Zoological Journal of the Linnean Society

journal article

LitStream Collection

Phylogeny and revision of the Oriental leafhopper genus Amritodus (Hemiptera: Cicadellidae: Idiocerini)

2019 Zoological Journal of the Linnean Society

Abstract The phylogeny of the Oriental leafhopper genus Amritodus is reconstructed, for the first time, based on 47 discrete morphological characters and DNA sequence data from one nuclear and two mitochondrial genes. The phylogenetic results show that Amritodus is not monophyletic, and its concept is narrowed here to include four species: Amritodus atkinsoni, Amritodus brevis, Amritodus brevistylus and Amritodus saeedi. The phylogenetic results support establishment of a new genus, Paramritodus gen. nov., with three new species,Paramritodus triangulus sp. nov. (type species), Paramritodus introflexus sp. nov., Paramritodus spatiosus sp. nov. and three species previously included in Amritodus: Paramritodus pistacious comb. nov., Paramritodus flavocapitatus comb. nov. and Paramritodus podocarpus comb. nov. In addition, Amritodus flavoscutatus is transferred from Amritodus to Hyalinocerus as Hyalinocerus flavoscutatus comb. nov. Keys to species of Amritodus and Paramritodus are provided. Auchenorrhyncha, Eurymelinae, Homoptera, Idiocerinae, morphology, phylogenetic analysis, taxonomy INTRODUCTION Idiocerini Baker, 1915 is one of the largest tribes of arboreal leafhoppers. The relationships among genera of this tribe remain poorly understood. Krishnankutty & Dietrich (2011) were the first to study idiocerine leafhoppers using phylogenetic methods. Their analysis supported the monophyly of Nesocerus Freytag & Knight, 1966 and resolved relationships among species of that genus. Moreover, in her unpublished PhD dissertation, Krishnankutty (2012) presented results of a molecular phylogenetic analysis of Idiocerini and related groups that included representatives from most biogeographical regions of the world. That analysis and a more recent phylogenomic analysis of Membracoidea (Dietrich et al., 2017) indicated that the endemic Australian group Eurymelinae is derived from Idiocerinae. Dietrich & Thomas (2018) treated Idiocerinae as a junior synonym of Eurymelinae, which now includes both former subfamilies, Eurymelinae and Idiocerinae, as its tribes. Anufriev (1970) established the genus Amritodus based on the species Idiocerus atkinsoni Lethierry, 1889, from India and Pakistan. Amritodus is widespread in the Oriental region, and its species often feed on Anacardiaceae (Viraktamath, 1997; Gnaneswaran et al., 2007). Viraktamath (1976) added Amritodus brevistylus Viraktamath and Amritodus mudigerensis Viraktamath from India. Viraktamath & Murphy (1980) transferred A. mudigerensis to Busoniomimus Maldonado-Capriles, 1977. Ahmed et al. (1980) described Amritodus saeediAhmed, Naheed & Ahmed, 1980 from Pakistan. Huang & Maldonado-Capriles (1992) reported Amritodus for the first time in China and described Amritodus pistacious Huang & Maldonado-Capriles, 1992. Viraktamath (1997) described Amritodus brevis from India, and suggested that A. pistacious is sufficiently different from other species of Amritodus that it should be removed from the genus. Cai & Shen (1998) described Amritodus flavoscutatus, Cai et al. (2001) added Amritodus flavocapitatus Cai & He, 2001, and Zhang & Li (2010) described Amritodus podocarpus Zhang & Li, 2010 from China. Until this study, Amritodus included eight species. Amritodus was previously defined based on characters of the external morphology and male genitalia, but in our studies, we found that some species do not conform to the diagnosis of this genus. In the present paper, the phylogeny of Amritodus is reconstructed based on DNA sequence data and adult morphological data, and a new classification scheme for Amritodus is proposed based on these phylogenetic results. Furthermore, a new genus is established to include some species excluded from Amritodus together with some additional new species, and Amritodus flavoscutatus is transferred to Hyalinocerus. MATERIAL AND METHODS Taxon sampling Nineteen taxa were included in the datasets analysed (Table 1). The ingroup comprised all eight previously recognized Amritodus species. The outgroup comprised 11 species belonging to eight related genera based on a previous phylogenetic analysis (Xue Q, Dietrich C & Zhang Y, in prep.), including Anidiocerus brevispinus Xue & Zhang, Busonia albilateralis Maldonado-Capriles, Busoniomimus polydoros (Kirkaldy), Chunra quadrispinosa Zhang, Li & Xu, Hyalinocerus nigrimaculatus Zhang & Li, Idioscopus nagpurensis (Pruthi), Idioscopus nitidulus (Walker), Jogocerus concavus Xue & Zhang and three undescribed species. Five taxa were represented only by morphological data. Specimens of all taxa except A. podocarpus were examined. The character states for A. podocarpus were determined based on the detailed description and illustrations by Zhang & Li (2010). Table 1. GenBank accession numbers for the respective DNA fragments Taxon Location 28S D2 16S COI Chunra quadrispinosa China: Hainan MK064017 MK063942 MK055892 Busonia albilateralis China: Yunnan MK064007 MK063938 MK055888 Anidiocerus brevispinus China: Shaanxi MK064000 MK063932 MK055881 Busoniomimus polydoros Australia: QLD MK064009 MK063939 MK055889 Hyalinocerus flavoscutatus comb. nov. China: Guizhou MK063996 MK063928 MK055878 Hyalinocerus nigrimaculatus China: Shaanxi MK064025 MK063950 MK055899 Idioscopus nagpurensis China: Yunnan MK064032 MK063956 MK055903 Idioscopus nitidulus China: Yunnan MK064033 NC029203 MK055904 Jogocerus concavus China: Yunnan MK064039 MK063963 MK055910 Amritodus atkinsoni India – – HQ268819 Amritodus brevis China: Yunnan MK063994 MK063926 MK055876 Amritodus brevistylus Sri Lanka – – HQ268817 Amritodus saeedi India – – – Paramritodus introflexus sp. nov. China: Yunnan – – – Paramritodus flavocapitatus comb. nov. China: Zhejiang MK063995 MK063927 MK055877 Paramritodus pistacious comb. nov. China: Taiwan – – – Paramritodus podocarpus comb. nov. China: Guizhou – – – Paramritodus spatiosus sp. nov. China: Yunnan – – – Paramritodus triangulus sp. nov. China: Yunnan MK064057 MK063977 MK055926 Taxon Location 28S D2 16S COI Chunra quadrispinosa China: Hainan MK064017 MK063942 MK055892 Busonia albilateralis China: Yunnan MK064007 MK063938 MK055888 Anidiocerus brevispinus China: Shaanxi MK064000 MK063932 MK055881 Busoniomimus polydoros Australia: QLD MK064009 MK063939 MK055889 Hyalinocerus flavoscutatus comb. nov. China: Guizhou MK063996 MK063928 MK055878 Hyalinocerus nigrimaculatus China: Shaanxi MK064025 MK063950 MK055899 Idioscopus nagpurensis China: Yunnan MK064032 MK063956 MK055903 Idioscopus nitidulus China: Yunnan MK064033 NC029203 MK055904 Jogocerus concavus China: Yunnan MK064039 MK063963 MK055910 Amritodus atkinsoni India – – HQ268819 Amritodus brevis China: Yunnan MK063994 MK063926 MK055876 Amritodus brevistylus Sri Lanka – – HQ268817 Amritodus saeedi India – – – Paramritodus introflexus sp. nov. China: Yunnan – – – Paramritodus flavocapitatus comb. nov. China: Zhejiang MK063995 MK063927 MK055877 Paramritodus pistacious comb. nov. China: Taiwan – – – Paramritodus podocarpus comb. nov. China: Guizhou – – – Paramritodus spatiosus sp. nov. China: Yunnan – – – Paramritodus triangulus sp. nov. China: Yunnan MK064057 MK063977 MK055926 ‘–’ indicates no sequence available. Open in new tab Table 1. GenBank accession numbers for the respective DNA fragments Taxon Location 28S D2 16S COI Chunra quadrispinosa China: Hainan MK064017 MK063942 MK055892 Busonia albilateralis China: Yunnan MK064007 MK063938 MK055888 Anidiocerus brevispinus China: Shaanxi MK064000 MK063932 MK055881 Busoniomimus polydoros Australia: QLD MK064009 MK063939 MK055889 Hyalinocerus flavoscutatus comb. nov. China: Guizhou MK063996 MK063928 MK055878 Hyalinocerus nigrimaculatus China: Shaanxi MK064025 MK063950 MK055899 Idioscopus nagpurensis China: Yunnan MK064032 MK063956 MK055903 Idioscopus nitidulus China: Yunnan MK064033 NC029203 MK055904 Jogocerus concavus China: Yunnan MK064039 MK063963 MK055910 Amritodus atkinsoni India – – HQ268819 Amritodus brevis China: Yunnan MK063994 MK063926 MK055876 Amritodus brevistylus Sri Lanka – – HQ268817 Amritodus saeedi India – – – Paramritodus introflexus sp. nov. China: Yunnan – – – Paramritodus flavocapitatus comb. nov. China: Zhejiang MK063995 MK063927 MK055877 Paramritodus pistacious comb. nov. China: Taiwan – – – Paramritodus podocarpus comb. nov. China: Guizhou – – – Paramritodus spatiosus sp. nov. China: Yunnan – – – Paramritodus triangulus sp. nov. China: Yunnan MK064057 MK063977 MK055926 Taxon Location 28S D2 16S COI Chunra quadrispinosa China: Hainan MK064017 MK063942 MK055892 Busonia albilateralis China: Yunnan MK064007 MK063938 MK055888 Anidiocerus brevispinus China: Shaanxi MK064000 MK063932 MK055881 Busoniomimus polydoros Australia: QLD MK064009 MK063939 MK055889 Hyalinocerus flavoscutatus comb. nov. China: Guizhou MK063996 MK063928 MK055878 Hyalinocerus nigrimaculatus China: Shaanxi MK064025 MK063950 MK055899 Idioscopus nagpurensis China: Yunnan MK064032 MK063956 MK055903 Idioscopus nitidulus China: Yunnan MK064033 NC029203 MK055904 Jogocerus concavus China: Yunnan MK064039 MK063963 MK055910 Amritodus atkinsoni India – – HQ268819 Amritodus brevis China: Yunnan MK063994 MK063926 MK055876 Amritodus brevistylus Sri Lanka – – HQ268817 Amritodus saeedi India – – – Paramritodus introflexus sp. nov. China: Yunnan – – – Paramritodus flavocapitatus comb. nov. China: Zhejiang MK063995 MK063927 MK055877 Paramritodus pistacious comb. nov. China: Taiwan – – – Paramritodus podocarpus comb. nov. China: Guizhou – – – Paramritodus spatiosus sp. nov. China: Yunnan – – – Paramritodus triangulus sp. nov. China: Yunnan MK064057 MK063977 MK055926 ‘–’ indicates no sequence available. Open in new tab The specimens used in this study are deposited in the following archives: the National Zoological Museum of China, Institute of Zoology, Chinese Academy of Sciences, Beijing, China (IOZ); the Entomological Museum, Northwest A&F University, Yangling, China (NWAFU); the Queen Sirikit Botanical Garden, Chiang Mai, Thailand (QSBG); the Shanghai Entomological Museum, Chinese Academy of Sciences, Shanghai, China (SEMCAS); the Department of Entomology, University of Agricultural Sciences, Bangalore, India (UASB); and the National Museum of Natural History, Smithsonian Institution, Washington, DC, USA (USNM), as indicated in the text. DNA sequencing Adult specimens were preserved in 95% or anhydrous ethanol before molecular analyses. We selected one nuclear gene, 28S D2 (~700 bp), and two mitochondrial genes, 16S (~550 bp) and COI (658 bp) gene fragments. These genes have been used previously to reconstruct phylogenetic relationships among Membracoidea (e.g. Dietrich et al., 2001; Zahniser & Dietrich, 2010; Krishnankutty & Dietrich, 2011; Wang et al., 2016, 2017; Evangelista et al., 2017). Total genomic DNA of individual specimens was extracted from either the abdomen or thoracic muscles using Qiagen DNEasy Kits (Qiagen, Valencia, CA, USA). Fragments of 28S D2 were amplified by PCR in 25 μL reaction volumes with the following cycling protocol: 94 °C for 3 min, then 30 cycles of 94 °C for 1 min, 52–57 °C for 1 min, 72 °C for 1.5–2.0 min, and one final extension at 72 °C for 7 min. COI was amplified as follows: 3 min at 94 °C; five cycles of 1 min at 94 °C, 1.5 min at 45 °C and 1.5 min at 72 °C; 35 cycles of 1 min at 94 °C, 1 min at 52–55 °C and 1 min at 72 °C; and 5 min at 72 °C. 16S was amplified as follows: 5 min at 94 °C; 11 cycles of 92 °C for 1 min, 48 °C for 1 min and 72 °C for 1.5 min; 30 cycles of 92 °C for 1 min, 54–56 °C for 35 s and 72 °C for 2 min; and 72 °C for 7 min. The PCR primers are listed in Table 2. Total genomic DNA was stored at −20 °C before PCR and Sanger sequencing using the same primer pairs. Table 2. Primers used in this study Primer Primer sequence (5′–3′) Source 28SD2F AGTCGKGTTGCTTGAKAGTGCAG Dietrich et al. (2001) 28SD2R TTCAATTTCATTKCGCCTT Dietrich et al. (2001) 16SF(LR-J-12887) CCGGTYTGAACTCARATCAWGT Dietrich et al. (1997) 16SR(LR-N-13398) CTGTTTAWCAAAAACATTTC Dietrich et al. (1997) COIF(LCO1490) GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COIR(HCO2198) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Primer Primer sequence (5′–3′) Source 28SD2F AGTCGKGTTGCTTGAKAGTGCAG Dietrich et al. (2001) 28SD2R TTCAATTTCATTKCGCCTT Dietrich et al. (2001) 16SF(LR-J-12887) CCGGTYTGAACTCARATCAWGT Dietrich et al. (1997) 16SR(LR-N-13398) CTGTTTAWCAAAAACATTTC Dietrich et al. (1997) COIF(LCO1490) GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COIR(HCO2198) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Open in new tab Table 2. Primers used in this study Primer Primer sequence (5′–3′) Source 28SD2F AGTCGKGTTGCTTGAKAGTGCAG Dietrich et al. (2001) 28SD2R TTCAATTTCATTKCGCCTT Dietrich et al. (2001) 16SF(LR-J-12887) CCGGTYTGAACTCARATCAWGT Dietrich et al. (1997) 16SR(LR-N-13398) CTGTTTAWCAAAAACATTTC Dietrich et al. (1997) COIF(LCO1490) GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COIR(HCO2198) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Primer Primer sequence (5′–3′) Source 28SD2F AGTCGKGTTGCTTGAKAGTGCAG Dietrich et al. (2001) 28SD2R TTCAATTTCATTKCGCCTT Dietrich et al. (2001) 16SF(LR-J-12887) CCGGTYTGAACTCARATCAWGT Dietrich et al. (1997) 16SR(LR-N-13398) CTGTTTAWCAAAAACATTTC Dietrich et al. (1997) COIF(LCO1490) GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) COIR(HCO2198) TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Open in new tab Sequences were assembled and edited with MEGA v.6 (Tamura et al., 2013). Sequences were aligned in MAFFT v.7.037 (Katoh & Standley, 2013) using the G-INS-i algorithm. Molecular and morphological datasets were merged using SEQUENCEMATRIX v.1.7.8 (Vaidya et al., 2011). GenBank accession numbers are provided in Table 1. Morphological characters The male abdomen was removed from the specimen and treated with 8–10% NaOH for 24 h, rinsed with water and then transferred to glycerol for further dissection and examination. After examination, the dissected genitalia were stored in a microvial with fresh glycerol and pinned below the specimen from which the abdomen was removed. Photographs and drawings were prepared using a Microvision system and CARTOGRAPH v.8.0.6 automontage software, a Nikon SMZ1500 dissecting microscope, an Olympus BH-2 stereoscopic microscope and a Zeiss stereoscopic microscope, and then adjusted in Adobe Photoshop. Morphological terminology mainly follows Zhang (1990) and Dietrich (2005), except for the apodemes of the abdomen, which follows Hamilton (1980). Fourty-seven morphological characters were used in the phylogenetic analysis, composed of 41 binary and six multistate characters, including 11 from the head, six from the forewing and hindleg and 30 from the male genitalia. Morphological data were compiled using MESQUITE v.3.31 (Maddison & Maddison, 2017). Inapplicable characters are indicated as ‘–’. All characters were treated as unordered and of equal weight. The data matrix is given in Table 3. Table 3. Morphological character matrix Species 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 02 21 22 23 24 Chunra quadrispinosa 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 - - 0 0 0 0 Busonia albilateralis 0 0 0 1 0 1 - - 0 0 0 1 0 1 0 1 0 0 - - 0 0 0 1 Anidiocerus brevispinus 1 1 0 0 0 0 1 1 1 1 0 0 1 1 1 1 1 1 2 0 0 0 0 0 Busoniomimus polydoros 1 1 0 0 0 0 0 1 1 1 0 0 1 1 1 1 1 1 2 1 1 0 1 0 Hyalinocerus flavoscutatus comb. nov. 1 0 1 1 1 0 1 1 1 0 1 0 1 1 1 1 1 1 2 0 0 0 0 0 Hyalinocerus nigrimaculatus 1 0 1 1 0 0 0 0 1 0 0 0 1 1 1 1 1 0 - - 0 0 1 1 Idioscopus nagpurensis 1 1 0 0 0 0 0 0 0 1 0 0 1 1 1 1 1 0 - - 0 0 0 0 Idioscopus nitidulus 1 1 0 0 0 0 1 1 1 1 1 0 1 0 1 1 2 0 - - 0 0 0 0 Jogocerus concavus 1 0 1 1 0 0 0 1 0 0 0 0 1 0 1 1 0 1 2 1 0 1 1 0 Amritodus atkinsoni 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevis 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevistylus 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus saeedi 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Paramritodus introflexus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 1 0 0 0 1 0 Paramritodus flavocapitatus comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus pistacious comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus podocarpus comb. nov. 1 1 0 0 0 0 ? ? 0 0 0 0 0 1 1 1 ? 1 0 0 0 0 1 0 Paramritodus spatiosus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus triangulus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Species 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Chunra quadrispinosa 0 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 - - - 0 0 Busonia albilateralis 0 1 0 0 0 0 0 0 1 - - - - 0 0 0 0 1 - - - 1 - Anidiocerus brevispinus 0 0 2 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 - - - 1 - Busoniomimus polydoros 0 1 3 0 0 0 0 1 1 - - - - 0 0 0 1 0 - - - 0 0 Hyalinocerus flavoscutatus comb. nov. 1 1 2 1 1 0 0 0 1 - - - - 0 0 0 1 0 - - - 1 - Hyalinocerus nigrimaculatus 1 1 3 0 1 0 0 0 0 2 0 0 1 0 0 0 0 0 - - - 1 - Idioscopus nagpurensis 0 0 2 0 0 0 0 0 0 1 1 1 1 0 0 0 1 0 - - - 0 0 Idioscopus nitidulus 0 0 2 0 0 0 0 0 0 1 0 1 1 0 0 0 1 0 - - - 0 0 Jogocerus concavus 0 1 2 0 0 0 1 0 0 0 1 0 1 0 0 0 1 0 - - - 0 0 Amritodus atkinsoni 0 0 1 0 1 1 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Amritodus brevis 0 2 1 0 1 0 0 0 1 - - - - 1 0 1 1 1 1 1 0 0 0 Amritodus brevistylus 0 0 1 0 1 0 0 0 0 0 2 0 0 1 0 0 1 1 1 1 0 0 0 Amritodus saeedi 0 0 1 0 1 0 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Paramritodus introflexus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Paramritodus flavocapitatus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 0 0 1 Paramritodus pistacious comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 1 0 1 Paramritodus podocarpus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 1 0 1 - Paramritodus spatiosus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 1 0 1 1 0 1 1 0 1 1 0 0 Paramritodus triangulus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Species 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 02 21 22 23 24 Chunra quadrispinosa 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 - - 0 0 0 0 Busonia albilateralis 0 0 0 1 0 1 - - 0 0 0 1 0 1 0 1 0 0 - - 0 0 0 1 Anidiocerus brevispinus 1 1 0 0 0 0 1 1 1 1 0 0 1 1 1 1 1 1 2 0 0 0 0 0 Busoniomimus polydoros 1 1 0 0 0 0 0 1 1 1 0 0 1 1 1 1 1 1 2 1 1 0 1 0 Hyalinocerus flavoscutatus comb. nov. 1 0 1 1 1 0 1 1 1 0 1 0 1 1 1 1 1 1 2 0 0 0 0 0 Hyalinocerus nigrimaculatus 1 0 1 1 0 0 0 0 1 0 0 0 1 1 1 1 1 0 - - 0 0 1 1 Idioscopus nagpurensis 1 1 0 0 0 0 0 0 0 1 0 0 1 1 1 1 1 0 - - 0 0 0 0 Idioscopus nitidulus 1 1 0 0 0 0 1 1 1 1 1 0 1 0 1 1 2 0 - - 0 0 0 0 Jogocerus concavus 1 0 1 1 0 0 0 1 0 0 0 0 1 0 1 1 0 1 2 1 0 1 1 0 Amritodus atkinsoni 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevis 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevistylus 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus saeedi 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Paramritodus introflexus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 1 0 0 0 1 0 Paramritodus flavocapitatus comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus pistacious comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus podocarpus comb. nov. 1 1 0 0 0 0 ? ? 0 0 0 0 0 1 1 1 ? 1 0 0 0 0 1 0 Paramritodus spatiosus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus triangulus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Species 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Chunra quadrispinosa 0 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 - - - 0 0 Busonia albilateralis 0 1 0 0 0 0 0 0 1 - - - - 0 0 0 0 1 - - - 1 - Anidiocerus brevispinus 0 0 2 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 - - - 1 - Busoniomimus polydoros 0 1 3 0 0 0 0 1 1 - - - - 0 0 0 1 0 - - - 0 0 Hyalinocerus flavoscutatus comb. nov. 1 1 2 1 1 0 0 0 1 - - - - 0 0 0 1 0 - - - 1 - Hyalinocerus nigrimaculatus 1 1 3 0 1 0 0 0 0 2 0 0 1 0 0 0 0 0 - - - 1 - Idioscopus nagpurensis 0 0 2 0 0 0 0 0 0 1 1 1 1 0 0 0 1 0 - - - 0 0 Idioscopus nitidulus 0 0 2 0 0 0 0 0 0 1 0 1 1 0 0 0 1 0 - - - 0 0 Jogocerus concavus 0 1 2 0 0 0 1 0 0 0 1 0 1 0 0 0 1 0 - - - 0 0 Amritodus atkinsoni 0 0 1 0 1 1 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Amritodus brevis 0 2 1 0 1 0 0 0 1 - - - - 1 0 1 1 1 1 1 0 0 0 Amritodus brevistylus 0 0 1 0 1 0 0 0 0 0 2 0 0 1 0 0 1 1 1 1 0 0 0 Amritodus saeedi 0 0 1 0 1 0 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Paramritodus introflexus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Paramritodus flavocapitatus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 0 0 1 Paramritodus pistacious comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 1 0 1 Paramritodus podocarpus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 1 0 1 - Paramritodus spatiosus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 1 0 1 1 0 1 1 0 1 1 0 0 Paramritodus triangulus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Open in new tab Table 3. Morphological character matrix Species 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 02 21 22 23 24 Chunra quadrispinosa 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 - - 0 0 0 0 Busonia albilateralis 0 0 0 1 0 1 - - 0 0 0 1 0 1 0 1 0 0 - - 0 0 0 1 Anidiocerus brevispinus 1 1 0 0 0 0 1 1 1 1 0 0 1 1 1 1 1 1 2 0 0 0 0 0 Busoniomimus polydoros 1 1 0 0 0 0 0 1 1 1 0 0 1 1 1 1 1 1 2 1 1 0 1 0 Hyalinocerus flavoscutatus comb. nov. 1 0 1 1 1 0 1 1 1 0 1 0 1 1 1 1 1 1 2 0 0 0 0 0 Hyalinocerus nigrimaculatus 1 0 1 1 0 0 0 0 1 0 0 0 1 1 1 1 1 0 - - 0 0 1 1 Idioscopus nagpurensis 1 1 0 0 0 0 0 0 0 1 0 0 1 1 1 1 1 0 - - 0 0 0 0 Idioscopus nitidulus 1 1 0 0 0 0 1 1 1 1 1 0 1 0 1 1 2 0 - - 0 0 0 0 Jogocerus concavus 1 0 1 1 0 0 0 1 0 0 0 0 1 0 1 1 0 1 2 1 0 1 1 0 Amritodus atkinsoni 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevis 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevistylus 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus saeedi 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Paramritodus introflexus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 1 0 0 0 1 0 Paramritodus flavocapitatus comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus pistacious comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus podocarpus comb. nov. 1 1 0 0 0 0 ? ? 0 0 0 0 0 1 1 1 ? 1 0 0 0 0 1 0 Paramritodus spatiosus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus triangulus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Species 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Chunra quadrispinosa 0 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 - - - 0 0 Busonia albilateralis 0 1 0 0 0 0 0 0 1 - - - - 0 0 0 0 1 - - - 1 - Anidiocerus brevispinus 0 0 2 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 - - - 1 - Busoniomimus polydoros 0 1 3 0 0 0 0 1 1 - - - - 0 0 0 1 0 - - - 0 0 Hyalinocerus flavoscutatus comb. nov. 1 1 2 1 1 0 0 0 1 - - - - 0 0 0 1 0 - - - 1 - Hyalinocerus nigrimaculatus 1 1 3 0 1 0 0 0 0 2 0 0 1 0 0 0 0 0 - - - 1 - Idioscopus nagpurensis 0 0 2 0 0 0 0 0 0 1 1 1 1 0 0 0 1 0 - - - 0 0 Idioscopus nitidulus 0 0 2 0 0 0 0 0 0 1 0 1 1 0 0 0 1 0 - - - 0 0 Jogocerus concavus 0 1 2 0 0 0 1 0 0 0 1 0 1 0 0 0 1 0 - - - 0 0 Amritodus atkinsoni 0 0 1 0 1 1 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Amritodus brevis 0 2 1 0 1 0 0 0 1 - - - - 1 0 1 1 1 1 1 0 0 0 Amritodus brevistylus 0 0 1 0 1 0 0 0 0 0 2 0 0 1 0 0 1 1 1 1 0 0 0 Amritodus saeedi 0 0 1 0 1 0 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Paramritodus introflexus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Paramritodus flavocapitatus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 0 0 1 Paramritodus pistacious comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 1 0 1 Paramritodus podocarpus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 1 0 1 - Paramritodus spatiosus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 1 0 1 1 0 1 1 0 1 1 0 0 Paramritodus triangulus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Species 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 02 21 22 23 24 Chunra quadrispinosa 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 - - 0 0 0 0 Busonia albilateralis 0 0 0 1 0 1 - - 0 0 0 1 0 1 0 1 0 0 - - 0 0 0 1 Anidiocerus brevispinus 1 1 0 0 0 0 1 1 1 1 0 0 1 1 1 1 1 1 2 0 0 0 0 0 Busoniomimus polydoros 1 1 0 0 0 0 0 1 1 1 0 0 1 1 1 1 1 1 2 1 1 0 1 0 Hyalinocerus flavoscutatus comb. nov. 1 0 1 1 1 0 1 1 1 0 1 0 1 1 1 1 1 1 2 0 0 0 0 0 Hyalinocerus nigrimaculatus 1 0 1 1 0 0 0 0 1 0 0 0 1 1 1 1 1 0 - - 0 0 1 1 Idioscopus nagpurensis 1 1 0 0 0 0 0 0 0 1 0 0 1 1 1 1 1 0 - - 0 0 0 0 Idioscopus nitidulus 1 1 0 0 0 0 1 1 1 1 1 0 1 0 1 1 2 0 - - 0 0 0 0 Jogocerus concavus 1 0 1 1 0 0 0 1 0 0 0 0 1 0 1 1 0 1 2 1 0 1 1 0 Amritodus atkinsoni 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevis 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus brevistylus 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Amritodus saeedi 1 0 0 0 0 0 0 1 1 1 0 1 1 1 1 1 2 1 0 1 0 0 0 0 Paramritodus introflexus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 1 0 0 0 1 0 Paramritodus flavocapitatus comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus pistacious comb. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus podocarpus comb. nov. 1 1 0 0 0 0 ? ? 0 0 0 0 0 1 1 1 ? 1 0 0 0 0 1 0 Paramritodus spatiosus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Paramritodus triangulus sp. nov. 1 1 0 0 0 0 1 1 0 0 0 0 0 1 1 1 1 1 0 0 0 0 1 0 Species 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Chunra quadrispinosa 0 1 0 0 0 0 0 0 0 1 2 0 0 0 0 0 0 0 - - - 0 0 Busonia albilateralis 0 1 0 0 0 0 0 0 1 - - - - 0 0 0 0 1 - - - 1 - Anidiocerus brevispinus 0 0 2 0 0 0 1 0 0 0 1 0 0 0 0 0 0 0 - - - 1 - Busoniomimus polydoros 0 1 3 0 0 0 0 1 1 - - - - 0 0 0 1 0 - - - 0 0 Hyalinocerus flavoscutatus comb. nov. 1 1 2 1 1 0 0 0 1 - - - - 0 0 0 1 0 - - - 1 - Hyalinocerus nigrimaculatus 1 1 3 0 1 0 0 0 0 2 0 0 1 0 0 0 0 0 - - - 1 - Idioscopus nagpurensis 0 0 2 0 0 0 0 0 0 1 1 1 1 0 0 0 1 0 - - - 0 0 Idioscopus nitidulus 0 0 2 0 0 0 0 0 0 1 0 1 1 0 0 0 1 0 - - - 0 0 Jogocerus concavus 0 1 2 0 0 0 1 0 0 0 1 0 1 0 0 0 1 0 - - - 0 0 Amritodus atkinsoni 0 0 1 0 1 1 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Amritodus brevis 0 2 1 0 1 0 0 0 1 - - - - 1 0 1 1 1 1 1 0 0 0 Amritodus brevistylus 0 0 1 0 1 0 0 0 0 0 2 0 0 1 0 0 1 1 1 1 0 0 0 Amritodus saeedi 0 0 1 0 1 0 0 0 1 - - - - 1 0 0 1 1 1 1 0 0 0 Paramritodus introflexus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Paramritodus flavocapitatus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 0 0 1 Paramritodus pistacious comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 0 1 0 1 Paramritodus podocarpus comb. nov. 0 1 3 0 0 0 0 0 1 - - - - 1 1 0 2 1 0 1 0 1 - Paramritodus spatiosus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 1 0 1 1 0 1 1 0 1 1 0 0 Paramritodus triangulus sp. nov. 0 1 3 0 0 0 0 0 0 0 2 0 0 1 1 0 2 1 0 1 1 0 1 Open in new tab Characters Head: 1. Crown texture: (0) shagreen; (1) rugose. 2. Coronal suture: (0) obsolete; (1) well developed. 3. Pronotum texture: (0) shagreen; (1) rugose. 4. Anteclypeus surpassing apex of gena: (0) no; (1) yes. 5. Anteclypeus elevated: (0) no; (1) yes. 6. Lateral frontal suture: (0) present; (1) absent. 7. Apex of lateral frontal suture, shape: (0) straight; (1) curved laterad. 8. Lateral frontal sutures extended to ocelli: (0) no; (1) yes. 9. Base of gena margin, shape: (0) straight or convex; (1) concave. 10. Apex of rostrum, shape: (0) tapered or parallel-sided; (1) broadened. 11. Colour of anteclypeus: (0) not black; (1) black. Forewing and hindleg: 12. Crossvein r-m1: (0) present; (1) absent. 13. Crossvein m-cu1: (0) absent; (1) present. 14. Number of subapical cells: (0) three; (1) two. 15. Number of apical cells bordering appendix: (0) three; (1) two. 16. Hind femur macrosetal formula: (0) 2 + 0; (1) 2 + 1. 17. Number of first hind tarsomere platellar setae: (0) two; (1) three; (2) four. Male genitalia: 18. Inner process of pygofer: (0) absent; (1) present. 19. Position of pygofer inner process: (0) arising from base on ventral margin; (1) arising from base on ventral margin and connecting with lateral surface; (2) arising from middle on ventral margin. 20. Apical half of pygofer inner process obviously curved dorsad: (0) no; (1) yes. 21. Basal lobe on pygofer ventral margin: (0) absent; (1) present. 22. Pygofer ventral margin concave: (0) no; (1) yes. 23. Length of pygofer distal lobe: (0) short; (1) elongate, surpassing anal tube. 24. Pygofer dorsal apodeme: (0) present, developed; (1) absent or undeveloped. 25. Extension of pygofer dorsal apodeme: (0) not extended to midline of pygofer side; (1) extended to midline of pygofer side. 26. Length of subgenital plate: (0) longer than pygofer; (1) between 0.5 and 1× as long as pygofer; (2) less than half as long as pygofer. 27. Setae on style dorsal margin: (0) absent; (1) dense and short; (2) fine, sparse; (3) stout and long. 28. Shape of style apical half: (0) not slender and tapered; (1) slender and tapered. 29. Style curved dorsally at nearly 90° angle: (0) no; (1) yes. 30. Apex of style curved dorsad: (0) no; (1) yes. 31. Texture of style ventral margin: (0) smooth; (1) serrate. 32. Aedeagal shaft pustulate: (0) no; (1) yes. 33. Aedeagal process: (0) present; (1) absent. 34. Number of aedeagal processes: (0) one pair; (1) two pairs; (2) more than two pairs. 35. Position of aedeagal process: (0) apical; (1) subapical; (2) basal. 36. Length of aedeagal process: (0) shorter than half-length of shaft; (1) longer than half-length of shaft. 37. Direction of aedeagal process: (0) directed distad; (1) directed basad. 38. Aedeagus S-shaped in lateral view: (0) no; (1) yes. 39. Apical half of aedeagal shaft in ventral view, shape: (0) parallel-sided or broadened; (1) slender and tapered. 40. Triangular lobe on aedeagus dorsal margin near apex: (0) absent; (1) present. 41. Position of gonopore: (0) apical; (1) subapical; (2) near middle of shaft. 42. Preatrium: (0) absent or undeveloped; (1) present, developed. 43. Length of preatrium: (0) shorter than shaft; (1) as long or longer than shaft. 44. Shape of preatrium in lateral view: (0) straight; (1) curved. 45. Preatrium much broader than shaft in lateral view: (0) no; (1) yes. 46. Presence of aedeagal dorsal apodeme: (0) present, developed; (1) absent or undeveloped. 47. Shape of aedeagal dorsal apodeme in lateral view: (0) not broadened; (1) broadened. Phylogenetic analysis Combined Bayesian inference (BI) analysis (16S, 28S D2, COI and morphological data) and molecular-only BI analysis were carried out in MrBayes v.3.2.6 (analyses on CIPRES Science Gateway; Miller et al., 2010). To determine the best-fitting nucleotide model for each gene, we used Partitionfinder v.2 (Lanfear et al., 2016) implemented in CIPRES. The GTR+G model was specified for 16S and 28S D2, and TVM+I+G for COI. The morphology dataset was run under the standard discrete model. Six chains were included in two runs of 10 million generations, sampled every 1000 generations, with a burn-in of 0.25. The average standard deviation of split frequencies was < 0.01, suggesting that runs converged. After the first 25% of trees were discarded as burn-in, posterior probability (PP) values were calculated for the majority-rule consensus tree. Combined maximum likelihood (ML) analysis (16S, 28S D2, COI and morphological data) and molecular-only ML analysis were carried out in IQ-TREE v.1.6.5. For the ML analysis, IQ-TREE selected the model for each gene using the Bayesian information criterion (BIC). The GTR+F+G4 model was specified for 16S, TIM3+F+R2 for 28S D2, TVM+F+I+G4 for COI, and the MK model for morphology. IQ-TREE executed the following tests to determine node support for the ML analysis: 5000 replicates for ultrafast bootstrap (UFB) approximation and 1000 replicates for the Shimodaira–Hasegawa approximate likelihood ratio test (SH-aLRT). The morphological data were analysed under parsimony carried out in TNT v.1.5 (Goloboff et al., 2003) using the traditional search approach, with 100 replicates followed by tree bisection and reconnection (TBR) branch swapping, and 100 trees saved per replication. Bremer support was calculated using TNT and obtained by TBR swapping on the most parsimonious trees. Character optimization and mapping were conducted with WinClada v.1.00.08 (Nixon, 2002). RESULTS The topologies resulting from combined molecular and morphological data are partly incongruent, but both trees recover Amritodus as non-monophyletic. Most nodes of the BI tree (Fig. 1) and the ML tree (Supporting Information, Fig. S1) are strongly supported by PP, SH-aLRT and UFB scores. The eight species of Amritodus are placed in three independent lineages. Amritodus flavoscutatus is recovered as more closely related to H. nigrimaculatus than to species of Amritodus with high support (PP = 1, SH-aLRT = 96.4, UFB = 96). Amritodus flavocapitatus, A. pistacious and A. podocarpus group together in a well-supported clade (PP = 1, SH-aLRT = 99.6, UFB = 100) with the three undescribed species (described below as Paramritodus introflexus, Paramritodus spatiosus and Paramritodus triangulus). The other four species [Amritodus atkinsoni (Lethierry, 1889), A. brevis, A. brevistylus and A. saeedi] of Amritodus group together in a separate clade with high support (PP = 1, SH-aLRT = 99.6, UFB = 99). The relationships among species within clades are poorly resolved. Figure 1. Open in new tabDownload slide Bayesian consensus tree based on analysis of three genes and 47 morphological characters for Amritodus and related idiocerines. Numbers below branches are the Bayesian posterior probabilities. Figure 1. Open in new tabDownload slide Bayesian consensus tree based on analysis of three genes and 47 morphological characters for Amritodus and related idiocerines. Numbers below branches are the Bayesian posterior probabilities. The BI (Supporting Information, Fig. S2) and ML (Supporting Information, Fig. S3) topologies based on molecular data only are congruent with those obtained from the combined data, but relationships among clades remain unresolved. The analysis of morphological characters carried out in TNT v.1.5 using the traditional search finds two equally most parsimonious trees (length = 99, consistency index = 55, retention index = 72). The resulting strict consensus tree (length = 100, consistency index = 55, retention index = 71) and the Bremer support are shown in Figure 2. In this analysis, Amritodus is also recovered as non-monophyletic. The clade A. flavoscutatus + H. nigrimaculatus is supported by a Bremer value of three and by three synapomorphic characters: pygofer dorsal apodeme extended to midline of pygofer side (25: 1), style curved dorsally at nearly 90° angle (29: 1) and aedeagal dorsal apodeme undeveloped (46: 1). The clade of three Amritodus species (A. flavocapitatus, A. pistacious and A. podocarpus) plus the three new species is supported by a Bremer value of two and by two synapomorphic characters: pygofer distal lobe surpassing anal tube (23: 1) and apical half of aedeagal shaft slender and tapered in ventral view (39: 1). The clade {A. brevistylus + [A. atkinsoni + (A. brevis + A. saeedi)]} is supported by a Bremer value of three and by the following synapomorphic characters: forewing without cross-vein r-m1 (12: 1), first hind tarsomere with four platellar setae (17: 2) and style curved dorsally at nearly 90° angle (29: 1). Figure 2. Open in new tabDownload slide Strict consensus of the two equally most parsimonious trees found by TNT. Numbers above the circles refer to characters and those below refer to character states. Black circles represent non-homoplasious changes; white circles represent homoplasious changes. Red numbers below the branches are Bremer support values. Figure 2. Open in new tabDownload slide Strict consensus of the two equally most parsimonious trees found by TNT. Numbers above the circles refer to characters and those below refer to character states. Black circles represent non-homoplasious changes; white circles represent homoplasious changes. Red numbers below the branches are Bremer support values. DISCUSSION Our phylogenetic analysis confirms that Amritodus, as previously defined, is not monophyletic. This supports the observations of Viraktamath (1997), who suggested removing A. pistacious from Amritodus based on differences from the type species in forewing venation, male genitalia, host plant and distribution. Our phylogenetic results also indicate that A. flavoscutatus was misclassified to genus and support the transfer of this species to Hyalinocerus. Morphological evidence supporting this transfer includes the fine transversely rugose crown and pronotum, anteclypeus surpassing the apex of the gena, forewing with r-m1 and m-cu1 cross-veins, pygofer dorsal apodeme extended to the midline of the pygofer side, style curved dorsally at a nearly 90° angle, undeveloped aedeagal dorsal apodeme and short preatrium. Our analyses also consistently placed the remaining previously described Amritodus species in two separate clades. One clade, including three previously described species, Amritodus flavocapitatus, A. pistacious and A. podocarpus, is supported by the following morphological features: crown finely rugose, pronotum shagreen, forewing with r-m1 crossvein, without m-cu1 vein, hind basitarsus with three platellae, pygofer distal lobe surpassing anal tube, style with stout and long setae on dorsal margin, apical half of aedeagal shaft slender and tapered in ventral view, and aedeagal preatrium shorter than shaft. This clade is formally recognized below as the new genus Paramritodus. The remaining Amritodus species, including the type species of the genus, were placed in the other clade, also well supported by morphological and molecular characters. The current classification of this group is revised to conform to these new phylogenetic results (see below). TAXONOMY Genus Amritodus Anufriev, 1970 AmritodusAnufriev, 1970: 376. Type species: Idiocerus atkinsoni Lethierry, 1889; by original designation. Diagnosis: Body generally yellowish brown or brown. Crown with a pair of black spots on either side of midline. Face yellowish or brownish. Pronotum with a pair of black markings on anterior margin. Head wider than pronotum. Crown finely rugose. Head wider than long, ocelli closer to eyes than to each other; lora broad; anteclypeus apex wider than base; rostrum broadened apically. Combined length of mesoscutum and scutellum longer than pronotum, shagreen. Forewing with m-cu1 cross-vein, without r-m1 and m-cu2 cross-veins. Hind femur with 2 + 1 apical setae. Hind tibiae with 18–20 setae on row PD, six setae on AD and six to eight setae on row AV. Hind basitarsus with four platellae. Male pygofer longer than height, with a pair of inner processes on the ventral margin; apical half of inner processes obviously curved dorsad. Subgenital plate with hair-like setae on dorsal and ventral margin. Style curved dorsally, with dense and short setae on dorsal margin. Aedeagus S-shaped, preatrium well developed, as long as or longer than shaft; dorsal apodeme developed; gonopore subapical on ventral margin. Female seventh sternite wider than long, with caudal margin obviously concave. Ovipositor extending beyond pygofer. First valvulae apical one-third to one-quarter curved dorsad, apex attenuated, with sculpture strigate. Second valvulae curved dorsally; dorsal margin with more than ten teeth. Distribution: Bangladesh, China, India, Myanmar, Pakistan, Sri Lanka and Thailand. Remarks: Amritodus is similar to Idioscopus, but differs from the latter in having an elongated aedeagal preatrium, and the aedeagal shaft short and S-shaped without a long process near the apex. Key to species of Amritodus (males) (modified from Viraktamath, 1997) 1. Subgenital plate shorter than half length of pygofer (Fig. 13A) A. brevis Subgenital plate longer than pygofer (Fig. 12A) 2 2. Aedeagus with basal pair of short processes on ventral surface (Fig. 14E) A. brevistylus Aedeagus without process (Fig. 12E) 3 3. Style apex strongly curved dorsad (Fig. 12G) A. atkinsoni Style apex not strongly curved dorsad (Viraktamath, 1997: fig. 9) A. saeedi Amritodus atkinsoni (Lethierry, 1889) (Figs 3, 12) Idiocerus atkinsoni Lethierry, 1889: 252. Amritodus atkinsoni (Lethierry) – Anufriev, 1970: 376, figs 1–7. – Viraktamath, 1997: 113, figs 1–6, 28. Diagnosis: Yellowish brown; pronotum, mesoscutum and scutellum with median brown stripe (Fig. 3A). Subgenital plate with dense, fine and long setae (Fig. 12A). Style apex curved dorsad, with dense, short and stout setae on dorsal surface (Fig. 12G). Aedeagal shaft smooth; preatrium much longer than shaft; dorsal apodeme oval in ventral view (Fig. 12E–F). Figure 3. Open in new tabDownload slide Amritodus atkinsoni. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, female abdomen, ventral view. J, first valvula. K, apex of second valvula. L, second valvula. Scale bars: 1.0 mm (A, B, G–I); 0.5 mm (C–F, J, L); 0.2 mm (K). Figure 3. Open in new tabDownload slide Amritodus atkinsoni. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, female abdomen, ventral view. J, first valvula. K, apex of second valvula. L, second valvula. Scale bars: 1.0 mm (A, B, G–I); 0.5 mm (C–F, J, L); 0.2 mm (K). Materials examined: Ten ♂ and ten ♀, India, Bhunga, 25 April 1967, coll. A. S. Sohi (USNM). Distribution: Bangladesh, India, Myanmar and Pakistan. Remarks: This species is similar to A. brevistylus in coloration and male genitalia, but can be distinguished from the latter by the aedeagus without process. Amritodus brevis Viraktamath, 1997 (Figs 4, 13) Amritodus brevisViraktamath, 1997: 115, figs 32–41. Diagnosis: Body robust and large. Rostrum much broadened on apical half (Fig. 4D). Subgenital plate shorter than half of pygofer, extended ventrally, without hair-like setae (Fig. 13A). Style with dense, short and fine setae on dorsal surface (Fig. 13G). Aedeagal shaft with a pair of short triangular processes subapically; preatrium slightly longer than shaft (Fig. 13E, F). Figure 4. Open in new tabDownload slide Amritodus brevis. A, habitus, dorsal view. B, habitus, lateral view. C, head and thorax, dorsal view. D, face. Scale bars: 1.0 mm. Figure 4. Open in new tabDownload slide Amritodus brevis. A, habitus, dorsal view. B, habitus, lateral view. C, head and thorax, dorsal view. D, face. Scale bars: 1.0 mm. Materials examined: One ♂, China, Yunnan Province, Daluo, 679 m, 23 May 2011, coll. Lin Lu (NWAFU); one ♂, Thailand, Phetchabun Khao Kho, NP, mixed deciduous forest near office, 16°39.55′N, 101°8.123′E, 230 m, Pan trap, 7–8 February 2007, coll. Somchai Chachumnan & Saink (QSBG). Distribution: India and new records for China and Thailand. Remarks: This species can be distinguished from the other species of Amritodus by the large body, short subgenital plate, and aedeagus with a pair of short triangular processes subapically. Amritodus brevistylus Viraktamath, 1976 (Figs 5, 14) Amritodus brevistylus Viraktamath, 1976: 234, figs 1–5. – Viraktamath, 1997: 115, figs 15–21, 27. Diagnosis: Rostrum broadened on apical half (Fig. 5D). Subgenital plate with dense, long and fine setae on dorsal margin and a few setae on ventral margin (Fig. 14A). Style apex and dorsal margin with dense, short and fine setae, serrate medially on ventral margin (Fig. 14G). Aedeagus with basal pair of short processes on ventral surface; preatrium much longer than shaft; dorsal apodeme fan shaped in ventral view (Fig. 14E, F). Figure 5. Open in new tabDownload slide Amritodus brevistylus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, forewing. J, sternite VII of female, ventral view. K, first valvula. L, second valvula. M, apex of first valvula. N, apex of second valvula. Scale bars: 1.0 mm (A, B, G–J); 0.5 mm (C–F, K, L); 0.2 mm (M, N). Figure 5. Open in new tabDownload slide Amritodus brevistylus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, forewing. J, sternite VII of female, ventral view. K, first valvula. L, second valvula. M, apex of first valvula. N, apex of second valvula. Scale bars: 1.0 mm (A, B, G–J); 0.5 mm (C–F, K, L); 0.2 mm (M, N). Materials examined: Five ♂ and five ♀, Sri Lanka, Kan., Dist., Kandy 1800 feet, Peak View Motel, 15–24 January 1970, coll. Davis & Rowe (USNM). Distribution: India and Sri Lanka. Remarks: This species is an economically problematic pest, feeding on mango and other fruit crops. It is close to A. atkinsoni, having the same colour and similar male genitalia; see remarks under A. atkinsoni for differences. Amritodus saeedi Ahmed, Naheed & Ahmed, 1980 Amritodus saeedi Ahmed, Naheed & Ahmed, 1980: 221, fig. 1. – Viraktamath, 1997: 114, figs 7–13, 22–26. Diagnosis: Pronotum, mesoscutum and scutellum without median brown stripe. Style apex not strongly curved dorsad. Aedeagus simple, without process; preatrium slightly longer than shaft; dorsal apodeme broadened in ventral view. Materials examined: One ♂, India, Karnataka, Jog Falls, 534 m, 18 November 1976, coll. C. A. Viraktamath (UASB); one ♂, India, Mangalore, 16 May 1986, coll. C. A. Viraktamath (UASB). Distribution: India and Pakistan. Remarks: This species is similar to A. atkinsoni in the aedeagus, but can be distinguished from the latter by the pronotum without a median stripe and style apex not strongly curved dorsad. Genus Paramritodus Xue & Zhang gen. nov. Type species (here designated): Paramritodus triangulus Xue & Zhang, sp. nov. LSID:http://zoobank.org/urn:lsid:zoobank.org:act:381ABAC6-4DA9-40F3-9FF6-18AAF8368C1A Diagnosis: Body small. Crown finely rugose. Head wider than long; ocelli closer to eyes than to each other; lora broad; rostrum slight or not broadened apically. Pronotum shagreen, shorter than combined length of mesoscutum and scutellum. Forewing with r-m1 cross-vein, without m-cu1 cross-vein. Hind femur with 2 + 1 apical setae. Hind tibiae with 14–18 setae on row PD, five or six setae on AD and five to seven setae on row AV. Hind basitarsus with three platellae. Male pygofer elongate, distal lobe surpassing anal tube, with pair of inner processes; apex of inner processes often hooked. Subgenital plate shorter than pygofer, with hair-like setae on dorsal and ventral margin. Connective short. Style sickle shaped, with stout and long setae in single row on dorsal margin. Aedeagus S-shaped, without process or with pair of basal processes on ventral surface; aedeagal shaft slender and tapered in ventral view; preatrium shorter than shaft; gonopore subapical or near middle of shaft. Female seventh sternite wider than long, caudal margin produced, concave in middle. First valvulae slightly curved, with sculpture strigate. Second valvulae with several irregular dorsal teeth near apex. Etymology: This masculine generic name refers to the similarity of this new genus to Amritodus. Distribution: China (Guizhou, Shanxi, Taiwan, Yunnan and Zhejiang). Remarks: This new genus is closely related to Amritodus based on its similar body size and coloration, but can be distinguished by the forewing with cross-vein r-m1 and without cross-vein m-cu1, pygofer distal lobe surpassing the anal tube, style with long setae, and aedeagal preatrium shorter than the shaft. Key to species of Paramritodus (males) 1. Aedeagal shaft with basal pair of processes on ventral surface (Fig. 16E) 2 Aedeagus without process (Fig. 15E) 4 2. Aedeagal process longer than half length of shaft; gonopore subapical (Fig. 18E) P. spatiosus Aedeagal process shorter than half length of shaft; gonopore near middle of shaft (Fig. 16E) 3 3. Aedeagal shaft distad of process, concave ventrally in lateral view (Fig. 16E) P. introflexus Aedeagal shaft distad of process, not concave ventrally in lateral view (Fig. 19E) P. triangulus 4. Pronotum with two triangular black markings on anterior margin (Zhang & Li, 2010: fig. 1); aedeagal preatrium ventral margin curved in lateral view (Zhang & Li, 2010: fig. 8) P. podocarpus Pronotum without black markings on anterior margin (Fig. 6A); aedeagal preatrium ventral margin straight in lateral view (Fig. 15E) 5 5. Pygofer caudal margin rounded; segment X with long slender caudal process (Fig. 15A) P. flavocapitatus Pygofer caudal margin angular; segment X with short wide caudal process (Fig. 17A) P. pistacious Paramritodus flavocapitatus (Cai & He, 2001) comb. nov. (Figs 6, 15) Amritodus flavocapitatus Cai & He – Cai et al., 2001: 199, figs 54–61. Diagnosis: Crown and pronotum mainly brownish. Face yellowish. Mesoscutum brown, basal triangles black; scutellum brown (Fig. 6C). Face with short seta adjacent to corresponding eye; rostrum apex slightly broad, not reaching hind coxae. Figure 6. Open in new tabDownload slide Paramritodus flavocapitatus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, forewing. J, female abdomen, ventral view. K, first valvula. L, second valvula. M, apex of first valvula. N, apex of second valvula. Scale bars: 1.0 mm (A, B, G, H–J); 0.5 mm (C–F, K, L); 0.2 mm (M, N). Figure 6. Open in new tabDownload slide Paramritodus flavocapitatus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, forewing. J, female abdomen, ventral view. K, first valvula. L, second valvula. M, apex of first valvula. N, apex of second valvula. Scale bars: 1.0 mm (A, B, G, H–J); 0.5 mm (C–F, K, L); 0.2 mm (M, N). Materials examined: One ♂, China, Zhejiang Province, Mt. Tianmu, at light, 26 July 2011, coll. Lin Lu (NWAFU); one ♂, China, Shanxi Province, Hengqu, Lishan, 19 July 2006, coll. Zhaofu Yang (NWAFU). Distribution: China (Shanxi and Zhejiang). Remarks: This species can be distinguished from the other species of Paramritodus by the following features: crown without black spot; pygofer elongate, caudal margin rounded; pygofer inner processes curved apically, hook-like; style flat, broad subapically; aedeagal shaft basal part straight. Paramritodus introflexus Xue & Zhang sp. nov. (Figs 7, 16) LSID:http://zoobank.org/urn:lsid:zoobank.org:act:5A2F9CE8-334D-40AC-97B2-49F8BB9891EA Diagnosis: Crown with pair of black spots. Pronotum with pair of triangular black markings on anterior margin. Rostrum slightly broadened apically. Pygofer ventral margin with inner process elongate. Aedeagus with a pair of basal processes on ventral surface. Aedeagal shaft concave medially. Description: Length (including wings): male 3.3–3.4 mm. Crown yellowish, with black spot on either side of midline close to eyes; frontoclypeus and anteclypeus brownish; gena and lora yellowish (Fig. 7D). Pronotum greenish, with black markings; anterior margin with dark brown spot on either side of midline. Mesoscutum yellowish, basal triangles small, black; scutellum yellowish (Fig. 7C). Forewing mainly green, apex infuscate, base of costal margin green (Fig. 7E). Face with short seta adjacent to corresponding eye; rostrum apex slightly broad, rhombus shaped, not reaching hind coxae. Figure 7. Open in new tabDownload slide Paramritodus introflexus. A, habitus, dorsal view. B, habitus, lateral view. C, head and thorax, dorsal view. D, face. E, forewing. Scale bars: 1.0 mm (A, B, E); 0.5 mm (C, D). Figure 7. Open in new tabDownload slide Paramritodus introflexus. A, habitus, dorsal view. B, habitus, lateral view. C, head and thorax, dorsal view. D, face. E, forewing. Scale bars: 1.0 mm (A, B, E); 0.5 mm (C, D). Male abdomen with tergal apodemes truncate, slightly less than two segments long, separated mesally by V-shaped notch; sternal apodemes small, less than one segment long (Fig. 16B, C). Male genitalia: Pygofer elongate, obviously surpassing anal tube; inner processes elongate, almost reaching caudal margin, apex curved and pointed (Fig. 16A). Style curved dorsally, with row of long setae on dorsal margin (Fig. 16G). Connective short. Aedeagal shaft much curved, tapering apically in lateral view, concave basally, with basal pair of slender processes on ventral surface, dorsal apodeme and preatrium developed (Fig. 16E, F). Materials examined: Holotype: ♂, China, Yunnan Province, Baoshan, 12 May 2012, coll. Yanghui Cao (NWAFU). Paratypes: three ♂, same data as holotype (NWAFU). Etymology: The specific name is a Latin adjective, which refers to the strongly concave ventral margin of the aedeagal shaft. Remarks: This species is similar to P. triangulus in colour and shape, but can be distinguished from the latter by the elongate pygofer inner process almost reaching the caudal margin and aedeagal shaft strongly concave medially. Paramritodus pistacious (Huang & Maldonado-Capriles, 1992) comb. nov. (Figs 8, 17) Amritodus pistaciousHuang & Maldonado-Capriles, 1992: 2, fig. 1. Diagnosis: Crown and face yellowish. Face with short seta adjacent to corresponding eye; rostrum parallel-sided apically, not reaching hind coxae (Fig. 8D). Pygofer caudal margin angular; segment X with short, wide caudal process (Fig. 17A). Figure 8. Open in new tabDownload slide Paramritodus pistacious. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of female. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, female abdomen, ventral view. J, first valvula. K, second valvula. L, apex of first valvula. M, apex of second valvula. Scale bars: 1.0 mm (A, B, G–I); 0.5 mm (C–F, J, K); 0.2 mm (L, M). Figure 8. Open in new tabDownload slide Paramritodus pistacious. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of female. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, female abdomen, ventral view. J, first valvula. K, second valvula. L, apex of first valvula. M, apex of second valvula. Scale bars: 1.0 mm (A, B, G–I); 0.5 mm (C–F, J, K); 0.2 mm (L, M). Materials examined: Four ♂ and three ♀ (paratypes), China, Taiwan, Taichung, 26 July 1987, coll. C. T. Yang (USNM); one ♂, China, Taiwan, Duona, 3 June 2011, coll. Xiaolei Huang (IOZ). Distribution: China (Taiwan). Remarks: This species can be distinguished from the other species of Paramritodus by the following features: pygofer triangular, extended well beyond apex of anal tube, apex not rounded; pygofer inner process curved apically, reaching caudal margin; style slightly curved. Paramritodus podocarpus (Zhang & Li, 2010) comb. nov. Amritodus podocarpusZhang & Li, 2010: 730, figs 1–9. Diagnosis: Crown yellow, without black spot. Pronotum with a pair of triangular black markings on anterior margin. Rostrum slightly broadened apically. Pygofer inner process not reaching caudal margin. Style subapical extended. Aedeagal dorsal apodeme undeveloped. Aedeagal preatrium arcuate in lateral view. Distribution: China (Guizhou). Remarks: Specimens of this species were not available for study. This species can be distinguished by the following features: crown without a pair of black spots on either side of midline; style medially concave and extended subapically; aedeagal shaft slender and elongate, and preatrium arcuate in lateral view. Paramritodus spatiosus Xue & Zhang sp. nov. (Figs 9, 18) LSID:http://zoobank.org/urn:lsid:zoobank.org:act:2F91797D-5C95-49AE-A39A-58D29B5AB205 Diagnosis: Crown with a pair of black spots. Pronotum with a pair of triangular black markings on anterior margin. Rostrum parallel-sided apically. Aedeagal process longer than half length of shaft. Aedeagal dorsal apodeme undeveloped. Aedeagal preatrium broadened basally. Gonopore subapical. Description: Length (including wings): male 3.4 mm. Crown with black spot on either side of midline (Fig. 9C). Pronotum with pair of black triangular markings on anterior margin (Fig. 9C). Face without seta adjacent to corresponding eye; rostrum short, not reaching hind coxae, parallel-sided apically. Figure 9. Open in new tabDownload slide Paramritodus spatiosus. A, habitus, dorsal view. B, habitus, lateral view. C, head and thorax, dorsal view. D, face. Scale bars: 1.0 mm (A, B); 0.5 mm (C, D). Figure 9. Open in new tabDownload slide Paramritodus spatiosus. A, habitus, dorsal view. B, habitus, lateral view. C, head and thorax, dorsal view. D, face. Scale bars: 1.0 mm (A, B); 0.5 mm (C, D). Male abdomen with large tergal apodemes, length as long as two segments, separated mesally by a V-shaped notch; sternal apodemes small, less than one segment long (Fig. 18B, C). Male genitalia: Pygofer with rounded caudal margin; inner process arising from base of ventral margin, apex curved mesad. Subgenital plate with dense, long and fine setae on dorsal margin, few fine setae on ventral margin (Fig. 18A). Aedeagus with a pair of basal processes on ventral surface, length longer than half of shaft; preatrium broadened basally in ventral and lateral view, slender medially; dorsal apodeme undeveloped (Fig. 18E, F). Material examined: Holotype: ♂, China, Yunnan Province, Dali, Yangbi, Yangjiang, 17 June 2013, coll. Qingquan Xue (NWAFU). Etymology: The specific epithet, a Latin adjective, refers to the elongate aedeagal process. Remarks: The new species seems to have close affinities with P. introflexus and P. triangulus (see below) based on the similar body colour, but it can be distinguished from these two species by the aedeagal process longer than half the length of the shaft and undeveloped dorsal apodeme. Paramritodus triangulus Xue & Zhang sp. nov. (Figs 10, 19) LSID:http://zoobank.org/urn:lsid:zoobank.org:act:8CD6C406-C95A-4CDE-8F0E-CB4C257F8469 Diagnosis: Crown with a pair of black spots. Pronotum with a pair of triangular black markings on anterior margin. Rostrum parallel-sided apically. Aedeagal process shorter than half length of shaft. Aedeagal shaft not concave medially. Description: Length (including wings): male 3.4–3.5 mm, female 3.4 mm. Crown stramineous, with black spot on either side of midline; frontoclypeus and anteclypeus and upper part of face brownish with black stripe; gena and lora yellowish (Fig. 10D). Pronotum greenish, with black markings, anterior margin with dark brown spot on either side of midline. Mesoscutum yellowish, basal triangles black; scutellum yellowish (Fig. 10C). Forewing infuscate, claval area and base of costal margin and parts of venation greenish. Face with short seta adjacent to corresponding eye; rostrum parallel-sided apically, not reaching hind coxae. Figure 10. Open in new tabDownload slide Paramritodus triangulus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, sternite VII of female, ventral view. J, first valvula. K, apex of first valvula. L, second valvula. M, apex of second valvula. Scale bars: 1.0 mm (A, B, G, H); 0.5 mm (C–F, I, J, L); 0.2 mm (K, M). Figure 10. Open in new tabDownload slide Paramritodus triangulus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, sternite VII of female, ventral view. J, first valvula. K, apex of first valvula. L, second valvula. M, apex of second valvula. Scale bars: 1.0 mm (A, B, G, H); 0.5 mm (C–F, I, J, L); 0.2 mm (K, M). Male abdomen with tergal apodemes truncate, less than two segments long, separated mesally by a U-shaped notch; sternal apodemes small, less than one segment long (Fig. 19B, C). Male genitalia: Pygofer triangular; pygofer inner process S-shaped, apex hook-like; subgenital plate with dense, long setae on dorsal margin and few setae on ventral margin (Fig. 19A). Style with long and stout setae on dorsal margin (Fig. 19G). Connective short. Aedeagal shaft tapering apically in lateral view, with basal pair of slender processes on ventral surface, dorsal apodeme and preatrium developed; gonopore on ventral surface medially (Fig. 19E, F). Materials examined: Holotype: ♂, China, Yunnan Province, Nansan, 29 May 2011, coll. Lin Lu (NWAFU). Paratypes: five ♂ and two ♀, same data as holotype (NWAFU). Etymology: The specific epithet, a Latin adjective, refers to the pygofer being triangular in lateral view. Remarks: This new species is close to P. introflexus, having the same colour and similar male genitalia; see remarks under P. introflexus for morphological comparison. Genus Hyalinocerus Zhang & Li, 2012 Hyalinocerus Zhang & Li, 2012: 204. Type species: Hyalinocerus nigrimaculatus Zhang & Li, 2012; by original designation. Diagnosis: Crown with a pair of large spots. Crown and pronotum finely transversely rugose; frontoclypeus and anteclypeus elevated; anteclypeus surpassing apex of gena. Forewing with r-m1 and m-cu1 cross-vein, without m-cu2 cross-vein. Hind femur with 2 + 1 apical setae. Hind tibiae with 16–25 setae on row PD, six to 14 setae on AD and seven to 14 setae on row AV. Hind basitarsus with three platellae. Pygofer dorsal apodeme present, extended to midline of pygofer lateral surface. Segment X inner process developed. Style elongate and curved dorsally at nearly a 90° angle. Aedeagal shaft tubular; preatrium short; dorsal apodeme undeveloped; gonopore situated near apex on ventral surface. Female seventh sternite shorter than wide, caudal margin obviously convex. Female first valvulae sculpture strigate, strongly curved, apex pointed. Female second valvulae curved obviously, with several dorsal teeth. Distribution: China (Guizhou, Henan, Hubei, Shaanxi and Sichuan). Remarks: This genus can be distinguished from other genera of Idiocerini by the following features: pronotum rugose; anteclypeus elevated; anteclypeus surpassing apex of gena; pygofer dorsal apodeme extended to midline of pygofer lateral surface; style distinctly curved dorsally. Hyalinocerus flavoscutatus (Cai & Shen, 1998) comb. nov. (Figs 11, 20) Amritodus flavoscutatus Cai & Shen, 1998: 33, fig. 7. Figure 11. Open in new tabDownload slide Hyalinocerus flavoscutatus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, sternite VII of female, ventral view. J, first valvula. K, apex of first valvula. L, second valvula. M, apex of second valvula. N, forewing. Scale bars: 1.0 mm (A, B, G, H, N); 0.5 mm (C–F, I, J, L); 0.2 mm (K, M). Figure 11. Open in new tabDownload slide Hyalinocerus flavoscutatus. A, habitus of male, dorsal view. B, habitus of male, lateral view. C, head and thorax of male, dorsal view. D, face of male. E, head and thorax of female, dorsal view. F, face of female. G, habitus of female, dorsal view. H, habitus of female, lateral view. I, sternite VII of female, ventral view. J, first valvula. K, apex of first valvula. L, second valvula. M, apex of second valvula. N, forewing. Scale bars: 1.0 mm (A, B, G, H, N); 0.5 mm (C–F, I, J, L); 0.2 mm (K, M). Figure 12. Open in new tabDownload slide Amritodus atkinsoni. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 12. Open in new tabDownload slide Amritodus atkinsoni. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 13. Open in new tabDownload slide Amritodus brevis. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 13. Open in new tabDownload slide Amritodus brevis. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 14. Open in new tabDownload slide Amritodus brevistylus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 14. Open in new tabDownload slide Amritodus brevistylus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 15. Open in new tabDownload slide Paramritodus flavocapitatus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 15. Open in new tabDownload slide Paramritodus flavocapitatus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm. Figure 16. Open in new tabDownload slide Paramritodus introflexus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (connective). Figure 16. Open in new tabDownload slide Paramritodus introflexus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (connective). Figure 17. Open in new tabDownload slide Paramritodus pistacious. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 17. Open in new tabDownload slide Paramritodus pistacious. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 18. Open in new tabDownload slide Paramritodus spatiosus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 18. Open in new tabDownload slide Paramritodus spatiosus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 19. Open in new tabDownload slide Paramritodus triangulus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 19. Open in new tabDownload slide Paramritodus triangulus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 20. Open in new tabDownload slide Hyalinocerus flavoscutatus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Figure 20. Open in new tabDownload slide Hyalinocerus flavoscutatus. A, male pygofer, anal tube and subgenital plate, lateral view. B, abdominal tergal apodemes. C, abdominal sternal apodemes. D, connective, ventral view. E, aedeagus, lateral view. F, aedeagus, ventral view. G, style, lateral view. Scale bars: 0.2 mm (A–C, E–G); 0.1 mm (D). Diagnosis: Crown with a pair of black spots. Pronotum finely rugose. Anteclypeus elevated and surpassing apex of gena. Pygofer inner process reaching caudal margin of pygofer. Style tapering apically. Aedeagal shaft straight in lateral view. Aedeagal dorsal apodeme and preatrium short. Description: Body brown. Base of face with black stripe in middle; ocelli with black markings around; lorum, anteclypeus, antennal pits and apical half of frontoclypeus black; frontoclypeus with several black markings on either side (Fig. 11D). Pronotum with a pair of semicircular black markings on anterior margin, and lateral area black. Mesoscutum mostly black; scutellum yellowish (Fig. 11C). Forewing veins dark brown and brownish, with black markings on subcostal margin (Fig. 11N). Female colour similar to male, but base of face with short brown stripe in middle; apical half of lorum, lateral and anterior margin of frontoclypeus black; pronotum with brown markings (Fig. 11E,F). Male abdomen with large tergal apodemes, length shorter than one segment long, separated mesally by a V-shaped notch; sternal apodemes small, less than one segment long (Fig. 20B, C). Pygofer caudal margin rounded, laterally with transverse hyaline band; with inner process arising from middle on ventral margin, reaching caudal margin. Subgenital plate slender, shorter than pygofer, apex with a few short and fine setae on ventral margin (Fig. 20A). Connective Y-shaped. Materials examined: Two ♂ and one ♀, China, Shaanxi Province, Huoditang, 1600 m, 7 July 2010, coll. Lin Lu (NWAFU); one ♂, China, Guizhou Province, Kuankuoshui, Fenshuiling, 1180 m, 15 August 2012, coll. Yang Wang (NWAFU); one ♂, China, Hubei Province, Xuanen, Chunmu, 30 July 1989, coll. Qingyao Liu (SEMCAS). Distribution: China (Guizhou, Henan, Hubei and Shaanxi). SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher's web-site: Figure S1. Maximum likelihood (ML) tree estimated from the combined morphological and molecular dataset. Numbers below branches are Shimodaira–Hasegawa approximate likelihood ratio test (SH-aLRT) and ultrafast bootstrap (UFB) from maximum likelihood analysis. Figure S2. Bayesian consensus tree recovered from Bayesian analysis of molecular dataset (without morphology). Numbers below branches are Bayesian posterior probabilities (PP). Figure S3. Maximum likelihood (ML) tree estimated from molecular dataset. Numbers below branches are Shimodaira–Hasegawa approximate likelihood ratio test (SH-aLRT) and ultrafast bootstrap (UFB) from maximum likelihood analysis. [Version of record, published online 21 November 2019; http://zoobank.org/urn:lsid:zoobank.org:pub:7AF64F35-5144- 432F-81C2-D6365C17B6FF] ACKNOWLEDGEMENTS We sincerely thank Professor C. A. Viraktamath (Agricultural Sciences University, India) for checking specimens and C. H. Dietrich (Illinois Natural History Survey, University of Illinois, USA) and J. R. Schrock (Emporia State University, USA) for revising this manuscript. This study was supported by the National Natural Science Foundation of China (31420103911, 31672339 and 31801995), the China Postdoctoral Science Foundation (2018M633590) and The Ministry of Science and Technology of the People’s Republic of China (2015FY210300 and 2005DKA21402). Many thanks are also given to the associate editor and anonymous reviewers for their helpful comments. REFERENCES Ahmed SS , Naheed R , Ahmed M . 1980 . Three new species of idiocerine leafhoppers . Proceedings of the 1st Pakistan Congress of Zoology, B : 221 – 225 . WorldCat Anufriev GA . 1970 . Description of a new genus: Amritodus for Idiocerus atkinsoni Leth. from India (Hemiptera: Cicadellidae) . Journal of Natural History 4 : 375 – 376 . Google Scholar Crossref Search ADS WorldCat Cai P , He JH , Gu XL . 2001 . Homoptera, Cicadellidae . In: Wu H , Pan CW , eds. Insects of Tianmushan National Nature Reserve. Beijing : Beijing Science Press , 185 – 218 . Google Preview WorldCat COPAC Cai P , Shen XC . 1998 . Eight new species of Idiocerinae from Mt. Funiu (Homoptera: Cicadellidae) . In: Shen XC , Shi ZY , eds. Insects of Mt. Funiu. Beijing : China Agricultural Science and Technology Press , 27 – 36 . Google Preview WorldCat COPAC Dietrich CH . 2005 . Keys to the families of Cicadomorpha and subfamilies and tribes of Cicadellidae (Hemiptera: Auchenorrhyncha) . Florida Entomologist 88 : 502 – 517 . Google Scholar Crossref Search ADS WorldCat Dietrich CH , Allen JM , Lemmon AR , Lemmon EM , Takiya DM , Evangelista O , Walden KKO , Grady PGS , Johnson KP . 2017 . Anchored hybrid enrichment-based phylogenomics of leafhoppers and treehoppers (Hemiptera: Cicadomorpha: Membracoidea) . Insect Systematics and Diversity 1 : 57 – 72 . Google Scholar Crossref Search ADS WorldCat Dietrich CH , Rakitov RA , Holmes JL , Black WC . 2001 . Phylogeny of the major lineages of Membracoidea (Insecta: Hemiptera: Cicadomorpha) based on 28S rDNA sequences . Molecular Phylogenetics and Evolution 18 : 293 – 305 . Google Scholar Crossref Search ADS PubMed WorldCat Dietrich CH , Thomas MJ . 2018 . New eurymeline leafhoppers (Hemiptera, Cicadellidae, Eurymelinae) from Eocene Baltic amber with notes on other fossil Cicadellidae . Zookeys 726 : 131 – 143 . Google Scholar Crossref Search ADS WorldCat Dietrich CH , Whitcomb RF , Black WC IV . 1997 . Phylogeny of the grassland leafhopper genus Flexamia (Homoptera: Cicadellidae) based on mitochondrial DNA sequences . Molecular Phylogenetics and Evolution 8 : 139 – 149 . Google Scholar Crossref Search ADS PubMed WorldCat Evangelista O , Sakakibara AM , Cryan JR , Urban JM . 2017 . A phylogeny of the treehopper subfamily Heteronotinae reveals convergent pronotal traits (Hemiptera: Auchenorrhyncha: Membracidae) . Systematic Entomology 42 : 410 – 428 . Google Scholar Crossref Search ADS WorldCat Folmer O , Black M , Hoeh W , Lutz R , Vrijenhoek R . 1994 . DNA primers for amplification of mitochondrial cytochrome oxidase subunit I from diverse metazoan invertebrates . Molecular Marine Biology and Biotechnology 3 : 294 – 299 . Google Scholar PubMed WorldCat Gnaneswaran KS , Hemachandra KS , Viraktamath CA , Ahangama D , Wijayagunasekara HNP , Wahundeniya I . 2007 . Idioscopus nagpurensis (Pruthi) (Hemiptera: Cicadellidae: Idiocerinae): a new member of mango leafhopper complex in Sri Lanka . Tropical Agricultural Research 19 : 78 – 90 . WorldCat Goloboff P , Farris S , Nixon K . 2003 . TNT: tree analysis using new technology. Program and documentation. Version 1.5. Available at: http://www.lillo.org.ar/phylogeny/tnt/ Google Preview WorldCat COPAC Hamilton KGA . 1980 . Review of the Nearctic Idiocerini, excepting those from the Sonoran subregion (Rhynchota: Homoptera: Cicadellidae) . The Canadian Entomologist 112 : 811 – 848 . Google Scholar Crossref Search ADS WorldCat Huang KW , Maldonado-Capriles J . 1992 . Idiocerinae of Taiwan (Homoptera: Cicadellidae) . Journal Taiwan Museum 45 : 1 – 14 . WorldCat Katoh K , Standley DM . 2013 . MAFFT multiple sequence alignment software version 7: improvements in performance and usability . Molecular Biology and Evolution 30 : 772 – 780 . Google Scholar Crossref Search ADS PubMed WorldCat Krishnankutty SH . 2012 . Systematics and biogeography of leafhoppers in Madagascar. Unpublished PhD Thesis, University of Illinois . Google Preview WorldCat COPAC Krishnankutty SM , Dietrich CH . 2011 . Taxonomic revision and phylogeny of an endemic leafhopper genus Nesocerus (Hemiptera: Cicadellidae: Idiocerinae) from Madagascar . Zoological Journal of the Linnean Society 162 : 499 – 543 . Google Scholar Crossref Search ADS WorldCat Lanfear R , Frandsen PB , Wright AM , Senfeld T , Calcott B . 2016 . PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses . Molecular Biology and Evolution 34 : 772 – 773 . WorldCat Maddison WP , Maddison DR . 2017 . Mesquite: a modular system for evolutionary analysis . Available at: http://mesquiteproject.org Miller MA , Pfeiffer W , Schwartz T . 2010 . Creating the CIPRES Science Gateway for inference of large phylogenetic trees . Gateway Computing Environments Workshop (GCE) . New Orleans: IEEE , 1 – 8 . Nixon KC . 2002 . WinClada v.100.08 . Ithaca : published by the author . Google Preview WorldCat COPAC Tamura K , Stecher G , Peterson D , Filipski A , Kumar S . 2013 . MEGA 6: molecular evolutionary genetics analysis version 6.0 . Molecular Biology and Evolution 30 : 2725 – 2729 . Google Scholar Crossref Search ADS PubMed WorldCat Vaidya G , Lohman DJ , Meier R . 2011 . SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information . Cladistics 27 : 171 – 180 . Google Scholar Crossref Search ADS WorldCat Viraktamath CA . 1976 . Four new species of idiocerine leafhoppers from India with a note on male Balocha astute (Melichar) (Homoptera: Cicadellidae: Idiocerniae) . Mysore Journal of Agricultural Science 10 : 234 – 244 . WorldCat Viraktamath CA . 1997 . A revision of the idiocerine leafhopper genus Amritodus (Hemiptera: Cicadellidae) breeding on mango . Entomon 22 : 111 – 117 . WorldCat Viraktamath CA , Murphy DH . 1980 . Description of two new species with notes on some Oriental Idiocerinae (Homoptera: Cicadellidae) . Journal of Entomology Research 4 : 83 – 90 . WorldCat Wang Y , Dietrich CH , Zhang YL . 2017 . Phylogeny and historical biogeography of leafhopper subfamily Evacanthinae (Hemiptera: Cicadellidae) based on morphological and molecular data . Scientific Reports 7 : 45387 . Google Scholar Crossref Search ADS PubMed WorldCat Wang Y , Nansen C , Zhang YL . 2016 . Integrative insect taxonomy based on morphology, mitochondrial DNA, and hyperspectral reflectance profiling . Zoological Journal of the Linnean Society 177 : 378 – 394 . Google Scholar Crossref Search ADS WorldCat Zahniser JN , Dietrich CH . 2010 . Phylogeny of the leafhopper subfamily Deltocephalinae (Hemiptera: Cicadellidae) based on molecular and morphological data with a revised family‐group classification . Systematic Entomology 35 : 489 – 511 . Google Scholar Crossref Search ADS WorldCat Zhang B , Li ZZ . 2010 . Amritodus podocarpus, a new species of the genus Amritodus Anufriev breeding on Podocarpus macrophyllus (Hemiptera, Cicadellidae) . Acta Zootaxonomica Sinica 35 : 730 – 732 . WorldCat Zhang YL . 1990 . A taxonomic study of Chinese Cicadellidae (Homoptera). Yangling : Tianze Eldonejo . Google Preview WorldCat COPAC © 2019 The Linnean Society of London, Zoological Journal of the Linnean Society This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

