. The gene cassette was subcloned into pBIN19 and introduced into plants by A. tumefaciens-based transformation. Fig. 1. Open in new tabDownload slide Schematic presentation of the gene construction leading to the expression of sorbitol-6-phosphate dehydrogenase (S6PDH) in transgenic tobacco. The gene cassette was subcloned into pBIN19 and introduced into plants by A. tumefaciens-based transformation. Plant Growth Seeds of wild-type tobacco (SR1) and the sorbitol-containing line (S5C) were germinated and grown in vermiculite for approximately 3 weeks and then transferred to hydroponic solution. Two hydroponic plant-growth systems were constructed, consisting of six tubs with 10 plants per tub. Three tubs were fed from a reservoir with a total volume of 230 L of nutrient solution. The nutrient solution was exchanged once per hour using submersible pumps (model 1P914B, TEEL, Dayton Electric Co., Chicago, IL). The plants were irrigated in one-fourth-strength Hoagland solution in a greenhouse with a light intensity during midday of approximately 1600 μmol quanta m−2 s−1, RH of approximately 60%, and a temperature of 28 ± 3°C. The nutrient content was analyzed by ion-exchange chromatography once a week and depleted elements were added. Six-week-old plants were salt stressed (see the figure legends), whereas salt was not added to control plants. Other experiments were conducted in a growth room in soil composed of potting mix:vermiculite:sand (3:2:1). Photon flux density (400–700 nm) was maintained at 400 μmol m−2s−1 with a day/night cycle of 12/12 h, RH < 20%, and temperatures of 27°C during the light period and 23°C during the dark period. Sugar, Polyol, Pro, and Starch Analysis Two hours into the light period leaves were collected, frozen in liquid N2, extracted for carbohydrates and Pro, and analyzed by HPLC separation using pulsed-amperometric detection (Adams et al., 1992, 1993). To determine starch, ethanol-insoluble residues after sugar analysis were washed in 70% ethanol and then solubilized in 20 mm NaOH for 1 h at 70°C. The pH was adjusted to 4.6 and the solution was digested with α-amylase and amyloglucosidase overnight (Sonnewald et al., 1991). After centrifugation the released Glc was determined by HPLC (Adams et al., 1993). Gas-Exchange Measurements Net CO2-assimilation rates in air were measured in attached leaves in the greenhouse under saturating light conditions using an IR gas analyzer (Li-6400, Li-Cor, Lincoln, NE). Leaf temperature was maintained at 28°C with CO2 at 360 ppm. Growth on Artificial Medium Surface-sterilized seeds of SR1 or S5C were grown in agar in sterile culture in 1× Murashige and Skoog medium containing Gamborg's B5 vitamins including thiamine hydrochloride, pyridoxine hydrochloride, and nicotinic acid (Murashige and Skoog, 1962). myo-Inositol was omitted from the basal medium. C was supplied by adding either Suc and Glc (8.8 and 38.8 mm, respectively) ormyo-inositol (1 mm). Controls included Suc, Glc, and myo-inositol or no additions to the basal medium. The temperature was maintained at 25°C at a light intensity of 100 μmol m−2 s−1. RESULTS Correlation between Amount of Sorbitol and Lesion Formation The apple Stpd1, encoding sorbitol-6-phosphate dehydrogenase under the control of an enhanced CaMV 35S promoter, was transferred into SR1. In addition to the Stpd1-coding region, the gene construct included 35 nucleotides of the 5′ untranslated region of the cDNA and approximately 200 nucleotides of the 3′ end downstream of the stop codon, which was fused to an additional polyadenylation segment (Fig. 1). Stpd1expression led to sorbitol accumulation, whereas sorbitol was not detectable in the SR1 progenitor line. Analysis of 125 independent transformants showed a wide variation of sorbitol concentration in plants of the T0 generation grown in tissue culture (Table I). In addition to sorbitol amounts the table lists the degree of lesion formation in plants at the three-leaf stage grown in soil. The sorbitol-producing transgenic plants differed from mannitol-producing plants reported previously (Tarczynski et al., 1992; Shen et al., 1997a) in that many lines contained considerably higher levels of sorbitol (up to 130 μmol g−1 fresh weight) than the mannitol producers (up to 8 μmol g−1 fresh weight). Table I. Sorbitol amounts in a selection of independent transformants of tobacco SR1 (T0 generation) Line . Sorbitol . Plant Habitus . μmol g−1 fresh wt SS106 0.35 No lesions SS110 2.5 No lesions SS32 2.6 No lesions SS38 3 No lesions SS105b 3.2 Lesions SS37 3.6 No lesions SS105a 3.9 No lesions SS59 4.6 No lesions SS86 5.0 Lesions SS81 8.7 Lesions SS97 10.1 Lesions, stunted growth SS108b 17.5 Lesions, stunted, infertile SS108a 23.8 Lesions, stunted, infertile SS91 27.8 Lesions, stunted, infertile SS104 52.0 Lesions, no root growth, death SS41 60.9 Lesions, no root growth, death SS19 130.0 Lesions, no root growth, death Line . Sorbitol . Plant Habitus . μmol g−1 fresh wt SS106 0.35 No lesions SS110 2.5 No lesions SS32 2.6 No lesions SS38 3 No lesions SS105b 3.2 Lesions SS37 3.6 No lesions SS105a 3.9 No lesions SS59 4.6 No lesions SS86 5.0 Lesions SS81 8.7 Lesions SS97 10.1 Lesions, stunted growth SS108b 17.5 Lesions, stunted, infertile SS108a 23.8 Lesions, stunted, infertile SS91 27.8 Lesions, stunted, infertile SS104 52.0 Lesions, no root growth, death SS41 60.9 Lesions, no root growth, death SS19 130.0 Lesions, no root growth, death Plantlets (T0) were transferred from agar to soil and kept in a growth room (450 μmol quanta m−2 s−1). After 10 d the first leaf, which had completely unfolded from the meristem, was sampled. No sorbitol could be detected in SR1 plants at any developmental stage. Transformants with sorbitol levels higher than approximately 30 μmol g−1 fresh weight never developed into mature plants. The letters a and b denote individual transformed plants that originated from the same callus. Open in new tab Table I. Sorbitol amounts in a selection of independent transformants of tobacco SR1 (T0 generation) Line . Sorbitol . Plant Habitus . μmol g−1 fresh wt SS106 0.35 No lesions SS110 2.5 No lesions SS32 2.6 No lesions SS38 3 No lesions SS105b 3.2 Lesions SS37 3.6 No lesions SS105a 3.9 No lesions SS59 