journal article

LitStream Collection

A sympatric pair of undescribed white-eye species (Aves: Zosteropidae: Zosterops) with different origins

O’Connell, Darren, P;Kelly, David, J;Lawless,, Naomi;O’Brien,, Katie;Marcaigh, Fionn, Ó;Karya,, Adi;Analuddin,, Kangkuso;Marples, Nicola, M

2019 Zoological Journal of the Linnean Society

doi: 10.1093/zoolinnean/zlz022

Abstract Research in the Indo-Pacific region has contributed massively to the understanding of speciation. White-eyes (Aves: Zosteropidae: Zosterops), a lineage containing both widespread ‘supertramp’ species and a high proportion of island endemics, have provided invaluable models. Molecular tools have increased speciation research, but delimiting species remains problematic. We investigated the evolutionary history of Zosterops species in south-east Sulawesi using mitochondrial DNA, morphometric, song and plumage analyses, to draw species limits and assess which techniques offer best resolution. Our investigation revealed a novel Zosterops species, >3000 km from its closest relative. Additionally, we demonstrated unanticipated diversity in the alleged ‘supertramp’ Zosterops chloris and propose the Wakatobi Islands subspecies (Z. c. flavissimus) to be given full species status. Furthermore, we provide the first molecular and phenotypic assessment of the Sulawesi endemic Zosterops consobrinorum. While local populations of this species vary in either genetics or morphometrics, none show consistency across measures. Therefore, we propose no change to Zosterops consobrinorum taxonomy. This study gives insight into one of the great Indo-Pacific radiations and demonstrates the value of using multiple lines of evidence for taxonomic review. birds, evolution, Indonesia, islands, new species, Wallacea INTRODUCTION Islands have long been key to our understanding of evolution, providing discrete geographical units to study patterns of speciation and the processes that underlie these patterns (Darwin, 1859; Wallace, 1869). The islands of the Indo-Pacific have been particularly important in the last half-century for laying down many of the fundamental principles underpinning our understanding of island biogeography and speciation (MacArthur & Wilson, 1967; MacArthur et al., 1972; Diamond, 1974, 1998; Diamond et al., 1976). This region is home to thousands of islands and several widespread species radiations, perfect for studying evolution in multiple, closely related populations (Mayr & Diamond, 2001). Modern molecular tools have bolstered this work, uncovering cryptic species (Lohman et al., 2010; Irestedt et al., 2013) and elucidating the evolutionary history of island colonizations (Cibois et al., 2011, 2014, Andersen et al., 2013, 2014). However, questions still remain on how best to delimit species in widespread radiations (Tobias et al., 2010; Andersen et al., 2014), and which processes allow some populations to maintain connectivity over large distances, while others become isolated endemic taxa (Andersen et al., 2015; Pedersen et al., 2018). One of the lineages of major importance to the study of avian speciation is the Zosterops white-eyes. Zosterops have a wide distribution across the Indo-Pacific, South Asia and Africa (Van Balen, 2008). They are supreme island colonizers, which are found throughout the Indo-Pacific, with 73 of the 96 currently recognized Zosterops species being found on islands in this region (Mees, 1961, 1969; Mayr & Diamond, 2001; Warren et al., 2006; Van Balen, 2018a). Zosterops show one of the fastest speciation rates of any vertebrate (Moyle et al., 2009), rivalled only by cichlid fish (Meyer, 1993; Genner et al., 2007; Elmer et al., 2010). This rapid rate of diversification has earned them the label as one of the ‘great speciators’ of the Indo-Pacific, species groups marked out by their remarkable speciation rates (Mayr & Diamond, 2001; Moyle et al., 2009; Cornetti et al., 2015; Lim et al., 2018). Zosterops species embody the paradox of ‘great speciators’ (Diamond et al., 1976): how do taxa that are sufficiently vagile to be such successful island colonizers become isolated and diverge into endemic species? Diamond et al. (1976) proposed that this pattern may arise from rapid shifts in dispersal ability in populations. The phylogeographic pattern of Zosterops species in Moyle et al. (2009) appeared consistent with this thesis. Dispersal ability can be reduced in island taxa when adaptation to local conditions favours traits other than dispersal ability (Mayr & Diamond, 2001; Gillespie et al., 2012). Wright et al. (2016) assessed this phenomenon across nine avian families (including the Zosteropidae) and found that reduced dispersal ability was associated with the lower species richness of predators on small islands. Additionally, the phenomenon of ‘behavioural flightlessness’, where isolated populations show reduced propensity to fly across water barriers despite being physically capable of doing so, has been observed to have evolved in multiple island bird and butterfly populations (Diamond, 1972, 1981; Holloway, 1977; Diamond & Gilpin, 1983). Adaptations in island populations that reduce the tendency to make long flights may conserve energy in resource-constrained islands (Diamond, 1981, 1984). The Zosterops radiation includes extremely widespread species, such as the Japanese white-eye, Zosterops japonicus (Temminck & Schlegel, 1845), and the Oriental white-eye, Zosterops palpebrosus (Temminck, 1824), containing multiple well-defined races (Lim et al., 2018), ‘supertramp’ edge species such as the Louisiade white-eye Zosterops griseotinctus (Gray, 1858), which are found on many small islands, varying little throughout their range (Mayr & Diamond, 2001), and a large number of single island endemics (Van Balen, 2008). Recent molecular work has begun to re-draw the taxonomy and evolutionary relationships of widespread Zosterops species (Habel et al., 2013, 2015a; Cox et al., 2014; Husemann et al., 2015; Round et al., 2017; Wells, 2017; Lim et al., 2018) and even show unexpected divergence in supposedly ‘supertramp’ lineages like Z. griseotinctus (Linck et al., 2016). However, there are still few studies addressing phenotypic and song evolution, processes key to species isolation (Uy et al., 2009), although see Phillimore et al. (2008), Baker (2012), Potvin (2013), Husemann et al. (2014) and Habel et al. (2015b). An understanding of how phenotype and song diverge in comparison to the molecular markers, in isolated populations, would give greater insight into this rapidly evolving lineage (Jønsson et al., 2014) and provide more effective species delimitation (Dong et al., 2015; Liu et al., 2016; Wood et al., 2016). In the heart of the Wallacea region, the south-eastern peninsula of Sulawesi provides an excellent study system to test the effect of isolation on Zosterops species (Fig. 1). There are continental islands (Buton, Muna, Kabaena and Wawonii), which were connected to Sulawesi at the time of the last glacial maximum, around 20 000 years ago (Voris, 2000; Yokoyama et al., 2000; Clark et al., 2009), and oceanic islands (the Wakatobi Islands and Runduma Island), which have never been connected to the Sulawesi mainland (Milsom & Ali, 1999; Nugraha & Hall, 2018). The region has been fruitful for recent speciation research. While the Wakatobi Islands are only separated from Buton by 27 km, they are home to six endemic bird subspecies (Kelly & Marples, 2010; Collar & Marsden, 2014), a proposed new species of flowerpecker (Aves: Dicaeidae; Kelly et al., 2014) potential new subspecies of kingfisher (Aves: Alcedinidae; O’Connell et al., 2019). Kabaena Island, only 16 km from the mainland, is also home to an endemic subspecies of red-backed thrush, Geokichla erythronota subsp. kabaena (Robinson-Dean et al., 2002). Figure 1. View largeDownload slide Map showing the study region of south-east Sulawesi (main panel) and the Sulawesi region of Indonesia (top right panel). Sites where Zosterops were sampled are indicated by coloured pins: red indicates Z. consobrinorum, blue indicates the ‘Wangi-wangi white-eye’ and green indicates Z. chloris, with the Z. c. flavissimus subspecies indicated by lime green. Figure 1. View largeDownload slide Map showing the study region of south-east Sulawesi (main panel) and the Sulawesi region of Indonesia (top right panel). Sites where Zosterops were sampled are indicated by coloured pins: red indicates Z. consobrinorum, blue indicates the ‘Wangi-wangi white-eye’ and green indicates Z. chloris, with the Z. c. flavissimus subspecies indicated by lime green. Current taxonomy identifies two Zosterops species, the lemon-bellied white-eye, Zosterops chloris (Bonaparte, 1850), and the pale-bellied white-eye, Zosterops consobrinorum (Meyer, 1904), in south-east Sulawesi (Van Balen, 2018a). The natural history of these species is still being studied. Zosterops chloris is thought to be a typical ‘supertramp’ species (Mayr & Diamond, 2001; Eaton et al., 2016). The designation ‘supertramp’ was developed by Diamond (1974, 1975) to describe the island-colonizing behaviour of birds; it includes the categories: (1) ‘sedentary’ – species confined to the larger islands, (2) ‘tramps’ – present on larger islands but also many smaller and more remote islands and (3) ‘supertramps’ species that are confined as residents mainly to small islands and virtually absent from larger islands, apart from edge habitats, such as mangroves, where they avoid stronger competitors. Zosterops chloris is found on small islands from the east coast of Sumatra to the west coast of Papua, and in coastal areas and edge habitats on larger islands in the Lesser Sundas and on Sulawesi, showing the habitat associations of a ‘supertramp’ species (Van Balen, 2018b). The different races of Z. chloris are not thought to be very distinct, with significant overlap in phenotypic traits (Eaton et al., 2016). The subspecies Z. c. flavissimus is found on the Wakatobi Islands and the subspecies Z. c. intermedius is found on Buton, Muna and Kabaena (Van Balen, 2018b). The newly discovered Z. chloris population on the mainland of south-east Sulawesi has been proposed to be either Z. c. intermedius (Kelly et al., 2010) or Z. c. mentoris, which is found in northern and central Sulawesi (Trochet et al., 2014). Zosterops consobrinorum is restricted to the south-eastern peninsula of Sulawesi, Buton and Kabaena (Wardill, 2003; Van Balen, 2008; O’Connell et al., 2017). The Buton Island population has been suggested as a potentially separate subspecies (Wardill, 2003). A potentially novel Zosterops species is present on only the northernmost Wakatobi Island, Wangi-wangi (Fig. 1). It has been provisionally assigned as a population of Z. consobrinorum (Van Balen, 2018c) and was proposed as a novel species by Eaton et al. (2016), the ‘Wangi-wangi white-eye’. This Zosterops population was first identified by DJK, NMM and Martin Meads in 2003 (Kelly & Marples, 2010) and has been awaiting molecular work to confirm its status. The south-east Sulawesi study system provides the opportunity, first, to clarify the understudied taxonomy of these populations, and, second, to investigate the impact of isolation on a widespread ‘supertramp’ and regional endemic Zosterops species. To achieve the aims of this study our research goals were: (1) to assess the ‘supertramp’ Z. chloris by comparing populations for divergence in mitochondrial DNA, morphometrics or song, (2) to assess populations of the regional endemic Z. consobrinorum using the same methods, with a particular focus on the undescribed ‘Wangi-wangi white-eye’, which has been provisionally assigned to this species, and (3) to estimate divergence times to gain insight into the evolutionary relationships of the Zosterops taxa in the region. MATERIAL AND METHODS Study site and sampling Sampling was carried out throughout south-east Sulawesi (Fig. 1) on research expeditions undertaken between 1999 and 2017 in the months of June–September by NNM, DJK, AK, KA and DOC. Zosterops species were sampled on 12 islands throughout the region (Fig. 1). For additional details on sampling locations, see Supporting Information (Table S1). Mist-nets were used to trap birds for sampling. Birds trapped were colour-ringed for easy identification if trapped again. Coates & Bishop (1997) and Eaton et al. (2016) were used for species identification and ageing of birds trapped. The morphometric measurements were taken: wing length (maximum chord), tarsus length (minimum), bill length (tip of bill to the base of the skull), skull length (base of the bill to the notch at the back of the head), bill depth (measured at the nares), tail length (longest tail feather from base to tip) and mass (grams) (Svensson, 1992; Redfern & Clark, 2001). All measurements were taken by a single recorder (NMM). Only adult birds were included in morphometric analyses. All morphometric data used in these analyses are available at https://figshare.com/articles/SE_Sulawesi_Zosterops_morphology/7998299/1. The Zosterops species of south-east Sulawesi are sexually monomorphic (Van Balen, 2018b, c), so sexes were not separated for morphometric analyses. Approximately 5–10 contour feathers were plucked from the flank of each bird and stored in sealed paper envelopes. Contour feathers were sampled to minimize the risk of injury to the birds and to avoid disruption to flight ability and plumage-based visual signals (McDonald & Griffith, 2011). Mist-netting was carried out in a variety of habitats used by Zosterops species, including plantation, forest edge, farmland and mangroves. Zosterops songs were recorded using a Zoom H2 Handy Recorder with a Sennheiser Me62 Omni-Directional Condenser Microphone Capsule with a K6 power supply. The microphone was mounted on a Telinga V2 Foldable Parabolic Reflector to minimize background noise. Songs were saved in a Waveform Audio File format for maximum song quality. As the song of the different focal Zosterops species is similar, the microphone operator was accompanied by another team member with binoculars to identify the species of each individual recorded. Recording was mainly carried out just after dawn and just before dusk, at the peaks of singing activity. To ensure each recording was of a separate individual, the song recording team walked a new 1-km transect route during each recording session and observed Zosterops flocks to ensure that the same individuals were not being recorded multiple times. In addition to these recordings, the xeno-canto bird sound collection (http:www.xeno-canto.org) was searched to source further recordings of our study species. DNA sequencing DNA was extracted from feathers using a Qiagen DNeasy Blood and Tissue Kit (Qiagen, California, USA), following the protocol of Kelly et al. (2014). We sequenced three mitochondrial genes: the entire second (1041 bp) and third (351 bp) subunits of mitochondrial nicotinamide adenine dinucleotide dehydrogenase (ND2 and ND3, respectively) and a 615-bp region of the cytochrome c oxidase subunit I (COI) gene. Several novel primers were developed for use in this study to amplify the selected regions (Supporting Information, Table S2). For primer development, suitable binding sites on either side of the regions we sought to amplify were identified by inspecting published Zosterops whole mitochondrial genomes (GenBank accession numbers: KX181885, NC_032058, KT194322, NC_027942, KC545407, NC_029146, KX181886, NC_032059 and KX181887). This allowed us to identify sites that were conserved between multiple Zosterops species, which would be suitable for binding by primers that conformed to the usual principles of primer design (Lustbader, 2015). The established primer L10755 was also used for ND3 (Chesser, 1999). The polymerase chain reaction (PCR) procedure was adapted from Kelly et al. (2014). All PCR amplifications were performed in 20 µL reactions, consisting of 8.1 µL double-distilled H20, 0.4 µL 10 mM deoxynucleoside triphosphates (dNTPs), 2 µL 10× PCR reaction buffer, 2.4 µL 25 mM MgCl2, 1 µL 10 µM forward primer, 1 µL 10 µM reverse primer, 0.1 µL Taq polymerase (New England Biolabs) and 5 µL template DNA. All reactions were amplified under the following thermal cycler conditions: 4 min at 94 °C followed by 45 cycles of 1 min at 94 °C, 1.5 min at the gene-specific annealing temperature (53 °C for ND2, 50 °C for ND3 and 55 °C for COI) and 1.5 min at 72 °C, finishing with 5 min at 72 °C. Amplified PCR products were screened on 2% agarose gels stained with Gel Red. Sanger sequencing was carried out in both directions by GATC Biotech (Cologne, Germany) using an ABI 3730xl DNA analyser system. All sequences were submitted to GenBank (Benson et al., 2013). The accession numbers of all sequences are provided in Supporting Information, Table S1. Taxon sampling In addition to our focal study populations in south-east Sulawesi, sequence information for Zosterops species and other comparison groups were sourced from GenBank (Benson et al., 2013) (accession numbers provided in Supporting Information, Table S1). ND2, ND3 and COI are widely used genes, allowing for comparisons with a large amount of published material to elucidate the evolutionary history of our target species. ND2 and ND3 sequences were concatenated and analysed separately to COI sequences, due to a much wider sample of Zosterops ND2 and ND3 genes being available on GenBank (Moyle et al., 2009; Wickramasinghe et al., 2017). Moyle et al. (2009) provided the only published sequences for an individual of our focal Zosterops species, a Z. chloris sampled in south Sulawesi. The ND2/ND3 analyses included 137 samples (56 produced by this study, 81 sourced from GenBank) representing 62 species; 51 Zosteropidae along with three Timaliidae, four Pellorneidae, one Passeridae, two Leiotrichidae and one Muscicapidae to serve as outgroup taxa (Supporting Information, Tables S1, S3). COI analyses included 108 samples (30 produced by this study, 78 sourced from GenBank) representing 22 species; 16 Zosteropidae along with four Timaliidae, one Vireonidae and one Muscicapidae to serve as outgroup taxa (Supporting Information, Tables S1, S4). Genetic sample sizes for each species are available in Supporting Information, Tables S3 & S4. All taxonomy was based on current Handbook of the birds of the world alive designations (del Hoya et al., 2018a). Phylogenetic and genetic analyses Sequences were aligned using ClustalW multiple alignment in BioEdit v.7.2.5 (Hall, 1999) and the ND2 and ND3 genes were concatenated using MESQUITE v.3.40 (Maddison & Maddison, 2018). Only one representative of each haplotype for ND2/ND3 and COI was included in the construction of the phylogenetic trees for the sampled species; a full list of the samples and their haplotypes is provided (Supporting Information, Table S1). The aligned ND2/ND3 samples were partitioned by gene and both concatenated ND2/ND3 and COI were partitioned by codon position for model selection (Angelis et al., 2018). Samples were partitioned by codon position, to allow for different substitution rates between positions (Shapiro et al., 2006). Modeltest was performed with MEGA X (Kumar et al., 2018). Using Bayesian Information Criterion (BIC) (Jhwueng et al., 2014) implemented in the ‘Find best DNA model’ tool (Kumar et al., 2018), the optimal nucleotide substitution model for each partition of the concatenated ND2/ND3 and COI data was selected and sequence summary information was produced (Supporting Information, Table S5). Using the partitioned model scheme selected (Supporting Information, Table S5), we carried out Maximum Likelihood analysis and Bayesian Phylogenetic Inference on our concatenated ND2/ND3 and COI data separately. Maximum Likelihood (ML) heuristic tree searches were performed using GARLI v.2.01 (Zwickl, 2006). To avoid local optima, 250 independent searches were performed, each starting from a random tree following Andersen et al. (2014). Searches were terminated when no topological improvements were found after 100 000 generations. All other parameters were left at default settings. Statistical support for the ML topology was assessed with 1000 nonparametric bootstrap replicates (Felsenstein, 1985) and a 50% majority-rule tree was generated in PAUP* 4.0b10 (Swofford, 2002). Bayesian Phylogenetic Inference (BI) was carried out using MrBayes v.3.2.6 (Ronquist & Huelsenbeck, 2003). We used two independent Markov chain Monte Carlo (MCMC) runs, with four chains per run, sampling every 1000 generations. Burnin and convergence were assessed using TRACER v.1.7.1 (Rambaut et al., 2018), burnin was set at 25% with convergence in runs accepted when the average standard deviation in split frequencies (ASDSF) reached 0.01 (Ronquist et al., 2012) and the effective sample size (ESS) of model parameters exceeded 200 (Drummond et al., 2006). The model of concatenated ND2/ND3 reached ASDSF 0.01 and an ESS of >200 for all model parameters after four million generations. The model for COI reached ASDSF 0.01 and an ESS of >200 for all model parameters after seven million generations. Phylogenetic tree topology was taken from the BI, with a 50% majority rule tree produced in FigTree v.1.4.3 (Rambaut, 2016). Annotations were added in INKSCAPE v.0.48.5 (Team Inkscape, 2018). TCS haplotype networks of the sampled Sulawesi Zosterops species were constructed with concatenated ND2/ND3 and with COI sequences using POPART (Leigh & Bryant, 2015). This allowed the connections between populations and haplotype sample sizes to be visualized. Molecular dating We estimated divergence times in BEAST v.2.4.8 (Drummond et al., 2002; Bouckaert et al., 2014). Concatenated ND2/ND3 sequences were used for divergence dating due to the wide array of comparison taxa (Moyle et al., 2009). The same partitioning scheme and model set was used as in the phylogenetic analysis (Supporting Information, Table S5). To allow different substitution models to be implemented for each partition, nucleotide substitution models were unlinked. Model calibration was provided by published geological information (Moyle et al., 2009) and substitution rates (Lerner et al., 2011). The estimated date of the divergence of Zosteropidae and Zosterornis (formerly Stachyris) from related taxa, given as 5.01 Myr (4.46–5.57 Myr) by Moyle et al. (2009), was used as a point calibration. This calibration was set as a normal distribution with mean 5.01 and sigma 0.555 (Wickramasinghe et al., 2017). Rates of evolution were set at 0.029 (lower bound: 0.024, upper bound: 0.033) and 0.024 (lower bound: 0.019, upper bound: 0.029) for ND2 and ND3, respectively, representing the number of substitutions per site per million years, derived from estimates produced by Lerner et al. (2011) for honeycreepers, following Linck et al. (2016). As no Zosterops fossil data are available for calibration, and the available rate calibrations for the target genes are not from close relatives of Zosterops, strict interpretation of divergence dating estimates presented here is not advised. Clock and tree models were linked between partitions (Drummond & Bouckaert, 2015). Following Baele et al. (2012), path sampling and stepping-stone sampling were carried out in BEAST to test for clock-like rates, by computing the marginal likelihood for each clock model (Lartillot & Philippe, 2006; Xie et al., 2011). A Relaxed Clock Log Normal clock model was found to have the highest marginal likelihood and was selected for use (Baele et al., 2012, 2013). A Yule speciation process was assumed for the tree model, following Wickramasinghe et al. (2017). We ran 10 independent MCMC chains for 100 million generations, sampling every 20 000 generations. We assessed burnin and convergence using TRACER v.1.7.1 (Rambaut et al., 2018) to confirm acceptable mixing, likelihood stationarity and ESS > 200 for all estimated parameters. Burnin was set at 25% for all runs. We used TreeAnnotator v.2.4.8 (Bouckaert et al., 2014) to summarize the posterior sample of phylogenetic time-trees produced by BEAST into a maximum clade credibility tree. This tree was visualized in FigTree v.1.4.3, displaying 95% highest posterior density (HPD) bars showing the estimate of node ages. Pairwise distance and molecular species delimitation Pairwise comparisons were carried out in MEGA X (Kumar et al., 2018) to calculate maximum, minimum and mean uncorrected proportional genetic distances (p-distances) within and between sampled Zosterops populations, for both longer mitochondrial genes: ND2 and COI. This outlined the level of within and between species genetic distance to be expected for Zosterops. Molecular species delimitation was carried out for sampled Zosterops populations to highlight populations for further assessment (see section Tobias scoring of species status). This was done for both ND2 and COI using Automatic Barcode Gap Discovery (ABGD). ABGD is a distance-based method developed by Puillandre et al. (2012) utilizing pairwise genetic distance calculations. This method groups individuals so that the distance between the sequences of two groups is always larger than a certain genetic distance threshold value termed the barcode gap. The barcode gap is a taxonomic group and gene-specific as it is dependent on the level of intraspecific and interspecific variation in the sampled group (Prévot et al., 2013). ABGD was run on the web-server http://wwwabi.snv.jussieu.fr/public/abgd/abgdweb.html using default settings (Pmin = 0.001, Pmax = 0.1, Steps = 10, X(relative gap width) = 1.5, Nb bins = 20) and a Kimura-2-Parameter (K2P) model (Kimura, 1980). Song data extraction Zosterops’ recordings were separated into calls and songs. Songs were selected to be analysed, as they are of principal importance in mediating species recognition (Uy et al., 2009). Sonograms were prepared and analysed using RAVEN PRO v.1.5 (Bioacoustics Research Program, 2018). Contrast and brightness were set to an equal level and the sharpness was set at 2000, all other settings were left at default (Ng et al., 2016). Recordings with clear sonograms, containing at least two discrete bursts of song, were chosen for analysis. Standard song traits were measured from the sonograms following Tobias et al. (2010): (1) total number of notes, (2) duration of song, (3) pace (number of notes divided by duration), (4) maximum frequency, (5) minimum frequency, (6) bandwidth (maximum minus minimum frequency) and (7) peak frequency (the frequency with the greatest amplitude) (Fig. 2). To account for intra-individual variation, intra-individual means were computed from an average of 6.13 songs (range 2–14) per individual (Potvin, 2013; Ng et al., 2016). These means were then used as sample points. All song data used in these analyses are available at https://figshare.com/articles/SE_Sulawesi_Zosterops_song/7998353. Figure 2. View largeDownload slide Typical Zosterops song burst as viewed in RAVEN PRO 1.5, illustrating some of the traits measured in this study. The individual shown is a Zosterops consobrinorum from Kabaena Island. Figure 2. View largeDownload slide Typical Zosterops song burst as viewed in RAVEN PRO 1.5, illustrating some of the traits measured in this study. The individual shown is a Zosterops consobrinorum from Kabaena Island. Morphometric and song analyses All morphometric and song statistical analyses were carried out in R Software v.3.4.2 (R Development Core Team, 2017). Histograms of each trait were first plotted to ensure normal distributions. Two types of analyses were carried out for both the morphometric and song data (separately), Principal Component Analysis (PCA) and Discriminant Function Analysis (DFA). PCA was carried out to capture the variance in the morphometric and song traits in a smaller number of principal components. A PCA was carried out for each of the analysis groups: (1) Z. chloris morphometrics, (2) Z. chloris song, (3) Z. consobrinorum and the ‘Wangi-wangi white-eye’ morphometrics and (4) Z. consobrinorum song. As the traits in each PCA were on different scales, all were re-scaled for inclusion in the PCA using the scale function in R, such that their means were = 0 and their variances were = 1 (Thomas et al., 2017). To test whether the different populations of our focal Zosterops species differed from each other in morphometrics or song, Analysis of Variance (ANOVA) was carried out on principal components with eigenvalues > 1. To ensure that the assumption of normality was not violated, Q–Q plots of the residuals of each ANOVA test were inspected. Tukey’s Honest Significant Difference (HSD) tests were used as post-hoc tests for ANOVAs, which returned significant results. DFA, conducted with package ‘MASS’ (Ripley et al., 2018), was used to identify axes that provided the most effective separation between pre-defined groups. For the DFA analyses, the groupings were taken from our molecular phylogenies and our analyses assessed how well (% grouping accuracy) the morphometric and song data for our study populations supported the phylogenetic groupings. DFA was carried out using the same groupings as in the PCA. Tobias scoring of species status To assess the species status of potentially novel Zosterops species addressed in this study, a Tobias scoring was carried out for any populations showing potential species-level genetic separation. The Tobias scoring system is used by the Handbook of the birds of the world and Birdlife International for their taxonomic assessments (del Hoyo et al., 2018a), based on the criteria outlined by Tobias et al. (2010). This system assesses phenotypic characteristics only (morphology, song and plumage) and does not take genetic results into account. A population must reach a Tobias score of seven to be considered a separate species. A detailed description of the criteria is supplied in the Supporting Information, Tobias Scoring for potentially novel Zosterops species. Ethics statement The necessary permits and approvals for this study were obtained from Kementerian Riset Teknologi Dan Pendidikan Tinggi (RISTEKDIKTI). Permit numbers: 0143/SlP/FRP/SM/Vll/2010, 278/SlP/FRP/SM/Vll/2012, 279/SIP/FRP/SM/VIII/2012, 174/SIP/FRP/E5/Dit.KI/V/2016, 159/SIP/FRP/E5/Fit.KIVII/2017 and 160/SIP/FRP/E5/Fit.KIVII/2017. We obtained prior permission from all landowners and no protected species were sampled. We are committed to reproducibility and aliquots of the extracted DNA for all sampled individuals are available upon request (subject to the Material Transfer policies of Trinity College Dublin, Halu Oleo University and RISTEKDIKTI). RESULTS Range extensions This study provides the first records of Z. chloris on Wawonii and Runduma Islands and of Z. consobrinorum on Muna Island (Van Balen, 2018b, c) (Fig. 1). Sequence production Sequencing of our focal Zosterops species focuses on the ND2 and ND3 genes, as they allow for comparison with the largest array of published Zosterops sequences (Moyle et al., 2009; Wickramasinghe et al., 2017). All individuals sequenced for ND2 were also sequenced for ND3, with a smaller sample of individuals sequenced for COI (Table 1; Supporting Information, Table S1). Table 1. Number of sequences produced for each of our focal species, for ND2/ND3 and for COI. The Sulawesi mainland and its continental islands are highlighted in bold, Wakatobi Islands are highlighted in italics and Runduma is treated as a separate oceanic island. Location for each individual sampled and GenBank accession numbers are provided in Supporting Information, Table S1 Island Zosterops chloris Zosterops consobrinorum Zos. sp. nov. ‘Wangi- wangi white-eye’ ND2/ND3 COI ND2/ND3 COI ND2/ND3 COI Mainland Sulawesi 12 4 6 2 - - Buton 5 2 5 3 - - Muna 4 - 1 - - - Kabaena 4 2 4 2 - - Wawonii 1 - - - - - Runduma 2 2 - - - - Wangi-wangi 2 2 - - 4 4 Kaledupa 2 4 - - - - Tomia 2 - - - - - Binongko 2 3 - - - - Total 36 19 16 7 4 4 Island Zosterops chloris Zosterops consobrinorum Zos. sp. nov. ‘Wangi- wangi white-eye’ ND2/ND3 COI ND2/ND3 COI ND2/ND3 COI Mainland Sulawesi 12 4 6 2 - - Buton 5 2 5 3 - - Muna 4 - 1 - - - Kabaena 4 2 4 2 - - Wawonii 1 - - - - - Runduma 2 2 - - - - Wangi-wangi 2 2 - - 4 4 Kaledupa 2 4 - - - - Tomia 2 - - - - - Binongko 2 3 - - - - Total 36 19 16 7 4 4 View Large Table 1. Number of sequences produced for each of our focal species, for ND2/ND3 and for COI. The Sulawesi mainland and its continental islands are highlighted in bold, Wakatobi Islands are highlighted in italics and Runduma is treated as a separate oceanic island. Location for each individual sampled and GenBank accession numbers are provided in Supporting Information, Table S1 Island Zosterops chloris Zosterops consobrinorum Zos. sp. nov. ‘Wangi- wangi white-eye’ ND2/ND3 COI ND2/ND3 COI ND2/ND3 COI Mainland Sulawesi 12 4 6 2 - - Buton 5 2 5 3 - - Muna 4 - 1 - - - Kabaena 4 2 4 2 - - Wawonii 1 - - - - - Runduma 2 2 - - - - Wangi-wangi 2 2 - - 4 4 Kaledupa 2 4 - - - - Tomia 2 - - - - - Binongko 2 3 - - - - Total 36 19 16 7 4 4 Island Zosterops chloris Zosterops consobrinorum Zos. sp. nov. ‘Wangi- wangi white-eye’ ND2/ND3 COI ND2/ND3 COI ND2/ND3 COI Mainland Sulawesi 12 4 6 2 - - Buton 5 2 5 3 - - Muna 4 - 1 - - - Kabaena 4 2 4 2 - - Wawonii 1 - - - - - Runduma 2 2 - - - - Wangi-wangi 2 2 - - 4 4 Kaledupa 2 4 - - - - Tomia 2 - - - - - Binongko 2 3 - - - - Total 36 19 16 7 4 4 View Large Phylogenetic analyses Results from our ML and Bayesian analyses produced highly concordant topologies for well-supported nodes for both concatenated ND2/ND3 and COI haplotypes. The concatenated ND2/ND3 tree is most informative, because more comparative material is available from GenBank. Zosterops chloris and Z. consobrinorum are close relatives, sharing a node with the black-crowned white-eye, Zosterops atrifrons (Vigors & Horsfield, 1827) (node support: BI–0.91, ML–84) (Fig. 3; Supporting Information, Fig. S1). For Z. chloris, there is a clear split between the Z. c. flavissimus population on the Wakatobi Islands and all other Z. chloris populations in ND2/ND3 (node support: BI–1.0, ML–100) (Fig. 3; Supporting Information, Fig. S3). All individuals from mainland south-east Sulawesi and the adjacent continental islands (Buton, Muna, Kabaena and Wawonii) group closely together. However, the mainland south-east Sulawesi population shows some divergence from the Z. c. intermedius population in south Sulawesi (ND2: 1.22%, see section Genetic distance) (node support: BI–1.0, ML–99). Therefore, the mainland south-east Sulawesi population is not assigned to this subspecies. The Runduma population is also distinct from the mainland south-east Sulawesi population (node support: BI–0.91, ML–99), although the split is shallower than that between the mainland south-east Sulawesi and south Sulawesi populations. The four groupings of Z. chloris: (1) Wakatobi Z. c. flavissimus, (2) south Sulawesi Z. c. intermedius, (3) south-east Sulawesi mainland and continental islands Z. chloris and (4) Runduma Island Z. chloris, show little within-group variability, but distinct splits between populations (Fig. 3; Supporting Information, Fig. S3). The majority of the ‘mainland south-east Sulawesi’ individuals share the same haplotype (ND2/ND3: hapCH02) (Supporting Information, Fig. S3, Table S1). The COI tree provides additional support for the taxonomic pattern seen in Z. chloris (Fig. 4; Supporting Information, Fig. S2), with a strong split between the Z. c. flavissimus population on the Wakatobi Islands and mainland south-east Sulawesi populations (node support: BI–1.0, ML–100) and a further shallower split between the Runduma Island population and the individuals sampled on mainland Sulawesi and its continental islands (node support: BI–1.0, ML–93). There is little within-group variability between haplotypes and distinct splits between these groups (Supporting Information, Fig. S4, Table S1). Figure 3. View largeDownload slide Bayesian consensus tree for concatenated ND2/ND3 haplotypes, showing Bayesian posterior probabilities (above) and bootstrap values from our Maximum Likelihood analysis (below) for each node. Haplotype number was given when there was more than one representative of a single taxon, with geographic information added with square brackets (single node) or curly brackets (multiple nodes) when that was informative to the pattern seen. Focal species highlighted in colour. Full tree with outgroups shown available in Supporting Information, Fig. S1. Figure 3. View largeDownload slide Bayesian consensus tree for concatenated ND2/ND3 haplotypes, showing Bayesian posterior probabilities (above) and bootstrap values from our Maximum Likelihood analysis (below) for each node. Haplotype number was given when there was more than one representative of a single taxon, with geographic information added with square brackets (single node) or curly brackets (multiple nodes) when that was informative to the pattern seen. Focal species highlighted in colour. Full tree with outgroups shown available in Supporting Information, Fig. S1. Figure 4. View largeDownload slide Bayesian consensus tree for COI haplotypes, showing Bayesian posterior probabilities (above) and bootstrap values from our Maximum Likelihood analysis (below) for each node. Haplotype number was given when there was more than one representative of a single taxon, with geographic information added with square brackets (single node) or curly brackets (multiple nodes) when that was informative to the pattern seen. Focal species highlighted in colour. Core Z. japonicus lineage collapsed as it was monophyletic. Full tree with outgroups shown available in Supporting Information, Fig. S2. Figure 4. View largeDownload slide Bayesian consensus tree for COI haplotypes, showing Bayesian posterior probabilities (above) and bootstrap values from our Maximum Likelihood analysis (below) for each node. Haplotype number was given when there was more than one representative of a single taxon, with geographic information added with square brackets (single node) or curly brackets (multiple nodes) when that was informative to the pattern seen. Focal species highlighted in colour. Core Z. japonicus lineage collapsed as it was monophyletic. Full tree with outgroups shown available in Supporting Information, Fig. S2. Zosterops consobrinorum displays an unusual pattern (Fig. 3; Supporting Information, Fig. S3). All mainland Sulawesi individuals group closely together (node support: BI–1.0, ML–73) and show only minor divergence from the most isolated Z. consobrinorum population on Kabaena Island in ND2/ND3. However, the Buton and Muna populations are suggested to be distinct (node support: BI–1.0, ML–88). In this population there is a further deeper split between individuals with the haplotypes hapCO11-12 (N = 2 from Buton) that are more closely related to the Kabaena and Sulawesi populations, and individuals with haplotypes hapCO10 and hapCO13 (N = 3 from Buton and N = 1 from Muna) that are much more distinct (node support: BI–1.0, ML–100) (Supporting Information, Fig. S3). Individuals from both of these divergent Buton/Muna populations are found at the same site on Buton (Kusambi, 5.153 S 122.895 E) (Supporting Information, Table S1). The mainland Sulawesi and Kabaena populations show no difference in COI, sharing the same haplotypes (Fig. 4; Supporting Information, Fig. S4, Table S1). The COI phylogeny also separates the Buton birds from those on mainland Sulawesi and Kabaena (node support: BI–1.0, ML–100), but with a shallower split then for ND2/ND3. The ‘Wangi-wangi white-eye’ is not closely related to Z. consobrinorum, as had been provisionally suggested (Van Balen, 2018c) (Fig. 3). It is a highly distinct taxon, most closely related to the Kolombangara white-eye, Zosterops murphyi (Hartert, 1929), the Rennell white-eye, Zosterops rennellianus (Murphy, 1929) and Z. griseotinctus; taxa found in the Solomon Islands (>3000 km distant) (node support: BI–0.75, ML–14). The COI tree lacks the depth of sampling in the genus Zosterops to provide any further insight into the evolutionary history of the ‘Wangi-wangi white-eye’, but confirms its difference from sequenced taxa (Fig. 4). In addition to our focal species, the phylogenetic analyses illustrated deep separations in the widespread species Z. palpebrosus, Z. japonicus and the African yellow white-eye, Zosterops senegalensis (Bonaparte, 1850) (Figs 3, 4). Divergence dating Our molecular clock shows that the Zosterops radiation began ~1.8 Mya (Fig. 5) as demonstrated in Moyle et al. (2009) and Wickramasinghe et al. (2017). Among our focal species, the ‘Wangi-wangi white-eye’ is estimated to have diverged 0.7–1.23 Mya. Precise dating for this taxon is difficult, as its closest relatives are Solomon Islands endemics, separated by a large geographic distance. Zosterops chloris diverged from Z. atrifrons and Z. consobrinorum 0.77–1.36 Mya. Zosterops c. flavissimus on the Wakatobi Islands diverged from Z. chloris mainland Sulawesi populations 0.38–0.8 Mya. This may mark the colonization of the Wakatobi Islands by Z. chloris. The south Sulawesi and south-east Sulawesi populations of Z. chloris then diverged 0.17–0.38 Mya, with a later divergence of the Runduma Island population from south-east Sulawesi mainland populations 0.08–0.22 Mya. Figure 5. View largeDownload slide Divergence dating of Zosterops species based on BEAST analysis on concatenated ND2/ND3 genes. The blue bars indicate 95% Highest Posterior Density (HPD) intervals. Figure 5. View largeDownload slide Divergence dating of Zosterops species based on BEAST analysis on concatenated ND2/ND3 genes. The blue bars indicate 95% Highest Posterior Density (HPD) intervals. Zosterops consobrinorum diverged from Z. atrifrons 0.57–1.21 Mya (Fig. 5). The unusual population structure in Z. consobrinorum from Buton and Muna makes estimating divergence dates challenging. Individuals with the ND2/ND3 haplotypes hapCO10 and hapCO13 (Buton and Muna) diverged from other populations 0.22–0.51 Mya. The remaining Buton individuals diverged 0.08–0.22 Mya. Divergence dating of the Kabaena population is also unclear and too shallow to offer sensible estimates. Genetic distance Calculations of pairwise genetic distance provides an indication of the level of divergence between the populations described in our phylogenetic trees. COI samples were not available for all populations, but COI distances are given where available. Pairwise distances between all Zosterops species sampled are available in the supplementary material (Supporting Information, Tables S6, S7). Zosterops chloris Mainland south-east Sulawesi (including continental islands) and south Sulawesi populations are divergent (ND2: 1.22%) as shown by our phylogenetic work. In the focal region, mainland south-east Sulawesi and the Wakatobi population are strongly divergent (ND2: 2.5%, COI: 4.9%). The Wakatobi population also differs from south Sulawesi (ND2: 2.05%) and Runduma (ND2: 2.35%, COI: 4.66%). The most closely related population to Runduma is that on mainland south-east Sulawesi (ND2: 0.73%, COI: 2.22%). Each population shows low within-group variability; mainland south-east Sulawesi (ND2: 0.09%, COI: 0.04%), Runduma (ND2: 0%, COI: 0%) and Wakatobi Islands (ND2: 0.04%, COI: 0.14%). Zosterops consobrinorum The Buton/Muna population differs in ND2 from the Sulawesi population (2.1%) and Kabaena population (1.9%), although the Buton population shows less difference in COI to Sulawesi/Kabaena (0.59%). Sulawesi and Kabaena populations differ little (ND2: 0.31%, COI: 0%). The Buton/Muna population shows high within-group variability for ND2 (ND2: 1.09%) in comparison to Sulawesi (ND2: 0.12%) and Kabaena (ND2: 0.29%) populations. COI is much less variable, with Buton populations showing only 0.11% within-group variation and the undifferentiated Sulawesi and Kabaena populations showing 0.08%. Zosterops sp. nov. The ‘Wangi-wangi white-eye’ is strongly distinct from all Z. consobrinorum populations (ND2: 6.23% and COI: 8.35% at a minimum) and all Z. chloris populations (ND2: 5.24% and COI: 7.17% at a minimum). The most closely related populations are Z. griseotinctus (ND2: 5.08%) and the lowland white-eye, Zosterops meyeni (Bonaparte, 1850) (COI: 6.78%). The ‘Wangi-wangi white-eye’ shows minor within-group variability (ND2: 0.29%, COI: 0.16%). Molecular species delimitation Automatic Barcode Gap Discovery (ABGD) analysis finds the barcoding gap between Zosterops species to be 3.5% (COI) and 1.3% (ND2) K2P genetic distance. For both genes, ABGD groups individuals from our focal Zosterops populations in Sulawesi into four putative species; Zosterops chloris from mainland south and south-east Sulawesi, the continental islands of Buton, Muna, Kabaena and Wawonii and Runduma Island (ND2 hapCH01-08, COI hapCH01-03; Supporting Information, Table S1). Zosterops c. flavissimus from the Wakatobi Islands (ND2 hapCH09-12, COI hapCH04-06). Zosterops consobrinorum – all sampled individuals (ND2 CO01-13, COI CO01-04) Zosterops sp. nov. ‘Wangi-wangi white-eye’ – all sampled individuals (ND2 hapCX01-03, COI hapCX01-02). Morphometric analyses A total of 752 Zosterops individuals from 11 islands were measured for these analyses; 575 Z. chloris, 139 Z. consobrinorum and 38 ‘Wangi-wangi white-eyes’ (Supporting Information, morphometric trait summaries, Tables S8–S11). The full morphometric database is available at https://figshare.com/articles/SE_Sulawesi_Zosterops_morphology/7998299/1. For analysis, the sampled individuals were grouped along the splits provided by the molecular phylogenies. Zosterops chloris individuals were classified into the groupings: mainland (Sulawesi mainland and the continental islands N = 168), Wakatobi (Z. c. flavissimus from the six Wakatobi Islands, N = 362) and Runduma (N = 45). Zosterops consobrinorum individuals were split into mainland Sulawesi (N = 48), Buton and Muna (N = 68) and Kabaena (N = 23) groups. ‘Wangi-wangi white-eyes’ (N = 38) were analysed with Z. consobrinorum to establish the level of separation between them. For Z. chloris morphometrics, PC1 (78% of the variance) and PC2 (8.3% of the variance) had eigenvalues > 1 and were carried forward for analyses. PC1 was loaded equally between the seven morphometric traits, giving a general indicator of body size (Supporting Information, Table S12). PC2 was largely loaded by bill length and skull length, giving a general indicator of bill to skull ratio. The Z. chloris populations are significantly different from each other in body size (PC1, ANOVA: F2, 572 = 554.5, P < 0.001), with the mainland, Wakatobi and Runduma populations all significantly different from each other (Tukey HSD, P adj. < 0.001 for all comparisons). Runduma individuals are the largest, followed by mainland individuals, with Wakatobi Z. c. flavissimus individuals being the smallest (Fig. 6; Supporting Information, Tables S8, S9). Zosterops chloris populations also significantly differ in bill to skull ratio (PC2, ANOVA: F2, 572 = 17.56, P < 0.001), with the Runduma population differing from mainland (Tukey HSD, P adj. < 0.001) and Wakatobi (Tukey HSD, P adj. < 0.001) populations (Fig. 6). Mainland and Wakatobi populations do not differ for PC2. This strong difference in the Runduma population in bill to skull ratio (PC2) is likely due to Runduma birds having the longest bill of any of the Z. chloris populations measured (Supporting Information, Tables S8, S9). Figure 6. View largeDownload slide Scatterplot of Zosterops chloris morphometric PCA. Black triangles represent individuals from mainland south-east Sulawesi and its continental islands, grey circles represent individuals from Runduma Island, green diamonds represent individuals from the Wakatobi Islands. Variance explained: PC1–78.3%, PC2–8.3%. Figure 6. View largeDownload slide Scatterplot of Zosterops chloris morphometric PCA. Black triangles represent individuals from mainland south-east Sulawesi and its continental islands, grey circles represent individuals from Runduma Island, green diamonds represent individuals from the Wakatobi Islands. Variance explained: PC1–78.3%, PC2–8.3%. For Z. consobrinorum and ‘Wangi-wangi white-eye’ morphometrics, only PC1 (88.7% of the variance) has an eigenvalue > 1 and is carried forward for analysis (Supporting Information, Table S12). PC1 is equally weighted between all seven morphometric traits and provided a general indicator of body size. The Z. consobrinorum populations and ‘Wangi-wangi white-eye’ differ significantly in body size (PC1, ANOVA: F3, 173 = 918.1, P < 0.001) (Fig. 7; Supporting Information, Tables S10, S11). The ‘Wangi-wangi white-eye’ is larger than all Z. consobrinorum populations (Tukey HSD, P adj. < 0.001 for all comparisons). The Z. consobrinorum Kabaena population is significantly larger than both the mainland Sulawesi and Buton/Muna population (Tukey HSD, P adj. < 0.001 for both comparisons). The mainland Sulawesi and Buton/Muna population do not differ in morphometric traits. Figure 7. View largeDownload slide Scatterplot of Zosterops consobrinorum and Zosterops sp. nov. (‘Wangi-wangi white-eye’) morphometric PCA. Black triangles represent Z. consobrinorum individuals from Buton and Muna Islands, red squares represent Z. consobrinorum individuals from mainland Sulawesi, green circles represent Z. consobrinorum individuals from Kabaena Island, blue diamonds represent the ‘Wangi-wangi white-eye’. Variance explained: PC1–88.7%, PC2–3.2%. Figure 7. View largeDownload slide Scatterplot of Zosterops consobrinorum and Zosterops sp. nov. (‘Wangi-wangi white-eye’) morphometric PCA. Black triangles represent Z. consobrinorum individuals from Buton and Muna Islands, red squares represent Z. consobrinorum individuals from mainland Sulawesi, green circles represent Z. consobrinorum individuals from Kabaena Island, blue diamonds represent the ‘Wangi-wangi white-eye’. Variance explained: PC1–88.7%, PC2–3.2%. Song analyses A total of 120 Zosterops individuals from seven islands had their song recorded for these analyses: 52 Z. chloris and 68 Z. consobrinorum (Supporting Information, song trait summaries, Tables S13–S16). No ‘Wangi-wangi white-eye’ songs were recorded. An additional three recordings were sourced from xeno-canto: two Z. chloris maxi recordings taken on Lombok (Lesser Sunda Islands; XC166854 and XC166855) and one Z. consobrinorum recording from Buton Island (XC333521). The full song database is available at https://figshare.com/articles/SE_Sulawesi_Zosterops_song/7998353. As with the morphometric analyses, for the song analyses Z. chloris individuals were split into mainland (N = 24) and Wakatobi (Z. c. flavissimus, N = 28) groups, with the addition of a Lombok group (N = 2). Zosterops consobrinorum individuals were split into mainland Sulawesi (N = 11), Buton and Muna (N = 31) and Kabaena (N = 27) groups. For Z. chloris song, PC1 (39.8% of the variance), PC2 (24.0%) and PC3 (16.4%) had eigenvalues > 1 and were carried forward for analyses (Supporting Information, Table S15). PC1 is most heavily loaded by the number of notes, duration, maximum frequency and bandwidth. PC2 is most heavily loaded by the temporal traits duration and pace. PC3 is most heavily loaded by minimum frequency and pace. The Z. chloris populations differ significantly in all comparisons (PC1, ANOVA: F2, 51 = 52.89, P < 0.001; PC2, ANOVA: F2, 51 = 6.073, P < 0.005; PC3, ANOVA: F2, 51 = 3.196, P < 0.05). All three populations are distinct (Fig. 8; Supporting Information, Tables S13–S15). The Z. chloris mainland population differs significantly from the Z. c. flavissimus Wakatobi population in PC1 (Tukey HSD, P adj. < 0.001) and from the Lombok population in PC1 and PC2 (Tukey HSD, P adj. < 0.001 and P adj. < 0.05, respectively). The Wakatobi and Lombok populations differ significantly in PC2 and PC3 (Tukey HSD, P adj. < 0.01 and < 0.05, respectively). Figure 8. View largeDownload slide Scatterplot of Zosterops chloris song PCA. Black triangles represent individuals from mainland south-east Sulawesi and its continental islands, green diamonds represent individuals from the Wakatobi Islands, blue circles represent individuals from Lombok. Variance explained: PC1–39.8%, PC2–24.0%. Figure 8. View largeDownload slide Scatterplot of Zosterops chloris song PCA. Black triangles represent individuals from mainland south-east Sulawesi and its continental islands, green diamonds represent individuals from the Wakatobi Islands, blue circles represent individuals from Lombok. Variance explained: PC1–39.8%, PC2–24.0%. For Z. consobrinorum song, PC1 (41.7% of the variance), PC2 (21.8%) and PC3 (16.2%) had eigenvalues > 1 and were carried forward for analyses (Supporting Information, Table S17). PC1 is most heavily loaded by duration, maximum frequency and bandwidth. PC2 is most heavily loaded by pace and peak frequency. PC3 is most heavily loaded by the number of notes, maximum frequency and bandwidth. The Z. consobrinorum Kabaena and Buton/Muna populations differ significantly in song PC1 (PC1, ANOVA: F2, 66 = 4.133, P < 0.05; Tukey HSD, P adj. < 0.05) (Fig. 9). There are no other significant differences in Z. consobrinorum song. Figure 9. View largeDownload slide Scatterplot of Zosterops consobrinorum song PCA. Black triangles represent Z. consobrinorum individuals from Buton and Muna Islands, red squares represent Z. consobrinorum individuals from mainland Sulawesi, green circles represent Z. consobrinorum individuals from Kabaena Island. Variance explained: PC1–41.7%, PC2–21.8%. Figure 9. View largeDownload slide Scatterplot of Zosterops consobrinorum song PCA. Black triangles represent Z. consobrinorum individuals from Buton and Muna Islands, red squares represent Z. consobrinorum individuals from mainland Sulawesi, green circles represent Z. consobrinorum individuals from Kabaena Island. Variance explained: PC1–41.7%, PC2–21.8%. Classification based on morphometric and song traits Discriminant Function Analysis (DFA) classification of Z. chloris individuals suggests a close match of morphometric and song traits for the taxonomic groupings identified in our molecular phylogeny (Table 2; Figs 3, 4). The sampling location of the majority of individuals can be accurately predicted from these traits. The ‘Wangi-wangi white-eye is 100% distinguishable in morphometrics from all Z. consobrinorum populations in the DFA analysis (Table 3). There is only a weak distinction between Z. consobrinorum populations. The Kabaena Z. consobrinorum is the most accurately classified in morphometrics and the Buton/Muna population shows the greatest classification accuracy in song, but both show a large degree of overlap with other Z. consobrinorum populations. The mainland Sulawesi population cannot be accurately classified, particularly with song traits. More Sulawesi individuals are classified as belonging to other islands than to Sulawesi. Table 2. View largeDownload slide Percentage classification accuracy of the DFA for morphometrics and song of Zosterops chloris. Sample sizes given are: N = morphometric sample size / song samples size. A dash indicates no sample available for that population. Results given indicate the % of individuals classified in that category, with morphometric results before the slash (/) and song results after. Shaded grey squares are the expected result, with the percentage in the shaded squares indicating what percentage of individuals from that population were correctly classified in the population from which they were sampled. All seven morphometric traits; wing, tail, tarsus, skull and bill length, bill depth and weight, were used. All seven song traits; number of notes, duration, pace, maximum, minimum and peak frequency and bandwidth, are also used Table 2. View largeDownload slide Percentage classification accuracy of the DFA for morphometrics and song of Zosterops chloris. Sample sizes given are: N = morphometric sample size / song samples size. A dash indicates no sample available for that population. Results given indicate the % of individuals classified in that category, with morphometric results before the slash (/) and song results after. Shaded grey squares are the expected result, with the percentage in the shaded squares indicating what percentage of individuals from that population were correctly classified in the population from which they were sampled. All seven morphometric traits; wing, tail, tarsus, skull and bill length, bill depth and weight, were used. All seven song traits; number of notes, duration, pace, maximum, minimum and peak frequency and bandwidth, are also used Table 3. View largeDownload slide Percentage classification accuracy of the DFA for morphometrics and song of Zosterops consobrinorum and the ‘Wangi-wangi white-eye’. Sample sizes given are: N = morphometric sample size / song samples size. A hyphen (-) indicates no sample available for that population. Results provided are: % of individuals classified in that category, with morphometric results before the slash (/) and song results after. Shaded grey squares are the predicted result, i.e. the population from which the individual was sampled. Morphometric traits wing, tail, tarsus, skull and bill length, bill depth and weight used. All seven song traits; number of notes, duration, pace, maximum, minimum and peak frequency and bandwidth, are also used Table 3. View largeDownload slide Percentage classification accuracy of the DFA for morphometrics and song of Zosterops consobrinorum and the ‘Wangi-wangi white-eye’. Sample sizes given are: N = morphometric sample size / song samples size. A hyphen (-) indicates no sample available for that population. Results provided are: % of individuals classified in that category, with morphometric results before the slash (/) and song results after. Shaded grey squares are the predicted result, i.e. the population from which the individual was sampled. Morphometric traits wing, tail, tarsus, skull and bill length, bill depth and weight used. All seven song traits; number of notes, duration, pace, maximum, minimum and peak frequency and bandwidth, are also used Tobias scoring For the Tobias scoring of phenotypic traits, the Wakatobi Z. c. flavissimus population is compared to the Z. chloris population from mainland south-east Sulawesi and its continental islands and the ‘Wangi-wangi white-eye’ was compared to Z. consobrinorum. Both Z. c. flavissimus (Tobias score: nine) and the ‘Wangi-wangi white-eye’ (Tobias score: seven) are identified as distinct species. Detailed scoring is provided in the Supplementary Information (Tables S18, S19). DISCUSSION Our results present evidence for a new species of Zosterops and that a subspecies of another Zosterops should be recognized as a full species, both from the same island archipelago in Sulawesi. The ‘Wangi-wangi white-eye’ is a genetically and phenotypically distinct species in need of recognition and formal description. It is reciprocally monophyletic from all other sampled Zosterops species. Zosterops c. flavissimus proves distinct in genetic, morphometric and song analyses. The first mention of the Wakatobi Z. c. flavissimus population by Hartert (1903) referred to it as a separate species, Zosterops flavissimus, although subsequent classifications of the avifauna in the region subsumed this population into Z. chloris. We propose that Z. c. flavissimus be once again recognized as a full species, Z. flavissimus the ‘Wakatobi white-eye’. The proposal to recognize these two new species is also supported by molecular species delimitation (ABGD) and the Tobias taxonomic scoring criteria (Supporting Information, Tobias scoring, Tables S18, S19; Tobias et al., 2010; Puillandre et al., 2012). Our results suggest that Sulawesi Z. chloris subspecies are in need of further revision. We do not recommend any change to the taxonomy of Z. consobrinorum, because populations of this species do not show consistent variation between genetic and phenotypic measures. Zosterops sp. nov. – the ‘wangi-wangi white-eye’ Due to its unique biogeographic position (Esselstyn et al., 2010), Sulawesi has particularly high endemism (Michaux, 2010). It also remains relatively poorly studied (Cannon et al., 2007) and novel taxa have been found on Sulawesi in recent years (Indrawan & Rasmussen, 2008; Esselstyn et al., 2012; Harris et al., 2014). However, these taxa were found in remote forested areas or on more isolated islands. The fact that the ‘Wangi-wangi white-eye’ occurs on a densely populated, environmentally degraded island is particularly remarkable. Most Wakatobi bird species descriptions date from the expedition of Heinrich Kühn (1901–02; Hartert, 1903). This single island endemic must have been overlooked. The ‘Wangi-wangi white-eye’ occurs in mixed-species flocks with Z. c. flavissimus on Wangi-wangi Island and exhibits the same generalist foraging habits common to Zosterops (Van Balen, 2008; Kelly, 2014). The ‘Wangi-wangi white-eye’ is a much larger bird than Z. chloris (Supporting Information, Tables S9, S11), likely facilitating niche partitioning between these congeneric species. It is relatively common on Wangi-wangi: in the 18 mist-netting sessions conducted on that island, 20% of birds caught were ‘Wangi-wangi white-eyes’ and 39% were Z. chloris. All netting was carried out in the scrub and forest edge habitats, which are the most common ecosystems on the island. ‘Wangi-wangi white-eyes’ shows tolerance of disturbed habitats, although they do not show the flexibility in habitat preference of Z. c. flavissimus (present in all habitats on the Wakatobi Islands) and were not present in mangroves. Concern for the future of the ‘Wangi-wangi white-eye’ is amplified by the small size of Wangi-wangi Island (155 km2) and that extensive surveys in south-east Sulawesi have shown it to be the only home of the ‘Wangi-wangi white-eye’ (it is absent from Oroho and Kapota, the satellite islands of Wangi-wangi). The authors recommend the collection of type specimens so that this species can be officially named and recognized, coupled with detailed surveys of Wangi-wangi Island to assess its distribution and density, and any conservation action required. A series of photos of this species are supplied in the Supporting Information to aid future field identification of this new taxon (Supplementary information, Tobias scoring, Table S19). The provisional classification of the ‘Wangi-wangi white-eye’ as a population of Z. consobrinorum (Van Balen, 2018c) is understandable. Both are pale-chested Zosterops separated by a short geographical distance (27 km between Buton and Wangi-wangi). Our work shows the closest relatives of the ‘Wangi-wangi white-eye’ are found in the Solomon Islands: Z. murphyi and Z. rennellianus (single island endemics) and Z. griseotinctus, a ‘supertramp’ species restricted to a series of small islands (Van Balen, 2018a). These taxa are all >3000 km distant from Wangi-wangi and are phenotypically distinct, all having yellow/green chests. The nodes placing the ‘Wangi-wangi white-eye’ in this clade have low support (Fig. 3), so its evolutionary origins remain uncertain. Sequencing of other Indo-Pacific Zosterops species that have not yet had their genetic data assessed, such as the black-ringed white-eye Zosterops anomalus (Meyer & Wiglesworth, 1896) from south Sulawesi, may shed light on this situation. The ‘Wangi-wangi white-eye’ may be a remnant of an older Zosterops radiation and represent the remaining relict taxon. Zosterops chloris – independent colonizations and the ‘Wakatobi white-eye’ This study clarifies a number of features about Sulawesi Z. chloris populations, while raising further questions. It appears from our data that white-eyes from the south-east Sulawesi mainland and its continental islands form a continuous population, rather than Z. c. intermedius being present on the continental islands and Z. c. mentoris on the mainland, as was suggested by Trochet et al. (2014). The mainland south-east Sulawesi population of Z. chloris is closely related to the south Sulawesi population (Z. c. intermedius), but shows sufficient divergence (ND2: 1.22%) that further investigation is required to clarify their taxonomy. Currently there is insufficient genetic or phenotypic data to classify Z. chloris from the mainland south-east Sulawesi population as either Z. c. intermedius or Z. c mentoris. Zosterops c. intermedius as currently defined includes populations from south Sulawesi, the continental islands of south-east Sulawesi and much of the Lesser Sunda Islands (Van Balen, 2018a). An assessment of the different populations currently assigned to Z. c. intermedius and Z. c. mentoris (isolated populations in central and northern Sulawesi) is needed to clarify the taxonomy of Z. chloris on mainland Sulawesi. Within south-east Sulawesi, the Runduma population of Z. chloris (first noted by this study) represents a recent independent colonization from a mainland south-east Sulawesi source population (Fig. 5), not from the Wakatobi Islands. This was an unexpected discovery, because the shortest distance between Runduma and the closest mainland population (Buton) is 123 km (Fig. 1). The distance between Runduma and its nearest Wakatobi Island neighbour is only 61 km. The Runduma population of another small passerine, the olive-backed sunbird Cinnyris jugularis (Linnaeus, 1766), appears to have colonized Runduma via the shorter distance from the Wakatobi Islands (Kelly, 2014). Given the isolation of Runduma and its tiny size (c. 5.5 km2), it was unsurprising that it was colonized much later than the Wakatobi Islands (Fig. 5). Runduma Z. chloris are morphologically distinct from other Z. chloris populations, showing the largest body size and longest bill length (Fig. 6; Supporting Information, Table S8). Larger bill and body size has been repeatedly observed to evolve in bird populations as an adaptation to a more generalist niche on small islands (Grant, 1965; Clegg & Owens, 2002; Clegg et al., 2002; Scott et al., 2003). Runduma Island is almost entirely covered in coconut plantations and the Z. chloris population has been observed to feed on coconut nectar more regularly on Runduma than elsewhere (DJK, pers. obs.). Thus, the longer bill may be an adaptation allowing the population to take advantage of an abundant resource in an ecologically constrained habitat. Such changes can be rapid and quickly come to fixation in a population (Bosse et al., 2017). This morphometric difference, coupled with the pairwise genetic distance (ND2: 0.73%, COI: 2.22%), between mainland Sulawesi and Runduma populations indicates there may be a subspecies level difference between them (Hebert et al., 2004). Future collection of song recordings and type specimens for assessment of more subtle plumage differences might prove useful in determining the taxonomic status of this population. Zosterops c. flavissimus (Wakatobi Islands) proved the most distinct of the Z. chloris populations sampled. It appears to have diverged much earlier (0.38–0.8 Mya) than any of the other Sulawesi populations of Z. chloris (Fig. 5). This was an older date of divergence than that of several recognized Zosterops species (Fig. 5). Zosterops c. flavissimus is morphometrically distinct from other Z. chloris populations (Fig. 6; Supporting Information, Tables S8, S9), being significantly smaller. Its song is highly distinct from mainland south-east Sulawesi Z. chloris (Fig. 8), with a generally higher maximum frequency and number of notes (Supporting Information, Tables S13, S14), which would be expected for a population with a smaller body size (Potvin, 2013). Zosterops c. flavissimus is also distinct from mainland south-east Sulawesi Z. chloris in plumage, with a more vibrant yellow head and paler bill (Supporting Information, Tobias scoring, Table S18). The pairwise difference between Z. c. flavissimus and mainland south-east Sulawesi Z. chloris (ND2: 2.5%, COI: 4.9%) is much larger than the average species difference (COI: 2.7%) that Hebert et al. (2004) found between North American birds, and is much more than 10 times the intra-group variation. In addition, our molecular species delimitation analyses (ABGD) highlights Z. c. flavissimus as a separate species. All of this evidence makes a strong case for the recognition of Z. c. flavissimus as a full species. While the gap between the Wakatobi Islands and Buton is small (27 km), differentiation over small, open-water gaps has been noted many times in the genus Zosterops (Mayr, 1942; Diamond, 1998; Mayr & Diamond, 2001). The isolation of the Wakatobi population may have been helped by a loss of dispersal ability during adaptation to the Wakatobi Islands (Supporting Information, assessment of dispersal ability, Fig. S5). Several type specimens of the Wakatobi Zosterops currently designated as Z. c. flavissimus are in the American Museum of Natural History’s collection (Supporting Information, Table S20) from the expedition of Heinrich Kühn (1901–02; Hartert, 1903), which should facilitate the promotion of this population to a full species as Z. flavissimus. Zosterops c. maxi from Lombok is also significantly different in song from other Z. chloris populations, although with a tiny sample size (N = 2). A much larger sample size and investigation of further traits would be needed to form a greater understanding of the relationship of Z. c. maxi to other Z. chloris populations. Zosterops consobrinorum – inconsistent variation between measures By providing the first detailed assessment of Z. consobrinorum, this study gives a first insight into its evolutionary history and emphasizes the need to use a combined approach when studying systematics and evolution. The fact that Z. atrifrons is the closest relative of Z. consobrinorum among the species sampled is not surprising. Zosterops atrifrons is a pale-chested, white-eye endemic to central and northern Sulawesi, showing geographic and phenotypic similarity (Van Balen, 2008). The unusual patterns of divergence between Z. consobrinorum populations emphasize how incorrect inferences can easily be drawn in phylogenetic studies, particularly when using a small number of mitochondrial genes. Due to unavoidable logistical constraints, many phylogeographic studies have relied on a small number of museum specimens from each individual population, or a single line of evidence, for assessing populations (genetic, phenotypic or acoustic). While phenotypic and genetic measures often provide the same answer (García et al., 2016), there are cases where they have been shown to differ (Phillimore et al., 2008; Potvin et al., 2013). While the Kabaena population of Z. consobrinorum is distinct in morphometrics and song (Figs 7, 9), it is almost inseparable from the mainland Sulawesi population in mitochondrial DNA (Figs 3, 4). This population has only been separated from mainland Sulawesi since the last glacial maximum (Voris, 2000). Kabaena is the smallest island (873 km2) that Z. consobrinorum was found on. This may have presented a more ecologically constrained environment for the Kabaena Z. consobrinorum population in comparison to the mainland (Lomolino & Weiser, 2001). The larger body size of the Kabaena Z. consobrinorum population (Fig. 7) may have been an adaptation to life on a smaller island (Clegg & Owens, 2002). Morphological adaptation to new environmental conditions can occur rapidly in birds and may not be related to change in neutral genetic markers like mitochondrial DNA, particularly over the short time -span Kabaena has been isolated (Nussey et al., 2005; Charmantier et al., 2008; Lande, 2009). As well as adaptation to local conditions, genetic drift can play a role in phenotypic change in island populations and may lead to rapid change in small populations on islands (Clegg et al., 2002; Runemark et al., 2010). The unusual population structure of the Buton/Muna Z. consobrinorum is more difficult to explain. Initial observations of the song and phenotype of the Buton population prompted suggestions it could be an independent subspecies (Wardill, 2003). This would be unexpected for an island only 6 km from Sulawesi, but not unprecedented (Mayr, 1942; Mayr & Diamond, 2001). This study finds no such differences, but there is strong genetic divergence in ND2/ND3 in half of the Buton birds and the single Muna bird sampled. That such genetically divergent individuals could be found at the same site on Buton (Kusambi, 5.153 °S, 122.895 °E) seems strange. The regular trading of Zosterops species as pets in Indonesia (Harris et al., 2017) may also have confused the pattern. Zosterops consobrinorum sing the most readily of our study species (pers. obs.) and are popular pets for that reason. It is entirely possible that the Buton/Muna population was originally more genetically distinct, but escaped Z. consobrinorum pets with mainland Sulawesi heritage may have bred with the local population, reducing any genetic divergence between Buton and Sulawesi (Laikre et al., 2010). There is no morphological distinction between Sulawesi, Buton or Muna birds, and a deeper genomic sampling would be needed to understand this pattern. The lack of morphometric divergence between the Buton and Muna populations may reflect the fact that they inhabit larger, more diverse islands than Kabaena (Buton–4408 km2; Muna–2890 km2), which are only separated by 0.6 km at their closest point. These two diverse islands may provide a less ecologically constrained environment (Lomolino & Weiser, 2001). Sampling from a larger number of sites, in a wider diversity of habitats, would allow greater understanding of the Buton and Muna populations and assess whether they are uniform in morphometrics throughout those islands. Considering all traits, together with ABGD classification of Z. consobrinorum as one species, we recommend no change to the taxonomy of Z. consobrinorum. CONCLUSIONS Studying ‘great speciator’ lineages of the Indo-Pacific, like Zosterops white-eyes, provides an excellent opportunity for both taxonomic revision and the examination of evolutionary processes. This study documents unrecorded endemism and different evolutionary histories in multiple Zosterops taxa and highlights the utility of using multiple measures of divergence to understand speciation. Our study species included an apparent ‘supertramp’ (Z. chloris), a regional endemic (Z. consobrinorum) and a single island endemic (‘Wangi-wangi white-eye’) (Eaton et al., 2016). This study found significant geographic structure to Z. chloris populations. However, the panmixia that would be expected of a true ‘supertramp’ was not apparent in Z. chloris, with the Wakatobi Z. c. flavissimus population deserving recognition as a separate species. This tallies with the recent assessment of the classic ‘supertramp’, Z. griseotinctus, by Linck et al. (2016), who found significant geographic and population structure. This may be an illustration of the rapid shifts in dispersal ability inferred to explain the paradox of ‘great speciator’ lineages (Diamond et al., 1976; Moyle et al., 2009). Our taxonomic considerations are given impetus by the discovery of a novel species on a small ecologically-degraded island. The ‘Wangi-wangi white-eye’ (first noted in 2003) still awaits formal description. This illustrates the administrative delays that can occur in conservation biology. We hope this study will prompt a deeper consideration of the birds of south-east Sulawesi and, in particular, the conservation of the endemic bird populations of the Wakatobi Islands. AUTHOR CONTRIBUTIONS DJK, NMM, KA, DOC and AK conceived this study and carried out fieldwork. DOC, NL and DJK carried out the lab work. DOC and DJK conducted genetic analyses. DOC extracted the song data and led the writing. DOC and KOB conducted the song and morphological analyses. DOC and DJK conducted plumage comparisons. FOM screened batches of recordings for clear Zosterops songs. All authors contributed to revising and improving the manuscript SUPPORTING INFORMATION Additional Supporting Information may be found in the online version of this article at the publisher's web-site. Figure S1.Full Bayesian consensus tree for concatenated ND2/ND3 haplotypes with outgroups shown, Bayesian posterior probabilities (above) and bootstrap values from our Maximum Likelihood analysis (below) are provided for each node. Solid grey lines used to indicate posterior probabilities and bootstrap values where there was not room by a node to note this. Haplotype number was given when there was more than one representative of a single taxon, with geographic information added with square brackets (single node) or curly brackets (multiple nodes) when that was informative to the pattern seen. Focal species highlighted in colour. Grey dashed lines used to space out species names. Branch lengths for outgroup root taxa reduced to save space. Figure S2.Bayesian consensus tree for COI haplotypes, showing Bayesian posterior probabilities (above) and bootstrap values from our Maximum Likelihood analysis (below) for each node. Haplotype number was given when there was more than one representative of a single taxon, with geographic information added with square brackets (single node) or curly brackets (multiple nodes) when that was informative to the pattern seen. Focal species highlighted in colour. Core Z. japonicus lineage collapsed as it was monophyletic. Branch lengths for outgroup root taxa reduced to save space. Figure S3. Haplotype network of sampled Sulawesi Zosterops populations samples, based on concatenated ND2/3 sequences. One bar indicates one mutation, black nodes are hypothetical ancestral states and the size of the circles corresponds to the number of sampled individuals sharing that haplotype. Figure S4. Haplotype network of sampled Sulawesi Zosterops populations samples, based on COI sequences. One bar indicates one mutation, black nodes are hypothetical ancestral states and the size of the circles corresponds to the number of sampled individuals sharing that haplotype. Assessment of dispersal ability: an assessment of the dispersal ability of the focal Zosterops populations using wingspan (S) to weight (m) ratio (S3/m) as a proxy of dispersal ability. Includes Figure S5: The wingspan/weight ratio (S3/m) of each Zosterops population identified in this study, providing an indication of their dispersal ability. Table S1. Full list of samples utilized in the phylogenetic analyses, detailing the species, sampling location and museum ID. Haplotypes identified for concatenated ND2 and ND3 sequences and for COI sequences in this study are listed. GenBank accession numbers are provided. Individuals are ordered by ND2/ND3 haplotype. Sulawesi samples collected under licence from Kementerian Negara Riset dan Teknologi (RISTEKDIKTI). Table S2. Novel primers developed for this study. Tables S3 & S4. Summary tables of taxa used in this study. Table S5. Phylogenetic models used for each partition and summary information about the sequence data used. Table S6. Pairwise distances between sampled Zosterops for ND2. Table S7. Pairwise distances between sampled Zosterops for COI. Tables S8–S11. Summary tables for the morphometric data used in this study, providing mean ± standard error and sample size from each island sampled. Tables S13–S16. Summary tables for the song data used in this study, providing mean ± standard error and sample size from each island sampled. Tables S12 & S17. PC trait loadings for PCAs on morphometric and song data. Tobias Scoring for potentially novel Zosterops species: an assessment of the taxonomic status of the potentially novel Zosterops species identified in this study using the Tobias Scoring criteria implemented by the Handbook of the Birds of the World. Includes Tables S18 & S19 featuring photographic comparisons of the potentially novel taxa. Table S20. Existing vouchered specimens of Zosterops chloris from south-east Sulawesi. ACKNOWLEDGEMENTS We thank Kementerian Riset Teknologi Dan Pendidikan Tinggi (RISTEKDIKTI) for providing the necessary permits and approvals for this study. We also thank Operation Wallacea for providing us with invaluable logistical support while working in Indonesia. This research was funded by the Irish Research Council (award number: 13046). The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript. We thank Frank Lambert and Joseph Monkhouse for making their Zosterops recordings available on xeno-canto. Finally, we like to thank all of the research assistants who contributed across many field seasons. We thank Louise Allcock, Maarten Christenhusz, Martin Husemann and one anonymous reviewer for their thoughtful comments, which greatly improved the manuscript. REFERENCES Andersen MJ , Oliveros CH , Filardi CE , Moyle RG . 2013 . Phylogeography of the variable dwarf-kingfisher Ceyx lepidus (Aves: Alcedinidae) inferred from mitochondrial and nuclear DNA sequences . The Auk 130 : 118 – 131 . Google Scholar Crossref Search ADS Andersen MJ , Nyári ÁS , Mason I , Joseph L , Dumbacher JP , Filardi CE , Moyle RG . 2014 . Molecular systematics of the world’s most polytypic bird: the Pachycephala pectoralis/melanura (Aves: Pachycephalidae) species complex . Zoological Journal of the Linnean Society 170 : 566 – 588 . Google Scholar Crossref Search ADS Andersen MJ , Shult HT , Cibois A , Thibault JC , Filardi CE , Moyle RG . 2015 . Rapid diversification and secondary sympatry in Australo-Pacific kingfishers (Aves: Alcedinidae: Todiramphus) . Royal Society Open Science 2 : 140375 . Google Scholar Crossref Search ADS PubMed Angelis K , Álvarez-Carretero S , Dos Reis M , Yang Z . 2018 . An evaluation of different partitioning strategies for Bayesian estimation of species divergence times . Systematic Biology 67 : 61 – 77 . Google Scholar Crossref Search ADS PubMed Baele G , Lemey P , Bedford T , Rambaut A , Suchard MA , Alekseyenko AV . 2012 . Improving the accuracy of demographic and molecular clock model comparison while accommodating phylogenetic uncertainty . Molecular Biology and Evolution 29 : 2157 – 2167 . Google Scholar Crossref Search ADS PubMed Baele G , Li WLS , Drummond AJ , Suchard MA , Lemey P . 2013 . Accurate model selection of relaxed molecular clocks in Bayesian phylogenetics . Molecular Biology and Evolution 30 : 239 – 243 . Google Scholar Crossref Search ADS PubMed Baker MC . 2012 . Silvereyes (Zosterops lateralis) song differentiation in an island-mainland comparison: analyses of a complex cultural trait . The Wilson Journal of Ornithology 124 : 454 – 466 . Google Scholar Crossref Search ADS Benson DA , Cavanaugh M , Clark K , Karsch-Mizrachi I , Lipman DJ , Ostell J , Sayers EW . 2013 . GenBank . Nucleic Acids Research 41 : D36 – D42 . Google Scholar Crossref Search ADS PubMed Bioacoustics Research Program. 2018 . Raven Pro: interactive sound analysis software, v.1.5. Ithaca : The Cornell Lab of Ornithology . Available at: http://www.birds.cornell.edu/raven (accessed 15 May 2018) . Bosse M , Spurgin LG , Laine VN , Cole EF , Firth JA , Gienapp P , Gosler AG , McMahon K , Poissant J , Verhagen I , Groenen MAM , van Oers K , Sheldon BC , Visser ME , Slate J . 2017 . Recent natural selection causes adaptive evolution of an avian polygenic trait . Science 358 : 365 – 368 . Google Scholar Crossref Search ADS PubMed Bouckaert R , Heled J , Kühnert D , Vaughan T , Wu CH , Xie D , Suchard MA , Rambaut A , Drummond AJ . 2014 . BEAST 2: a software platform for Bayesian evolutionary analysis . PLoS Computational Biology 10 : e1003537 . Google Scholar Crossref Search ADS PubMed Cannon CH , Summers M , Harting JR , Kessler PJA . 2007 . Developing conservation priorities based on forest type, condition, and threats in a poorly known ecoregion: Sulawesi, Indonesia . Biotropica 39 : 747 – 759 . Google Scholar Crossref Search ADS Charmantier A , McCleery RH , Cole LR , Perrins C , Kruuk LEB , Sheldon BC . 2008 . Adaptive phenotypic plasticity in response to climate change in a wild bird population . Science 320 : 800 – 803 . Google Scholar Crossref Search ADS PubMed Chesser RT . 1999 . Molecular systematics of the rhinocryptid genus Pteroptochus . Condor 101 : 439 – 446 . Google Scholar Crossref Search ADS Cibois A , Beadell JS , Graves GR , Pasquet E , Slikas B , Sonsthagen SA , Thibault J , Fleischer RC . 2011 . Charting the course of reed‐warblers across the Pacific islands . Journal of Biogeography 38 : 1963 – 1975 . Google Scholar Crossref Search ADS Cibois A , Thibault JC , Bonillo C , Filardi CE , Watling D , Pasquet E . 2014 . Phylogeny and biogeography of the fruit doves (Aves: Columbidae) . Molecular Phylogenetics and Evolution 70 : 442 – 453 . Google Scholar Crossref Search ADS PubMed Clark PU , Dyke AS , Shakun JD , Carlson AE , Clark J , Wohlfarth B , Mitrovica JX , Hostetler SW , McCabe AM . 2009 . The last glacial maximum . Science 325 : 710 – 714 . Google Scholar Crossref Search ADS PubMed Clegg SM , Owens PF . 2002 . The ‘island rule’ in birds: medium body size and its ecological explanation . Proceedings of the Royal Society B: Biological Sciences 269 : 1359 – 1365 . Google Scholar Crossref Search ADS Clegg SM , Degnan SM , Moritz C , Estoup A , Kikkawa J , Owens IPF . 2002 . Microevolution in island forms: the roles of drift and directional selection in morphological divergence of a passerine bird . Evolution 56 : 2090 – 2099 . Google Scholar Crossref Search ADS PubMed Coates BJ , Bishop KD . 1997 . A guide to the birds of Wallacea: Sulawesi, the Moluccas, and Lesser Sunda Islands, Indonesia. Alderley : Dove Publications . Collar NJ , Marsden SJ . 2014 . The subspecies of yellow-crested cockatoo Cacatua sulphurea . Forktail 30 : 23 – 27 . Cornetti L , Valente LM , Dunning LT , Quan X , Black RA , Hébert O , Savolainen V . 2015 . The genome of the ‘great speciator’ provides insights into bird diversification . Genome Biology and Evolution 7 : 2680 – 2691 . Google Scholar Crossref Search ADS PubMed Cox SC , Prys-Jones RP , Habel JC , Amakobe BA , Day JJ . 2014 . Niche divergence promotes rapid diversification of East African sky island white-eyes (Aves: Zosteropidae) . Molecular Ecology 23 : 4103 – 4118 . Google Scholar Crossref Search ADS PubMed Darwin C . 1859 . On the origins of species by means of natural selection. London : Murray . Diamond JM . 1972 . Biogeographic kinetics: estimation of relaxation times for avifaunas of southwest Pacific islands . Proceedings of the National Academy of Sciences 69 : 3199 – 3203 . Google Scholar Crossref Search ADS Diamond JM . 1974 . Colonization of exploded volcanic islands by birds: the supertramp strategy . Science 184 : 803 – 806 . Google Scholar Crossref Search ADS PubMed Diamond JM . 1975 . Assembly of species communities . In: Cody ML , MacArthur RH , Diamond JM , eds. Ecology and evolution of communities. Massachusetts : Harvard University Press , 342 – 444 . Diamond JM . 1981 . Flightlessness and fear of flying in island species . Nature 293 : 507 . Google Scholar Crossref Search ADS Diamond JM . 1984 . Distributions of New Zealand birds on real and virtual islands . New Zealand Journal of Ecology 7 : 37 – 55 . Diamond JM . 1998 . Geographic variation in vocalisations of the white-eye superspecies Zosterops [griseotinctus] in the New Georgia Group . Emu 98 : 70 – 74 . Google Scholar Crossref Search ADS Diamond JM , Gilpin ME . 1983 . Biogeographic umbilici and the origin of the Philippine avifauna . Oikos 41 : 307 – 321 . Google Scholar Crossref Search ADS Diamond JM , Gilpin ME , Mayr E . 1976 . Species-distance relation for birds of the Solomon Archipelago, and the paradox of the great speciators . Proceedings of the National Academy of Sciences 73 : 2160 – 2164 . Google Scholar Crossref Search ADS Dong L , Wei M , Alström P , Huang X , Olsson U , Shigeta Y , Zhang Y , Zheng G . 2015 . Taxonomy of the narcissus flycatcher Ficedula narcissina complex: an integrative approach using morphological, bioacoustic and multilocus DNA data . Ibis 157 : 312 – 325 . Google Scholar Crossref Search ADS Drummond AJ , Bouckaert RR . 2015 . Bayesian evolutionary analysis with BEAST. Cambridge : Cambridge University Press . Drummond AJ , Nicholls GK , Rodrigo AG , Solomon W . 2002 . Estimating mutation parameters, population history and genealogy simultaneously from temporally spaced sequence data . Genetics 161 : 1307 – 1320 . Google Scholar PubMed Drummond AJ , Ho SYW , Phillips MJ , Rambaut A . 2006 . Relaxed phylogenetics and dating with confidence . PLoS Biology 4 : e88 . Google Scholar Crossref Search ADS PubMed Eaton JA , van Balen B , Brickle NW , Rheindt FE . 2016 . Birds of the Indonesian Archipelago: Greater Sundas and Wallacea. Barcelona : Lynx Edicions . Elmer KR , Fan S , Gunter HM , Jones JC , Boekhoff S , Kuraku S , Meyer A . 2010 . Rapid evolution and selection inferred from the transcriptomes of sympatric crater lake cichlid fishes . Molecular Ecology 19 : 197 – 211 . Google Scholar Crossref Search ADS PubMed Esselstyn JA , Oliveros CH , Moyle RG , Peterson AT , McGuire JA , Brown RM . 2010 . Integrating phylogenetic and taxonomic evidence illuminates complex biogeographic patterns along Huxley’s modification of Wallace’s Line . Journal of Biogeography 37 : 2054 – 2066 . Google Scholar Crossref Search ADS Esselstyn JA , Achmadi AS , Rowe KC . 2012 . Evolutionary novelty in a rat with no molars . Biology Letters 8 : 990 – 993 . Google Scholar Crossref Search ADS PubMed Felsenstein J . 1985 . Confidence limits on phylogenies: an approach using the bootstrap . Evolution 39 : 783 – 791 . Google Scholar Crossref Search ADS PubMed García NC , Barreira AS , Lavinia PD , Tubaro PL . 2016 . Congruence of phenotypic and genetic variation at the subspecific level in a Neotropical passerine . Ibis 158 : 844 – 856 . Google Scholar Crossref Search ADS Genner MJ , Seehausen O , Lunt DH , Joyce DA , Shaw PW , Carvalho GR , Turner GF . 2007 . Age of cichlids: new dates for ancient lake fish radiations . Molecular Biology and Evolution 24 : 1269 – 1282 . Google Scholar Crossref Search ADS PubMed Gillespie RG , Baldwin BG , Waters JM , Fraser CI , Nikula R , Roderick GK . 2012 . Long-distance dispersal: a framework for hypothesis testing . Trends in Ecology & Evolution 27 : 47 – 56 . Google Scholar Crossref Search ADS PubMed Grant PR . 1965 . The adaptive significance of some size trends in island birds . Evolution 19 : 355 – 367 . Google Scholar Crossref Search ADS Habel JC , Cox S , Gassert F , Mulwa RK , Meyer J , Lens L . 2013 . Population genetics of the East African white-eye species complex . Conservation Genetics 14 : 1019 – 1028 . Google Scholar Crossref Search ADS Habel JC , Borghesio L , Newmark WD , Day JJ , Lens L , Husemann M , Ulrich W . 2015a . Evolution along the Great Rift Valley: phenotypic and genetic differentiation of East African white-eyes (Aves, Zosteropidae) . Ecology and Evolution 5 : 4849 – 4862 . Google Scholar Crossref Search ADS Habel JC , Husemann M , Ulrich W . 2015b . Patterns of contact call differentiation in the panmictic East African Abyssinian white-eye Zosterops abyssinicus (Aves: Passeriformes) . Ecology and Evolution 5 : 5974 – 5982 . Google Scholar Crossref Search ADS Hall TA . 1999 . BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT . Nucleic Acids Symposium Series 41 : 95 – 98 . Harris JBC , Rasmussen PC , Yong DL , Prawiradilaga DM , Putra DD , Round PD , Rheindt FE . 2014 . A new species of Muscicapa flycatcher from Sulawesi, Indonesia . PLoS ONE 9 : e112657 . Google Scholar Crossref Search ADS PubMed Harris JBC , Tingley MW , Hua F , Yong DL , Adeney JM , Lee TM , Marthy W , Prawiradilaga DM , Sekercioglu CH , Winarni N . 2017 . Measuring the impact of the pet trade on Indonesian birds . Conservation Biology 31 : 394 – 405 . Google Scholar Crossref Search ADS PubMed Hartert E . 1903 . On the birds collected on the Tukang-Besi Islands and Buton, south-east of Celebes, by Mr. Heinrich Kuhn . Novitates Zoologicae 10 : 18 – 38 . Hebert PDN , Stoeckle MY , Zemlak TS , Francis CM . 2004 . Identification of birds through DNA barcodes . PLoS Biology 2 : e312 . Google Scholar Crossref Search ADS PubMed Holloway JD . 1977 . The Lepidoptera of Norfolk Island . The Hague : Junk . del Hoyo J , Elliot A , Christie D . 2018a . Handbook of the birds of the world alive. Available at: www.hbw.com (accessed on 9 October 2018) . del Hoyo J , Elliot A , Christie D . 2018b . Handbook of the birds of the world alive taxonomic scoring system . Available at: https://www.hbw.com/taxonomic-scoring-system (accessed on 9 October 2018). Husemann M , Ulrich W , Habel JC . 2014 . The evolution of contact calls in isolated and overlapping populations of two white-eye congeners in East Africa (Aves, Zosterops) . BMC Evolutionary Biology 14 : 115 . Google Scholar Crossref Search ADS PubMed Husemann M , Cousseau L , Borghesio L , Lens L , Habel JC . 2015 . Effects of population size and isolation on the genetic structure of the East African mountain white-eye Zosterops poliogaster (Aves) . Biological Journal of the Linnean Society 114 : 828 – 836 . Google Scholar Crossref Search ADS Indrawan M , Rasmussen PC . 2008 . A new white-eye (Zosterops) from the Togian Islands, Sulawesi, Indonesia . The Wilson Journal of Ornithology 120 : 1 – 9 . Google Scholar Crossref Search ADS Irestedt M , Fabre PH , Batalha-Filho H , Jønsson KA , Roselaar CS , Sangster G , Ericson PGP . 2013 . The spatio-temporal colonization and diversification across the Indo-Pacific by a ‘great speciator’ (Aves, Erythropitta erythrogaster) . Proceedings of the Royal Society B: Biological Sciences 280 : 20130309 . Google Scholar Crossref Search ADS Jhwueng DC , Huzurbazar S , O’Meara BC , Liu L . 2014 . Investigating the performance of AIC in selecting phylogenetic models . Statistical Applications in Genetics and Molecular Biology 13 : 459 – 475 . Google Scholar Crossref Search ADS PubMed Jønsson KA , Irestedt M , Christidis L , Clegg SM , Holt BG , Fjeldså J . 2014 . Evidence of taxon cycles in an Indo-Pacific passerine bird radiation (Aves: Pachycephala) . Proceedings of the Royal Society B: Biological Sciences 281 : 20131727 . Google Scholar Crossref Search ADS Kelly SBA . 2014 . Integrative avian taxonomy and the role of competition in the diversification of passerine birds. Unpublished thesis, PhD Thesis, Trinity College Dublin. Kelly DJ , Marples NM . 2010 . Bird populations of the Wakatobi . In: Clifton J , Unsworth RKF , Smith DJ , eds. Marine research and conservation in the coral triangle: The Wakatobi National Park. New York : Nova , 149 – 170 . Kelly DJ , Marples NM , Singer HA . 2010 . A population of lemon-bellied white-eye Zosterops chloris from the south-eastern peninsula of Sulawesi . Forktail 26 : 138 – 139 . Kelly SBA , Kelly DJ , Cooper N , Bahrun A , Analuddin K , Marples NM . 2014 . Molecular and phenotypic data support the recognition of the Wakatobi flowerpecker (Dicaeum kuehni) from the unique and understudied Sulawesi region . PLoS ONE 9 : e98694 . Google Scholar Crossref Search ADS PubMed Kimura M . 1980 . A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences . Journal of Molecular Evolution 16 : 111 – 120 . Google Scholar Crossref Search ADS PubMed Kumar S , Stecher G , Li M , Knyaz C , Tamura K . 2018 . MEGA X: molecular evolutionary genetics analysis across computing platforms . Molecular Biology and Evolution 35 : 1547 – 1549 . Google Scholar Crossref Search ADS PubMed Laikre L , Schwartz MK , Waples RS , Ryman N , Group GW . 2010 . Compromising genetic diversity in the wild: unmonitored large-scale release of plants and animals . Trends in Ecology & Evolution 25 : 520 – 529 . Google Scholar Crossref Search ADS PubMed Lande R . 2009 . Adaptation to an extraordinary environment by evolution of phenotypic plasticity and genetic assimilation . Journal of Evolutionary Biology 22 : 1435 – 1446 . Google Scholar Crossref Search ADS PubMed Lartillot N , Philippe H . 2006 . Computing Bayes Factors using thermodynamic integration . Systematic Biology 55 : 195 – 207 . Google Scholar Crossref Search ADS PubMed Leigh JW , Bryant D . 2015 . PopArt: full‐feature software for haplotype network construction . Methods in Ecology and Evolution 6 : 1110 – 1116 . Google Scholar Crossref Search ADS Lerner HRL , Meyer M , James HF , Hofreiter M , Fleischer RC . 2011 . Multilocus resolution of phylogeny and timescale in the extant adaptive radiation of Hawaiian honeycreepers . Current Biology 21 : 1838 – 1844 . Google Scholar Crossref Search ADS PubMed Lim BTM , Sadanandan KR , Dingle C , Leung YY , Prawiradilaga DM , Irham M , Ashari H , Lee JGH , Rheindt FE . 2018 . Molecular evidence suggests radical revision of species limits in the great speciator white-eye genus Zosterops . Journal of Ornithology 160 : 1 – 16 . Google Scholar Crossref Search ADS Linck E , Schaack S , Dumbacher JP . 2016 . Genetic differentiation within a widespread ‘supertramp’ taxon: molecular phylogenetics of the Louisiade white-eye (Zosterops griseotinctus) . Molecular Phylogenetics and Evolution 94 : 113 – 121 . Google Scholar Crossref Search ADS PubMed Liu Y , Chen G , Huang Q , Jia C , Carey G , Leader P , Li Y , Zou F , Yang X , Olsson U . 2016 . Species delimitation of the white‐tailed rubythroat Calliope pectoralis complex (Aves, Muscicapidae) using an integrative taxonomic approach . Journal of Avian Biology 47 : 899 – 910 . Google Scholar Crossref Search ADS Lohman DJ , Ingram KK , Prawiradilaga DM , Winker K , Sheldon FH , Moyle RG , Ng PKL , Ong PS , Wang LK , Braile TM . 2010 . Cryptic genetic diversity in ‘widespread’ South-east Asian bird species suggests that Philippine avian endemism is gravely underestimated . Biological Conservation 143 : 1885 – 1890 . Google Scholar Crossref Search ADS Lomolino MV , Weiser MD . 2001 . Towards a more general species-area relationship: diversity on all islands, great and small . Journal of Biogeography 28 : 431 – 445 . Google Scholar Crossref Search ADS Lustbader R . 2015 . 4 tips for efficient primer design. Available at: http://www.genomecompiler.com/tips-for-efficient-primer-design/ (accessed 4 February 2016) . MacArthur RH , Wilson EO . 1967 . The theory of island biogeography. New Jersey : Princeton University Press . MacArthur RH , Diamond JM , Karr JR . 1972 . Density compensation in island faunas . Ecology 53 : 330 – 342 . Google Scholar Crossref Search ADS Maddison WP , Maddison DR . 2018 . Mesquite: a modular system for evolutionary analysis. Available at: https://www.mesquiteproject.org/Installation.html (accessed 2 February 2018). Mayr E . 1942 . Systematics and the origin of species. Harvard : Harvard University Press . Mayr E , Diamond JM . 2001 . The birds of northern Melanesia: speciation, ecology & biogeography. Oxford : Oxford University Press . McDonald PG , Griffith SC . 2011 . To pluck or not to pluck: the hidden ethical and scientific costs of relying on feathers as a primary source of DNA . Journal of Avian Biology 42 : 197 – 203 . Google Scholar Crossref Search ADS Mees GF . 1961 . A systematic review of the Indo-Australian Zosteropidae (Part II) . Zoologische Verhandelingen 50 : 1 – 168 . Mees GF . 1969 . A systematic review of the Indo-Australian Zosteropidae (Part III) . Zoologische Verhandelingen 102 : 1 – 390 . Meyer A . 1993 . Phylogenetic relationships and evolutionary processes in East African cichlid fishes . Trends in Ecology & Evolution 8 : 279 – 284 . Google Scholar Crossref Search ADS PubMed Michaux B . 2010 . Biogeology of Wallacea: geotectonic models, areas of endemism, and natural biogeographical units . Biological Journal of the Linnean Society 101 : 193 – 212 . Google Scholar Crossref Search ADS Milsom J , Ali J . 1999 . Structure and collision history of the Buton continental fragment, eastern Indonesia . AAPG Bulletin 83 : 1666 – 1689 . Moyle RG , Filardi CE , Smith CE , Diamond J . 2009 . Explosive Pleistocene diversification and hemispheric expansion of a ‘great speciator’ . Proceedings of the National Academy of Sciences 106 : 1863 – 1868 . Google Scholar Crossref Search ADS Ng EYX , Eaton JA , Verbelen P , Hutchinson RO , Rheindt FE . 2016 . Using bioacoustic data to test species limits in an Indo-Pacific island radiation of Macropygia cuckoo doves . Biological Journal of the Linnean Society 118 : 786 – 812 . Google Scholar Crossref Search ADS Nugraha AMS , Hall R . 2018 . Late Cenozoic palaeogeography of Sulawesi, Indonesia . Palaeogeography, Palaeoclimatology, Palaeoecology 490 : 191 – 209 . Google Scholar Crossref Search ADS Nussey DH , Postma E , Gienapp P , Visser ME . 2005 . Selection on heritable phenotypic plasticity in a wild bird population . Science 310 : 304 – 306 . Google Scholar Crossref Search ADS PubMed O’Connell DP , Sealy S , Ó Marcaigh F , Karya A , Bahrun A , Analuddin K , Kelly DJ , Marples NM . 2017 . The avifauna of Kabaena Island, south-east Sulawesi, Indonesia . Forktail 33 : 14 – 19 . O’Connell DP , Kelly DJ , Lawless N , Karya A , Analuddin K , Marples NM . 2019 . Diversification of a ‘great speciator’ in the Wallacea region: differing responses of closely related resident and migratory kingfisher species (Aves: Alcedinidae: Todiramphus) . Ibis (doi: https://doi.org/10.1111/ibi.12688) . Pedersen MP , Irestedt M , Joseph L , Rahbek C , Jønsson KA . 2018 . Phylogeography of a ‘great speciator’ (Aves: Edolisoma tenuirostre) reveals complex dispersal and diversification dynamics across the Indo‐Pacific . Journal of Biogeography 45 : 826 – 837 . Google Scholar Crossref Search ADS Phillimore AB , Owens IPF , Black RA , Chittock J , Burke T , Clegg SM . 2008 . Complex patterns of genetic and phenotypic divergence in an island bird and the consequences for delimiting conservation units . Molecular Ecology 17 : 2839 – 2853 . Google Scholar Crossref Search ADS PubMed Potvin DA . 2013 . Larger body size on islands affects silvereye Zosterops lateralis song and call frequency . Journal of Avian Biology 44 : 221 – 225 . Google Scholar Crossref Search ADS Potvin DA , Parris KM , Mulder RA . 2013 . Limited genetic differentiation between acoustically divergent populations of urban and rural silvereyes (Zosterops lateralis) . Evolutionary Ecology 27 : 381 – 391 . Google Scholar Crossref Search ADS Prévot V , Jordaens K , Sonet G , Backeljau T . 2013 . Exploring species level taxonomy and species delimitation methods in the facultatively self-fertilizing land snail genus Rumina (Gastropoda: Pulmonata) . PLoS ONE 8 : e60736 . Google Scholar Crossref Search ADS PubMed Puillandre N , Lambert A , Brouillet S , Achaz G . 2012 . ABGD, Automatic Barcode Gap Discovery for primary species delimitation . Molecular Ecology 21 : 1864 – 1877 . Google Scholar Crossref Search ADS PubMed Rambaut A . 2016 . FigTree 1.4.3 software. Institute of Evolutionary Biology, University of Edinburgh. Available at: http://tree.bio.ed.ac.uk/software/figtree/ (accessed 1 April 2018) . Rambaut A , Drummond AJ , Xie D , Baele G , Suchard MA . 2018 . Posterior summarisation in Bayesian phylogenetics using Tracer 1.7 . Systematic Biology 67 : 901 – 904 . Google Scholar Crossref Search ADS PubMed Redfern CPF , Clark JA . 2001 . Ringer’s manual, 4 th edn. Thetford : British Trust for Ornithology . Ripley B , Venables B , Bates DM , Hornik K , Gebhardt A , Firth D . 2018 . MASS: Support functions and datasets for Venables and Ripley’s MASS. R package version 7.3-51.1 Available at http://CRAN.R-project.org/package=MASS (accessed 31 October 2018). Robinson-Dean JC , Willmott KR , Catterall MJ , Kelly DJ , Whittington A , Phalan B , Marples NM , Boeadi DRS . 2002 . A new subspecies of red-backed thrush Zoothera erythronota kabaena subsp. nov. (Muscicapidae: Turdidae) from Kabaena island, Indonesia . Forktail 18 : 1 – 10 . Ronquist F , Huelsenbeck JP . 2003 . MrBayes 3: Bayesian phylogenetic inference under mixed models . Bioinformatics 19 : 1572 – 1574 . Google Scholar Crossref Search ADS PubMed Ronquist F , Teslenko M , van der Mark P , Ayres DL , Darling A , Höhna S , Larget B , Liu L , Suchard MA , Huelsenbeck JP . 2012 . MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space . Systematic Biology 61 : 539 – 542 . Google Scholar Crossref Search ADS PubMed Round PD , Manawattana S , Khudamrongsawat J , Thunhikorn S . 2017 . Disentangling avian diversity: South-East Asian mainland Oriental white-eye Zosterops palpebrosus constitutes two distinct lineages . Forktail 33 : 103 – 115 . Runemark A , Hansson B , Pafilis P , Valakos ED , Svensson EI . 2010 . Island biology and morphological divergence of the Skyros wall lizard Podarcis gaigeae: a combined role for local selection and genetic drift on color morph frequency divergence? BMC Evolutionary Biology 10 : 269 . Google Scholar Crossref Search ADS PubMed Scott SN , Clegg SM , Blomberg SP , Kikkawa J , Owens IP . 2003 . Morphological shifts in island-dwelling birds: the roles of generalist foraging and niche expansion . Evolution 57 : 2147 – 2156 . Google Scholar Crossref Search ADS PubMed Shapiro B , Rambaut A , Drummond AJ . 2006 . Choosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences . Molecular Biology and Evolution 23 : 7 – 9 . Google Scholar Crossref Search ADS PubMed Svensson L . 1992 . Identification guide to European passerines, 4 th edn. Stockholm : Lars Svensson . Swofford DL . 2002 . PAUP*. Phylogenetic Analysis Using Parsimony (* and other methods), v.4.0. Sunderland : Sinauer Associates . Team Inkscape . 2018 . Inkscape: a vector drawing tool, v.0.48.5. Available at: https://inkscape.org/ (accessed 2 April 2018) . Thomas R , Lello J , Medeiros R , Pollared A , Robinson P , Seward A , Smith J , Vafidis J , Vaughan I . 2017 . Data analysis with R statistical software: a guidebook for scientists. Newport : Eco-explore . Tobias JA , Seddon N , Spottiswoode CN , Pilgrim JD , Fishpool LDC , Collar NJ . 2010 . Quantitative criteria for species delimitation . Ibis 152 : 724 – 746 . Google Scholar Crossref Search ADS Trochet JA , Irham M , Hitch AT , Haryoko T , Ashari H , Putra DD , Engilis Jr A . 2014 . Range expansion of lemon-bellied white-eye Zosterops chloris and sooty-headed bulbul Pycnonotus aurigaster to South-East Sulawesi, Indonesia . Forktail 30 : 143 – 145 . Uy JAC , Moyle RG , Filardi CE . 2009 . Plumage and song differences mediate species recognition between incipient flycatcher species of the Solomon Islands . Evolution 63 : 153 – 164 . Google Scholar Crossref Search ADS PubMed Van Balen B . 2008 . Family Zosteropidae (White-eyes and Yuhinas) . In: del Hoyo J , Elliott A , Christie DA , eds. Handbook of the birds of the world. Barcelona : Lynx Edicions , 402 – 485 . Van Balen B . 2018a . Family Zosteropidae (White-eyes and Yuhinas) . In: del Hoyo J , Elliott A , Sargatal J , Christie DA , de Juana E , eds. Handbook of the birds of the world alive. Barcelona : Lynx Edicions . Available at: https://www.hbw.com/node/52351 (accessed 12 November 2018) . Van Balen B . 2018b . Lemon-bellied white-eye (Zosterops chloris) . In: del Hoyo J , Elliott A , Sargatal J , Christie DA , de Juana E , eds. Handbook of the birds of the world alive. Barcelona : Lynx Edicions . Available at: https://www.hbw.com/node/60176 (accessed 30 July 2018). Van Balen B . 2018c . Pale-bellied white-eye (Zosterops consobrinorum) . In: del Hoyo J , Elliott A , Sargatal J , Christie DA , de Juana E , eds. Handbook of the birds of the world alive. Lynx Edicions . Available at: https://www.hbw.com/node/60178 (accessed 30 July 2018) . Voris HK . 2000 . Maps of Pleistocene sea levels in South-east Asia: shorelines, river systems and time durations . Journal of Biogeography 27 : 1153 – 1167 . Google Scholar Crossref Search ADS Wallace AR . 1869 . The Malay Archipelago: the land of the orangutan, and the bird of paradise. A narrative of travel, with studies of man and nature. New York : Harper & Brothers . Wardill JC . 2003 . New distributional records and notes on the pale-bellied white-eye Zosterops consobrinorum . Kukila 12 : 12 – 16 . Warren BH , Bermingham E , Prys‐Jones RP , Thebaud C . 2006 . Immigration, species radiation and extinction in a highly diverse songbird lineage: white‐eyes on Indian Ocean islands . Molecular Ecology 15 : 3769 – 3786 . Google Scholar Crossref Search ADS PubMed Wells DR . 2017 . Zosterops white-eyes in continental South-East Asia. 1: proposed refinements to the regional definition of Oriental white-eye Z. palpebrosus . Bulletin of the British Ornithologists’ Club 137 : 100 – 109 . Google Scholar Crossref Search ADS Wickramasinghe N , Robin VV , Ramakrishnan U , Reddy S , Seneviratne SS . 2017 . Non-sister Sri Lankan white-eyes (genus Zosterops) are a result of independent colonizations . PLoS ONE 12 : e0181441 . Google Scholar Crossref Search ADS PubMed Wood JR , Lawrence HA , Scofield RP , Taylor GA , Lyver PO , Gleeson DM . 2016 . Morphological, behavioural, and genetic evidence supports reinstatement of full species status for the grey-faced petrel, Pterodroma macroptera gouldi (Procellariiformes: Procellariidae) . Zoological Journal of the Linnean Society 179 : 201 – 216 . Wright NA , Steadman DW , Witt CC . 2016 . Predictable evolution toward flightlessness in volant island birds . Proceedings of the National Academy of Sciences 113 : 4765 – 4770 . Google Scholar Crossref Search ADS Xie W , Lewis PO , Fan Y , Kuo L , Chen MH . 2011 . Improving marginal likelihood estimation for Bayesian phylogenetic model selection . Systematic Biology 60 : 150 – 160 . Google Scholar Crossref Search ADS PubMed Yokoyama Y , Lambeck K , De Deckker P , Johnston P , Fifield LK . 2000 . Timing of the Last Glacial Maximum from observed sea-level minima . Nature 406 : 713 – 716 . Google Scholar Crossref Search ADS PubMed Zwickl DJ . 2006 . Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Unpublished PhD Thesis, The University of Texas at Austin . © 2019 The Linnean Society of London, Zoological Journal of the Linnean Society This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