4.6 No lesions SS86 5.0 Lesions SS81 8.7 Lesions SS97 10.1 Lesions, stunted growth SS108b 17.5 Lesions, stunted, infertile SS108a 23.8 Lesions, stunted, infertile SS91 27.8 Lesions, stunted, infertile SS104 52.0 Lesions, no root growth, death SS41 60.9 Lesions, no root growth, death SS19 130.0 Lesions, no root growth, death Line . Sorbitol . Plant Habitus . μmol g−1 fresh wt SS106 0.35 No lesions SS110 2.5 No lesions SS32 2.6 No lesions SS38 3 No lesions SS105b 3.2 Lesions SS37 3.6 No lesions SS105a 3.9 No lesions SS59 4.6 No lesions SS86 5.0 Lesions SS81 8.7 Lesions SS97 10.1 Lesions, stunted growth SS108b 17.5 Lesions, stunted, infertile SS108a 23.8 Lesions, stunted, infertile SS91 27.8 Lesions, stunted, infertile SS104 52.0 Lesions, no root growth, death SS41 60.9 Lesions, no root growth, death SS19 130.0 Lesions, no root growth, death Plantlets (T0) were transferred from agar to soil and kept in a growth room (450 μmol quanta m−2 s−1). After 10 d the first leaf, which had completely unfolded from the meristem, was sampled. No sorbitol could be detected in SR1 plants at any developmental stage. Transformants with sorbitol levels higher than approximately 30 μmol g−1 fresh weight never developed into mature plants. The letters a and b denote individual transformed plants that originated from the same callus. Open in new tab When transferred to soil, plantlets producing the highest amount of sorbitol failed to develop roots and died. Those with lower concentrations of sorbitol (5–50 μmol g−1fresh weight) developed necrotic lesions in their leaves and the leaves remained small (Fig. 2). Plants with sorbitol concentrations less than approximately 2 μmol g−1 fresh weight had normal growth patterns, whereas plants with more than approximately 3 μmol g−1 fresh weight sorbitol showed stunted growth. Lesion formation in immature leaves was also correlated with the sorbitol concentration. Plants containing less than 3 μmol sorbitol g−1 fresh weight showed no lesions, and occasional lesions occurred in plants accumulating sorbitol at 3 to 7 μmol g−1 fresh weight. The number of lesions and the size of the affected areas increased as sorbitol increased (Table I). Fig. 2. Open in new tabDownload slide Phenotype of S5C plant and examples of leaves with necrotic lesions. The top panel shows the habitus of a 10-week-old plant typical of plants with a sorbitol concentration of more than approximately 15 μmol g−1 fresh weight. The bottom panel shows mature leaves typical of plants that accumulated sorbitol to 5 to 10 μmol g−1 fresh weight in their young, expanding leaves. Fig. 2. Open in new tabDownload slide Phenotype of S5C plant and examples of leaves with necrotic lesions. The top panel shows the habitus of a 10-week-old plant typical of plants with a sorbitol concentration of more than approximately 15 μmol g−1 fresh weight. The bottom panel shows mature leaves typical of plants that accumulated sorbitol to 5 to 10 μmol g−1 fresh weight in their young, expanding leaves. Plants from the segregating T2 generation of S5C were used in further analyses after selection for kanamycin resistance and screening for sorbitol amounts. The higher the sorbitol concentration, the more numerous the lesions and the larger the areas of necrotic tissue (Fig. 2; Table II). The appearance of lesions depended on sorbitol amount when the leaves were young. Initially, affected tissue patches lost chlorophyll, yellowed, and later became necrotic. After the leaves became fully expanded, no new lesions formed, necrotic areas expanded slightly, and, because of inequal expansion in the presence of necrotic spots, the leaves became distorted (Fig. 2). In older leaves sorbitol amounts always declined, which we interpret as a consequence of altered CaMV 35S promoter activity. The examples provided in Table II represent typical behavior. Plants with high amounts of sorbitol contained the highest polyol concentrations in leaf number 2 and sorbitol amounts declined from leaf number 3 on. Leaves of one of these plants, at 10% to 20% of the area of a mature leaf, might show lesions or yellowing in patches in a prelesion stage. In plants accumulating intermediate or low sorbitol amounts (e.g. plant no. 4, Table II), the two youngest leaves showed the highest amount of sorbitol, although lesions never formed at a comparable frequency compared with plants with higher sorbitol concentrations, and sorbitol declined gradually in the older leaves. Table II. Amounts of sorbitol in the leaves of S5C tobacco transformants . Sorbitol . Leaf No. . Plant no. 1 . Plant no. 2 . Plant no. 3 . Plant no. 4 . μmol g−1 fresh wt 1 9.4 16.5+ 10.0 4.4 2 33.7+ 20.6+ 12.2 3.6 3 27.8+ 14.8+ 8.2 1.5 4 1.3 6.0+ 7.3+ 1.5 5 7.4+ 3.2+ 3.1+ 1.0 . Sorbitol . Leaf No. . Plant no. 1 . Plant no. 2 . Plant no. 3 . Plant no. 4 . μmol g−1 fresh wt 1 9.4 16.5+ 10.0 4.4 2 33.7+ 20.6+ 12.2 3.6 3 27.8+ 14.8+ 8.2 1.5 4 1.3 6.0+ 7.3+ 1.5 5 7.4+ 3.2+ 3.1+ 1.0 Lesion formation is indicated by +. Leaves were numbered beginning at the top of the plant, counting as leaf number 1 a leaf with an area equivalent to approximately 10 to 20% of the leaf area of the first fully developed leaf (leaf no. 5). The plants used were 10 weeks old. Data from a single experiment are shown, because the absolute values in different experiments varied, although the same relative differences were seen in all experiments (n > 5). Open in new tab Table II. Amounts of sorbitol in the leaves of S5C tobacco transformants . Sorbitol . Leaf No. . Plant no. 1 . Plant no. 2 . Plant no. 3 . Plant no. 4 . μmol g−1 fresh wt 1 9.4 16.5+ 10.0 4.4 2 33.7+ 20.6+ 12.2 3.6 3 27.8+ 14.8+ 8.2 1.5 4 1.3 6.0+ 7.3+ 1.5 5 7.4+ 3.2+ 3.1+ 1.0 . Sorbitol . Leaf No. . Plant no. 1 . Plant no. 2 . Plant no. 3 . Plant no. 4 . μmol g−1 fresh wt 1 9.4 16.5+ 10.0 4.4 2 33.7+ 20.6+ 12.2 3.6 3 27.8+ 14.8+ 8.2 1.5 4 1.3 6.0+ 7.3+ 1.5 5 7.4+ 3.2+ 3.1+ 1.0 Lesion formation is indicated by +. Leaves were numbered beginning at the top of the plant, counting as leaf number 1 a leaf with an area equivalent to approximately 10 to 20% of the leaf area of the first fully developed leaf (leaf no. 5). The plants used were 10 weeks old. Data from a single experiment are shown, because the absolute