journal article

LitStream Collection

Repeated evolution of flightlessness in Dryolimnas rails (Aves: Rallidae) after extinction and recolonization on Aldabra

Hume, Julian, P;Martill,, David

2019 Zoological Journal of the Linnean Society

doi: 10.1093/zoolinnean/zlz018

Abstract The Aldabra rail, Dryolimnas cuvieri subsp. aldabranus, endemic to the Aldabra Atoll, Seychelles, is the last surviving flightless bird in the Indian Ocean. Aldabra has undergone at least one major, total inundation event during an Upper Pleistocene (Tarantian age) sea-level high-stand, resulting in the loss of all terrestrial fauna. A flightless Dryolimnas has been identified from two temporally separated Aldabran fossil localities, deposited before and after the inundation event, providing irrefutable evidence that a member of Rallidae colonized the atoll, most likely from Madagascar, and became flightless independently on each occasion. Fossil evidence presented here is unique for Rallidae and epitomizes the ability of birds from this clade to successfully colonize isolated islands and evolve flightlessness on multiple occasions. Aldabra Atoll, fossil, flightless, extinction, sea-level rise, recolonization INTRODUCTION The white-throated rail, Dryolimnas cuvieri (Pucheran, 1845), is indigenous to islands in the south-western Indian Ocean and occurs widely throughout the region (Fig. 1) where it is known to include three subspecies. Volant D. c. subsp. cuvieri is found today on Madagascar and Mayotte (Safford & Hawkins, 2013), with a totally flightless derivative on Aldabra, D. c. subsp. aldabranus (Günther, 1879), the last surviving flightless rail in the Indian Ocean (Stoddart & Wright, 1967), and a poorly volant/flightless subspecies, D. c. subsp. abbotti (Ridgway, 1894) formerly on Assumption (Nicoll, 1908), which became extinct between 1907 and 1937 (Safford & Hawkins, 2013; Hume, 2017). Possibly distinct, but now extinct, rail populations reputedly occurred on Ile aux Cèdres (Aldabra), Cosmoledo Atoll and Astove Island (Collar, 1993) (Figs 1, 2), but no specimens were collected to confirm their status. However, a distinct Dryolimnas population on the tiny islet of Ile aux Cèdres in the Aldabra lagoon appears unlikely. In addition, two Dryolimnas species once inhabited the Mascarenes: the large, flightless Réunion rail, D. augustiMourer-Chauviré et al., 1999, which survived until at least the end of the 17th century (Mourer-Chauviré et al., 1999), and a probably flightless, undescribed Dryolimnas from Mauritius that was last recorded in 1638 (Hume, 2013, 2017). Figure 1. View largeDownload slide Outline map of the south-western Indian Ocean showing the distribution of Dryolimnas: Dryolimnas c. cuvieri; D. c. aldabranus; †D. c. abbotti; †D. augusti; †D. sp. † = extinct. Figure 1. View largeDownload slide Outline map of the south-western Indian Ocean showing the distribution of Dryolimnas: Dryolimnas c. cuvieri; D. c. aldabranus; †D. c. abbotti; †D. augusti; †D. sp. † = extinct. Figure 2. View largeDownload slide Outline map of Aldabra Atoll indicating the fossil localities discussed in the text. Adapted from Hume et al. (2018). Figure 2. View largeDownload slide Outline map of Aldabra Atoll indicating the fossil localities discussed in the text. Adapted from Hume et al. (2018). The discovery of fossil remains of a flightless Dryolimnas (two humeri) at Bassin Cabri on Ile Picard confirms the presence of the bird on Aldabra during the Middle Pleistocene (Chibanian age) to the Upper Pleistocene (Tarantian age; Hume et al., 2018) (Fig. 2). The absolute maximum age of the Aldabra Atoll is unknown, but inferences made from sea-level high-stands dating back 400 000 years before present (YBP) show that the Aldabra platform was subject to at least one total inundation event around 340 000 YBP, with possibly two others at 240 000 and 200 000 YBP, respectively (Braithwaite et al., 1973; Braithwaite, 1984) (Fig. 3). An undated limestone depositional sequence (Picard Calcarenites) exposed on present-day Ile Picard must be in excess of 136 000 YBP, as the younger, overlying and island-wide Aldabra Limestone has been dated from Ile Picard deposits between 136 000 (Middle Pleistocene) and 118 000 (Upper Pleistocene) YBP ± 9000 (~127 000+) (Thomson & Walton, 1972; Braithwaite et al., 1973) (Fig. 3), which represents the most recent complete inundation event. The Bassin Cabri cavity-fill fossil material accumulated during this period (for a detailed depositional history see: Braithwaite et al., 1973). After the deposition of the Aldabra Limestone, and with falling sea levels, terrestrial soils were created. A reptile-rich fossil deposit formed at Point Hodoul (inferred date ~100 000 YBP; Taylor et al., 1979), which included a distal tarsometatarsus of a Dryolimnas rail (Harrison & Walker, 1978). Figure 3. View largeDownload slide Figure showing the sea-level curve and possible inundation events that affected the Aldabra platform in the last 400 000+ YBP. The 118 000 and 136 000 YBP ± 9000 (~127 000+) sea-level high-stand separates the Ile Picard and Point Hodoul fossil localities. Adapted from Perry & Hsu (2000) and Andreas et al. (2012). Figure 3. View largeDownload slide Figure showing the sea-level curve and possible inundation events that affected the Aldabra platform in the last 400 000+ YBP. The 118 000 and 136 000 YBP ± 9000 (~127 000+) sea-level high-stand separates the Ile Picard and Point Hodoul fossil localities. Adapted from Perry & Hsu (2000) and Andreas et al. (2012). MATERIAL AND METHODS Specimens Two humeri held at the Smithsonian Institution National Museum of Natural History (USNM) and a distal tarsometatarsus held at the Natural History Museum, London (NHMUK) of Pleistocene Dryolimnas cuvieri were compared with modern specimens held at the Natural History Museum, Tring (NHMUK) of D. c. cuvieri, D. c. aldabranus and a unique skeleton of the extinct, D. c. abbotti (Supporting Information, Tables S1, S2). Morphometric analysis Measurements were taken using a dial calliper and rounded to the nearest 0.1mm. Only humeri and distal tarsometatarsi were available, so measurements of total length, proximal width, proximal depth, shaft width, shaft depth, distal width and distal depth of humerus (Supporting Information, Table S1) and distal width, distal depth and greatest depths taken proximal to trochlea. Metatarsi II were used for tarsometatarsus (Supporting Information, Table S2). Anatomical terminology follows Baumal & Witmer (1993). RESULTS Morphology The rail humeri from Bassin Cabri are almost undifferentiated from modern D. c. aldabranus, other than being more robust proximally, with the crista bicipitalis more expanded, the shaft more robust and straighter, and the epicondylus dorsalis less pronounced. Like D. c. aldabranus, it also differs considerably in size from D. c. cuvieri and D. c. abbotti (Fig. 4; Supporting Information, Tables S1, S3). In the few morphometrics available from the tarsometatarsus, the Point Hodoul specimen shows a very similar morphology to D. c. aldabranus and D. c. abbotti compared with nominate, with the foramen vasculare distale more deeply situated and further distad, the incisura intertrochlearis more open and trochlea. metatarsi II larger and directed further mediad (Fig. 5; Supporting Information, Tables S2, S4); characters indicative of flightlessness (Olson, 1977). The more robust distal end of the tarsometatarsus in the Pleistocene specimen, together with the depth of the shaft proximal to the trochlea also greater than in nominate, suggests that Dryolimnas had become more terrestrial and flightless. Figure 4. View largeDownload slide A comparison of humeri (left side) of Dryolimnas used in this study. From left to right: D. cuvieri aldabranus NHMUK S/1989.38.7 ♂; D. cuvieri (Upper Pleistocene) USNM UJP79 unsexed; D. c. abbotti NHMUK 1910.4.8.1 unsexed; D. c. cuvieri NHMUK 1897.5.10.47 unsexed. Scale bar = 10mm. From Hume et al. (2018). Figure 4. View largeDownload slide A comparison of humeri (left side) of Dryolimnas used in this study. From left to right: D. cuvieri aldabranus NHMUK S/1989.38.7 ♂; D. cuvieri (Upper Pleistocene) USNM UJP79 unsexed; D. c. abbotti NHMUK 1910.4.8.1 unsexed; D. c. cuvieri NHMUK 1897.5.10.47 unsexed. Scale bar = 10mm. From Hume et al. (2018). Figure 5. View largeDownload slide A comparison of tarsometatarsi (right side) of Dryolimnas used in this study. From left to right: D. cuvieri (Upper Pleistocene) NHMUK A4380 unsexed; D. cuvieri aldabranus NHMUK S/1989.38.7 ♂; D. c. abbotti NHMUK 1910.4.8.1 unsexed; D. c. cuvieri NHMUK 1897.5.10.47 unsexed. Scale bar = 10mm. Figure 5. View largeDownload slide A comparison of tarsometatarsi (right side) of Dryolimnas used in this study. From left to right: D. cuvieri (Upper Pleistocene) NHMUK A4380 unsexed; D. cuvieri aldabranus NHMUK S/1989.38.7 ♂; D. c. abbotti NHMUK 1910.4.8.1 unsexed; D. c. cuvieri NHMUK 1897.5.10.47 unsexed. Scale bar = 10mm. DISCUSSION The complete inundation of the Aldabra Atoll during deposition of the Aldabra Limestone resulted in the extinction of the endemic Aldabra petrel Pterodroma kurodai Harrison & Walker, 1978, Aldabra duck Aldabranus cabri Harrison & Walker, 1978 and loss of other bird taxa, including the flightless Dryolimnas rail (Harrison & Walker, 1978; Taylor et al., 1979). A number of reptiles also disappeared, including an endemic horned crocodile Aldabrachampsus dilophus Brochu, 2006, the giant tortoise Aldabrachelys cf. gigantea Loveridge & Williams, 1957, an Oplurus iguana and terrestrial skinks (Arnold, 1979). At the younger Point Hodoul fossil deposit, the occurrence of giant tortoise, iguana, skinks and Dryolimnas show that the atoll was seemingly rapidly recolonized on re-emergence, at least from 100 000 YBP (Taylor et al., 1979). The presence of Dryolimnas at both deposits requires explanation. The Bassin Cabri humeri indicate the rail was already flightless at ~127 000+ YBP during the Middle Pleistocene (Fig. 6); therefore, it must have disappeared, along with the other terrestrial fauna, when the atoll was completely submerged (Thomson & Walton, 1972; Taylor et al., 1979). Furthermore, characters of the tarsometatarsus in the Pleistocene specimen suggest that it had evolved a degree of flightlessness at least comparable with D. c. abbotti (Harrison & Walker, 1978), being shorter and more robust than the nominate and D. c. aldabranus (Fig. 7). This, and its presence on Aldabra today, provides irrefutable evidence that Dryolimnas subsequently recolonized Aldabra after inundation and became flightless for a second time. This scenario may seem surprising, but rails are known to be persistent colonizers of isolated islands and can evolve flightlessness rapidly if suitable conditions exist (Olson, 1977). Therefore, it is likely that the dispersal of nominate Dryolimnas from Madagascar to remote Aldabra occurred on multiple occasions, as did giant tortoises (Taylor et al., 1979). The Point Hodoul fossil record shows that the giant tortoise, iguana, a number of lizard taxa and Dryolimnas successfully recolonized the atoll (Hume et al. 2018), but the iguana and most other lizards subsequently perished. Based on the geological record (Braithwaite et al., 1973), this extinction event appears to be unrelated to inundation and may have been the result of introduced black rats Rattus rattus (Linneaus, 1758), which were present on Aldabra in 1890 (Cheke, 2010) but no doubt arrived much earlier. Figure 6. View largeDownload slide Density plots of measurements (mm) of the humerus of Dryolimnas, showing that Pleistocene Dryolimnas cuvieri nestles in with the flightless species. Abbreviations: TL, total length; PW, proximal width; PD, proximal depth; SW, shaft width; SD, shaft depth; DW, distal width; DD, distal depth; (n), number of specimens; (m), mean; SD, Standard Deviation. Figure 6. View largeDownload slide Density plots of measurements (mm) of the humerus of Dryolimnas, showing that Pleistocene Dryolimnas cuvieri nestles in with the flightless species. Abbreviations: TL, total length; PW, proximal width; PD, proximal depth; SW, shaft width; SD, shaft depth; DW, distal width; DD, distal depth; (n), number of specimens; (m), mean; SD, Standard Deviation. Figure 7. View largeDownload slide Density plots of measurements (mm) of the tarsometatarsus of Dryolimnas, showing that Pleistocene Dryolimnas cuvieri approximates flightless species. Abbreviations: DW, distal width; DD, distal depth; TMD, greatest depth taken proximal to trochlea. metatarsi II; (n), number of specimens; (m), mean; SD, Standard Deviation. Figure 7. View largeDownload slide Density plots of measurements (mm) of the tarsometatarsus of Dryolimnas, showing that Pleistocene Dryolimnas cuvieri approximates flightless species. Abbreviations: DW, distal width; DD, distal depth; TMD, greatest depth taken proximal to trochlea. metatarsi II; (n), number of specimens; (m), mean; SD, Standard Deviation. Only relatively few taxa from the Middle to Upper Pleistocene fossil deposits on Aldabra survived into the Holocene. Of those that did, apart from breeding sea birds, the most notable are adept open-water travellers, including giant tortoises (by floating) (Gerlach et al., 2006) and Dryolimnas rails (periodic, long-distance flight dispersal) (Wanless & Hockey, 2008). Evidence of multiple avian colonization events with recurring flightlessness are extremely rare in the fossil record (e.g. Olson & James, 1991; Fulton et al., 2012), especially on smaller oceanic islands where long-term preservation of fossiliferous material is generally poor. We know of no other example in Rallidae, or of birds in general, that demonstrates this phenomenon so evidently. Only on Aldabra, which has the oldest palaeontological record of any oceanic island in the Indian Ocean region (Thomson & Walton, 1972), is fossil evidence available that demonstrates the effects of changing sea levels on extinction and recolonization events. Conditions were such on Aldabra, the most important being the absence of terrestrial predators and competing mammals, that a Dryolimnas rail was able to evolve flightlessness independently on each occasion. ACKNOWLEDGEMENTS We thank Robert Prŷs-Jones, Julia Heinen, Anthony Cheke and an anonymous reviewer for comments that helped improve this paper, and we especially thank Julia Heinen for providing the excellent statistical figures. We thank Storrs Olson, Helen James, Jennifer Strotman and Mark Florence (USNM) for the long-term loan of the John Becker Aldabra material. We thank Sandra Chapman and Lorna Steel (NHMUK) for access to material in their care; Harry Taylor (NHMUK) for photography and Richard Hing (University of Portsmouth) for some fossil preparation. We especially thank the Percy Sladen Centenary Fund whose financial support made this research possible. SUPPORTING INFORMATION Supporting information may be found in the online version of this article at the publisher’s web-site. Table S1. Summary statistics for measurements (mm) of the humerus of Dryolimnas. Table S2. Summary statistics for measurements (mm) of the tarsometatarsus of Dryolimnas. TableS3. Raw measurements (mm) of the humerus of Dryolimnas. Table S4. Raw measurements (mm) of the tarsometatarsus of Dryolimnas. REFERENCES Andreas P , Reijmer JJG , Fürstenau J , Kinkel H , Betzler C . 2012 . Relationship between Late Pleistocene sea-level variations, carbonate platform morphology and aragonite production (Maldives, Indian Ocean) . Sedimentology 59 : 1640 – 1658 . Google Scholar Crossref Search ADS Arnold EN . 1979 . Fossil reptiles from Aldabra Atoll, Indian Ocean . Bulletin of the British Museum (Natural History), Zoology 29 : 85 – 116 . Baumel JJ , Witmer LM . 1993 . Osteologia. In: Baumel JJ , King AS , Breazile JE , Evans HE , Vanden Berge JC , eds. Handbook of avian anatomy: nomina anatomica avium , 2 nd edn. Cambridge : Publications of the Nuttall Ornithological Club , 45 – 132 . Braithwaite CJR . 1984 . Geology of the Seychelles. In: Stoddart DR , ed. Biogeography and ecology of the Seychelles Islands . The Hague : Dr W. Junk Publishers , 17 – 38 . Braithwaite CJR , Taylor JD , Kennedy WJ . 1973 . The evolution of an atoll: the depositional and erosional history of Aldabra . Philosophical Transactions of the Royal Society of London B 266 : 307 – 340 . Google Scholar Crossref Search ADS Brochu CA . 2006 . A new miniature horned crocodile from the Quaternary of Aldabra Atoll, western Indian Ocean . Copeia 2 : 149 – 158 . Google Scholar Crossref Search ADS Cheke A . 2010 . The timing of arrival of humans and their commensal animals on Western Indian Ocean oceanic Islands . Phelsuma 18 : 38 – 69 . Collar NJ . 1993 . The conservation status in 1982 of the Aldabran white-throated rail Dryolimnas cuvieri aldabranus . Bird Conservation International 3 : 299 – 305 . Google Scholar Crossref Search ADS Fulton TL , Letts B , Shapiro B . 2012 . Multiple losses of flight and recent speciation in steamer ducks . Proceedings of the Royal Society B, Biological Sciences 279 : 2339 – 2346 . Google Scholar Crossref Search ADS Gerlach J , Muir C , Richmond MD . 2006 . The first substantiated case of trans-oceanic tortoise dispersal . Journal of Natural History 40 : 2403 – 2408 . Google Scholar Crossref Search ADS Günther A . 1879 . On the occurrence of a land-rail (Rallus) in the Island of Aldabra . Annals and Magazine of Natural History 3 : 164 – 168 . Google Scholar Crossref Search ADS Harrison CJO , Walker CA . 1978 . Pleistocene bird remains from Aldabra Atoll, Indian Ocean . Journal of Natural History 12 : 7 – 14 . Google Scholar Crossref Search ADS Hume JP . 2013 . A synopsis of the pre-human avifauna of the Mascarene Islands. In: Göhlich UB , Kroh A , eds. Proceedings of the 8th international meeting of the Society of avian paleontology and evolution . Vienna : Natural History Museum , 195 – 237 . Hume JP . 2017 . Extinct birds , 2 nd edn. London : Christopher Helm . Hume JP , Martill D , Hing R . 2018 . A palaeontological review of Aldabra Atoll, Aldabra Group, Seychelles . PlosOne . doi: https://doi.org/10.1371/journal.pone.0192675 . Perry CA , Hsu KJ . 2000 . Geophysical, archaeological, and historical evidence support a solar-output model for climate change . PNAS 97 : 12433 – 12438 . Google Scholar Crossref Search ADS PubMed Loveridge A , Williams EE . 1957 . Revision of the African tortoises and turtles of the suborder Cryptodira . Bulletin of the Museum of Comparative Zoology, Harvard 115 : 161 – 557 . Mourer-Chauviré C , Bour R , Ribes S , Moutou F . 1999 . The avifauna of Réunion Island (Mascarene Islands) at the time of the arrival of the first Europeans . Smithsonian Contributions to Paleobiology 89 : 1 – 38 . Nicoll MJ . 1908 . Three voyages of a naturalist . London : Witherby and Co . Olson SL . 1977 . A synopsis of the fossil Rallidae. In: Ripley SD , ed. Rails of the world. A monograph of the family Rallidae . Boston : David R. Godine , 338 – 378 . Olson SL , James HF . 1991 . Descriptions of 32 new species of birds from the Hawaiian Islands: part 1, non-Passeriformes . Ornithological Monographs 45 : 1 – 88 . Google Scholar Crossref Search ADS Pucheran MLD . 1845 . Notes sur quelques espèces Madécasses de l’ordre des Échassiers . Revue Zoologique par la Société Cuvierienne 1845 : 277 – 280 . Ridgway R . 1894 . Descriptions of some new birds from Aldabra, Assumption, and Gloriosa Islands, collected by Dr W. L. Abbott . Proceedings of the United States National Museum 17 : 371 – 373 . Google Scholar Crossref Search ADS Safford R , Hawkins F . 2013 . Birds of Africa, vol. VIII: the Malagasy region . London : Christopher Helm . Stoddart DR , Wright CA . 1967 . Geography and ecology of Aldabra Atoll . Atoll Research Bulletin 118 : 11 – 52 . Taylor JD , Braithwaite CJR , Peake JF , Arnold EN . 1979 . Terrestrial faunas and habitats of Aldabra during the Late Pleistocene . Philosophical Transactions of the Royal Society of London B 286 : 47 – 66 . Google Scholar Crossref Search ADS Thomson J , Walton A . 1972 . Redetermination of chronology of Aldabra Atoll by 230Th/234U dating . Nature 240 : 145 – 146 . Google Scholar Crossref Search ADS Wanless RM , Hockey PAR . 2008 . Natural behaviour of the Aldabra Rail (Dryolimnas [cuvieri] aldabranus) . Wilson Journal of Ornithology 120 : 50 – 61 . Google Scholar Crossref Search ADS © 2019 The Linnean Society of London, Zoological Journal of the Linnean Society This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

journal article

LitStream Collection

A new species of deropristid trematode from the sterlet Acipenser ruthenus (Actinopterygii: Acipenseridae) and revision of superfamily affiliation of the family Deropristidae

Sokolov,, Sergey;Voropaeva,, Ekaterina;Atopkin,, Dmitry

2019 Zoological Journal of the Linnean Society

doi: 10.1093/zoolinnean/zlaa015

Abstract A new species, Skrjabinopsolus nudidorsalis sp. nov. is described from the sterlet Acipenser ruthenus, caught in the River Volga basin (Russia). This species differs from previously described congeners by the absence of vitelline follicles on the dorsal side of the body. The complete 18S rRNA and partial 28S rRNA gene sequences obtained for S. nudidorsalis are the first molecular data for the family Deropristidae. The results of phylogenetic analysis indicate that Deropristidae is sister to the Monorchiidae + Lissorchiidae group. The results of the phylogenetic study contradict the current taxonomic hypothesis that Deropristidae belongs to the superfamily Lepocreadioidea and allow inclusion of this family in Monorchioidea. The morphological similarity of deropristids to other monorchioids is recognizable from the presence of a bipartite internal seminal vesicle, spinous cirrus and a voluminous, armed metraterm. 18S, 28S, Monorchioidea, new species, River Volga, Skrjabinopsolus, sturgeons INTRODUCTION Acipenseriformes – sturgeons and paddlefishes – are one of most ancient groups of ray-finned fish and are of great scientific and economic importance (Birstein et al., 1997; Betancur et al., 2017). Currently, these fish species are present in Europe and large parts of Asia and North America. The parasite fauna of sturgeons and paddlefishes is unique and conditioned by the presence of host-specific high-level taxa (Skrjabina, 1974; Choudchury & Dick, 2001; Evans et al., 2008). In the present study, we focus on trematodes of the genus Skrjabinopsolus Ivanov, 1936. This genus was described based on the type species, S. acipenseris Ivanov, 1936, which was collected from the intestines of the Russian sturgeon Acipenser gueldenstaedtii von Brandt & Ratzeburg, 1833, the starry sturgeon Acipenser stellatus Pallas, 1771, the sterlet Acipenser ruthenus Linnaeus, 1758 and the beluga Acipenser huso Linnaeus, 1758, caught in the River Volga delta (Ivanov & Murygin, 1936). The year of description of this trematode genus and species is not indicated correctly in previous publications, except that of Shulman (1954). The first time A. S. Ivanov presented data on Skrjabinopsolus was at the 230th session of the Standing Committee for the Study of Helminth Fauna of the USSR Academy of Sciences on 19 May 1934. However, these materials were not published. The original description of this taxon was published in the paper of Ivanov & Murygin (1936). At various times, nine species of trematodes have been assigned to the genus Skrjabinopsolus, namely S. acipenseris, S. semiarmatus (Molin, 1858), S. skrjabini Osmanov, 1940, S. manteri (Cable, 1952), S. minor Bykhovskaya-Pavlovskaya & Mikailov, 1969, S. elongatus (Madhavi, 1974) (with synonyms of S. indicus Gupta & Ahmad, 1976 and S. kurotchkini Parukhin, 1976 as proposed by Hafeezullah, 1984) and S. sanyaensis Shen, 1990 (e.g. Bykhovskaya-Pavlovskaya & Mikailov, 1969; Hafeezullah, 1984; Shen, 1990). Skrjabinopsolus elongatus is now considered a member of the monorchiid genus Opisthodiplomonorchis Madhavi, 1974 (Choudhury & Dick, 1998; Madhavi & Bray, 2018). Skrjabinopsolus sanyaensis does not show the diagnostic characters of either Skrjabinopsolus or the Deropristidae. Therefore, its systematic position is still unclear (Choudhury & Dick, 1998). The basic features of S. acipenseris, S. skrjabini, S. minor and S. manteri (body and organ size, gonad arrangement, extension of the vitelline fields, distribution of the uterus, egg size, etc.) are highly variable (Bykhovsky & Dubinina, 1954; Shulman, 1954; Bykhovskaya-Pavlovskaya & Mikailov, 1969, Skrjabina, 1974; Bunyatova & Mikailov, 1991; Choudhury & Dick, 1998). In this respect, Skrjabina (1974) and Choudhury & Dick (1998) considered S. acipenseris, S. skrjabini and S. minor as junior synonyms of S. semiarmatus. Bunyatova & Mikailov (1991) considered that S. manteri and S. semiarmatus are also conspecific. Choudhury & Dick (1998) recognized S. manteri as a Nearctic subspecies of S. semiarmatus – S. semiarmatus manteri. At the same time, Choudhury & Dick (2001) considered S. manteri as an independent species but without additional argument. Thus, the genus Skrjabinopsolus is most widely considered to consist of two valid species – S. semiarmatus, identified in Europe, Western Asia and the Russian Far East (Skrjabina, 1974; Yukhimenko & Belyaev, 2002; Noie, 2011), and S. manteri, found in North America (Choudhury & Dick, 1998, 2001). According to the present view on systematics of the class Trematoda, this genus belongs to the family Deropristidae of the superfamily Lepocreadioidea (Bray, 2005; Bray et al., 2009; Bray & Cribb, 2012). However, this viewpoint has not been verified with molecular data. In 2019, trematode specimens belonging to the genus Skrjabinopsolus were found by E. Voropaeva in sterlet from the River Volga basin (Russia). These parasites differ from their congeners by a number of morphological characteristics that allow us to consider these worms as a new species, Skrjabinopsolus nudidorsalis. In the present paper, we provide a description, drawings and results of the molecular phylogenetic analysis of this species with clarifying phylogenetic relationships of the family Deropristidae. MATERIAL AND METHODS Sample collection Worm specimens were collected in the course of a parasitological investigation of 12 specimens [total length (TL) = 38–54 cm] from the sterlet, caught in the River Oka (River Volga basin) near the village of Kletino, Ryazan Oblast, Russia, in June 2019. All applicable international guidelines for the care and use of animals were followed by the authors (Directive 2010/63/EU of the European Parliament and of the Council of 22 September 2010 on the protection of animals used for scientific purposes). Catching of sterlet was carried out by the employees of the Russian Federal Research Institute of Fisheries and Oceanography (FSBSI ‘VNIRO’, Moscow) in accordance with the monitoring programme of the ichthyofauna of the middle course of the River Oka. The worms collected for morphological study were fixed in hot 70% ethanol, stained with acetocarmine, dehydrated in dimethyl phthalate, mounted in Canada balsam and studied with the aid of a light microscope Axio Imager A1 (Zeiss AG, Oberkochen, Germany). All measurements were made in micrometres based on 12 adults and four juvenile specimens, unless otherwise indicated. The measurements of the adults are provided as the range of followed by the mean values in round brackets and the measurements for the holotype in square brackets. For the juvenile specimens, only the range is provided. Specimens were deposited in the Museum of Helminthological Collections at the Centre of Parasitology of the A. N. Severtsov Institute of Ecology and Evolution (IPEE RAS) in Moscow, Russia. Specimens destined for molecular analysis were fixed in 96% ethanol and stored at –18 °C. Examination of further specimens from museum collections We studied the morphology of the following museum specimens of Skrjabinopsolus to clarify the differential diagnosis of a new species: • Photos of holotype, paratype and two voucher specimens of S. manteri from North American sturgeons, the National Museum of Natural History (USNM 1337876, USNM 1337877, USNM 1380936, USNM 1384527), Washington DC, United States. Photos were kindly provided by Dr Anna Philips. • Eighteen voucher specimens of S. semiarmatus (Molin, 1858). Whole-mounted adult specimens from the beluga, the starry sturgeon and the bastard sturgeon Acipenser nudiventris Lovetsky, 1828 caught in the Caspian Sea, April 1964 (IPEE RAS 1082–1088, 1092). Unfortunately, the procedure of descriptions of S. semiarmatus s.s. and two other nominal species, namely S. acipenseris and S. skrjabini, were performed without designation of the place of storage of type specimens (see: Molin, 1858; Ivanov & Murygin, 1936; Osmanov, 1940). These specimens are absent in the most presumable depositaries: the central helminthological collections of Moscow (A. N. Severtsov Institute of Ecology and Evolution; K. I. Skrjabin All-Russian Institute of Helminthology), St. Petersburg (Zoological Institute RAS), Vena (Naturhistorisches Museum) and Berlin (Museum für Naturkunde). The type specimens of S. minor were placed to the Helminthological Laboratory of Zoological Institute of Azerbaijan SSR, Baku (see: Bykhovskaya-Pavlovskaya & Mikailov, 1969), but these specimens have apparently been lost (A. Manafov, personal communication). Molecular and phylogenetic study Total DNA was extracted from three adult specimens of the potential new species, S. nudidorsalis, using the ‘hot shot’ technique (Truett, 2006). Polymerase chain reaction (PCR) was used to amplify the 18S rRNA gene with the primers 18S-8 (5’-GCA GCC GCG GTA ACT CCA GC-3’) and 18S-A27 (5’-CCA TAC AAA TGC CCC CGT CTG-3’) (Littlewood & Olson, 2001). The initial PCR reaction was performed in a total volume of 20 µL and contained 0.25 mM of each primer, approximately 10 ng of total DNA in water, 10X Dream Taq buffer, 1.25 mM dNTPs and one unit of Dream Taq polymerase (Thermo Scientific, USA). Amplification of a 2000-base pair (bp) fragment of 18S rDNA was performed in a GeneAmp 9700 (Applied Biosystems, USA) with a 5-min denaturation at 96 °C, 35 cycles of 1 min at 96 °C, 20 s at 58 °C and 5 min at 72 °C and a 10-min extension at 72 °C. Negative and positive controls using both primers were included. The 28S rRNA gene was amplified with the primers DIG12 (5’-AAG CAT ATC ACT AAG CGG -3’) and 1500R (5’-GCT ATC CTG AGG GAA ACT TCG-3’) (Tkach et al., 2003). The master mix for the PCR reaction was identical to that described above for 18S rRNA gene. Amplification of a 1200-bp fragment of 28S rRNA gene was performed in a T-100 thermocycler (Bio-Rad, USA) with a 3-min denaturation at 94 °C, 40 cycles of 30 s at 94 °C, 30 s at 55 °C and 2 min at 72 °C and a 7-min extension at 72 °C. Negative and positive controls using both primers were included. Sequences were assembled with SeqScape v.2.6 software. Alignments and estimation of the number of variable sites and sequence differences were performed using MEGA 7.0 (Kumar et al., 2016). Phylogenetic analyses of the nucleotide sequences were performed using the maximum likelihood (ML) and Bayesian inference (BI) algorithms with PhyML 3.1 (Guindon & Gascuel, 2003) and MrBayes v.3.1.2 software (Huelsenbeck et al., 2001), respectively. The best nucleotide substitution model, GTR+G+I, was estimated with jModeltest v.2.1.5 software (Darriba et al., 2012) for both ML and BI algorithms. Bayesian analysis was performed using 10 000 000 generations, with two independent runs. Summary parameters and the phylogenetic tree were calculated with a burn-in of 250 000 generations. Support of the phylogenetic relationships was estimated using posterior probabilities (Huelsenbeck et al., 2001) for both ML and BI algorithms. The phylogenetic relationships were inferred from our data, along with the nucleotide sequences of the combined complete 18S rRNA gene and partial 28S rRNA gene of other trematode specimens obtained from the NCBI GenBank database (Table 1). The tree was rooted with species from the Opisthorchioidea. Table 1. List of previously published sequences used in the phylogenetic analysis Species . 18S rRNA gene . 28S rRNA gene . Reference . Acanthocolpidae Pleorchis polyorchis (Stossich, 1889) DQ248202 DQ248215 Bray et al. (2005) Pleorchis uku Yamaguti, 1970 DQ248203 DQ248216 Bray et al. (2005) Stephanostomum baccatum (Nicoll, 1907) DQ248205 DQ248218 Bray et al. (2005) Stephanostomum bicoronatum (Stossich, 1883) DQ248212 DQ248225 Bray et al. (2005) Stephanostomum cesticillus (Molin, 1858) DQ248213 DQ248226 Bray et al. (2005) Stephanostomum interruptum Sparks & Thatcher, 1958 DQ248210 DQ248223 Bray et al. (2005) Stephanostomum gaidropsari Bartoli & Bray, 2001 DQ248208 DQ248221 Bray et al. (2005) Stephanostomum minutum (Looss, 1901) DQ248211 DQ248224 Bray et al. (2005) Stephanostomum pristis (Deslongchamps, 1824) DQ248209 DQ248222 Bray et al. (2005) Stephanostomum tantabiddii Bray & Cribb, 2004 DQ248207 DQ248220 Bray et al. (2005) Tormopsolus orientalis Yamaguti, 1934 DQ248204 DQ248217 Bray et al. (2005) Aephnidiogenidae Tetracerasta blepta Watson, 1984 L06670 – Blair & Barker (1993) – FJ788494 Bray et al. (2009) Allocreadiidae Allocreadium neotenicum Peters, 1957 JX983204 JX977132 Bray et al. (2012) Apocreadiidae Homalometron armatum (MacCallum, 1895) AY222130 AY222241 Olson et al. (2003) Homalometron synagris (Yamaguti, 1953) AJ287523 – Cribb et al. (2001) – AY222243 Olson et al. (2003) Neoapocreadium splendens Cribb & Bray, 1999 AJ287543 – Cribb et al. (2001) – AY222242 Olson et al. (2003) Schistorchis zancli Hanson, 1953 AY222129 AY222240 Olson et al. (2003) Atractotrematidae Atractotrema sigani Durio & Manter, 1969 AJ287479 – Cribb et al. (2001) – AY222267 Olson et al. (2003) Pseudomegasolena ishigakiense Machida & Kamiya, 1976 AJ287569 – Cribb et al. (2001) – AY222266 Olson et al. (2003) Brachycladiidae Brachycladium goliath (van Beneden, 1858) KR703279 KR703279 Briscoe et al. (2016) Zalophotrema hepaticum Stunkard & Alvey, 1929 AJ224884 – Cribb et al. (2001) – AY222255 Olson et al. (2003) Dicrocoeliidae Brachylecithum lobatum (Railliet, 1900) AY222144 AY222260 Olson et al. (2003) Dicrocoelium dendriticum (Rudolphi 1819) Y11236 – Sandoval H.H. (unpublished) – AF151939 Tkach et al. (2000) Lyperosomum collurionis (Skrjabin & Isaichikov, 1927) AY222143 AY222259 Olson et al. (2003) Gorgocephalidae Gorgocephalus kyphosi Manter, 1966 AY222126 AY222234 Olson et al. (2003) Gorgoderidae Degeneria halosauri (Bell, 1887) AJ287497 – Cribb et al. (2001) – AY222257 Olson et al. (2003) Gorgodera sp. AJ287518 – Cribb et al. (2001) – AY222264 Olson et al. (2003) Nagmia floridensis Markell, 1953 AY222145 AY222262 Olson et al. (2003) Gyliauchenidae Paragyliauchen arusettae Machida, 1984 AY222127 – Olson et al. (2003) – FJ788503 Bray et al. (2009) Enenteridae Enenterum aureum Linton, 1910 AY222124 AY222232 Olson et al. (2003) Koseiria xishaensis Gu & Shen, 1983 AY222125 AY222233 Olson et al. (2003) Haploporidae Elonginurus mugilis Lü, 1995 MH763777 MH763761 Atopkin et al. (2019) Hapladena nasonis Yamaguti, 1970 AY222146 AY222265 Olson et al. (2003) Haploporus benedeni (Stossich, 1887) FJ211228 FJ211237 Blasco-Costa et al. (2009) Lepocreadiidae Preptetos caballeroi Pritchard, 1960 AJ287563 – Cribb et al. (2001) – AY222236 Olson et al. (2003) Preptetos trulla (Linton, 1907) AY222128 AY222237 Olson et al. (2003) Lissorchiidae Lissorchis kritskyi Barnhart & Powell, 1979 AY222136 AY222250 Olson et al. (2003) Monorchiidae Cableia pudica Bray, Cribb & Barker, 1996 AJ287486 – Cribb et al. (2001) – AY222251 Olson et al. (2003) Diplomonorchis leiostomi Hopkins, 1941 AY222137 AY222252 Olson et al. (2003) Lasiotocus typicum (Nicoll, 1912) AJ287474 – Cribb et al. (2001) – AY222254 Olson et al. (2003) Provitellus turrum Dove & Cribb, 1998 AJ287566 – Cribb et al. (2001) – AY222253 Olson et al. (2003) Opecoelidae Halosaurotrema halosauropsi (Bray & Campbell, 1996) [access as Gaevskajatrema halosauropsi] AJ287514 – Cribb et al. (2001) – AY222207 Olson et al. (2003) Macvicaria macassarensis (Yamaguti, 1952) AJ287533 – Cribb et al. (2001) – AY222208 Olson et al. (2003) Peracreadium idoneum (Nicoll, 1909) AJ287558 – Cribb et al. (2001) – AY222209 Olson et al. (2003) Outgroup Caecincola parvulus Marshall & Gilbert, 1905 AY222123 AY222231 Olson et al. (2003) Haplorchis pumilio (Looss, 1896) KX815125 KX815125 Le et al. (2017) Metagonimus miyatai Saito, Chai, Kim, Lee & Rim, 1997 HQ832626 HQ832635 Pornruseetairatn et al. (2016) Metagonimus yokogawai (Katsurada, 1912) HQ832630 HQ832639 Pornruseetairatn et al. (2016) Opisthorchis felineus (Rivolta, 1884) MF077357 MF099790 Dao et al. (2017) Opisthorchis viverrini (Poirier, 1886) JF823987 JF823990 Thaenkham et al. (2011) Species . 18S rRNA gene . 28S rRNA gene . Reference . Acanthocolpidae Pleorchis polyorchis (Stossich, 1889) DQ248202 DQ248215 Bray et al. (2005) Pleorchis uku Yamaguti, 1970 DQ248203 DQ248216 Bray et al. (2005) Stephanostomum baccatum (Nicoll, 1907) DQ248205 DQ248218 Bray et al. (2005) Stephanostomum bicoronatum (Stossich, 1883) DQ248212 DQ248225 Bray et al. (2005) Stephanostomum cesticillus (Molin, 1858) DQ248213 DQ248226 Bray et al. (2005) Stephanostomum interruptum Sparks & Thatcher, 1958 DQ248210 DQ248223 Bray et al. (2005) Stephanostomum gaidropsari Bartoli & Bray, 2001 DQ248208 DQ248221 Bray et al. (2005) Stephanostomum minutum (Looss, 1901) DQ248211 DQ248224 Bray et al. (2005) Stephanostomum pristis (Deslongchamps, 1824) DQ248209 DQ248222 Bray et al. (2005) Stephanostomum tantabiddii Bray & Cribb, 2004 DQ248207 DQ248220 Bray et al. (2005) Tormopsolus orientalis Yamaguti, 1934 DQ248204 DQ248217 Bray et al. (2005) Aephnidiogenidae Tetracerasta blepta Watson, 1984 L06670 – Blair & Barker (1993) – FJ788494 Bray et al. (2009) Allocreadiidae Allocreadium neotenicum Peters, 1957 JX983204 JX977132 Bray et al. (2012) Apocreadiidae Homalometron armatum (MacCallum, 1895) AY222130 AY222241 Olson et al. (2003) Homalometron synagris (Yamaguti, 1953) AJ287523 – Cribb et al. (2001) – AY222243 Olson et al. (2003) Neoapocreadium splendens Cribb & Bray, 1999 AJ287543 – Cribb et al. (2001) – AY222242 Olson et al. (2003) Schistorchis zancli Hanson, 1953 AY222129 AY222240 Olson et al. (2003) Atractotrematidae Atractotrema sigani Durio & Manter, 1969 AJ287479 – Cribb et al. (2001) – AY222267 Olson et al. (2003) Pseudomegasolena ishigakiense Machida & Kamiya, 1976 AJ287569 – Cribb et al. (2001) – AY222266 Olson et al. (2003) Brachycladiidae Brachycladium goliath (van Beneden, 1858) KR703279 KR703279 Briscoe et al. (2016) Zalophotrema hepaticum Stunkard & Alvey, 1929 AJ224884 – Cribb et al. (2001) – AY222255 Olson et al. (2003) Dicrocoeliidae Brachylecithum lobatum (Railliet, 1900) AY222144 AY222260 Olson et al. (2003) Dicrocoelium dendriticum (Rudolphi 1819) Y11236 – Sandoval H.H. (unpublished) – AF151939 Tkach et al. (2000) Lyperosomum collurionis (Skrjabin & Isaichikov, 1927) AY222143 AY222259 Olson et al. (2003) Gorgocephalidae Gorgocephalus kyphosi Manter, 1966 AY222126 AY222234 Olson et al. (2003) Gorgoderidae Degeneria halosauri (Bell, 1887) AJ287497 – Cribb et al. (2001) – AY222257 Olson et al. (2003) Gorgodera sp. AJ287518 – Cribb et al. (2001) – AY222264 Olson et al. (2003) Nagmia floridensis Markell, 1953 AY222145 AY222262 Olson et al. (2003) Gyliauchenidae Paragyliauchen arusettae Machida, 1984 AY222127 – Olson et al. (2003) – FJ788503 Bray et al. (2009) Enenteridae Enenterum aureum Linton, 1910 AY222124 AY222232 Olson et al. (2003) Koseiria xishaensis Gu & Shen, 1983 AY222125 AY222233 Olson et al. (2003) Haploporidae Elonginurus mugilis Lü, 1995 MH763777 MH763761 Atopkin et al. (2019) Hapladena nasonis Yamaguti, 1970 AY222146 AY222265 Olson et al. (2003) Haploporus benedeni (Stossich, 1887) FJ211228 FJ211237 Blasco-Costa et al. (2009) Lepocreadiidae Preptetos caballeroi Pritchard, 1960 AJ287563 – Cribb et al. (2001) – AY222236 Olson et al. (2003) Preptetos trulla (Linton, 1907) AY222128 AY222237 Olson et al. (2003) Lissorchiidae Lissorchis kritskyi Barnhart & Powell, 1979 AY222136 AY222250 Olson et al. (2003) Monorchiidae Cableia pudica Bray, Cribb & Barker, 1996 AJ287486 – Cribb et al. (2001) – AY222251 Olson et al. (2003) Diplomonorchis leiostomi Hopkins, 1941 AY222137 AY222252 Olson et al. (2003) Lasiotocus typicum (Nicoll, 1912) AJ287474 – Cribb et al. (2001) – AY222254 Olson et al. (2003) Provitellus turrum Dove & Cribb, 1998 AJ287566 – Cribb et al. (2001) – AY222253 Olson et al. (2003) Opecoelidae Halosaurotrema halosauropsi (Bray & Campbell, 1996) [access as Gaevskajatrema halosauropsi] AJ287514 – Cribb et al. (2001) – AY222207 Olson et al. (2003) Macvicaria macassarensis (Yamaguti, 1952) AJ287533 – Cribb et al. (2001) – AY222208 Olson et al. (2003) Peracreadium idoneum (Nicoll, 1909) AJ287558 – Cribb et al. (2001) – AY222209 Olson et al. (2003) Outgroup Caecincola parvulus Marshall & Gilbert, 1905 AY222123 AY222231 Olson et al. (2003) Haplorchis pumilio (Looss, 1896) KX815125 KX815125 Le et al. (2017) Metagonimus miyatai Saito, Chai, Kim, Lee & Rim, 1997 HQ832626 HQ832635 Pornruseetairatn et al. (2016) Metagonimus yokogawai (Katsurada, 1912) HQ832630 HQ832639 Pornruseetairatn et al. (2016) Opisthorchis felineus (Rivolta, 1884) MF077357 MF099790 Dao et al. (2017) Opisthorchis viverrini (Poirier, 1886) JF823987 JF823990 Thaenkham et al. (2011) Open in new tab Table 1. List of previously published sequences used in the phylogenetic analysis Species . 18S rRNA gene . 28S rRNA gene . Reference . Acanthocolpidae Pleorchis polyorchis (Stossich, 1889) DQ248202 DQ248215 Bray et al. (2005) Pleorchis uku Yamaguti, 1970 DQ248203 DQ248216 Bray et al. (2005) Stephanostomum baccatum (Nicoll, 1907) DQ248205 DQ248218 Bray et al. (2005) Stephanostomum bicoronatum (Stossich, 1883) DQ248212 DQ248225 Bray et al. (2005) Stephanostomum cesticillus (Molin, 1858) DQ248213 DQ248226 Bray et al. (2005) Stephanostomum interruptum Sparks & Thatcher, 1958 DQ248210 DQ248223 Bray et al. (2005) Stephanostomum gaidropsari Bartoli & Bray, 2001 DQ248208 DQ248221 Bray et al. (2005) Stephanostomum minutum (Looss, 1901) DQ248211 DQ248224 Bray et al. (2005) Stephanostomum pristis (Deslongchamps, 1824) DQ248209 DQ248222 Bray et al. (2005) Stephanostomum tantabiddii Bray & Cribb, 2004 DQ248207 DQ248220 Bray et al. (2005) Tormopsolus orientalis Yamaguti, 1934 DQ248204 DQ248217 Bray et al. (2005) Aephnidiogenidae Tetracerasta blepta Watson, 1984 L06670 – Blair & Barker (1993) – FJ788494 Bray et al. (2009) Allocreadiidae Allocreadium neotenicum Peters, 1957 JX983204 JX977132 Bray et al. (2012) Apocreadiidae Homalometron armatum (MacCallum, 1895) AY222130 AY222241 Olson et al. (2003) Homalometron synagris (Yamaguti, 1953) AJ287523 – Cribb et al. (2001) – AY222243 Olson et al. (2003) Neoapocreadium splendens Cribb & Bray, 1999 AJ287543 – Cribb et al. (2001) – AY222242 Olson et al. (2003) Schistorchis zancli Hanson, 1953 AY222129 AY222240 Olson et al. (2003) Atractotrematidae Atractotrema sigani Durio & Manter, 1969 AJ287479 – Cribb et al. (2001) – AY222267 Olson et al. (2003) Pseudomegasolena ishigakiense Machida & Kamiya, 1976 AJ287569 – Cribb et al. (2001) – AY222266 Olson et al. (2003) Brachycladiidae Brachycladium goliath (van Beneden, 1858) KR703279 KR703279 Briscoe et al. (2016) Zalophotrema hepaticum Stunkard & Alvey, 1929 AJ224884 – Cribb et al. (2001) – AY222255 Olson et al. (2003) Dicrocoeliidae Brachylecithum lobatum (Railliet, 1900) AY222144 AY222260 Olson et al. (2003) Dicrocoelium dendriticum (Rudolphi 1819) Y11236 – Sandoval H.H. (unpublished) – AF151939 Tkach et al. (2000) Lyperosomum collurionis (Skrjabin & Isaichikov, 1927) AY222143 AY222259 Olson et al. (2003) Gorgocephalidae Gorgocephalus kyphosi Manter, 1966 AY222126 AY222234 Olson et al. (2003) Gorgoderidae Degeneria halosauri (Bell, 1887) AJ287497 – Cribb et al. (2001) – AY222257 Olson et al. (2003) Gorgodera sp. AJ287518 – Cribb et al. (2001) – AY222264 Olson et al. (2003) Nagmia floridensis Markell, 1953 AY222145 AY222262 Olson et al. (2003) Gyliauchenidae Paragyliauchen arusettae Machida, 1984 AY222127 – Olson et al. (2003) – FJ788503 Bray et al. (2009) Enenteridae Enenterum aureum Linton, 1910 AY222124 AY222232 Olson et al. (2003) Koseiria xishaensis Gu & Shen, 1983 AY222125 AY222233 Olson et al. (2003) Haploporidae Elonginurus mugilis Lü, 1995 MH763777 MH763761 Atopkin et al. (2019) Hapladena nasonis Yamaguti, 1970 AY222146 AY222265 Olson et al. (2003) Haploporus benedeni (Stossich, 1887) FJ211228 FJ211237 Blasco-Costa et al. (2009) Lepocreadiidae Preptetos caballeroi Pritchard, 1960 AJ287563 – Cribb et al. (2001) – AY222236 Olson et al. (2003) Preptetos trulla (Linton, 1907) AY222128 AY222237 Olson et al. (2003) Lissorchiidae Lissorchis kritskyi Barnhart & Powell, 1979 AY222136 AY222250 Olson et al. (2003) Monorchiidae Cableia pudica Bray, Cribb & Barker, 1996 AJ287486 – Cribb et al. (2001) – AY222251 Olson et al. (2003) Diplomonorchis leiostomi Hopkins, 1941 AY222137 AY222252 Olson et al. (2003) Lasiotocus typicum (Nicoll, 1912) AJ287474 – Cribb et al. (2001) – AY222254 Olson et al. (2003) Provitellus turrum Dove & Cribb, 1998 AJ287566 – Cribb et al. (2001) – AY222253 Olson et al. (2003) Opecoelidae Halosaurotrema halosauropsi (Bray & Campbell, 1996) [access as Gaevskajatrema halosauropsi] AJ287514 – Cribb et al. (2001) – AY222207 Olson et al. (2003) Macvicaria macassarensis (Yamaguti, 1952) AJ287533 – Cribb et al. (2001) – AY222208 Olson et al. (2003) Peracreadium idoneum (Nicoll, 1909) AJ287558 – Cribb et al. (2001) – AY222209 Olson et al. (2003) Outgroup Caecincola parvulus Marshall & Gilbert, 1905 AY222123 AY222231 Olson et al. (2003) Haplorchis pumilio (Looss, 1896) KX815125 KX815125 Le et al. (2017) Metagonimus miyatai Saito, Chai, Kim, Lee & Rim, 1997 HQ832626 HQ832635 Pornruseetairatn et al. (2016) Metagonimus yokogawai (Katsurada, 1912) HQ832630 HQ832639 Pornruseetairatn et al. (2016) Opisthorchis felineus (Rivolta, 1884) MF077357 MF099790 Dao et al. (2017) Opisthorchis viverrini (Poirier, 1886) JF823987 JF823990 Thaenkham et al. (2011) Species . 18S rRNA gene . 28S rRNA gene . Reference . Acanthocolpidae Pleorchis polyorchis (Stossich, 1889) DQ248202 DQ248215 Bray et al. (2005) Pleorchis uku Yamaguti, 1970 DQ248203 DQ248216 Bray et al. (2005) Stephanostomum baccatum (Nicoll, 1907) DQ248205 DQ248218 Bray et al. (2005) Stephanostomum bicoronatum (Stossich, 1883) DQ248212 DQ248225 Bray et al. (2005) Stephanostomum cesticillus (Molin, 1858) DQ248213 DQ248226 Bray et al. (2005) Stephanostomum interruptum Sparks & Thatcher, 1958 DQ248210 DQ248223 Bray et al. (2005) Stephanostomum gaidropsari Bartoli & Bray, 2001 DQ248208 DQ248221 Bray et al. (2005) Stephanostomum minutum (Looss, 1901) DQ248211 DQ248224 Bray et al. (2005) Stephanostomum pristis (Deslongchamps, 1824) DQ248209 DQ248222 Bray et al. (2005) Stephanostomum tantabiddii Bray & Cribb, 2004 DQ248207 DQ248220 Bray et al. (2005) Tormopsolus orientalis Yamaguti, 1934 DQ248204 DQ248217 Bray et al. (2005) Aephnidiogenidae Tetracerasta blepta Watson, 1984 L06670 – Blair & Barker (1993) – FJ788494 Bray et al. (2009) Allocreadiidae Allocreadium neotenicum Peters, 1957 JX983204 JX977132 Bray et al. (2012) Apocreadiidae Homalometron armatum (MacCallum, 1895) AY222130 AY222241 Olson et al. (2003) Homalometron synagris (Yamaguti, 1953) AJ287523 – Cribb et al. (2001) – AY222243 Olson et al. (2003) Neoapocreadium splendens Cribb & Bray, 1999 AJ287543 – Cribb et al. (2001) – AY222242 Olson et al. (2003) Schistorchis zancli Hanson, 1953 AY222129 AY222240 Olson et al. (2003) Atractotrematidae Atractotrema sigani Durio & Manter, 1969 AJ287479 – Cribb et al. (2001) – AY222267 Olson et al. (2003) Pseudomegasolena ishigakiense Machida & Kamiya, 1976 AJ287569 – Cribb et al. (2001) – AY222266 Olson et al. (2003) Brachycladiidae Brachycladium goliath (van Beneden, 1858) KR703279 KR703279 Briscoe et al. (2016) Zalophotrema hepaticum Stunkard & Alvey, 1929 AJ224884 – Cribb et al. (2001) – AY222255 Olson et al. (2003) Dicrocoeliidae Brachylecithum lobatum (Railliet, 1900) AY222144 AY222260 Olson et al. (2003) Dicrocoelium dendriticum (Rudolphi 1819) Y11236 – Sandoval H.H. (unpublished) – AF151939 Tkach et al. (2000) Lyperosomum collurionis (Skrjabin & Isaichikov, 1927) AY222143 AY222259 Olson et al. (2003) Gorgocephalidae Gorgocephalus kyphosi Manter, 1966 AY222126 AY222234 Olson et al. (2003) Gorgoderidae Degeneria halosauri (Bell, 1887) AJ287497 – Cribb et al. (2001) – AY222257 Olson et al. (2003) Gorgodera sp. AJ287518 – Cribb et al. (2001) – AY222264 Olson et al. (2003) Nagmia floridensis Markell, 1953 AY222145 AY222262 Olson et al. (2003) Gyliauchenidae Paragyliauchen arusettae Machida, 1984 AY222127 – Olson et al. (2003) – FJ788503 Bray et al. (2009) Enenteridae Enenterum aureum Linton, 1910 AY222124 AY222232 Olson et al. (2003) Koseiria xishaensis Gu & Shen, 1983 AY222125 AY222233 Olson et al. (2003) Haploporidae Elonginurus mugilis Lü, 1995 MH763777 MH763761 Atopkin et al. (2019) Hapladena nasonis Yamaguti, 1970 AY222146 AY222265 Olson et al. (2003) Haploporus benedeni (Stossich, 1887) FJ211228 FJ211237 Blasco-Costa et al. (2009) Lepocreadiidae Preptetos caballeroi Pritchard, 1960 AJ287563 – Cribb et al. (2001) – AY222236 Olson et al. (2003) Preptetos trulla (Linton, 1907) AY222128 AY222237 Olson et al. (2003) Lissorchiidae Lissorchis kritskyi Barnhart & Powell, 1979 AY222136 AY222250 Olson et al. (2003) Monorchiidae Cableia pudica Bray, Cribb & Barker, 1996 AJ287486 – Cribb et al. (2001) – AY222251 Olson et al. (2003) Diplomonorchis leiostomi Hopkins, 1941 AY222137 AY222252 Olson et al. (2003) Lasiotocus typicum (Nicoll, 1912) AJ287474 – Cribb et al. (2001) – AY222254 Olson et al. (2003) Provitellus turrum Dove & Cribb, 1998 AJ287566 – Cribb et al. (2001) – AY222253 Olson et al. (2003) Opecoelidae Halosaurotrema halosauropsi (Bray & Campbell, 1996) [access as Gaevskajatrema halosauropsi] AJ287514 – Cribb et al. (2001) – AY222207 Olson et al. (2003) Macvicaria macassarensis (Yamaguti, 1952) AJ287533 – Cribb et al. (2001) – AY222208 Olson et al. (2003) Peracreadium idoneum (Nicoll, 1909) AJ287558 – Cribb et al. (2001) – AY222209 Olson et al. (2003) Outgroup Caecincola parvulus Marshall & Gilbert, 1905 AY222123 AY222231 Olson et al. (2003) Haplorchis pumilio (Looss, 1896) KX815125 KX815125 Le et al. (2017) Metagonimus miyatai Saito, Chai, Kim, Lee & Rim, 1997 HQ832626 HQ832635 Pornruseetairatn et al. (2016) Metagonimus yokogawai (Katsurada, 1912) HQ832630 HQ832639 Pornruseetairatn et al. (2016) Opisthorchis felineus (Rivolta, 1884) MF077357 MF099790 Dao et al. (2017) Opisthorchis viverrini (Poirier, 1886) JF823987 JF823990 Thaenkham et al. (2011) Open in new tab RESULTS Phylogeny Our sample represents the first species of the family Deropristidae to be represented by molecular data. In both the ML and BI analyses, based on concatenated complete 18S rRNA and partial 28S rRNA genes, Deropristidae appears as a member of the well-supported Monorchioidea clade, within which this family forms a sister relationship with the Monorchiidae + Lissorchiidae group (Fig. 1). The Monorchioidea clade is closely related to the Brachycladioidea + Opecoeloidea + Gorgoderoidea + Haploporoidea group, with high Bayesian support for both ML and Bayesian trees. Figure 1. Open in new tabDownload slide Phylogenetic position of Skrjabinopsolus nudidorsalis, constructed by Bayesian inference and maximum likelihood (ML/BI) analyses of 18S+28S rRNA genes sequences alignment. Nodal support shower for ML/BI algorithms, respectively. References for data retrieved from GenBank, are listed in Table 1. Figure 1. Open in new tabDownload slide Phylogenetic position of Skrjabinopsolus nudidorsalis, constructed by Bayesian inference and maximum likelihood (ML/BI) analyses of 18S+28S rRNA genes sequences alignment. Nodal support shower for ML/BI algorithms, respectively. References for data retrieved from GenBank, are listed in Table 1. Representatives of the Lepocreadioidea formed a distinct clade, sister to the (Brachycladioidea + Opecoeloidea + Gorgoderoidea + Haploporoidea) + Monorchioidea clade. Trematodes of the Apocreadioidea are basal to all the above-mentioned superfamilies, with high statistical support for both ML and Bayesian analyses (Fig. 1). The new species is supported and is described below. TAXONOMY Family Deropristidae Cable & Hunninen, 1942Genus Skrjabinopsolus Ivanov, 1936Skrjabinopsolus nudidorsalis sp. nov.