values in different experiments varied, although the same relative differences were seen in all experiments (n > 5). Open in new tab Table III compares carbohydrates in different leaves of SR1 and S5C plants. The amount of sorbitol in S5C exceeded the amounts of Glc, Fru, and Suc. In all S5C plants sorbitol was highest in the apical leaf. myo-Inositol was lower in the youngest leaves of S5C than in comparable leaves of SR1. In leaves with the highest sorbitol amounts myo-inositol was barely detectable. Concomitant with the decrease in sorbitol as S5C leaves matured, myo-inositol increased again, but did not reach the amount found in leaf number 5 and older leaves of SR1. This behavior is different from that of SR1, in which the youngest leaves contained the highest amount of myo-inositol, which then declined as the leaves became source leaves. In leaves with high sorbitol and lowmyo-inositol (leaf numbers 1–4) the amount of starch was 2 to 3 times higher in sorbitol-containing plants compared with wild type. The amounts of Glc and Fru for the whole leaf showed no correlation with leaf number, and no significant differences existed between SR1 and S5C plants. Suc amounts, however, were lower in sorbitol-containing plants yet still maintained diurnal fluctuation (data not shown). The ratio of starch to Suc in S5C was higher than that in SR1 by a factor of 7 to 5 in leaf numbers 1 to 4, which contained the highest amounts of sorbitol. Table III. Nonstructural carbohydrates in leaves of SR1 and S5C plants Leaf No. . Carbohydrate . Sorbitol . Inositol . Starch2-a . Glc . Fru . Suc . Starch/Suc . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . μmol g−1 fresh wt 1 0 30.9 7.8 0.02 9.6 20.0 4.3 5.9 3.6 3.6 4.6 1.4 2.1 14.2 2 0 22.9 8.1 0.02 8.0 29.8 4.2 3.8 3.3 3.1 3.4 2.3 2.4 12.8 3 0 13.6 6.1 0.02 9.1 29.1 2.3 1.4 1.8 1.5 3.1 1.7 2.9 16.8 4 0 14.4 4.9 0.04 7.4 22.4 3.3 2.4 3.1 2.4 3.7 2.2 2.0 10.2 5 0 7.4 3.6 0.80 15.2 16.7 4.3 2.7 4.4 2.4 2.8 2.8 5.5 6.0 Leaf No. . Carbohydrate . Sorbitol . Inositol . Starch2-a . Glc . Fru . Suc . Starch/Suc . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . μmol g−1 fresh wt 1 0 30.9 7.8 0.02 9.6 20.0 4.3 5.9 3.6 3.6 4.6 1.4 2.1 14.2 2 0 22.9 8.1 0.02 8.0 29.8 4.2 3.8 3.3 3.1 3.4 2.3 2.4 12.8 3 0 13.6 6.1 0.02 9.1 29.1 2.3 1.4 1.8 1.5 3.1 1.7 2.9 16.8 4 0 14.4 4.9 0.04 7.4 22.4 3.3 2.4 3.1 2.4 3.7 2.2 2.0 10.2 5 0 7.4 3.6 0.80 15.2 16.7 4.3 2.7 4.4 2.4 2.8 2.8 5.5 6.0 Plants were grown in a growth room in soil for 10 weeks. Control plants were of the same developmental stage and were selected to be approximately the same height. Sorbitol plants had small lesions on all leaves except on the first immature leaf. The data shown are from one S5C and one SR1 plant, representing the behavior of all plants. The experiment was repeated three times. The results were comparable in trend, but the absolute values varied between experiments. Leaves were counted beginning at the meristem. Plants had 9 to 10 leaves; leaf no. 5 was the first fully expanded leaf. F2-a Starch is given as micromoles of Glc equivalents per gram fresh weight. Open in new tab Table III. Nonstructural carbohydrates in leaves of SR1 and S5C plants Leaf No. . Carbohydrate . Sorbitol . Inositol . Starch2-a . Glc . Fru . Suc . Starch/Suc . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . μmol g−1 fresh wt 1 0 30.9 7.8 0.02 9.6 20.0 4.3 5.9 3.6 3.6 4.6 1.4 2.1 14.2 2 0 22.9 8.1 0.02 8.0 29.8 4.2 3.8 3.3 3.1 3.4 2.3 2.4 12.8 3 0 13.6 6.1 0.02 9.1 29.1 2.3 1.4 1.8 1.5 3.1 1.7 2.9 16.8 4 0 14.4 4.9 0.04 7.4 22.4 3.3 2.4 3.1 2.4 3.7 2.2 2.0 10.2 5 0 7.4 3.6 0.80 15.2 16.7 4.3 2.7 4.4 2.4 2.8 2.8 5.5 6.0 Leaf No. . Carbohydrate . Sorbitol . Inositol . Starch2-a . Glc . Fru . Suc . Starch/Suc . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . SR1 . S5C . μmol g−1 fresh wt 1 0 30.9 7.8 0.02 9.6 20.0 4.3 5.9 3.6 3.6 4.6 1.4 2.1 14.2 2 0 22.9 8.1 0.02 8.0 29.8 4.2 3.8 3.3 3.1 3.4 2.3 2.4 12.8 3 0 13.6 6.1 0.02 9.1 29.1 2.3 1.4 1.8 1.5 3.1 1.7 2.9 16.8 4 0 14.4 4.9 0.04 7.4 22.4 3.3 2.4 3.1 2.4 3.7 2.2 2.0 10.2 5 0 7.4 3.6 0.80 15.2 16.7 4.3 2.7 4.4 2.4 2.8 2.8 5.5 6.0 Plants were grown in a growth room in soil for 10 weeks. Control plants were of the same developmental stage and were selected to be approximately the same height. Sorbitol plants had small lesions on all leaves except on the first immature leaf. The data shown are from one S5C and one SR1 plant, representing the behavior of all plants. The experiment was repeated three times. The results were comparable in trend, but the absolute values varied between experiments. Leaves were counted beginning at the meristem. Plants had 9 to 10 leaves; leaf no. 5 was the first fully expanded leaf. F2-a Starch is given as micromoles of Glc equivalents per gram fresh weight. Open in new tab During the entire lifetime of the S5C plants the amounts of the reducing sugars Suc and myo-inositol approached those found in SR1, as the amount of sorbitol gradually decreased in mature leaves (data not shown). Therefore, the plants were able to outgrow the seemingly detrimental effect of sorbitol accumulation in immature leaves. At the flowering stage, S5C presented the habitus of plants that had survived, recognizable by the necrotic lesions, viral or fungal infections, or severe environmental stress as immature plants. Sugar and Sorbitol Accumulation in Different Parts of One Leaf Figure 3 compares the relationships between sorbitol, myo-inositol, Glc, and Fru for young, developing leaves of S5C (6 weeks old). In whole-leaf extracts sorbitol, Glu, and Fru increased and myo-inositol decreased as the amount of sorbitol increased. When lesions formed, the carbohydrate content was highly variable across the leaf. TableIV compares the sugars and polyols for different areas, normal and discolored, of the same young, developing leaf. Data from a single leaf are shown. Areas in which chlorophyll was reduced tended to accumulate sorbitol, starch, Glc, and Fru, and had low amounts of myo-inositol. There was no difference between the normal and discolored spots in the amount of Suc. Although the average amount of Glc and Fru per leaf showed no consistent differences between leaves of SR1 and S5C plants, areas with discoloration showed slightly increased Fru and Glc compared with areas with a normal appearance. Fig. 3. Open in new tabDownload slide Relationship between myo-inositol, Glc, Fru, and sorbitol amounts in S5C plants. Plants were grown for 10 weeks in a growth room (see Methods). The plant material was collected 2 h after the beginning of illumination. The same relationship was found when starch content and sorbitol amounts were compared. gfw, Grams fresh weight. Fig. 3. Open in new tabDownload slide Relationship between myo-inositol, Glc, Fru, and sorbitol amounts in S5C plants. Plants were grown for 10 weeks in a growth room (see Methods). The plant material was collected 2 h after the beginning of illumination. The same relationship was found when starch content and sorbitol amounts were compared. gfw, Grams fresh weight. Table IV. Nonstructural carbohydrates in normal and discolored parts of S5C leaves Plant No. . Carbohydrate . Sorbitol . myo-Inositol . Starch . Glc . Fru . N . D . N . D . N . D . N . D . N . D . μmol g−1 fresh wt 1 22.9 26.3 0.108 0.122 28.77 41.81 2.71 3.57 1.50 2.27 2 18.71 20.56 0.068 0.022 23.77 48.61 1.42 4.34 1.15 2.55 3 16.17 20.20 0.103 0.056 16.69 20.26 1.53 2.92 1.20 2.08 4 12.47 33.67 0.19 0.03 13.48 38.44 2.88 6.60 1.95 7.33 5 10.32 27.72 0.091 0.043 4.28 16.43 0.86 1.84 0.60 1.83 6 8.21 27.76 0.23 0.025 6.98 14.84 1.46 3.98 1.34 4.40 7 6.17 14.8 0.40 0.072 35.3 32.5 2.37 3.5 1.79 3.54 8 2.97 19.83 0.56 0.086 3.64 16.48 0.97 3.09 0.11 4.01 Plant No. . Carbohydrate . Sorbitol . myo-Inositol . Starch . Glc . Fru . N . D . N . D . N . D . N . D . N . D . μmol g−1 fresh wt 1 22.9 26.3 0.108 0.122 28.77 41.81 2.71 3.57 1.50 2.27 2 18.71 20.56 0.068 0.022 23.77 48.61 1.42 4.34 1.15 2.55 3 16.17 20.20 0.103 0.056 16.69 20.26 1.53 2.92 1.20 2.08 4 12.47 33.67 0.19 0.03 13.48 38.44 2.88 6.60 1.95 7.33 5 10.32 27.72 0.091 0.043 4.28 16.43 0.86 1.84 0.60 1.83 6 8.21 27.76 0.23 0.025 6.98 14.84 1.46 3.98 1.34 4.40 7 6.17 14.8 0.40 0.072 35.3 32.5 2.37 3.5 1.79 3.54 8 2.97 19.83 0.56 0.086 3.64 16.48 0.97 3.09 0.11 4.01 S5C plants were grown in a growth room in soil for 8 weeks. Leaf punches were taken from areas of young leaves that showed normal green color (N), or from the same leaf from partially discolored areas (D), which later developed into lesions. Data from a single expeirment are shown, because the absolute values varied in different experiments. Suc is not shown, because there were no significant differences. Open in new tab Table IV. Nonstructural carbohydrates in normal and discolored parts of S5C leaves Plant No. . Carbohydrate . Sorbitol . myo-Inositol . Starch . Glc . Fru . N . D . N . D . N . D . N . D . N . D . μmol g−1 fresh wt 1 22.9 26.3 0.108 0.122 28.77 41.81 2.71 3.57 1.50 2.27 2 18.71 20.56 0.068 0.022 23.77 48.61 1.42 4.34 1.15 2.55 3 16.17 20.20 0.103 0.056 16.69 20.26 1.53 2.92 1.20 2.08 4 12.47 33.67 0.19 0.03 13.48 38.44 2.88 6.60 1.95 7.33 5 10.32 27.72 0.091 0.043 4.28 16.43 0.86 1.84 0.60 1.83 6 8.21 27.76 0.23 0.025 6.98 14.84 1.46 3.98 1.34 4.40 7 6.17 14.8 0.40 0.072 35.3 32.5 2.37 3.5 1.79 3.54 8 2.97 19.83 0.56 0.086 3.64 16.48 0.97 3.09 0.11 4.01 Plant No. . Carbohydrate . Sorbitol . myo-Inositol . Starch . Glc . Fru . N . D . N . D . N . D . N . D . N . D . μmol g−1 fresh wt 1 22.9 26.3 0.108 0.122 28.77 41.81 2.71 3.57 1.50 2.27 2 18.71 20.56 0.068 0.022 23.77 48.61 1.42 4.34 1.15 2.55 3 16.17 20.20 0.103 0.056 16.69 20.26 1.53 2.92 1.20 2.08 4 12.47 33.67 0.19 0.03 13.48 38.44 2.88 6.60 1.95 7.33 5 10.32 27.72 0.091 0.043 4.28 16.43 0.86 1.84 0.60 1.83 6 8.21 27.76 0.23 0.025 6.98 14.84 1.46 3.98 1.34 4.40 7 6.17 14.8 0.40 0.072 35.3 32.5 2.37 3.5 1.79 3.54 8 2.97 19.83 0.56 0.086 3.64 16.48 0.97 3.09 0.11 4.01 S5C plants were grown in a growth room in soil for 8 weeks. Leaf punches were taken from areas of young leaves that showed normal green color (N), or from the same leaf from partially discolored areas (D), which later developed into lesions. Data from a single expeirment are shown, because the absolute values varied in different experiments. Suc is not shown, because there were no significant differences. Open in new tab myo-Inositol and Lesion Formation To further examine the correlation between lowmyo-inositol, high sorbitol, and lesion formation, surface-sterilized seeds of SR1 and S5C were germinated in MS medium supplemented with different C sources, Suc, Glc, andmyo-inositol (Fig. 4). S5C seedlings in this generation still showed segregation (Fig. 4C). SR1 plants grew well irrespective of the additions, with slightly enhanced growth and higher chlorophyll content in the leaves in medium containing both sugars and myo-inositol. In the absence of sugars and myo-inositol, S5C seedlings formed lesions and grew extremely slowly. Growth of S5C was stimulated and few or no lesions formed when the medium was supplemented withmyo-inositol either with or without sugars. When only Suc and Glc were provided, growth was stimulated, but lesions still developed on the cotyledons. Six to nine seedlings each from SR1 and S5C were combined for assays of carbohydrates. Sorbitol was high in the absence of any additions (and myo-inositol was then low) and lowest when myo-inositol was supplied to the S5C seedlings (Table V). Fig. 4. Open in new tabDownload slide Seedling growth supplemented withmyo-inositol. Seedlings of SR1 (A and B) and S5C (C and D) plants were grown in Murashige and Skoog medium with (B and D) and without myo-inositol (A and C). Fig. 4. Open in new tabDownload slide Seedling growth supplemented withmyo-inositol. Seedlings of SR1 (A and B) and S5C (C and D) plants were grown in Murashige and Skoog medium with (B and D) and without myo-inositol (A and C). Table V. Amounts of sugars, myo-inositol, and sorbitol in SR1 and S5C plants grown in sterile culture on different media Plant/Growth Conditions . Carbohydrate . Sorbitol . Inositol . Glc . Fru . Suc . μmol g−1 fresh wt SR1  Suc, Glc,myo-inositol n.d.4-a 1.08  ± 0.51 3.88  ± 2.91 4.02  ± 3.2 1.76  ± 0.47  Suc, Glc n.d. 0.50  ± 0.07 0.63  ± 0.24 0.43  ± 0.24 1.11  ± 0.05  myo-Inositol n.d. 0.77  ± 0.08 1.72  ± 0.83 1.20  ± 0.16 1.29  ± 0.08  No addition n.d. 0.23  ± 0.02 0.44  ± 0.08 0.42  ± 0.27 1.05  ± 0.14 S5C  Suc, Glc,myo-inositol 0.64  ± 0.30 0.63  ± 0.09 2.19  ± 0.69 1.08  ± 0.60 1.25  ± 0.07  Suc, Glc 0.41  ± 0.11 0.19  ± 0.05 0.72  ± 0.03 0.57  ± 0.10 1.11  ± 0.03  myo-Inositol 0.19  ± 0.05 0.43  ± 0.17 0.36  ± 0.03 0.34  ± 0.08 0.79  ± 0.13  No addition 0.89  ± 0.69 0.09  ± 0.01 1.89  ± 0.75 1.80  ± 0.42 0.41  ± 0.02 Plant/Growth Conditions . Carbohydrate . Sorbitol . Inositol . Glc . Fru . Suc . μmol g−1 fresh wt SR1  Suc, Glc,myo-inositol n.d.4-a 1.08  ± 0.51 3.88  ± 2.91 4.02  ± 3.2 1.76  ± 0.47  Suc, Glc n.d. 0.50  ± 0.07 0.63  ± 0.24 0.43  ± 0.24 1.11  ± 0.05  myo-Inositol n.d. 0.77  ± 0.08 1.72  ± 0.83 1.20  ± 0.16 1.29  ± 0.08  No addition n.d. 0.23  ± 0.02 0.44  ± 0.08 0.42  ± 0.27 1.05  ± 0.14 S5C  Suc, Glc,myo-inositol 0.64  ± 0.30 0.63  ± 0.09 2.19  ± 0.69 1.08  ± 0.60 1.25  ± 0.07  Suc, Glc 0.41  ± 0.11 0.19  ± 0.05 0.72  ± 0.03 0.57  ± 0.10 1.11  ± 0.03  myo-Inositol 0.19  ± 0.05 0.43  ± 0.17 0.36  ± 0.03 0.34  ± 0.08 0.79  ± 0.13  No addition 0.89  ± 0.69 0.09  ± 0.01 1.89  ± 0.75 1.80  ± 0.42 0.41  ± 0.02 SR1 and S5C seeds were germinated and grown in agar in sterile culture in Murashige and Skoog medium and Gamborg's B5 vitamins including thiamine hydrochloride, pyridoxine, and nicotinic acid, but withoutmyo-inositol. Suc was added at 8.8 mm, Glc at 38.8 mm, and myo-inositol at 1 mm. The plants were grown for 4 weeks under low-light conditions (100 μmol m−2 s−1). The largest leaf was taken for analysis from six to nine plantlets for each determination and the experiment was repeated twice. In each experiment the same trend was observed, although the absolute values between experiments varied. SR1 with sugars and myo-inositol added grew best; S5C without any additions grew worst and developed lesions in all leaves. S5C with only sugars added showed lesions on the cotyledons. F4-a n.d., Not detected. Open in new tab Table V. Amounts of sugars, myo-inositol, and sorbitol in SR1 and S5C plants grown in sterile culture on different media Plant/Growth Conditions . Carbohydrate . Sorbitol . Inositol . Glc . Fru . Suc . μmol g−1 fresh wt SR1  Suc, Glc,myo-inositol n.d.4-a 1.08  ± 0.51 3.88  ± 2.91 4.02  ± 3.2 1.76  ± 0.47  Suc, Glc n.d. 0.50  ± 0.07 0.63  ± 0.24 0.43  ± 0.24 1.11  ± 0.05  myo-Inositol n.d. 0.77  ± 0.08 1.72  ± 0.83 1.20  ± 0.16 1.29  ± 0.08  No addition n.d. 0.23  ± 0.02 0.44  ± 0.08 0.42  ± 0.27 1.05  ± 0.14 S5C  Suc, Glc,myo-inositol 0.64  ± 0.30 0.63  ± 0.09 2.19  ± 0.69 1.08  ± 0.60 1.25  ± 0.07  Suc, Glc 0.41  ± 0.11 0.19  ± 0.05 0.72  ± 0.03 0.57  ± 0.10 1.11  ± 0.03  myo-Inositol 0.19  ± 0.05 0.43  ± 0.17 0.36  ± 0.03 0.34  ± 0.08 0.79  ± 0.13  No addition 0.89  ± 0.69 0.09  ± 0.01 1.89  ± 0.75 1.80  ± 0.42 0.41  ± 0.02 Plant/Growth Conditions . Carbohydrate . Sorbitol . Inositol . Glc . Fru . Suc . μmol g−1 fresh wt SR1  Suc, Glc,myo-inositol n.d.4-a 1.08  ± 0.51 3.88  ± 2.91 4.02  ± 3.2 1.76  ± 0.47  Suc, Glc n.d. 0.50  ± 0.07 0.63  ± 0.24 0.43  ± 0.24 1.11  ± 0.05  myo-Inositol n.d. 0.77  ± 0.08 1.72  ± 0.83 1.20  ± 0.16 1.29  ± 0.08  No addition n.d. 0.23  ± 0.02 0.44  ± 0.08 0.42  ± 0.27 1.05  ± 0.14 S5C  Suc, Glc,myo-inositol 0.64  ± 0.30 0.63  ± 0.09 2.19  ± 0.69 1.08  ± 0.60 1.25  ± 0.07  Suc, Glc 0.41  ± 0.11 0.19  ± 0.05 0.72  ± 0.03 0.57  ± 0.10 1.11  ± 0.03  myo-Inositol 0.19  ± 0.05 0.43  ± 0.17 0.36  ± 0.03 0.34  ± 0.08 0.79  ± 0.13  No addition 0.89  ± 0.69 0.09  ± 0.01 1.89  ± 0.75 1.80  ± 0.42 0.41  ± 0.02 SR1 and S5C seeds were germinated and grown in agar in sterile culture in Murashige and Skoog medium and Gamborg's B5 vitamins including thiamine hydrochloride, pyridoxine, and nicotinic acid, but withoutmyo-inositol. Suc was added at 8.8 mm, Glc at 38.8 mm, and myo-inositol at 1 mm. The plants were grown for 4 weeks under low-light conditions (100 μmol m−2 s−1). The largest leaf was taken for analysis from six to nine plantlets for each determination and the experiment was repeated twice. In each experiment the same trend was observed, although the absolute values between experiments varied. SR1 with sugars and myo-inositol added grew best; S5C without any additions grew worst and developed lesions in all leaves. S5C with only sugars added showed lesions on the cotyledons. F4-a n.d., Not detected. Open in new tab DISCUSSION Tao et al. (1995) reported the expression of an apple sorbitol-6-phosphate dehydrogenase in tobacco. The work focused on transformants with low amounts of sorbitol (up to 0.45 μmol g−1 fresh weight) and the phenotype of these plants was identical to wild type. In repeated experiments we obtained a large number of independent transformants distinguished by the accumulation of sorbitol over a wide range, up to 130 μmol g−1 fresh weight. Changes in phenotype were correlated with sorbitol accumulation. Plants with low amounts of sorbitol (less than 2–3 μmol g−1 fresh weight) developed normally, but necrotic lesions formed with increasing frequency when sorbitol accumulated to higher amounts. Increased lesion formation was accompanied by increasing severity of compromised growth, reduced or abolished root development, and low fertility or infertility. Lesion formation in immature leaves was an unexpected outcome of experiments that sought to explore the metabolic tolerance of tobacco to high accumulation of a polyol. Our investigations of polyol accumulation in transgenic plants have mainly pertained to the protective function(s) that carbohydrate-based osmolytes might have (Tarczynski et al., 1993; Shen et al., 1997a, 1997b; Sheveleva et al., 1997). Like mannitol- or ononitol-accumulating plants (Tarzynski et al., 1993; Sheveleva et al., 1997), the sorbitol-accumulating plants tolerated both salt stress and drought better than the wild type, but this effect was difficult to monitor because of the growth retardation and influence on development that characterized high accumulation of sorbitol. Depending on sorbitol amounts in the plants, absolute photosynthesis rates of line S5C in the absence of stress could be less than 50% of those of control plants. However, rates of photosynthesis declined less in S5C than in SR1 controls when the plants were stressed by the addition of 150 mm NaCl (data not shown). Heineke et al. (1992) have suggested that an increase of osmotic pressure in the leaf sap could cause lesion formation after the accumulation of a foreign carbohydrate in the cytosol. Measurements of osmolality of the leaf sap were, however, identical in S5C and SR1 at approximately 400 mosmol kg−1. Overall osmolality, though, may not reflect the conditions in different compartments. Sorbitol probably accumulated mostly in the cytosol and may be at least partially excluded from chloroplasts, mitochondria, and the vacuole. Osmotic pressure differences between compartments could cause metabolic imbalances. The accumulation of starch in the youngest leaves of high-sorbitol-producing plants (Table III) could be the indicator of such an effect. Sorbitol in the cytosol might interfere with the export of carbohydrates from the chloroplasts, and this could be responsible for starch increases in these leaves. The correlation between sorbitol amount and the frequency of necrotic tissue could point to a causal relationship between osmotic pressure and necrosis symptoms. Compromised membrane integrity or altered carbohydrate export from plastids could lead to a decrease of photosynthesis and altered metabolism in the cytosol, setting in motion signaling events that finally lead to lesions. The formation of lesions has frequently been reported as a defense reaction to pathogen attack (Walbot et al., 1983; Hahlbrock and Scheel, 1987). Biochemical and metabolic changes after pathogen attack include the accumulation of salicylic acid, callose, and lignin, the synthesis of cell wall-bound phenolics, the biosynthesis of pathogenesis-related proteins, phytoalexin accumulation, and lipid peroxidation (Hahlbrock and Scheel, 1987; Bowles, 1990; Yalpani et al., 1993; Greenberg et al., 1994; Baillieul et al., 1995). A basis for lesion formation has been seen in the perturbation of the ubiquitin system, altered proton pumping, altered hexose concentrations, or the expression of gene VI of CaMV leading to cell death (Takahashi et al., 1989; Becker et al., 1993; Mittler et al., 1995; Herbers et al., 1996). Using probes for a tobacco catalase, Cat1 (Schultes et al., 1994), a sequenced PCR product (E. Sheveleva, unpublished data), and superoxide dismutase (Sod3, cytosolic Cu/Zn superoxide dismutase; Tsang et al., 1991) we observed increases in the transcripts of these genes in S5C (not shown) compared with wild-type tobacco, which seems to support a relationship between lesion formation and the expression of defense-related proteins in the sorbitol-producing plants. Lesions in S5C plants under our growth conditions, however, were not caused by abiotic environmental stresses or senescence or by pathogen infection in the greenhouse because wild-type plants grown interspersed with sorbitol-producing plants never developed comparable symptoms. Leaf necrosis and lesion formation in the absence of pathogens have also been observed as a result of disturbances in C allocation. Lesions formed on transgenic tobacco leaves expressing the cDNA for yeast invertase targeted to the plant cell wall (von Schaewen et al., 1990;Sonnewald et al., 1991). As a result of invertase activity in the cell wall, Glc and Fru accumulated, leading to a disturbance of source-to-sink relationships, which then inhibited photosynthesis depending on how much the capacity for Suc export was affected. The inhibition of photosynthesis in source leaves inhibited growth, and stunted leaves developed necrotic lesions. Herbers et al. (1996), reporting on the induction of systemic acquired resistance symptoms in tobacco with ectopic expression of differently targeted invertases, point to hexose sensing as a cause of lesion formation. The authors considered a threshold concentration of either Fru or Glc to be responsible for activation of genes of pathogen-related proteins in the absence of pathogens. Accumulating sugars could have directly repressed genes encoding photosynthetic functions and activated defense-related genes. Alternatively, altered levels of hexoses could have affected hexose kinases and acted as signals for Glc-mediated gene regulation (Jang and Sheen, 1994; Jang et al., 1997), but this seems unlikely because sorbitol (and other polyols) are not known to affect hexose kinase signaling. We show that another perturbation in carbohydrate status, high sorbitol accumulation, leads to effects similar to those observed after ectopic invertase expression. The symptoms, including low photosynthesis activity, lesion formation, stunted growth, and altered ratios of Glc and Fru, however, developed earlier than in invertase-expressing tobacco. The correlation between lesions and growth and sorbitol amounts suggests that carbohydrate levels are at the basis of the phenotype, but perturbations of carbohydrates could affect several different pathways. First, sorbitol-6-phosphate dehydrogenase could affect the rate of Suc biosynthesis by competing for Glc-6-P needed for the activation of Suc-P synthase. Second, hexose phosphates will not only serve as substrates for Suc biosynthesis but will be directed toward glycolysis and respiration. Depletion of the hexose phosphate pool would affect both pathways and could alter sink development. In fact, the transformants in which we measured the highest sorbitol amounts were the most severely inhibited in the development of the root and shoot meristems. Third, UDP-Glc as well as myo-inositol are essential precursors for cell wall biosynthesis. Changes in metabolic balance through altered Glc-6-P levels would affect growing tissues. Also, lowering of the Glc-6-P pool might affect the synthesis of myo-inositol throughl-myo-inositol-1-phosphate synthase. Finally, draining the Glc-6-P pool might alter the balance in signaling pathways involving Fru kinases and Glc kinases, or sorbitol-6-phosphate/sorbitol might interact with these hexose kinases. Alternatively, when the flux from Glc-6-P to myo-inositol is drastically altered, signaling pathways involving inositol phosphates could be affected. The data do not permit a distinction between the various alternatives, but these sorbitol-producing plants represent an experimental material with which to test these hypotheses. The amounts of Glc and Fru increased in the regions of the leaf that were beginning to show lesion development, likely affecting the expression of photosynthesis-related genes (and activation of pathogenesis-related proteins), but we consider this increase a late consequence of the primary damage. To our knowledge, the inverse correlation between sorbitol amount and lesion formation versus the amount of myo-inositol has not been reported previously. In S5C and all other lines tested, high sorbitol was invariably correlated with low myo-inositol. Sorbitol-producing plants were free of lesions after the addition ofmyo-inositol (Fig. 4). A causal relationship is also suggested by the fact that under salt stress and during drought,myo-inositol increases in wild-type tobacco (Sheveleva et al., 1997). This is also observed in sorbitol-producing plants, which showed less lesion formation when stressed by the addition of 150 mm NaCl (data not shown). In summary, by the introduction of a new enzyme generating a high flux of C into a new pathway originating from Glc-6-P we observed a disturbance in development. The reasons for the metabolic and developmental effects of high sorbitol production seem to be 2-fold: reduced C flux from Glc-6-P to myo-inositol and osmotic imbalance affecting C allocation or transport. The results permit yet another conclusion, namely, that attempts for the metabolic engineering of osmolyte synthesis may reach an upper limit in the concentration of an accumulating metabolite that is tolerated. Considering that metabolite accumulation has been studied in terms of osmotic or ionic stress protection, we wished to explore how high accumulation affected plant metabolism. Low to moderate accumulation seems to have protective effects and, in addition, cellular location seems to be important (Tarczynski et al., 1993; Shen et al., 1997a, 1997b). Inducible, stress-dependent high accumulation of the methylated inositol, ononitol, did not generate comparable lesions (Sheveleva et al., 1997). High constitutive accumulation, achieved here with sorbitol, may be detrimental. Even in the case of moderate mannitol accumulation, it has been reported that the growth of the transgenic tobacco plants was slower than that of wild type (Karakas et al., 1997). High amounts of metabolites, at least in the case of sorbitol, could imbalance metabolism and development even under normal growth conditions. Flux through basic metabolic pathways may be affected by the high accumulation of products for which the transformed species has not been adapted. Although low constitutive accumulation may be tolerated, the best strategy seems to be inducible accumulation of osmolytes (Sheveleva et al., 1997). ACKNOWLEDGMENTS We thank Dr. Y. Kanayama (Nagoya University, Japan) for the apple Stpd1 cDNA. We thank Dr. D. Inzé (University of Gent, Belgium) for a probe of tobacco superoxide dismutase, Christine Michalowski for assembling the gene construction, and Pat Adams and Jane Dugas Huff for dedicated assistance. Abbreviation: CaMV cauliflower mosaic virus LITERATURE CITED 1 Adams P Thomas JC Vernon DM Bohnert HJ Jensen RG Distinct cellular and organismic response to salt stress. Plant Cell Physiol 33 1992 1215 1223 Google Scholar OpenURL Placeholder Text WorldCat 2 Adams P Zegeer A Bohnert HJ Jensen RG Anion exchange separation and pulsed amperometric detection of inositols from flower petals. Anal Biochem 214 1993 321 324 Google Scholar Crossref Search ADS PubMed WorldCat 3 Asada K Production and action of active oxygen species in photosynthetic tissues. Foyer CH Mullineaux PM Causes of Photooxidative Stress and Amelioration of Defense Systems in Plants. 1994 77 105 CRC Press London 4 Baillieul F Genetet I Kopp M Saindrenan P Fritig B Kauffmann S A new elicitor of the hypersensitive response in tobacco: a fungal glycoprotein elicits cell death, expression of defence genes, production of salicylic acid, and induction of systemic acquired resistance. Plant J 8 1995 551 560 Google Scholar Crossref Search ADS PubMed WorldCat 5 Becker F Buschfeld E Schell J Bachmair A Altered response to viral infection in tobacco plants perturbed in ubiquitin system. Plant J 3 1993 875 881 Google Scholar Crossref Search ADS WorldCat 6 Bowles DJ Defense-related proteins in higher plants. Annu Rev Biochem 59 1990 873 907 Google Scholar Crossref Search ADS PubMed WorldCat 7 Galinski EA Compatible solutes of halophilic eubacteria: molecular principles, water-solute interaction, stress protection. Experientia 49 1993 487 496 Google Scholar Crossref Search ADS WorldCat 8 Greenberg JT Guo A Klessig DF Ausubel FM Programmed cell death in plants: a pathogen-triggered response activated coordinately with multiple defense functions. Cell 77 1994 551 563 Google Scholar Crossref Search ADS PubMed WorldCat 9 Hahlbrock K Scheel D Biochemical responses of plants to pathogens. Chet I Innovative Approaches to Plant Disease Control. 1987 229 254 John Wiley & Sons New York 10 Hayashi H Alia Mustardy L Deshnium P Ida M Murata N Transformation of Arabidopsis thaliana with the codA gene for choline oxidases: accumulation of glycinebetaine and enhanced tolerance to salt and cold stress. Plant J 12 1997 133 142 Google Scholar Crossref Search ADS PubMed WorldCat 11 Heineke D Sonnewald U Bussis D Gunter G Leidreiter K Wilke I Raschke K Willmitzer L Heldt HW Apoplastic expression of yeast-derived invertase in potato. Effects on photosynthesis, leaf solute composition, water relations, and tuber composition. Plant Physiol 100 1992 301 308 Google Scholar Crossref Search ADS PubMed WorldCat 12 Herbers K Meuwly P Frommer WB Metraux J-P Sonnewald U Systemic acquired resistance mediated by the ectopic expression of invertase: possible hexose sensing in the secretory pathway. Plant Cell 8 1996 793 803 Google Scholar Crossref Search ADS PubMed WorldCat 13 Holmström K Mantyla E Welin B Mandal A Palva ET Tunnela OE Londesborough J Drought tolerance in tobacco. Nature 379 1996 683 684 Google Scholar Crossref Search ADS WorldCat 14 Jang J-C Leon P Zhou L Sheen J Hexokinase as a sugar sensor in higher plants. Plant Cell 9 1997 5 19 Google Scholar PubMed OpenURL Placeholder Text WorldCat 15 Jang J-C Sheen J Sugar sensing in higher plants. Plant Cell 6 1994 1665 1679 Google Scholar PubMed OpenURL Placeholder Text WorldCat 16 Kanayama Y Mori H Imaseki H Yamaki S Nucleotide sequence of a cDNA encoding NADP-sorbitol-6-phosphate dehydrogenase from apple. Plant Physiol 100 1992 1607 1608 Google Scholar Crossref Search ADS PubMed WorldCat 17 Karakas B Ozias-Akins P Stushnoff C Suefferheld M Rieger M Salinity and drought tolerance of mannitol-accumulating transgenic plants. Plant Cell Environ 20 1997 609 616 Google Scholar Crossref Search ADS WorldCat 18 Kishor PBK Hong Z Miao G Hu CA Verma DPS Overexpression of pyrroline-5-carboxylase synthase increases proline production and confers osmotolerance in transgenic plants. Plant Physiol 108 1995 1387 1394 Google Scholar Crossref Search ADS PubMed WorldCat 19 LeRudulier D Bouillard L Glycine betaine, an osmotic effector in Klebsiella pneumoniae and other members of the Enterobacteriaceae. Appl Environ Microbiol 46 1983 152 159 Google Scholar Crossref Search ADS PubMed WorldCat 20 Mittler R Shulaev V Lam E Coordinated induction of programmed cell death and defense mechanisms in transgenic tobacco plants expressing a bacterial proton pump. Plant J 7 1995 29 42 Google Scholar OpenURL Placeholder Text WorldCat 21 Murashige T Skoog F A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15 1962 473 497 Google Scholar Crossref Search ADS WorldCat 22 Nomura M Ishitani M Takabe T Rai AK Takabe T Synechococcus sp. PCC7942 transformed with Escherichia coli bet genes produces glycine betaine from choline and acquires resistance to salt stress. Plant Physiol 107 1995 703 708 Google Scholar Crossref Search ADS PubMed WorldCat 23 Papageorgiou G Murata N The unusually strong stabilizing effects of glycine betaine on the structure and function of the oxygen-evolving photosystem II complex. Photosynth Res 44 1995 243 252 Google Scholar Crossref Search ADS PubMed WorldCat 24 Pilon-Smits EAH Ebskamp MJM Paul MJ Jeuken MJW Weisbeek PJ Smeekens SCM Improved performance of transgenic fructan-accumulating tobacco under drought stress. Plant Physiol 107 1995 125 130 Google Scholar Crossref Search ADS PubMed WorldCat 25 Schultes NP Zelitch I McGonigle B Nelson T The primary leaf catalase gene from Nicotiana tabacum and Nicotiana sylvestris. Plant Physiol 106 1994 399 400 Google Scholar Crossref Search ADS PubMed WorldCat 26 Shen B Jensen RG Bohnert HJ Increased resistance to oxidative stress in transgenic plants by targeting mannitol biosynthesis to chloroplasts. Plant Physiol 113 1997a 1177 1183 Google Scholar Crossref Search ADS WorldCat 27 Shen B Jensen RG Bohnert HJ Mannitol protects against oxidation by hydroxyl radicals. Plant Physiol 115 1997b 527 532 Google Scholar Crossref Search ADS WorldCat 28 Sheveleva E Chmara W Bohnert HJ Jensen RG Increased salt and drought tolerance by d-ononitol production in transgenic Nicotiana tabacum L. Plant Physiol 115 1997 1211 1219 Google Scholar Crossref Search ADS PubMed WorldCat 29 Smirnoff N The role of active oxygen in the response of plants to water deficit and desiccation. New Phytol 125 1993 27 58 Google Scholar Crossref Search ADS PubMed WorldCat 30 Smirnoff N Cumbes QJ Hydroxyl radical scavenging activity of compatible solutes. Phytochemistry 28 1989 1057 1060 Google Scholar Crossref Search ADS WorldCat 31 Sonnewald U Brauer M von Schaewen A Stitt M Transgenic tobacco plants expressing yeast-derived invertase in either the cytosol, vacuole or apoplast: a powerful tool for studying sucrose metabolism and sink/source interactions. Plant J 1 1991 95 106 Google Scholar Crossref Search ADS PubMed WorldCat 32 Takahashi H Shimamoto K Ehara Y Cauliflower mosaic virus gene VI causes growth suppression, development of necrotic spots and expression of defence-related genes in transgenic tobacco plants. Mol Gen Genet 216 1989 188 194 Google Scholar Crossref Search ADS WorldCat 33 Tao R Uratsu SL Dandekar AM Sorbitol synthesis in transgenic tobacco with apple cDNA encoding NADP-dependent sorbitol-6-phosphate dehydrogenase. Plant Cell Physiol 366 1995 525 532 Google Scholar OpenURL Placeholder Text WorldCat 34 Tarczynski MC Jensen RG Bohnert HJ Expression of a bacterial mtlD gene in transgenic tobacco leads to production and accumulation of mannitol. Proc Natl Acad Sci USA 89 1992 2600 2604 Google Scholar Crossref Search ADS PubMed WorldCat 35 Tarczynski MC Jensen RG Bohnert HJ Stress protection of transgenic tobacco by production of the osmolyte mannitol. Science 259 1993 508 510 Google Scholar Crossref Search ADS PubMed WorldCat 36 Tsang EWT Bowler C Herouart D Camp WV Villaroel R Genetello C Van Montagu M Inze D Differential regulation of superoxide dismutases in plants exposed to environmental stress. Plant Cell 3 1991 783 792 Google Scholar PubMed OpenURL Placeholder Text WorldCat 37 Vernon DM Tarczynski MC Jensen RG Bohnert HJ Cyclitol production in transgenic tobacco. Plant J 4 1993 199 205 Google Scholar Crossref Search ADS WorldCat 38 von Schaewen A Stitt M Schmidt R Sonnewald U Willmitzer L Expression of a yeast-derived invertase in the cell wall of tobacco and Arabidopsis plants leads to accumulation of carbohydrate and inhibition of photosynthesis and strongly influences growth and phenotype of transgenic tobacco plants. EMBO J 9 1990 3033 3044 Google Scholar Crossref Search ADS PubMed WorldCat 39 Walbot V, Hoisington DA, Neuffer MG (1983) Disease lesions mimic mutations. In T Kosuge, CP Meredith, A Hollender, eds, Genetic Engineering of Plants. Plenum Publishing, New York, pp 431–442 40 Yalpani N Shulaev V Raskin I Endogenous salicylic acid levels correlate with accumulation of pathogenesis-related proteins and virus resistance in tobacco. Phytopathology 83 1993 702 708 Google Scholar Crossref Search ADS WorldCat Author notes 1 Supported by the Department of Energy, Division of Energy Biosciences (grant no. DE-FG03-95ER20179), the U.S. Department of Agriculture, National Research Initiative-Competitive Grants Program (“Plant Responses to the Environment”), the Arizona Agricultural Experiment Station, and the New Energy and Industrial Technology Development Organization, Japan. * Corresponding author; e-mail [email protected]; fax 1–520–621–1697. Copyright © 1998 American Society of Plant Physiologists This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)