(Figs 2A–D, 3A, 4A) ZooBank registration LSID: http://www.zoobank.org/urn:lsid:zoobank.org:act:0CB540AC-F471-4C92-AEC4-80F5AD9F5A53 Figure 2. Open in new tabDownload slide Skrjabinopsolus nudidorsalis. A, holotype, whole view. B, juvenile voucher specimen, whole view. C, terminal genitalia of voucher specimen, dextro-lateral view. D, ovarian complex of paratype, dorsal view. Abbreviations: c, cirrus (partially evaginated); fc, fertilization chamber; lc, Laurer’s canal, mpo, middle part of oviduct; mt, metraterm, om, oötype with Mehlis’ gland, ov, ovary; pc, prostatic cells, pp, pars prostatica, s, sphincter; sc, spines of cirrus, sm, spines of metraterm; sr, canalicular seminal receptacle, sv, bipartite internal seminal vesicle; vr, common vitelline reservoir. Scale bars: A 1 mm, B 0.4 mm, C 0.15 mm, D 0.2 mm. Figure 2. Open in new tabDownload slide Skrjabinopsolus nudidorsalis. A, holotype, whole view. B, juvenile voucher specimen, whole view. C, terminal genitalia of voucher specimen, dextro-lateral view. D, ovarian complex of paratype, dorsal view. Abbreviations: c, cirrus (partially evaginated); fc, fertilization chamber; lc, Laurer’s canal, mpo, middle part of oviduct; mt, metraterm, om, oötype with Mehlis’ gland, ov, ovary; pc, prostatic cells, pp, pars prostatica, s, sphincter; sc, spines of cirrus, sm, spines of metraterm; sr, canalicular seminal receptacle, sv, bipartite internal seminal vesicle; vr, common vitelline reservoir. Scale bars: A 1 mm, B 0.4 mm, C 0.15 mm, D 0.2 mm. Figure 3. Open in new tabDownload slide Microphotograph of dorsal side of the body. A, paratype of Skrjabinopsolus nudidorsalis; the microphotographs demonstrate the absence of dorsal vitelline follicles in the new species. B, paratype of S. manteri (©2019 F. Goetz, D. Weimer). C, voucher specimen of Skrjabinopsolus semiarmatus. Scale bars 0.5 mm. Figure 3. Open in new tabDownload slide Microphotograph of dorsal side of the body. A, paratype of Skrjabinopsolus nudidorsalis; the microphotographs demonstrate the absence of dorsal vitelline follicles in the new species. B, paratype of S. manteri (©2019 F. Goetz, D. Weimer). C, voucher specimen of Skrjabinopsolus semiarmatus. Scale bars 0.5 mm. Figure 4. Open in new tabDownload slide Microphotographs of the egg shell. A, paratype of Skrjabinopsolus nudidorsalis. B, voucher specimen of Skrjabinopsolus semiarmatus. Scale bars: 10 μm. Figure 4. Open in new tabDownload slide Microphotographs of the egg shell. A, paratype of Skrjabinopsolus nudidorsalis. B, voucher specimen of Skrjabinopsolus semiarmatus. Scale bars: 10 μm. Type-host: Acipenser ruthenus Linnaeus, 1758 (Actinopterygii: Acipenseridae), the sterlet. Type locality: Oka River near Kletino village, Ryazan Oblast, Russia (54°59′55″ N, 41°10′56″E). Type and voucher materials: Holotype IPEE RAS 1319 (whole-mounted adult specimen), 11 paratypes, IPEE RAS 1319–1324 (whole-mounted adult specimens) and five voucher specimens, IPEE RAS 14279 (four juvenile trematodes and 14 280 one adult specimen). Site of infection: Intestines of adult specimens and stomach of juvenile specimens. Prevalence: 66.7% (N = 12). Intensity of infection: 1–297 worms/infected host specimen. Representative DNA sequences: Sequences of three representatives were deposited in the NCBI database: complete 18S rRNA gene (MN700959–MN700961) and partial 28S rRNA gene (MN700996–MN700998). One 18S rRNA gene sequence (MN700959) possesses a single transition G/A. Sequences of 28S rRNA gene were identical to each other. Etymology: Latin compound adjective nudidorsalis, from nudus, naked, and dorsalis, dorsal, indicating a lack of the fields of vitelline follicles on the dorsal side of the body. Description of adult specimens: Body elongate, flattened dorsoventrally, length 3.48–5.28 (4.08) [3.61] mm, maximum width 0.47–0.70 (0.57) [0.59] mm at level of ventral sucker. Forebody 24.2–37.7 (32.1) [37.7]% of body length. Tegument spinous. Eye-spot pigment scattered at oesophageal level. Oral sucker subglobular, 212–283 (239) × 219–290 (247) [212 × 226]. Ventral sucker rounded, 170–262 (205) × 163–276 (209) [198 × 205], sessile, pre-equatorial, slightly smaller than oral sucker. Oral sucker to ventral sucker width ratio 1: 0.68–0.95 (1: 0.84) [1: 0.91]. Mouth opening subterminally. Prepharynx distinct, 106–184 (154) [142]. Pharynx large, 149–212 (172) × 149–212 (178) [177 × 163]. Pharynx to oral sucker width ratio 1: 1.27–1.62 (1: 1.39) [1: 1.39]. Oesophagus 142–212 (166) [212]. Intestinal bifurcation at about midlevel of forebody. Caeca terminate blindly near posterior end of body. Testes two, entire, ellipsoidal, tandem, separated, in posterior half of hindbody; anterior testis 283–524 (319) × 191–262 (216) [326 × 255], posterior testis 319–630 (398) × 163–276 (215) [425 × 226]. Post-testicular region 4.9–15.5 (10.3) [8.4]% of hindbody length. Cirrus-sac elongate, 587–814 (698) × 120–205 (147) [616 × 156], reaches into anterior hindbody, contains bipartite internal seminal vesicle, tubular pars prostatica surrounded by extensive field of prostatic cells, and long invaginated cirrus. Ejaculatory duct absent and pars prostatica directly joining proximal end of invaginated cirrus. Cirrus covered by thin cytoplasmic filaments and numerous large spines; spines length 31–47. Vas deferens absent; vasa efferentia directly joining seminal vesicle. Cirrus-sac to ventral sucker length ratio 1: 0.25–0.33 (1: 0.29) [1: 0.32]. Genital atrium distinct. Genital pore median, immediately anterior to ventral sucker. Ovary entire, rounded to pyriform, 142–262 (187) × 127–226 (174) [180 × 198], pretesticular, separated from anterior testes. Ovicapt weakly developed. Proximal part of oviduct forms tubular fertilization chamber, terminates with sphincter. Middle part of oviduct tubular, receives Laurer’s canal and common vitelline duct. Distal part of oviduct forms ootype. Laurer’s canal opens sinistro-dorso-sublaterally at the level of the ovary or Mehlis’ gland, occasionally at the level of just the anterior to anterior margin of Mehlis’ gland. Canalicular seminal receptacle saccular, large, usually between ovary and anterior testis and partly overlaps them dorsally. Mehlis’ gland compact, anterodorsal to ovary, contiguous or partly overlapping, median. Uterus extends posteriorly to or beyond posterior testis, terminates with massive metraterm. Metraterm 283–517 (402) × 92–205 (153) [403 × 142], runs spiral from sinistroventral to sinistrodorsal side of cirrus-sac, sheathed in gland cells. Internal surface of metraterm with thin cytoplasmic filaments and numerous large spines; spine length 19–38. Metraterm to cirrus-sac length ratio 1: 1.08–2.08 (1: 1.75) [1: 1.53]. Eggs operculate, 46–51 (48.4) × 25–28 (26.9); shell provided with numerous granular tubercles. Vitellarium follicular; follicles in two fields distributed along ventral and lateral sides of the hindbody, overlapping caeca and extend from the level of the middle third of the cirrus-sac to, or beyond, the midlevel of the anterior testis, but do not reach the midlevel of the posterior testis; occasionally single follicles may be present on the dorsal side of the hindbody. Excretory pore dorsosubterminal; excretory vesicle elongate, oval or claviform, extends to, or beyond, the posterior margin of the posterior testis, but does not reach beyond the midlevel of the posterior testis. Description of juvenile specimens: Body elongate, flattened dorsoventrally, blunt at the anterior end and tapering at the posterior end; length 550–663, maximum width 150–213 at the level of the anterior quarter of the hindbody. Forebody 54.7–58.3% of body length. Tegument spinous. Eye-spot pigment scattered at oesophageal level. Oral sucker subglobular, 85–91 × 82–101. Ventral sucker rounded, sessile, postequatorial, smaller than oral sucker, 69–76 × 69–76. Oral sucker to ventral sucker width ratio 1: 0.75–0.85. Mouth opening subterminal. Prepharynx distinct, 25–44. Pharynx large, 57–63 × 57–69. Pharynx to oral sucker width ratio 1: 1.09–1.89. Oesophagus short, 16–31. Intestinal bifurcation in third-quarter of forebody. Caeca terminate blindly near posterior end of body. Primordiums of testes entire, oblique or almost tandem, separated, in middle third of hindbody. Primordium of ovary entire, pretesticular, separated from anterior testis, median. Primordium of terminal genitalia dorsally to ventral sucker. Excretory pore dorsosubterminal; excretory vesicle elongate oval, occupies 56–73% of hindbody length. Remarks: The presence of a short genital atrium, which does not expand behind the midline of the ventral sucker, absence of a crown of large hooks near the mouth, and absence of a lateral bulge armed with large spines on the anterior end of the body in combination with common features for all deropristids (external seminal vesicular absent, canalicular seminal receptacle present, cirrus-sac present, cirrus and metraterm strongly spined, testes in hindbody, suckers unspecialized, ventral sucker pre-equatorial, uterus reaches close to posterior end of body, vitellarium not reaching posteriorly beyond posterior testis) are evidence of the new species belonging to the genus Skrjabinopsolus (compare with: Bray, 2005). Skrjabinopsolus nudidorsalis differs from the two congeners by the arrangement of the fields of vitelline follicles. The arrangement of these fields is limited to the ventral side of the body in published descriptions of S. semiarmatus and S. manteri (Ivanov & Murygin, 1936; Chulkova, 1939; Osmanov, 1940; Cable, 1952; Bykhovsky & Dubinina, 1954; Edelényi, 1963, 1967, 1974; Agapova, 1966; Žitňan, 1966; Čanković et al., 1968; Bykhovskaya-Pavlovskaya & Mikailov, 1969; Schell, 1970; Mikailov, 1975; Bunyatova & Mikailov, 1991; Bray, 2005). According to our data obtained during study of museum specimens of S. semiarmatus and S. manteri, the fields of vitelline follicles in these species are located ventrally, laterally and dorsally. In S. manteri, the left and right fields on the dorsal side of the body are separated, but in S. semiarmatus they can be separated or confluent (Fig. 3B, C). In the new species, the vitelline fields are absent on the dorsal side of the body (Fig. 3A). In addition, S. nudidorsalis differs from S. semiarmatus in the surface structure of egg shells. The egg shell in the new species has numerous granular tubercles, but in S. semiarmatus it has distinct irregular ridges (Fig. 4A, B). DISCUSSION The juvenile specimens of S. nudidorsalis described in this study are interpreted as being excysted metacercariae migrated from digested bodies of the second intermediate hosts in the stomach of the sterlet. Body size, postequatorial position of the ventral sucker and the developmental condition of the reproductive system indicate that these specimens were in the metacercarial stage. Metacercariae of the Skrjabinopsolus have been described in only two publications. Peters (1961) provided a description of the metacercaria of S. manteri from unidentified freshwater oligochaetes and Komarova (1968) reported on the metacercaria of S. skrjabini (= S. semiarmatus) from eurigaline mysid shrimp Limnomysis benedeni Czerniavsky, 1882. However, parasite species identification in the work of Komarova (1968) is not convincing, because the metacercaria described by this author does not correspond with adults of S. semiarmatus s.l. in the position of the primordia of the gonads and vitellarium. Skrjabina (1974) attributed S. semiarmatus and S. manteri to marine and freshwater ecological groups, respectively. However, Bunyatova & Mikailov (1991) and Choudhury & Dick (1998) suggested that the life cycle of S. semiarmatus can be realized in a freshwater environment too. Undoubtedly, the new species is a freshwater parasite, because the place where the sterlet was caught is separated from the Caspian Sea by a large section of the River Volga (downstream migrations of sterlet are limited; see: Sokolov & Vasil’ev, 1989) and cascades of the Volga’s hydroelectric dams. A record of juvenile specimens of S. nudidorsalis also suggests that infection with this parasite occurred at the place where the sterlet was caught. The conclusions of Bunyatova & Mikailov (1991) and Choudhury & Dick (1998) about the possibility of completion of the S. semiarmatus life-cycle in freshwater environments are based on records of this species in a freshwater riverine sterlet. It is possible that the data in the literature on Skrjabinopsolus in the freshwater riverine sterlet actually refer to S. nudidorsalis. The genus Skrjabinopsolus was originally placed in the family Acanthocolpidae (Ivanov & Myrygin, 1936). Skrjabin (1958) moved this genus to the family Deropristidae and placed deropristids into the superfamily Lepocreadioidea. A few years earlier, Cable & Hunninen (1942) had originally allocated deropristids as a subfamily of Lepocreadiidae. Most authors agreed with K. I. Skrjabin’s view on the family affiliation of Skrjabinopsolus spp. and the superfamily affiliation of deropristids (Peters, 1961; Skrjabina, 1974; Brooks et al., 1985; Gibson, 1996; Choudhury & Dick, 1998; Bray, 2005; Bray et al., 2009; Bray & Cribb, 2012). We obtained molecular evidence of the phylogenetic position of the genus Skrjabinopsolus and extrapolated this to the family Deropristidae, based on morphologically substantiated monophyly of deropristids (see: Choudhury & Dick, 1998). The results of phylogenetic analysis allow the consideration of Deropristidae as a family in the superfamily Monorchioidea, which is sister to the Monorchiidae + Lissorchiidae group (Fig. 1). The morphological similarity of deropristids to most other monorchioid trematodes (monorchiids and lissorchiids) is in the anatomy of the terminal genitalia, namely the presence of a cirrus-sac with bipartite seminal vesicle and spinous cirrus, and also in the large spinous metraterm (see: Bray, 2008; Madhavi, 2008). Among Deropristidae, cercariae have been described only for Deropristis inflata (Molin, 1859) and S. manteri (see: Cable & Hunninen, 1942; Seitner, 1951; Peters, 1961). Cercariae of these species possess a long tail, two eyespots, an excretory vesicle with well or moderately thick wall and have no stylet. These features of cercariae do not impede the inclusion of deroprestids into the Monorchioidea, because long-tailed, biocellate cercariae with thick-walled excretory vesicle and without a stylet are typical of some monorchiids (e.g. Cremonte et al., 2001; Gilardoni et al., 2011). The basal position of Deropristidae relative to other Monorchioidea members is consistent with the ancient origin of the definitive hosts of deropristid trematodes – acipenseriform and anguilliform fish. These fish groups appeared earlier than the lineage of clupeocephalan fishes (Hughes et al., 2018), which includes most of the definitive hosts of the Monorchiidae and Lissorchiidae. ACKNOWLEDGEMENTS The authors are deeply thankful to Drs Ilya I. Gordeev, Andrey D. Bykov and Dmitry M. Palatov (Russian Federal Research Institute of Fisheries and Oceanography, Moscow) for help in collecting samples of S. nudidorsalis from the River Oka, and Research Zoologist Dr Anna J. Phillips for essential help with examination of the S. manteri collection stored in the National Museum of Natural History, Washington DC. The present study was financialy supported by the Russian Science Foundation, project No: 17-74-20074. Conflict of interest: The authors declare that they have no conflict of interest to declare. [Version of record, published online 21 March 2020; http://zoobank.org/urn:lsid:zoobank.org:pub:093E8C8F-A240-49AC-9384-4BF0B3C27AEB] REFERENCES Agapova AI . 1966 . The parasites of fishes from ponds in Kazakhstan . Alma-Ata : Izdatelstvo Nauka Kazakhskoi SSR . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Atopkin DM , Besprozvannykh VV, Ha ND, Nguyen HV, Khamatova AY, Vainutis KS. 2019 . Morphometric and molecular analyses of Carassotrema koreanum Park 1938 and Elonginurus mugilus Lu 1995 (Digenea: Haploporidae) Srivastava, 1937 from the Russian Far East and Vietnam . Parasitology Research 118 : 2129 – 2137 . Google Scholar Crossref Search ADS PubMed WorldCat Betancur RR , Wiley EO, Arratia G, Acero A, Bailly N, Miya M, Lecointre G, Ortí G. 2017 . Phylogenetic classification of bony fishes . BMC Evolutionary Biology 17 : 162 . Google Scholar Crossref Search ADS PubMed WorldCat Birstein VJ , Waldman JR, Bemis WE, eds. 1997 . Sturgeon biodiversity and conservation. Dordrecht, Boston : Kluwer . Available at: https://doi.org/444/10.1007/0-306-46854-9 (date last accessed, 22 November 2019). Google Scholar Crossref Search ADS Google Scholar Google Preview WorldCat COPAC Blair D , Barker SC. 1993 . Affinities of the Gyliauchenidae: utility of the 18S rRNA gene for phylogenetic inference in the Digenea (Platyhelminthes) . International Journal for Parasitology 23 : 527 – 532 . Google Scholar Crossref Search ADS PubMed WorldCat Blasco-Costa I , Balbuena JA, Kostadinova AA, Olson PD. 2009 . Interrelationships of the Haploporinae (Digenea: Haploporidae): a molecular test of the taxonomic framework based on morphology . Parasitology International 58 : 263 – 269 . Google Scholar Crossref Search ADS PubMed WorldCat Bray RA . 2005 . Family Deropristidae Cable and Hunninen, 1942 . In: Jones A, Bray RA, Gibson DI, eds. Keys to the Trematoda, Vol. 2. Wallingford : CAB International and The Natural History Museum , 653 – 656 . Google Scholar Crossref Search ADS Google Scholar Google Preview WorldCat COPAC Bray RA . 2008 . Family Lissorchiidae Magath, 1917 . In: Bray RA, Gibson DI, Jones A, eds. Keys to the Trematoda, Vol. 3 . Wallingford : CAB International and The Natural History Museum , 177 – 186 . Google Scholar Crossref Search ADS Google Scholar Google Preview WorldCat COPAC Bray RA , Cribb TH. 2012 . Reorganization of the superfamily Lepocreadioidea Odhner, 1905 based on an inferred molecular phylogeny . Systematic Parasitology 83 : 169 – 177 . Google Scholar Crossref Search ADS PubMed WorldCat Bray RA , Webster BL, Bartoli P, Littlewood DTJ. 2005 . A molecular phylogenetic study of the Acanthocolpidae (Digenea) . Acta Parasitologica 50 : 281 – 291 . OpenURL Placeholder Text WorldCat Bray RA , Waeschenbach A, Cribb TH, Weedall GD, Dyal P, Littlewood DTJ. 2009 . The phylogeny of the Lepocreadioidea (Platyhelminthes, Digenea) inferred from nuclear and mitochondrial genes: implications for their systematics and evolution . Acta Parasitologica 54 : 310 – 329 . OpenURL Placeholder Text WorldCat Bray RA , Foster GN, Waeschenbach A, Littlewood DTJ. 2012 . The discovery of progenetic Allocreadium neotenicum Peters, 1957 (Digenea: Allocreadiidae) in water beetles (Coleoptera: Dytiscidae) in Great Britain . Zootaxa 3577 : 58 – 70 . Google Scholar Crossref Search ADS WorldCat Briscoe AG , Bray RA, Brabec J, Littlewood DTJ. 2016 . The mitochondrial genome and ribosomal operon of Brachycladium goliath (Digenea: Brachycladiidae) recovered from a stranded minke whale . Parasitology International 65 : 271 – 275 . Google Scholar Crossref Search ADS PubMed WorldCat Brooks DR , O’Grady RT, Glen DR. 1985 . Phylogenetic analysis of the Digenea (Platyhelminthes: Cercomeria) with comments on their adaptive radiation . Canadian Journal of Zoology 63 : 411 – 443 . Google Scholar Crossref Search ADS WorldCat Bunyatova II , Mikailov TK. 1991 . Variability of the morphological characters and its importance in the systematics of the digenean genus Skrjabinopsolus (Fasciolida, Acanthocolpidae . Izvestiya Akademii Nauk Azerbaidzhana (Seria Bioligicheskikh Nauk) 5–6 : 37 – 45 [in Russian]. OpenURL Placeholder Text WorldCat Bykhovsky BE , Dubinina MN. 1954 . Material on the systematics of the digenetic trematode family Acanthocolpidae Lühe, 1909 . Zoologicheskii Zhurnal 33 : 788 – 793 (In Russian). OpenURL Placeholder Text WorldCat Bykhovskaya-Pavlovskaya IE , Mikailov TK. 1969 . On the systematics of the digenetic trematode genus Skrjabinopsolus Ivanov, 1934 . Parazitologiya 3 : 164 – 167 [in Russian]. OpenURL Placeholder Text WorldCat Cable RM . 1952 . On the systematic position of the genus Deropristis, of Dihemistephanus sturionis Little, 1930, and of a new digenetic trematode from a sturgeon . Parasitology 42 : 85 – 91 . Google Scholar Crossref Search ADS PubMed WorldCat Cable RM , Hunninen AV. 1942 . Studies on Deropristis inflata; its life history and affinities to trematodes of the family Acanthocolpidae . Biological Bulletin, Woods Hole 3 : 292 – 312 . Google Scholar Crossref Search ADS WorldCat Čanković M , Delić S, Kiškarol M, Rukavina J. 1968 . Parasite fauna of freshwater fish from Bosnia and Hercegovina (Trematoda, Cestoda, Nematoda, Acanthocephala) . Sarajevo : Academy of Sciences and Arts of Bosnia and Hercegovina [in Bosnian]. Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Choudhury A , Dick TA. 1998 . Systematics of the Deropristiidae Cable and Hunninen, 1942 (Trematoda) and biogeographical associations with sturgeons (Osteichthyes: Acipenseridae) . Systematic Parasitology 41 : 21 – 39 . Google Scholar Crossref Search ADS WorldCat Choudhury A , Dick TA. 2001 . Sturgeons and their parasites: patterns and processes in historical biogeography . Journal of Biogeography 28 : 1411 – 1439 . Google Scholar Crossref Search ADS WorldCat Chulkova VN . 1939 . Parasites of marine fish in the vicinity of Batumi . Uchennye Zapiski Leningradskogo Gosudarstvennogo Universiteta, Seria Biologicheskikh Nauk 43 : 21 – 32 [in Russian]. OpenURL Placeholder Text WorldCat Cremonte F , Kroeck MA, Martorelli SR. 2001 . A new monorchiid (Digenea) cercaria parasitizing the purple clam Amiantis purpurata (Veneridae) from the southwest Atlantic Ocean, with notes on its gonadal effect . Folia Parasitologica 48 : 217 – 223 . Google Scholar Crossref Search ADS PubMed WorldCat Cribb TH , Bray RA, Littlewood DTJ, Pichelin S, Herniou EA. 2001 . Relationships of the Digenea – evidence from molecules and morphology . In: Littlewood DTJ, Bray RA, eds. Interrelationships of the Platyhelminthes . London : Taylor & Francis , 186 – 193 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Dao THT , Nguyen TGT, Gabriel S, Bui KL, Dorny P, Le TH. 2017 . Updated molecular phylogenetic data for Opisthorchis spp. (Trematoda: Opisthorchioidea) from ducks in Vietnam . Parasites & Vectors 10 : 575 . Google Scholar Crossref Search ADS PubMed WorldCat Darriba D , Taboada GL, Doallo R, Posada D. 2012 . jModeltest2: more models, new heuristics and parallel computing . Nature Methods 9 : 772 . Google Scholar Crossref Search ADS PubMed WorldCat Edelényi B . 1963 . Endoparasitic flatworms from our domestic fish . Acta Academiae Paedagogicae Agriensis 1 : 301 – 322 [in Hungarian]. OpenURL Placeholder Text WorldCat Edelényi B . 1967 . Data to the knowledge of piscicolous parasites in the River Tisza . Opuscula Zoologiea, Budapest 6 : 267 – 281 . OpenURL Placeholder Text WorldCat Edelényi B . 1974 . Fauna Hungariae, Vol. 117. Trematodes II. Digenea . Budapest : Akadémiai Kiadó [in Hungarian]. Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Evans NM , Lindner A, Raikova EV, Collins AG, Cartwright P. 2008 . Phylogenetic placement of the enigmatic parasite, Polypodium hydriforme, within the phylum Cnidaria . BMC Evolutionary Biology 8 : 139 . Google Scholar Crossref Search ADS PubMed WorldCat Gibson DI . 1996 . Trematoda . In: Margolis L, Kabata Z, eds. Guide to the parasites of fishes of Canada, Part IV . Ottawa : NRC Research Press , 1 – 373 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Gilardoni C , Posadas G, Kroeck MA, Cremonte F. 2011 . Monorchiid and aporocotylid cercariae (Digenea) parasitizing the purple clam Amiantis purpurata (Bivalvia, Veneridae) from the Southwestern Atlantic coast . Acta Parasitologica 56 : 385 – 391 . OpenURL Placeholder Text WorldCat Guindon S , Gascuel O. 2003 . PhyML: a simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood . Systematic Biology 52 : 696 – 704 . Google Scholar Crossref Search ADS PubMed WorldCat Hafeezullah M . 1984 . On the status of some digenetic trematodes of marine fishes of India . Bulletin of the Zoological Survey of India 6 : 209 – 218 . OpenURL Placeholder Text WorldCat Huelsenbeck JP , Ronquist F, Nielsen R, Bollback JP. 2001 . Bayesian inference of phylogeny and its impact on evolutionary biology . Science 294 : 2310 – 2314 . Google Scholar Crossref Search ADS PubMed WorldCat Hughes LC , Ortí G, Huang Y, Sun Y, Baldwin CC, Thompson AW, Arcila D, Betancur-R R, Li C, Becker L, Bellora N, Zhao X, Li X, Wang M, Fang C, Xie B, Zhou Z, Huang H, Chen S, Venkatesh B, Shi Q. 2018 . Comprehensive phylogeny of ray-finned fishes (Actinopterygii) based on transcriptomic and genomic data . Proceedings of the National Academy of Sciences 115 : 6249 – 6254 . Google Scholar Crossref Search ADS WorldCat Ivanov AS , Murygin II. 1936 . Materials to the helminthofauna of fishes of the lower Volga (parasitic worms of sturgeon fishes) . Trudy Astrakhanskogo Gosudarstvennogo Medicinskogo Instituta 4 : 21 – 46 [in Russian]. OpenURL Placeholder Text WorldCat Komarova TI . 1968 . Metacercaria of digenetic trematodas (sic!) of the benthic Arthropoda from the basins of the Danube delta . Vestnik Zoologii 6 : 7 – 14 [in Russian]. OpenURL Placeholder Text WorldCat Kumar S , Stecher G, Tamura K. 2016 . MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets . Molecular Biology and Evolution 33 : 1870 – 1874 . Google Scholar Crossref Search ADS PubMed WorldCat Le TH , Nguyen KT, Nguyen NT, Doan HT, Dung DT, Blair D. 2017 . The ribosomal transcription units of Haplorchis pumilio and H. taichui and the use of 28S rDNA sequences for phylogenetic identification of common heterophyids in Vietnam . Parasites & Vectors 10 : 17 . Google Scholar Crossref Search ADS PubMed WorldCat Littlewood DTJ , Olson PD. 2001 . Small subunit rDNA and the Platyhelminthes: signal, noise, conflict and compromise . In: Littlewood DTJ, Bray RA, eds. Interrelationships of Platyhelminthes . London : Taylor & Francis , 262 – 278 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Madhavi R . 2008 . Family Monorchiidae Odhner, 1911 . In: Bray RA, Gibson DI, Jones A, eds. Keys to the Trematoda, Vol. 3 . Wallingford : CAB International and The Natural History Museum , 145 – 175 . Google Scholar Crossref Search ADS Google Scholar Google Preview WorldCat COPAC Madhavi R , Bray R. 2018 . Digenetic trematodes of Indian marine fishes . Heidelberg : Springer . Available at: https://doi.org/10.1007/978-94-024-1535-3 (date last accessed, 22 November 2019). Google Scholar Crossref Search ADS Google Scholar Google Preview WorldCat COPAC Mikailov TK . 1975 . Parasites of fishes of Azerbaijan waters (systematics, dynamics, origin). Baku : Izdatelstvo “Elm” (in Russian). Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Molin RP . 1858 . Prospectus helminthum, quae in parte secunda prodromi faunae helminthologicae venetae continentur . Sitzungsberichte der Kaiserlichen Academie der Wissenschaften. Mathematisch-naturwissenschaftliche Classe, Wien 30 : 127 – 158 . OpenURL Placeholder Text WorldCat Noei MR . 2011 . Parasitic worms of Acipenser stellatus, A. gueldenstaedtii, A. nudiventris and Huso huso (Chondrostei: Acipenseridae) from the southwest shores of the Caspian Sea . Caspian Journal of Environmental Sciences 9 : 257 – 266 . OpenURL Placeholder Text WorldCat Olson PD , Cribb TH, Tkach VV, Bray RA, Littlewood DTJ. 2003 . Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda) . International Journal for Parasitology 33 : 733 – 755 . Google Scholar Crossref Search ADS PubMed WorldCat Osmanov SO . 1940 . Material on the parasite-fauna of fishes of the Black Sea . Uchennye Zapiski Leningradskogo Pedagogicheskogo Instituta 30 : 187 – 265 [in Russian]. OpenURL Placeholder Text WorldCat Peters LE . 1961 . The genus Skrjabinopsolus (Trematoda: Digenea), with reference to the allocreadioid problem . American Midland Naturalist 65 : 436 – 445 . Google Scholar Crossref Search ADS WorldCat Pornruseetairatn S , Kino H, Shimazu T, Nawa Y, Scholz T, Ruangsittichai J, Saralamba NT, Thaenkham U. 2016 . A molecular phylogeny of Asian species of the genus Metagonimus (Digenea)-small intestinal flukes-based on representative Japanese populations . Parasitology Research 115 : 1123 – 1130 . Google Scholar Crossref Search ADS PubMed WorldCat Schell S . 1970 . The trematodes . Dubuque : Brown Company Publishers . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Seitner GP . 1951 . The life history of Allocreadium ictaluri Pearse, 1924 (Trematoda: Digenea) . Journal of Parasitology 37 : 223 – 244 . Google Scholar Crossref Search ADS PubMed WorldCat Shen J . 1990 . Digenetic trematodes of marine fishes from Hainan Island . Beijing : Science Publications [in Chinese]. Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Shulman SS . 1954 . Survey of parasite fauna of the USSR sturgeons . Trudy Leningradskogo Obshchestva Estestvoispitatelei 72 : 190 – 254 [in Russian]. OpenURL Placeholder Text WorldCat Skrjabin KI . 1958 . Family Deropristidae Skrjabin, 1958 . In: Skrjabin KI, ed. Trematody zhyvotnykh i cheloveka. Osnovy Trematodologii. Vol. 15 . Moscow : Nauka , 29 – 48 [in Russian]. Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Skrjabina ES . 1974 . Helminths of sturgeons (Acipenseridae Bonaparte, 1831) . Moscow : Izdatelstvo Nauka [in Russian]. Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Sokolov LI , Vasil’ev VP. 1989 . Acipenser ruthenus Linnaeus, 1758 . In: Holcik J, ed. The freshwater fishes of Europe, Vol. 1, Part II. General introduction to fishes, Acipenseriformes. Wiesbaden : AULA-Verlag , 227 – 262 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Thaenkham U , Nawa Y, Blair D, Waikagul J. 2011 . Confirmation of the paraphyletic relationship between Opisthorchiidae and Heterophyidae using a small and large subunit ribosomal DNA sequences as DNA markers . Parasitology International 60 : 521 – 523 . Google Scholar Crossref Search ADS PubMed WorldCat Tkach V , Pawlowski J, Mariaux J. 2000 . Phylogenetic analysis of the suborder Plagiorchiata (Platyhelminthes, Digenea) based on partial lsrDNA sequences . International Journal for Parasitology 30 : 83 – 93 . Google Scholar Crossref Search ADS PubMed WorldCat Tkach VV , Littlewood DT, Olson PD, Kinsella JM, Swiderski Z. 2003 . Molecular phylogenetic analysis of the Microphalloidea Ward, 1901 (Trematoda: Digenea) . Systematic Parasitology 56 : 1 – 15 . Google Scholar Crossref Search ADS PubMed WorldCat Truett GE . 2006 . Preparation of genomic DNA from animal tissues . In: Truett GE, Kieleczawa J, ed. The DNA book: protocols and procedures for the modern molecular biology laboratory . Sudbury : Jones and Bartlett Publisher , 33 – 46 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC Yukhimenko SS , Belyaev VA. 2002 . Parasite fauna of the kaluga from River Amur and the use of parasitology data to study the population structure of this species . Voprosy Rybolovstva 3 : 73 – 83 [in Russian]. OpenURL Placeholder Text WorldCat Žitňan R . 1966 . Die Trematoden des Flusses Hron . Helminthologia 7 : 201 – 220 [in German]. OpenURL Placeholder Text WorldCat © 2020 The Linnean Society of London, Zoological Journal of the Linnean Society This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Related Journals: