Laboratory Medicine

Wei,, Luo;Nan,, Yao;Ying,, Bian;Zuoliang,, Dong

doi: 10.1093/labmed/lmz023pmid: 31152169

Abstract Background Although many factors may interfere with hemoglobin (Hb)A1c measurement, Hb variants are among the most important factors. Methods We tested the HbA1c levels of the patient, a 32 year old Manchu Chinese woman, during a routine health check. We used different methods, including high-performance liquid chromatography (HPLC) and capillary electrophoresis, to test specimens from the patient. Next, we tested the specimen further using polymerase chain reaction (PCR) and sequencing. Results We discovered that our patient, who had an HbA1c value of 0, also has an Hb variant, Hb Long Island, which we found during the HbA1c analysis as part of her routine health check at the Health Management Center in the General Hospital of Tianjin Medical University, Tianjin, China. Also, we discovered that the exon 1 of β gene contained transversion mutations, with 1 heterozygous and 1 homozygous variant (HBB:c.8A > C, 9T > C). These gene mutations resulted in an amino-acid change (His to Pro) and a decrease in HbA1c value. Conclusions When there is no correlation between the clinical signs, glycemic status, and glycated Hb levels of the patient, the chromatogram of HbA1c should be carefully checked to detect possible variants that cause interference in the measurement. diabetes, hemoglobin variant, HbA1c, β-gene Diabetes mellitus is a growing public health problem worldwide. According to the World Health Organization (WHO), diabetes will be the seventh leading cause of death by the year 2030.1 Glycated hemoglobin (GHb) plays an important role in diabetes management, and hemoglobin (Hb)A1c is recommended by the WHO for use in diabetes diagnosis.2 Ion-exchange high-performance liquid chromatography (HPLC) is widely used in the detection of HbA1c in many hospitals;3 however, the presence of Hb variants may interfere with the quantification of HbA1c when tested by HPLC.4 In this study, we report a rare Hb variant, Hb Long Island. We discovered this variant in our patient, a 32 year old Manchu Chinese woman, during a routine health check at the General Hospital of Tianjin Medical University, Tianjin, China. Materials and Methods An abnormal Hb level was detected in a 32 year old Manchu Chinese woman during a routine health check, It was reported that the patient had an HbA1c value of 0, as measured by the HLC-723G8 analyzer in standard mode (Tosoh G8; Tosoh Corporation). Her HbA1c level was also tested via the BioRad Variant II (Bio-Rad Laboratories, Inc) and Sebia Capillarys 2 FP (Sebia SA) instruments. The hematological parameters were detected with an automated cell counter (Sysmex, XN-2000+PA-990, Sysmex Corporation) based on the flow cytometry method, and her fasting glucose level was tested using the cobas 6000 analyzer (F. Hoffman-La Roche, Ltd). Isolation of genomic DNA was performed with a TIANamp Blood DNA kit (TIANGEN Biotech Co. Ltd) according to the manufacturer-provided instructions. The α1, α2, β1–2, β3, Aγ, and Gγ globin genes were amplified by PCR using pairs of primers (synthesized by BGI Tech Solutions Co. Ltd; Table 1) that were designed according to GeneBank and a report by Lin et al.5 PCR was performed with Phusion DNA Polymerase (Thermo Fisher Scientific Inc.) with 35 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 60 seconds, and a final extension at 72°C for 20 minutes. Finally, the amplified fragments were tested by electrophoresis and sequenced by BGI Tech. All of our clinical findings and hematological indices were collected after written informed consent from the patient. Table 1. α1, α2, β1–2, β3, Aγ, and Gγ Globin Gene Primers for PCR and Sequencing Gene Name . Sequencing (5'–3') . Product Size (bp) . α1 (exon 1 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: CCATGCCTGGCACGTTTGCTGAG α2 (exon 2 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: AACACCTCCATTGTTGGCACATTCC β1–2 (exon 1–2 of β gene) F: CTAGGGTTGGCCAATCTACTC 700 R: GCAATCATTCGTCTGTTTCC β3 (exon 3 of β gene) F: AAGGCTGGATTATTCTGAGTC 446 R: TGTATTTTCCCAAGGTTTGA Aγ F: TGAAACTGTTGCTTTATAGGAT 658 R: GAGCTTATTGATAACCTCAGACG Gγ F: CTGCTAACTGAAGAGACTAAGATT 723 R: CAAATCCTGAGAAGCGACCT Gene Name . Sequencing (5'–3') . Product Size (bp) . α1 (exon 1 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: CCATGCCTGGCACGTTTGCTGAG α2 (exon 2 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: AACACCTCCATTGTTGGCACATTCC β1–2 (exon 1–2 of β gene) F: CTAGGGTTGGCCAATCTACTC 700 R: GCAATCATTCGTCTGTTTCC β3 (exon 3 of β gene) F: AAGGCTGGATTATTCTGAGTC 446 R: TGTATTTTCCCAAGGTTTGA Aγ F: TGAAACTGTTGCTTTATAGGAT 658 R: GAGCTTATTGATAACCTCAGACG Gγ F: CTGCTAACTGAAGAGACTAAGATT 723 R: CAAATCCTGAGAAGCGACCT Abbreviations: PCR, polymerase chain reaction; F, forward primer; R, reverse primer. Open in new tab Table 1. α1, α2, β1–2, β3, Aγ, and Gγ Globin Gene Primers for PCR and Sequencing Gene Name . Sequencing (5'–3') . Product Size (bp) . α1 (exon 1 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: CCATGCCTGGCACGTTTGCTGAG α2 (exon 2 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: AACACCTCCATTGTTGGCACATTCC β1–2 (exon 1–2 of β gene) F: CTAGGGTTGGCCAATCTACTC 700 R: GCAATCATTCGTCTGTTTCC β3 (exon 3 of β gene) F: AAGGCTGGATTATTCTGAGTC 446 R: TGTATTTTCCCAAGGTTTGA Aγ F: TGAAACTGTTGCTTTATAGGAT 658 R: GAGCTTATTGATAACCTCAGACG Gγ F: CTGCTAACTGAAGAGACTAAGATT 723 R: CAAATCCTGAGAAGCGACCT Gene Name . Sequencing (5'–3') . Product Size (bp) . α1 (exon 1 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: CCATGCCTGGCACGTTTGCTGAG α2 (exon 2 of α gene) F: TCCCCACAGACTCAGAGAGAACC 880 R: AACACCTCCATTGTTGGCACATTCC β1–2 (exon 1–2 of β gene) F: CTAGGGTTGGCCAATCTACTC 700 R: GCAATCATTCGTCTGTTTCC β3 (exon 3 of β gene) F: AAGGCTGGATTATTCTGAGTC 446 R: TGTATTTTCCCAAGGTTTGA Aγ F: TGAAACTGTTGCTTTATAGGAT 658 R: GAGCTTATTGATAACCTCAGACG Gγ F: CTGCTAACTGAAGAGACTAAGATT 723 R: CAAATCCTGAGAAGCGACCT Abbreviations: PCR, polymerase chain reaction; F, forward primer; R, reverse primer. Open in new tab Results Our laboratory performed the initial HbA1c testing using a Tosoh G8 HPLC analyzer; we noted a 0% result (reference range [RR], 4%–6%) (Figure 1A). After comparing this value with that from the healthy control individual (Figure 1B), we discovered that the customary HbA1c peak was absent (shown by an arrow in Figure 1A). Normal peaks from left to right represent A1a, A1b, F, LA1c+, s-a1c, and A0, respectively. The shaded peak, namely, s-a1c, is the target peak HbA1c. The value of each peaks are shown below the graphs in the Figures. To exclude the interference of an HbS variant (sickle-cell anemia) with HbA1c,6 we also observed the blood smear with Wright staining; however, there was no abnormality in blood-cell morphology in this patient (data not shown). Figure 1 Open in new tabDownload slide Chromatograms of hemoglobin (Hb)A1c analysis via Tosoh G8 analyzer (Tosoh Corporation). A, Results of analysis of a specimen from the case-study patient, a 32 year old Manchu Chinese woman. B, Results of analysis of a specimen from the healthy control individual. Figure 1 Open in new tabDownload slide Chromatograms of hemoglobin (Hb)A1c analysis via Tosoh G8 analyzer (Tosoh Corporation). A, Results of analysis of a specimen from the case-study patient, a 32 year old Manchu Chinese woman. B, Results of analysis of a specimen from the healthy control individual. The other relevant test results from the patient were as follows. For routine blood testing: Hb 121 g per L; mean corpuscular volume (MCV), 88.1 fL; mean corpuscular Hb (MCH), 27.6 pg; mean corpuscular Hb concentration (MCHC), 313 g per L; red blood cell (RBC) count, 4.38 × 1012 per L; and RBC distribution width (RDW), 14.4%. For fasting glucose: 5.07 mmol per L (RR, 3.6–6.1 mmol/L). All of these clinical findings and hematological indices showed no abnormity. To exclude the limitations of the Tosoh G8 in our laboratory, we used a BioRad Variant II in another clinical laboratory from Tianjin Cancer Hospital for reexamination of our specimen. Using this method, we observed that the peak HbA1c value for our patient was also absent (as shown by the arrow in Figure 2A), compared with the control specimens (Figure 2B). We note our discovery of an unknown peak in the parameter table (in Figure 1A) of this patient, with 49.2% value of the area. Figure 2 Open in new tabDownload slide Case study hemoglobin (Hb)A1c analysis via Bio Rad Variant II instrument (BioRad Laboratories, Inc. A, Analysis of a specimen from our patient, a 32 year old Manchu Chinese woman. B, Analysis of a specimen from the healthy control individual. Figure 2 Open in new tabDownload slide Case study hemoglobin (Hb)A1c analysis via Bio Rad Variant II instrument (BioRad Laboratories, Inc. A, Analysis of a specimen from our patient, a 32 year old Manchu Chinese woman. B, Analysis of a specimen from the healthy control individual. The study of Hb by capillary zone electrophoresis (Sebia Capillarys 2 FP) showed anomalous peaks and electropherogram (Figure 3A), compared with the reading from a specimen from a healthy control (Figure 3B). Atypical graph alarm results were shown in Figure 3A with white box markers and arrows. An abnormal strip was considered to indicate A1c with suspicious value of 0.8%, via the instrument. However, the instrument finally displayed an atypical peak diagram alarm and did not calculate the true HbA1c value. Figure 3 Open in new tabDownload slide Hemoglobin (Hb) analysis using a Sebia Capillarys 2 FP instrument (Sebia SA). A, Results from a specimen from our patient, a 32 year old Manchu Chinese woman. B, Results from a specimen from the healthy control individual. Figure 3 Open in new tabDownload slide Hemoglobin (Hb) analysis using a Sebia Capillarys 2 FP instrument (Sebia SA). A, Results from a specimen from our patient, a 32 year old Manchu Chinese woman. B, Results from a specimen from the healthy control individual. A total of 6 PCR-amplified fragments (α1, α2, β1–2, β3, Aγ, and Gγ) were acquired and tested by electrophoresis. Except for the low yield of β3, all of the other bands were approximately the correct length (Figure 4A). To exclude the influence of primer dimers on the β3 electrophoresis results, we amplified and electrophoresed β3 again. Finally, a clear and approximately correct β3 product was acquired (Figure 4B). To further investigate the Hb-gene characteristics, all of the amplified products were sequenced. Although there was no mutation in the other genes, we found 1 heterozygous and 1 homozygous gene mutant in exon 1 of the β gene with HBB:c.8A > C, 9T > C (CAT to CCC), which resulted in 1 amino-acid change from His to Pro (Figure 4C and 4D). After consulting the HbVar database (http://globin.cse.psu.edu/), we discovered that this amino mutant has been reported as Hb Long Island. Figure 4 Open in new tabDownload slide Results of electrophoresis testing of 6 polymerase chain reaction (PCR) fragments. A, Identification of the polymerase chain reaction (PCR) products of globin genes α1, α2, β1–2, β3, Aγ, and Gγ. B, Reamplification and identification of the β3 gene. C, Sequencing of the β1–2 globin gene of the first exon and substitution of CAT → CCC; the arrows indicate the 2 mutant peaks. D, Details of β1–2 globin gene-sequence alignment. Figure 4 Open in new tabDownload slide Results of electrophoresis testing of 6 polymerase chain reaction (PCR) fragments. A, Identification of the polymerase chain reaction (PCR) products of globin genes α1, α2, β1–2, β3, Aγ, and Gγ. B, Reamplification and identification of the β3 gene. C, Sequencing of the β1–2 globin gene of the first exon and substitution of CAT → CCC; the arrows indicate the 2 mutant peaks. D, Details of β1–2 globin gene-sequence alignment. Discussion The National Academy of Clinical Biochemistry (NACB) requires repeated measurement and further study of HbA1c when its value is greater than 15% or less than 3.5%; it is best to use different methods with different principles to determine whether there is an Hb variant.7,8 According to this guideline, we tested this patient specimen with different methods, including HPLC and capillary electrophoresis, and all of the results indicated that there must be a variant. We also analyzed this specimen by G8 variation mode; however, the result also cannot specify which the variation is (date not shown). We believed this result may be attributed to the fact that the G8 current variation database does not include this variant. Subsequent PCR and sequencing results confirmed our prediction. After comparing it with the listings in the HbVar database (http://globin.cse.psu.edu/), we discovered that this Hb variant is described in the second and third bases of codon 2 of the beta chain (CAT > CCC) at the gene level. This change resulted in amino His changing into Pro. This amino-acid variation was first reported by Barwick et al9; those investigators named this variation Hb Long Island. However, there is a wide difference in HbA1c testing results (their HbA1c by cation-exchange chromatography was 51% of total Hb) compared with our findings; we believe this result occurred perhaps due to the ethnic difference between our patient and theirs or other, deeper reasons. The results of our present research only uncovered the variant and confirmed the mutation, so further biochemical structural and Hb glycation studies are needed to reveal why this mutation causes the HbA1c measurement to drop to 0. We discovered that when Hb Long Island is present, HPLC is inappropriate for quantifying HbA1c and monitoring glycemic control. We believe that this finding is an important contribution to Hb variant research. In such cases, alternative methods, such as affinity chromatography, immunologic assay, or glycated serum albumin detection, may be useful. Abbreviations Abbreviations WHO World Health Organization GHb glycated hemoglobin Hb hemoglobin HPLC high-performance liquid chromatography MCV mean corpuscular volume MCH mean corpuscular hemoglobin MCHC mean corpuscular hemoglobin concentration RBC red blood cell RDW red blood cell distribution width F forward primer R reverse primer Acknowledgments We thank study staff members at Tianjin Medical University Cancer Hospital and Tosoh Corporation in Shanghai, China for equipment and technical support. The study was approved by the ethics committee of Tianjin Medical University, Tianjin Medical University General Hospital. Also, we thank LetPub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript. This work was supported by Youth Incubation Foundation of General Hospital of Tianjin Medical University (ZYYFY2016024), National Science Foundation of China (81701968). References 1. Schwarz PE , Gallein G , Ebermann D , et al. Global diabetes survey–an annual report on quality of diabetes care . Diabetes Res Clin Pract. 2013 ; 100 ( 1 ): 11 – 18 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Saxena P , Verma P , Goswami B . Comparison of diagnostic accuracy of non-fasting DIPSI and HbA1c with fasting WHO criteria for diagnosis of gestational diabetes mellitus . J Obstet Gynaecol India. 2017 ; 67 ( 5 ): 337 – 342 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Roth J , Müller N , Lehmann T , et al. Comparison of HbA1c measurements using 3 methods in 75 patients referred to one outpatient department . Exp Clin Endocrinol Diabetes. 2018 ; 126 ( 1 ): 23 – 26 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Torrejón MJ , Ortíz-Cabrera NV , M Nieto J , et al. Hb Moncloa: a new variant of haemoglobin that interferes in the quantification of HbA1c . Clin Biochem. 2017 ; 50 ( 9 ): 521 – 524 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Lin M , Wen Y-F , Wu JR , et al. Hemoglobinopathy: molecular epidemiological characteristics and health effects on Hakka people in the Meizhou region, southern China . PLoS One. 2013 ; 8 ( 2 ): e55024 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Sultana TA , Sheme ZA , Sultana GS , et al. Challenges in HbA1c analysis and reporting in patients with variant hemoglobins . Mymensingh Med J. 2016 ; 25 ( 2 ): 248 – 254 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 7. Radin MS . Pitfalls in hemoglobin A1c measurement: when results may be misleading . J Gen Intern Med. 2014 ; 29 ( 2 ): 388 – 394 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Sacks DB , Arnold M , Bakris GL , et al. Guidelines and recommendations for laboratory analysis in the diagnosis and management of diabetes mellitus . Clin Chem. 2011 ; 57 ( 6 ): e1 – e47 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Barwick RC , Jones RT , Head CG , Shih MF , Prchal JT , Shih DT . Hb Long Island: a hemoglobin variant with a methionyl extension at the NH2 terminus and a prolyl substitution for the normal histidyl residue 2 of the beta chain . Proc Natl Acad Sci U S A. 1985 ; 82 ( 14 ): 4602 – 4605 . Google Scholar Crossref Search ADS PubMed WorldCat © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Clavijo,, Alex;Fallaw,, David;Coule,, Philip;Singh,, Gurmukh

doi: 10.1093/labmed/lmz047pmid: 31414127

Abstract Background Timely communication of critical laboratory results is important yet cumbersome. Objective To assess the impact of a new technology on the process of reporting critical laboratory results at our 480-bed, adult/children, tertiary-care, medical school–affiliated health center in the southeastern region of the United States. Methods We changed the process of reporting critical values by telephone only to reporting via telephone and a secure messaging app. Physician order entry, an online on-call roster for availability, and support from the C-suite (executive branch of the organization) were instrumental in implementation. Results Consistently, before our process changes, more than 95% of the critical laboratory results were reported in less than 30 minutes. Use of the app reduced the time taken for reporting results. The need to involve pathology residents and attending physicians in reporting has been eliminated by this process. Discussion Secure messaging has facilitated the reporting of critical laboratory values, making it more efficient and providing a reliable record of the process. This process meets or exceeds the standards of the accrediting agencies. The method is suitable for activating rapid-response teams in case of hypercritical values. critical laboratory results, secure messaging app, performance improvement, accrediting agency standards, hypercritical values, employee satisfaction Critical laboratory values are findings that need immediate attention by a bedside health care provider (eg, a seriously low or seriously high serum potassium level, extremely low hemoglobin level, extremely high international normalized ratio [INR]). A second category of findings, although it does not require immediate action, are deemed to be so important that direct communication with the health care provider is warranted (eg, first time diagnosis of malignant neoplasms in a given patient). There are multiple standards regarding communication of critical values, as defined by the United States federal government and accrediting agencies such as the College of American Pathologists (CAP) and The Joint Commission.1–3 The following elements are generally expected to be satisfied for proper communication of critical values: Establishing critical values: The actual values are not mandated by accrediting agencies or the United States Department of Health and Human Services. The results and the values considered critical are identified by each health care facility and approved by the Medical Executive Committee of the institution. Almost all critical values are within the purview of the Department of Clinical Pathology/Laboratory Medicine. First time diagnoses of malignant neoplasms and frozen section results are generally treated as critical results in the Department of Anatomic Pathology. In addition to the results requiring immediate attention and action by a bedside caregiver, some tests and any results from those tests are deemed critical (eg, cerebrospinal fluid examination results and examination of blood smear for malarial parasites).4,5 Timeliness of notification: The CAP, through its laboratory accreditation program, suggests that at least 90% of critical values be reported within 30 minutes from the time the result is verified. A similar requirement is in place through The Joint Commission. Other institutions may set a more stringent standard. The institution where this report originated expects 95% or more of the critical values be reported within 30 minutes.5–7 Verification and documentation of notification (readback): To ensure that the results are received by an appropriate caregiver and that those results are communicated accurately, the institutions usually define the categories of personnel authorized to receive results. The authorized personnel are generally physicians and nurses. Unit clerks are usually not considered appropriate staff members to receive critical values. If the results are communicated by the laboratory staff member to a physician, the name of the physician contacted, time of contact, and documentation of readback is recorded as a comment with the results in the laboratory records. If the result is provided to a nonphysician, the person contacted by the laboratory is required to notify the concerned physician and to record the notification and readback in the medical record. Readback involves the person contacted by the laboratory reading back to the sender the results communicated by the laboratory, to ensure accurate transmission of information.2,3 Problems with the usual process of communicating critical values: Identity of the person to be notified: Usually, the person ordering the test is notified. This part of the process used to be problematic before provider order entry; however, it is generally not a problem now because provider order entry has been implemented as part of the electronic medical record, at least at this institution. Contacting the provider: The first step was generally calling the location of the patient, to reach the responsible provider. If phone call to the location of the patient was not successful in contacting a suitable person for transmission of the critical values, the next step was to page the provider. If the provider did not return the page, there was risk of the process breaking down due to the laboratory staff member being busy/engaged/overwhelmed in analytical processes.6,7 At our institution, if the laboratory staff member was unable to contact a person responsible for the patient after 2 tries, the clinical pathology resident was contacted for assistance in communicating the critical values. The pathology resident often reviewed the medical record to identify the responsible attending physician and tried to page that physician to communicate the results. If the pathology resident was unsuccessful in reaching the responsible attending physician, the next person contacted was the on-call attending pathologist. The attending pathologist had the option of determining whether the process could be terminated and the results conveyed the following day during regular duty hours. If the pathologist determined that waiting was not advisable, that person had the option of contacting the service chief of the relevant clinical service and, if needed, the Chief Medical Officer of the hospital. This final option was rarely used; however, approximately 5% of the result reporting was delayed beyond the 30-minute goal. Methods The activity reported herein was carried out as part of the continuing quality improvement process of the laboratory at our 480-bed, adult/children, tertiary-care, medical school–affiliated health center in Augusta, GA (in the southeastern region of the United States).8 The new protocol for using the Imprivata Cortext (Imprivata, Inc.; hereinafter, Cortext) secure messaging system was as follows: In November 2017, our institution implemented the Cortext app-based, secure messaging system for communication of protected health information (PHI). The app is designed to replace pagers and is usable in computers and on smartphones. All of the providers, including in-house staff members, can be contacted by secure messaging through this app. Also, users can search the directory of medical center personnel through the app. The choice of app was made at the executive level; all other departments in the medical center implemented that app. Several other apps are available; however, the laboratory did not evaluate other vendors or apps.9 The flowchart for communication of critical values is shown in Figure 1. The process is in evolution; the old and new steps are shown. The app displays whether the intended sender is available (Figure 2). If the first targeted contact, usually a member of the in-house staff, is not available, the second targeted person, usually the attending physician, is contacted. The name and medical record number for the patient, as well as the critical results for that person, are transmitted through the app. The laboratory personnel still usually call the location of the patient first, especially during off-hours, and communicate the results by phone, using Cortext as a back-up, despite that they have the option of using the Cortext as the first step. The laboratory plans to shift to using Cortext entirely. Sending the message via Cortext serves the same purpose as a pager: an audible alert is activated in phone of the intended recipient. If the laboratory staff member is unable to reach a person who is responsible for the patient after 2 attempts, the laboratory staff member is expected to contact the on-call pathology resident and hand over the process to that person. The resident may involve the attending pathologist, as needed. Notification via Cortext obviates the need for readback because results are communicated in a written format, and the communication is documented in the app. Closing the loop: Use of Cortext allows closing the loop in communication—the fact that the intended recipient has opened the message (and is presumably reading it) is documented in the system and can be viewed at the time of reporting. The on-line availability of the call schedule for all of the clinical service units has further facilitated the process of identifying a caregiver who is responsible for the patient. In case of technical issues with Cortext, the usual process of notification by phone call is maintained. Cortext maintains the record of communications; those records are retrievable through the electronic medical record, as needed. The records include patient identity, the identities of the persons reporting and receiving the message, the date and time of communication, and record of receipt and reading of the message. Figure 1 Open in new tabDownload slide Flowchart for communicating critical values. * indicates that reporting using the Imprivata Cortex secure-messaging system (Imprivata, Inc.) is being implemented as the first step in notification of critical values; **, before implementation of the Cortext system (Imprivata, Inc.), the laboratory staff member contacted the pathology resident to continue the process. If the resident was unable to resolve the issue, the matter was escalated to the attending pathologist; EHR indicates electronic health record. Figure 1 Open in new tabDownload slide Flowchart for communicating critical values. * indicates that reporting using the Imprivata Cortex secure-messaging system (Imprivata, Inc.) is being implemented as the first step in notification of critical values; **, before implementation of the Cortext system (Imprivata, Inc.), the laboratory staff member contacted the pathology resident to continue the process. If the resident was unable to resolve the issue, the matter was escalated to the attending pathologist; EHR indicates electronic health record. Figure 2 Open in new tabDownload slide Screenshots from the Imprivata Cortex secure messaging app (Imprivata, Inc.). The top segment shows the initiation of the message. Alex Clavijo is the sender; Alex can see that Gurmukh Singh is available, as indicated by the green dot with check marks next to the name. The text message would usually include the patient name, medical record number (MRN), and the critical result, plus any additional text message content. The middle panel shows the appearance of the screen on the phone/computer of the sender, which indicates that Gurmukh Singh received and opened the message, as indicated by the open envelope on the right side of the blue message box. The bottom panel would appear on the device of the sender if the recipient acknowledges the message. Figure 2 Open in new tabDownload slide Screenshots from the Imprivata Cortex secure messaging app (Imprivata, Inc.). The top segment shows the initiation of the message. Alex Clavijo is the sender; Alex can see that Gurmukh Singh is available, as indicated by the green dot with check marks next to the name. The text message would usually include the patient name, medical record number (MRN), and the critical result, plus any additional text message content. The middle panel shows the appearance of the screen on the phone/computer of the sender, which indicates that Gurmukh Singh received and opened the message, as indicated by the open envelope on the right side of the blue message box. The bottom panel would appear on the device of the sender if the recipient acknowledges the message. Screenshots from the Cortext messaging system are shown in Figure 2. The timeliness of reporting of critical values is an ongoing goal, the progress of which is monitored as part of the laboratory quality management program. The results are reported at each monthly meeting. Results Since implementing notification using the Cortext system, the laboratory has consistently achieved notification of critical results in less than 30 minutes in 95% or more of instances (Table 1). The results are statistically significantly stronger than before, despite that the laboratory was meeting the reporting requirement of notifying 95% of the critical values in less than 30 minutes even before the implementation of secure messaging. The timeliness of notification of critical results has improved since the introduction of secure messaging. Results of an anonymous survey of laboratory personnel regarding the reduction in time spent in communicating critical values indicated a decrease in time until notification, from a mean of 16.6 minutes to 5.9 minutes, after implementation of the Cortext system. A similar anonymous survey of the residents, regarding the frequency of calls related to reporting critical values during a 6-week period, revealed that the frequency had decreased from 14 to 0. Also, we note that the need to escalate the issue to attending physicians in the Department of Pathology did not take place in the past year. A dedicated survey of the physicians regarding their satisfaction with Cortext for reporting of critical values was not conducted. However, the results of a general survey of satisfaction with laboratory services did not reveal any issues with critical-values reporting. The laboratory underwent an accreditation inspection by CAP after the introduction of the Cortext system. No deficiencies or recommendations were identified for the standards pertaining to notification of critical values. Table 1. Timeliness of Reporting Critical Values Before and After Implementing the Imprivata Cortext Secure Messaging Systema,b Timeliness of Reporting Critical Values . No. of Minutes . Before . After . <10 74.8% 93.1% 11–20 11.5% 3.5% 21–30 8.9% 1.4% 31–60 3.3% 1.3% >60 1.6% 0.7% Timeliness of Reporting Critical Values . No. of Minutes . Before . After . <10 74.8% 93.1% 11–20 11.5% 3.5% 21–30 8.9% 1.4% 31–60 3.3% 1.3% >60 1.6% 0.7% aManufactured by Imprivata, Inc. bThe timeliness is significantly improved after implementation of the Imprivata Cortext system (P <.001). Also, percentages may not total 100 because of rounding. Open in new tab Table 1. Timeliness of Reporting Critical Values Before and After Implementing the Imprivata Cortext Secure Messaging Systema,b Timeliness of Reporting Critical Values . No. of Minutes . Before . After . <10 74.8% 93.1% 11–20 11.5% 3.5% 21–30 8.9% 1.4% 31–60 3.3% 1.3% >60 1.6% 0.7% Timeliness of Reporting Critical Values . No. of Minutes . Before . After . <10 74.8% 93.1% 11–20 11.5% 3.5% 21–30 8.9% 1.4% 31–60 3.3% 1.3% >60 1.6% 0.7% aManufactured by Imprivata, Inc. bThe timeliness is significantly improved after implementation of the Imprivata Cortext system (P <.001). Also, percentages may not total 100 because of rounding. Open in new tab Discussion Notification of critical laboratory results is an important function of the clinical laboratory. The performance of this service is monitored by the laboratory quality management programs and may be the only laboratory item submitted to, or discussed at, the hospital wide quality management programs. The accrediting agencies have explicit standards regarding the performance of this function.2,3 Telephones have been the traditional method for transmitting critical results. All laboratory personnel have experienced problems with the process of notification of critical values. An anecdotal list of the issues includes inability to identify the physician responsible for the patient in question; lack of response to paging by the physician; the contacted physician declining to accept critical values; misunderstanding of the results by the non-physician employee receiving the critical value; rude behavior from the physician toward the laboratory staff member communicating the results; the physician declining to read back results, as required by standards; and the laboratory staff members losing track of the process when a page is not returned due to other issues that may need immediate attention, resulting in the critical value notification not being completed. In the uncommon circumstance of adverse outcomes related to a critical value, there is a general tendency to blame the laboratory for not communicating the critical values properly. Laboratory staff members spend considerable time and effort in ensuring compliance with reporting of critical values, not to mention the aggravation incurred through unsuccessful attempts at this process. Through the efforts of the laboratory staff members, the institution met the goal of reporting more than 95% of critical values in less than 30 minutes, even before the implementation of the Cortext system. After that implementation, our laboratory experienced an objective, significant improvement in the timeliness of notification, surpassing the requirements of the medical center. The satisfaction of the laboratory staff members with the messaging process has improved; they note that less time is taken up by the process. Improvements in the process gained by using electronic means of communication have been noted by other researchers as well.9–11 Text messaging is now a common mode of communication between 2 or multiple parties; however, such messaging is not secure enough for transmission of protected health information. The proprietary Cortext app addresses these issues and allows timely notification of critical values. The Cortext system has replaced pagers at our institution; its app has the added advantage of transmitting information securely and eliminating the need for return phone calls. At the initiation of messaging, the app shows whether the person intended to be contacted is available, thus avoiding the risk of trying to contact a person who may not be on duty. As mentioned earlier, the online availability of the on-call roster has further facilitated the communication of critical values. An additional endeavor that is not in use at this medical center but could be easily implemented through the Cortext system would be activation of a rapid-response team in cases of hypercritical values.12,13 Multiple parties on a given team could be notified with a single action. In summary, using the Cortext system for notification of critical laboratory values has improved the efficiency, reliability, and documentation of the process. It has been particularly effective in eliminating the need to escalate the process to pathology residents and attending pathologists. Abbreviations Abbreviations INR international normalized ratio CAP College of American Pathologists PHI protected health information EHR electronic health record MRN medical record number Acknowledgements We thank Issac Green, MT, for assistance in data collection. Personal and Professional Conflicts of Interest None reported. References 1. Lundberg G . When to panic over abnormal values . MLO Med Lab Obs. 1972 ; 4 : 47 – 54 . OpenURL Placeholder Text WorldCat 2. http://www.cap.org/ShowProperty?nodePath=/UCMCon/Contribution%20Folders/DctmContent/education/OnlineCourseContent/2016/LAP-TLTMv2/checklists/cl-gen.pdf. Accessed April 20, 2019. 3. The Joint Commission. National Patient Safety Goals Effective January 1, 2015: Hospital Accreditation Program. https://www.lovell.fhcc.va.gov/about/NationalPatientSafetyGoals2015.pdf. Accessed on June 12, 2019. 4. Genzen JR , Tormey CA ; Education Committee of the Academy of Clinical Laboratory Physicians and Scientists . Pathology consultation on reporting of critical values . Am J Clin Pathol. 2011 ; 135 ( 4 ): 505 – 513 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Dighe AS , Rao A , Coakley AB , Lewandrowski KB . Analysis of laboratory critical value reporting at a large academic medical center . Am J Clin Pathol. 2006 ; 125 ( 5 ): 758 – 764 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Valenstein PN , Wagar EA , Stankovic AK , Walsh MK , Schneider F . Notification of critical results: a College of American Pathologists Q-Probes study of 121 institutions . Arch Pathol Lab Med. 2008 ; 132 ( 12 ): 1862 – 1867 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 7. Piva E , Sciacovelli L , Zaninotto M , Laposata M , Plebani M . Evaluation of effectiveness of a computerized notification system for reporting critical values . Am J Clin Pathol. 2009 ; 131 ( 3 ): 432 – 441 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Singh G . Innovation in equipment and technology acquisition: Long-term alliance for improved quality, efficiency and cost. In: Physician Leadership Library . Tampa, FL: American Association for Physician Leadership ; 2016 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 9. Listing of apps for secure communication of data in healthcare . https://alternativeto.net/software/imprivata/. Accessed June 22, 2019. 10. Saw S , Loh TP , Ang SB , Yip JW , Sethi SK . Meeting regulatory requirements by the use of cell phone text message notification with autoescalation and loop closure for reporting of critical laboratory results . Am J Clin Pathol. 2011 ; 136 ( 1 ): 30 – 34 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Kuperman GJ , Teich JM , Tanasijevic MJ , et al. Improving response to critical laboratory results with automation: results of a randomized controlled trial . J Am Med Inform Assoc. 1999 ; 6 ( 6 ): 512 – 522 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Etchells E , Adhikari NKJ , Cheung C , et al. Real-time clinical alerting: effect of an automated paging system on response time to critical laboratory values–a randomised controlled trial . Qual Saf Health Care. 2010 ; 19 ( 2 ): 99 – 102 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Newitt VN. Labs Add Safety Net to Critical Values Procedure . CAP Today website. https://www.captodayonline.com/labs-add-safety-net-to-critical-values-procedure/. Accessed June 12, 2019. Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Sathirareuangchai,, Sakda;Whelen, A, Christian

doi: 10.1093/labmed/lmz065pmid: 31580429

Abstract The genus Coccidioides is composed of C. immitis and C. posadasii. Both can cause coccidioidomycosis and are geographically restricted to certain areas of endemicity. The histopathologic features in pulmonary coccidioidomycosis include necrotizing granulomatous inflammation and the presence of spherules, which is considered to be a key diagnostic finding. Cavitary lung disease containing a fungal ball with branching septate hyphae is an unusual funding in pulmonary coccidioidomycosis but is typical for aspergillosis. We present a case of 42 year old man who underwent wedge resection of the lung for a persistent cavitary lesion. The microscopic examination shows a fungal ball composed of acute-angle branching septate hyphae, consistent with a diagnosis of aspergillosis. However, cultures and molecular testing by DNA sequencing of the 28S ribosomal DNA gene confirmed the identification of C. posadasii. This finding highlights the importance of exposure history and organism identification by either conventional cultivation or molecular testing in rendering an accurate diagnosis. pulmonary coccidioidomycosis, morphologic mimicker, fungal infection, aspergillosis, surgical pathology, microscopic finding Coccidioides spp. are dimorphic fungi endemic to the southwestern United States (California, Arizona, Nevada, New Mexico, and Texas), as well as certain areas in Central and South America.1 Based on genomic data, the genus can be divided into the species C. immitis and C. posadasii.2 Both species can cause infection in human (coccidioidomycosis) with no difference in clinical course. C. immitis is the main isolate from central and southern California, especially the San Joaquin Valley, while C. posadasii is mostly isolated from locations outside California.1 During its saprophytic phase in the soil, Coccidioides spp. exist in their mold form, with septate hyphae and barrel-shaped alternating arthroconidia. The arthroconidia are the primarily infectious form and are transmitted by inhalation. Inside the host, the arthroconidia transform into the characteristic spherules. The mature spherule is a large (30 μm to 100 μm), thick-walled, spherical structure containing multiple endospores (2 μm to 5 μm).1 Once a spherule ruptures, endospores are released, and each endospore further develops into a spherule as a continuing cycle in the host body. After inhalation of arthroconidia, incubation period usually takes 1 to 3 weeks. Most infected individuals (60%) will either become asymptomatic or show mild, self-limited, respiratory symptoms.1 The 40% of symptomatic patients will have an acute/subacute spectrum of diseases, ranging from “flu-like” to pneumonia.1 These symptoms include fever, cough, chest discomfort, malaise, and fatigue. Individuals who experienced pneumonia will have the same manifestation as that of any other community-acquired pneumonia.1 Herein, we describe a case of a middle-aged male who presented with unusual morphologic features of pulmonary coccidioidomycosis. Case Report The patient is a 42 year old man who was diagnosed with valley fever back in 2014 while incarcerated in Arizona. At that time, he had fever with chill, night sweats, hemoptysis, and weight loss. Chest computed tomography (CT) showed a cavitary lesion in the left upper lobe. A bronchoalveolar lavage fluid specimen was sent for fungal culture and found to be positive for Coccidioides species. He was treated with fluconazole with some improvement of symptoms. He continued to have episodic hemoptysis every few weeks. Repeat chest CT in 2018 showed a persistent lung lesion with increased solid component. Surgical treatment was offered, and the patient agreed to undergo wedge resection of the lesion. Wedge resection of the left upper lobe mass was then performed. The specimen was submitted to the pathology department for histology and to the microbiology laboratory for fungal culture and identification. Gross examination revealed a mass lesion with a cavity, measuring 2.5 × 2 × 1 cm. Histologic examination showed marked inflammation in the lung parenchyma with a cavity containing a fungal ball and necrotic tissue debris (Image 1). Chronic inflammatory infiltrate and squamous metaplasia in the cavity wall were noted (Image 2). Necrotizing granulomatous inflammation was identified (Image 3). The fungal organism was highlighted by Grocott-Gomori’s methenamine silver stain (GMS) and mainly showed acute-angle branching septate hyphae, resembling Aspergillus (Image 4). Further examination of the GMS stain revealed emptied spherules without endospores (Image 5). It is worth noting that the hyphae found in the specimen were mostly distorted and had terminal expansion, which is not typically seen in Aspergillus spp. Image 1 Open in new tabDownload slide Low power view of the cavitary lung lesion shows fungal ball (mycetoma) with surrounding chronic inflammation (hematoxylin-eosin, original magnification x20). Image 1 Open in new tabDownload slide Low power view of the cavitary lung lesion shows fungal ball (mycetoma) with surrounding chronic inflammation (hematoxylin-eosin, original magnification x20). Image 2 Open in new tabDownload slide Squamous metaplasia can be identified along the cavity wall. Lymphocytes, macrophages, and fibroblasts can also be seen in the surrounding lung parenchyma (hematoxylin-eosin, original magnification x100). Image 2 Open in new tabDownload slide Squamous metaplasia can be identified along the cavity wall. Lymphocytes, macrophages, and fibroblasts can also be seen in the surrounding lung parenchyma (hematoxylin-eosin, original magnification x100). Image 3 Open in new tabDownload slide High power view in another area of the lung shows granulomatous inflammation with central necrotic tissue (dotted line) and surrounding inflammatory infiltrate (hematoxylin-eosin, original magnification x200). Image 3 Open in new tabDownload slide High power view in another area of the lung shows granulomatous inflammation with central necrotic tissue (dotted line) and surrounding inflammatory infiltrate (hematoxylin-eosin, original magnification x200). Image 4 Open in new tabDownload slide Grocott-Gomori’s methenamine silver (GMS) stain highlights septate hyphae with acute angle branching as the main component in the fungal ball (GMS stain, original magnification x400). Image 4 Open in new tabDownload slide Grocott-Gomori’s methenamine silver (GMS) stain highlights septate hyphae with acute angle branching as the main component in the fungal ball (GMS stain, original magnification x400). Image 5 Open in new tabDownload slide Empty spherules without endospores are evident in some areas (GMS stain, original magnification x400). Image 5 Open in new tabDownload slide Empty spherules without endospores are evident in some areas (GMS stain, original magnification x400). Fungal culture initially revealed waxy colonies that eventually showed only sterile hyphae without any distinguishing characteristics. Since conventional cultivation failed to show any identifiable characteristics, the isolate was sent for molecular testing. By performing DNA sequencing of the D1/D2 region and the internal transcribed spacer (ITS) region of the 28S ribosomal DNA gene, the fungal organism was identified as C. posadasii. The patient reported to have no recurrent cough or shortness of breath after the surgery. His medication was changed to voriconazole instead of fluconazole and he responded to treatment. Discussion Histologic assessment of pulmonary mycoses occurs when a lung biopsy or wedge resection is performed to evaluate a mass lesion. Although a definitive identification of a fungus cannot be made from hematoxylin and eosin (H&E) slide alone, a pathologist should provide at least information regarding the morphology of the organism to the physician. These morphologic findings can be used as a preliminary diagnosis to guide the therapeutic decision. Certain fungi appear in the specimen in their yeast form, such as Histoplasma capsulatum, Cryptococcus neoformans, Blastomyces dermatitidis, and Paracoccidioides spp. The presence of acute-angled branching, septate hyphae raises the possibility of aspergillosis, while right-angled branching, nonseptate hyphae are consistent with mucormycosis. The histopathologic features in pulmonary coccidioidomycosis include necrotizing, often suppurative, granulomatous inflammation, along with eosinophil infiltrate, either within the granulomas and the surrounding parenchyma.3 The presence of spherules is considered to be pathognomonic for pulmonary coccidioidomycosis.3 In the case of an amorphous necrotic background, both spherules and endospores can be highlighted with GMS stain. Although rare, fungal hyphae or mycelial forms of Coccidioides spp. can be encountered. This phenomenon was first mentioned by Forbus and Bestebreurtje in 1946.4 In their study, the hyphal form was visualized in 1 of 95 surgical specimens evaluated. Hyphae and spherules were also reported to coexist in the same individual.5 In some cases, the hyphal form can be a prominent finding, posing a challenge in differentiating between Coccidioides and Aspergillus spp. in surgical specimens.5 However, septate branching hyphae with terminal expansion were noted to be more consistent with the presence of Coccidioides spp.6 The hyphal form was found to be more common among individuals with diabetes mellitus type 2.7 When present, the hyphal form tends to be associated with cavitary coccidioidomycosis.8 Klotz et al proposed a theory that the cavity favors hyphal development over spherules because of its low CO2 concentration.8 The incidence of cavity formation was estimated to be 13% to 15% of pulmonary coccidioidomycosis cases.9 The presence of a fungus ball inside the cavity is also uncommon. The majority of these cases were reported from the areas of endemicity, including California,10–12 Arizona,5 and Mexico.7 In the latest case series based in Arizona by Sobonya et al in 2014, the authors described 21 patients with cavitary pulmonary coccidioidomycosis, with 6 cases (28%) containing a fungal ball in the cavity.13 Outside the areas of endemicity, there is a limited number of case reports of cavitary coccidioidomycosis.6,14,15 Thus, traveling history to the area of endemicity is important to remind laboratory personnel of the possibility of coccidioidomycosis. The pathology of cavitary pulmonary coccidioidomycosis has been well described.13 The wall of the cavity usually shows palisading fibroblasts and fibrosis with chronic inflammation. Squamous reepithelialization can be seen in 43% of cases. Granuloma is not typically seen in the cavity wall but rather in the adjacent lung parenchyma. Lymphoid hyperplasia and chronic bronchiolitis are seen in most cases. Atypical morphologic features of Coccidioides spp. resembling other fungi have been recognized. A cavitary lesion with fungal ball formation would most commonly be confused with Aspergillus spp., as demonstrated in the present case. In some circumstances, thick-walled immature arthroconidia or “germ tubes” and appressed immature or atypical spherules can resemble budding cells and mimic the broad-based budding cells of Blastomycosis dermatitidis.15,16 The spherules of Coccidioides spp. can sometimes show multiple cleavages resembled the morular form of Prototheca spp.16 Endospores outside spherules or young spherules without endospores can be confused with Histoplasma spp., Cryptococcus spp., Candida spp., and other yeasts, especially in the cerebrospinal fluid (CSF).17 Regarding fungal infection in general, the rate of discrepancy between histology findings and culture results was previously reported by Sangoi et al.18 In their study, the discrepant diagnoses were identified in 21% of specimens submitted for both histology and fungal culture. After reviewing the cases, the authors concluded that the causes of discrepancy were: 1) misidentification of septate and nonseptate hyphal organisms and yeast forms, 2) morphological mimics, 3) use of inappropriate terminology, and 4) incomplete knowledge in mycology. Conclusion Since coccidioidomycosis is rarely encountered outside an area of endemicity, the presence of a fungal ball and the hyphal form in the setting of a cavitary lung lesion might be easily misinterpreted as aspergillosis. Thus, exposure history is critical to obtain and should be provided to the laboratory. In addition to histologic assessment, microbiology testing with either conventional cultivation or a molecular method is essential to accurately identify the organism so that appropriate antifungal therapy can be administered. Abbreviations Abbreviations CT computed tomography GMS Grocott-Gomori’s methenamine silver stain ITS internal transcribed spacer H&E hematoxylin and eosin CSF cerebrospinal fluid References 1. Saubolle MA , McKellar PP , Sussland D . Epidemiologic, clinical, and diagnostic aspects of coccidioidomycosis . J Clin Microbiol. 2007 ; 45 : 26 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Fisher MC , Koenig GL , White TJ , Taylor JW . Molecular and phenotypic description of Coccidioides posadasii sp. nov., previously recognized as the non-California population of Coccidioides immitis . Mycologia. 2002 ; 94 : 73 – 84 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Katzenstein A-LA . Infection II: granulomatous infections. In: Diagnostic Atlas of Non-neoplastic Lung Disease . New York, NY : Demos Medical Publishing ; 2016 : 181 – 200 . Google Scholar Google Preview OpenURL Placeholder Text WorldCat COPAC 4. Forbus WD , Bestebreurtje AM . Coccidioidomycosis; a study of 95 cases of the disseminated type with special reference to the pathogenesis of the disease . Mil Surg. 1946 ; 99 : 653 – 719 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 5. Winn RE , Johnson R , Galgiani JN , Butler C , Pluss J . Cavitary coccidioidomycosis with fungus ball formation. Diagnosis by fiberoptic bronchoscopy with coexistence of hyphae and spherules . Chest. 1994 ; 105 : 412 – 416 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Osaki T , Morishita H , Maeda H , et al. Pulmonary coccidioidomycosis that formed a fungus ball with 8-years duration . Intern Med. 2005 ; 44 : 141 – 144 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Muñoz-Hernández B , Martínez-Rivera MA , Palma Cortés G , Tapia-Díaz A , Manjarrez Zavala ME . Mycelial forms of Coccidioides spp. in the parasitic phase associated to pulmonary coccidioidomycosis with type 2 diabetes mellitus . Eur J Clin Microbiol Infect Dis. 2008 ; 27 : 813 – 820 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Klotz SA , Drutz DJ , Huppert M , Sun SH , DeMarsh PL . The critical role of CO2 in the morphogenesis of Coccidioides immitis in cell-free subcutaneous chambers . J Infect Dis. 1984 ; 150 : 127 – 134 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Gadkowski LB , Stout JE . Cavitary pulmonary disease . Clin Microbiol Rev. 2008 ; 21 : 305 – 333 , table of contents. Google Scholar Crossref Search ADS PubMed WorldCat 10. Thadepalli H , Salem FA , Mandal AK , Rambhatla K , Einstein HE . Pulmonary mycetoma due to Coccidioides immitis . Chest. 1977 ; 71 : 429 – 430 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Fee HJ , McAvoy JM , Michals AA , Gold PM . Unusual manifestation of Coccidioides immitis infection . J Thorac Cardiovasc Surg. 1977 ; 74 : 548 – 550 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Bayer AS , Yoshikawa TT , Galpin JE , Guze LB . Unusual syndromes of coccidioidomycosis: diagnostic and therapeutic considerations; a report of 10 cases and review of the English literature . Medicine (Baltimore). 1976 ; 55 : 131 – 152 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Sobonya RE , Yanes J , Klotz SA . Cavitary pulmonary coccidioidomycosis: pathologic and clinical correlates of disease . Hum Pathol. 2014 ; 45 : 153 – 159 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Rohatgi PK , Schmitt RG . Pulmonary coccidioidal mycetoma . Am J Med Sci. 1984 ; 287 : 27 – 30 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Ke Y , Smith CW , Salaru G , Joho KL , Deen MF . Unusual forms of immature sporulating Coccidioides immitis diagnosed by fine-needle aspiration biopsy . Arch Pathol Lab Med. 2006 ; 130 : 97 – 100 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 16. Kaufman L , Valero G , Padhye AA . Misleading manifestations of Coccidioides immitis in vivo . J Clin Microbiol. 1998 ; 36 : 3721 – 3723 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Saubolle MA . Laboratory aspects in the diagnosis of coccidioidomycosis . Ann N Y Acad Sci. 2007 ; 1111 : 301 – 314 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Sangoi AR , Rogers WM , Longacre TA , Montoya JG , Baron EJ , Banaei N . Challenges and pitfalls of morphologic identification of fungal infections in histologic and cytologic specimens: a ten-year retrospective review at a single institution . Am J Clin Pathol. 2009 ; 131 : 364 – 375 . Google Scholar Crossref Search ADS PubMed WorldCat © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

doi: 10.1093/labmed/lmz095pmid: N/A

Article PDF first page preview Close This content is only available as a PDF. © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Bertholf, Roger, L

doi: 10.1093/labmed/lmz097pmid: 31834383

In January 1970, volume 1, issue #1 of a brand new journal rolled off the J.B. Lippincott press in Philadelphia, PA. The journal was named Laboratory Medicine, and it took its place alongside the American Journal of Clinical Pathology in the American Society for Clinical Pathology (ASCP) portfolio of scientific publications. Laboratory Medicine was the brainchild of Dr. Sylvester E. Gould and replaced 2 previous ASCP publications, The Bulletin of Pathology and the Technical Bulletin of the Registry of Medical Technologists. Gould, the journal’s first editor, described his vision for Laboratory Medicine in the inaugural issue: “This periodical is intended to serve the interests of all medical laboratory workers—pathologists, clinical chemists, medical technologists, and others, without regard for their academic attainment as attested by degree or title—B.S., M.T., Ph.D., M.D., or other. It is designed to foster a spirit of cooperation among all medical laboratory workers and to advance the common goal of high professional and scientific endeavor—whether in learning or teaching, in clinical application or research. It shall strive toward elevation of the standards of education and performance—and thereby, the quality of patient care.” Thus began what now has been a 50-year journey for Laboratory Medicine, during which time it has had 6 editors (and 1 interim editor), 7 cover designs, 3 publishers, 3 titles (Laboratory Medicine, LABMEDICINE, and Lab Medicine), and 1 curator of its cover art. The profession of laboratory medicine has reached many milestones in the past 50 years, and most of them are chronicled in the pages of this journal. I believe Laboratory Medicine has not only been witness to great progress in clinical laboratory practice, but it also has substantially contributed to it. The journal has reached its own milestones as well, such as the creation of a complementary website, labmedicine.com, and its acceptance in 2014 by the National Library of Medicine for indexing in the MEDLINE database. To commemorate its half-century of service to laboratory medicine professionals, Lab Medicine will publish a series of essays tracing the history of the journal over the past 50 years. The first installment, appearing in this issue, describes the beginnings of the journal and its growth and evolution under the leadership of Dr. Coye C. Mason, who took over as editor in March 1970 after Dr. Gould sadly had to step aside due to failing health. Subsequent installments will describe the changes in the appearance and focus of Laboratory Medicine over its lifetime, its response to the political and economic uncertainties that transformed healthcare in the 1980s and 1990s, its reinvention in 2004, and its complete makeover in 2012. While preparing this series of historical essays, I was privileged to talk with some of the previous editors, and they were kind enough to give me some of their thoughts about the journal, which I am delighted to share. The entire series will be published on the labmedicine.com. Look for the 50th anniversary logo, which will also appear on the cover of all 2020 issues of Lab Medicine. If you would like to include your own comments on the history of Laboratory Medicine, or simply add your congratulations, email them to me or tweet them with the hashtag #LabMedTurns50. Your feedback may be included on the 50th anniversary webpage. Please include your full name, credentials (if applicable), and hometown if you would like your comments to be posted on the website. It also gives me great pleasure to announce that, starting with this issue, Lab Medicine will begin publishing bimonthly. I am very grateful to the ASCP Board of Directors for their response to our growth and success, and the additional 2 issues per year will help us provide more timely publication of the outstanding scientific papers we receive. This, the 539th (vol. 51, #1) issue of Laboratory Medicine, ushers the journal into its next era. While we dedicate this year to celebrating the past 50 years of Laboratory Medicine, we also look forward to a bright future for the journal and the profession. Honor the past, but welcome the future – e e cummings Author notes Editor in Chief © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Bertholf, Roger, L

doi: 10.1093/labmed/lmz093pmid: 31894859

In his introductory editorial titled, “Laboratory Medicine Moves Ahead,” appearing in the January 1970 issue of Laboratory Medicine, Dr. S.E. Gould quotes Louis Pasteur: “Take an interest, I entreat you, in those sacred places that are significantly designated as laboratories. Ask that they be multiplied and adorned. They are the future temples of wealth and well being. It is within them that humanity matures and grows stronger and better.” Gould then provides his own vision of the future of the new journal: “This periodical is intended to serve the interests of all medical laboratory workers—pathologists, clinical chemists, medical technologists, and others, without regard for their academic attainment as attested by degree or title—BS, MT, PhD, MD, or other. It is designed to foster a spirit of cooperation among all medical laboratory workers and to advance the common goal of high professional and scientific endeavor—whether in learning or teaching, in clinical application or research. It shall strive toward elevation of the standards of education and performance—and thereby, the quality of patient care.” American Society of Clinical Pathologists (ASCP) President Clyde G. Culbertson added: “Laboratory Medicine should then be the source of new educational and scientific information—for pathologists and nonpathologists alike.” Thus, a new journal, dedicated to the interests of all medical laboratory professionals and the quality of patient care, was born. Laboratory Medicine replaced 2 ASCP publications, The Bulletin of Pathology and Technical Bulletin of the Registry of Medical Technologists, consolidating the 2 journals into a single publication designed for both pathologists and laboratory technical staff. As an official publication of the ASCP, the journal would be sent to all ASCP members and all ASCP-registered medical technologists; its initial circulation was over 65,000. The journal was published by the J.B. Lippincott Company in Philadelphia, PA. The first editor of Laboratory Medicine was the renowned cardiac pathologist Sylvester E. Gould, MD, DSc, who was assisted by associate editor W.A.D. Anderson, MD, author of several popular textbooks on pathology, and managing editor John L. Normoyle. The inaugural issue included 3 papers featuring Building 37, which housed the National Aeronautics and Space Administration (NASA) Lunar Receiving Laboratory at the Houston Manned Spacecraft Center (renamed the Lyndon B. Johnson Space Center in 1973), and the cover displayed a photomicrograph of a pulverized sample of lunar rock. In July 1969, Apollo 11 astronauts Neil Armstrong and Edwin “Buzz” Aldrin became the first humans to walk on the surface of the moon. On their return, NASA quarantined the astronauts and the samples they collected from the moon surface for 21 days in Building 37 while tests for foreign biological activity were conducted. The 3-article series included an interview with NASA pathologist Craig L. Fischer, who was responsible for the laboratory services in Building 37, a discussion by NASA veterinary pathologist Norman D. Jones of the techniques used to detect biological activity in the moon samples, and first-person accounts by medical technologists who worked in the laboratory. Dr. Gould’s term as editor of Laboratory Medicine was brief, as he was forced to resign from the position for health reasons after the second issue. In regretfully accepting his friend’s resignation, ASCP President Culbertson said of Dr. Gould, “The Society and the profession owe heartfelt thanks to Mannie Gould for the enthusiasm, the long hours and hard work he has put into his editorial efforts for so many years.” The third issue of Laboratory Medicine (March 1970) had a new editor, Coye C. Mason, MD, an academic pathologist and medical illustrator who established the Dreyer Medical Laboratory in Aurora, IL. Dr. Mason was the first ASCP commissioner of continuing education, and he would serve as editor of Laboratory Medicine for nearly 8 years. The October 1970 issue (vol 1, no. 10) introduced what would become a regular monthly feature, an editorial by the ASCP president. The first presidential editorial, “Accentuate the Positive,” was written by Elmer R. “Al” Jennings, MD, who, along with Stanley Levey, devised their eponymous control chart in 1950 while at Wayne University College of Medicine in Detroit, MI. The monthly presidential editorials continued under Dr. Jennings’s successor as ASCP president, William D. Dolan, MD. The first issue of volume 4 (January 1974) included an editorial by 1973 ASCP president Jack M. Layton, MD, but the feature then went dormant until Robert J. Frost, MD, renewed the monthly editorials during his term as ASCP president in late 1974. The tradition would be continued by his successors, ASCP presidents James J. Humes, MD (1975), Warren L. Bostick, MD (1976), and George J. Carroll, MD (1977). On March 15. 1971, the ASCP moved its headquarters from 710 S. Wolcott Ave. to new offices on 2100 W. Harrison Street in Chicago, IL. The Laboratory Medicine editorial office relocated along with the Society. The May 1971 issue of Laboratory Medicine (vol 2, no. 5) reported that, on March 22, 1971, the U.S. District Court in Chicago dismissed a complaint filed in 1969 by the American Society of Medical Technologists (ASMT) against the ASCP for violation of antitrust laws, claiming that the ASCP conspired to monopolize trade in commercial medical laboratories through its registry of medical technologists and its refusal to acknowledge the ASMT as the official representative of the profession. Although the decision was appealed by the ASMT, the hatchet appeared to be buried at the 1974 Spring Meeting in Los Angeles, CA, when ASMT president Annamarie Barros met with the ASCP Board of Directors to discuss joint initiatives among the 2 organizations. However, in the February 1977 issue of Laboratory Medicine (vol 8, no. 2), ASCP president George Carroll announced that the ASMT had withdrawn its representative to the ASCP Board of Registry and had no intentions for future participation in ASCP operations. In the January 1975 issue (vol 6, no. 1), ASCP president James J. Humes, MD, announced a new feature that would consist of model laboratory procedures to be published in Laboratory Medicine, intended as templates for a properly designed laboratory procedure manual. From the feedback in letters to the editor, it is apparent the feature was popular with readers, even getting the attention of Dr. William G. Bernhard, who complained in a letter to the editor on behalf of the College of American Pathologists that their accreditation program had not been mentioned along with the Centers for Disease Control and Prevention (CDC) as an agency that accredits clinical laboratories. Some Laboratory Medicine readers took offense to the cover of the June 1976 issue (vol 7, no. 6). The image on that cover was a painting by artist Aaron Bohrod entitled “The Autopsy,” a framed reproduction of which was presented to ASCP by member Dr. Milton G. Bohrod, brother of the artist, at the Spring meeting in Dallas, TX (the original hung in the ASCP Educational Center in Chicago). Although not particularly graphic in detail, some readers complained that such an image should not adorn the cover of a magazine that is mailed unwrapped. Another Bohrod painting appeared on the cover of the July 1977 issue (vol 8, no. 7). Laboratory Medicine entered its eighth year amid a flurry of correspondence that centered on an article published in the November 1976 (vol 7, no. 11) issue, titled “MD vs. MT: An Attitude Survey.” The article, authored by Charles G. Showery, Jr., MT, summarized the results of a survey he conducted involving pathologists and medical laboratory personnel in Texas, New Mexico, and New York. A complete description of the survey results appeared in another journal, but the editorial staff of Laboratory Medicine agreed to publish a brief summary of his results as an informal article. To the surprise of few, the survey identified “lack of respect” as a principal reason for dissatisfaction with medical technology as a profession. Showery concluded his article with a wish: “I would like to see in the future, articles with titles such as ‘M.D. and M.T.’ instead of ‘M.D. vs. M.T.'” In October 1977, Merilyn Wiler, MT(ASCP)SBB, was appointed associate editor of Laboratory Medicine, and she pledged to make the publication more relevant to medical technologists, urging her colleagues to submit articles to the journal and offering a fee of $25 for submissions accepted for publication. Her term as associate editor began in January 1978 with the first issue of volume 9. The December 1977 (vol 8, no. 12) Laboratory Medicine was the last issue to list Coye C. Mason, MD, as its editor. With the exception of the first 2 issues, Dr. Mason had been the only editor in the journal’s history, and Laboratory Medicine was very much created in his image. Letters were a regular feature from the first issues of Laboratory Medicine, and they offer some insight into the early growing pains of the new journal. Some comments in the letters were complimentary, even laudatory, while others were deeply critical. Some letters offered suggestions for improvement, while others expressed the view that Laboratory Medicine was a poor substitute for the publications it replaced. There were humorous comments, indignant comments, scholarly insights, and detailed corrections among the many letters published in journal. Occasionally, but not often, there was an editorial response presumably written by Dr. Mason; those responses were always dignified and appropriate. However, the editor chooses which letters to print and which deserve a response, and Dr. Mason’s choices provide a unique window into his editorial philosophy. Ever professional and diligent in his responsibilities as editor, there are hints of Coye Mason’s humor as well, such as when 3 letters were printed together, with the following: one described the journal as worthless, another praised its value, and a third characterized Laboratory Medicine as “interesting.” Dr. Mason probably chuckled to himself as he selected those 3 letters for publication. During nearly all of Dr. Mason’s tenure, editorials were penned by the ASCP president, a choice that ceded what many editors would consider their prerogative. This, too, reflects the humility and grace of someone whose aim was service above self. Dr. Coye C. Mason died on February 6, 2009. Notable articles in Laboratory Medicine volumes 1 to 8 include: Detection of circulating cancer cells. (1970) 1:4 p. 16. Lamé KD. Can an automated laboratory system be cost justified? (1970) 11:1 p. 10. Banatvala JE. The EB virus and infectious mononucleosis. (1971) 2:1 p. 30. Child PL. An in-depth look at drug abuse. (1971) 2:7 p. 11. Murphy GH. A workload recording method for clinical laboratories. (1972) 3:7 p. 18. Jackson JA, Vastbinder E, Hamburg J. A report of laboratory procedures performed in a physician’s office or clinic. (1973) 4:9 p. 17. Bucklin R. Informed consent—a problem for the pathologists? (1974) 5:6 p. 28. Wolf PL, Kearns T, Neuhoff J, Lauridson J. Identification of CPK isoenzyme MB in myocardial infarction. (1974) 5:7 p. 48. Weindling H, Henry JB. Drug interaction and clinical laboratory data. (1975) 6:1 p. 24. Free AH, Free HM. Urine sugar testing—state of the art. (1975) 6:2 p. 23. Rappoport AE, Berquist RE, Gennaro WD. The communicating magnetic card. (1975) 6:4 p. 22. Henry JB, Martin BG, Pusch AL. Organization and response of clinical pathology to ambulatory and emergency patient care. (1975) 6:6 p. 41. Dixon, MG. Legal implications of computers in the medical laboratory. (1976) 7:5 p. 25. Showery CC. MD vs. MT: an attitude survey. (1976) 7:11 p. 9. A news item in vol 1, no. 10 (October 1970): Diagnosis by Computer? Within 20 years, all diagnoses will be made by automated equipment. That is the prediction made by Dr. Fritz Geiger, president of the Austrian Society of General Practice, during the Fourth World Conference on General Practice, in Chicago, IL, in August. The Austrian physician said that within the next 2 decades, computers will take over the function of diagnosing all medical ailments. This will necessitate the training of more medical students as general practitioners and family physicians, he also said. Dr. Geiger also predicted there to be around-the-clock family health service by physicians working in groups as one of the coming developments in medicine. Letter to the Editor in the April 1973 (vol 4, no. 4) issue: I am neither a tight-lipped Calvinist nor an enthusiast of anchoritic austerity, but I must confess that I wince at the thought of having the ASCP-CAP meeting in Honolulu. This strikes me as an inexcusably profligate gesture in an era in which we are at last becoming aware of the dark underside of the Great American Dream of endless consumption of inexhaustible resources, and of the fact that we will before too long have to face some fairly unpleasant consequences of our heedless past. If any group should be cognizant of the implications of our national lifestyle of “squander now and to hell with the future,” certainly the medical profession should be. Again, if any group should, both by precept and example, assume the leadership required to revise our individual and societal priorities, and to draw back gradually to a simpler mode of living, certainly ours should be that group. One of the most prestigious scientific meetings in this country—the Gordon Conferences—convenes on the campuses of rural New England private schools, during student vacations when the dormitories and lecture halls are free for the conference. This provides some extra income for the private schools, which are notoriously destitute, and the spare and modest accommodations, together with the breathtakingly beautiful countryside, are like a breath of fresh air when contrasted with the stifling atmosphere and prodigal luxury of the usual conference hotels. This alone would commend it, aside from the lesser expense of traveling to the meetings. How about considering some such change in the meetings of the ASCP-CAP?” Philip M. Allen, M.D., Deputy Chairman, University of Virginia School of Medicine, Department of Pathology, Charlottesville, Virginia Letter to the Editor in August 1973 issue (vol 4, no. 8): Regarding the letter entitled, “Girlie Girlie Magazine” in the April issue, contrary to the remarks of that letter (do I detect a touch of women’s lib?), I think the advertisements in Laboratory Medicine are steadily improving with each issue. It is rather delightful to look at a thing of beauty in an advertisement rather than an old bag, which is rather depressing. In fact, I think that well-endowed beauty in the American Optical Corporation advertisement is rather neat. Keep up the good work! Hart Isaacs, Jr., M.D., Pathologist, Children’s Hospital of Los Angeles, Los Angeles, California Coming in the March issue, The History of Laboratory Medicine, Part 2: 1978–1985; Refocusing the Objective. Economics: Cost of a 10k gold lapel pin from ASCP in 1971: $5.20. Rate for round-trip airfare and hotel accommodations for 8 nights and 9 days at the 1973 ASCP-CAP Joint Spring Meeting in Honolulu, Hawaii (from Chicago): $443.88. Subscription to Laboratory Medicine: in 1970: $2.40/year. in 1975: $8.00/year. in 1976: $10.00/year. in 1977: $12.00/year. © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

doi: 10.1093/labmed/lmz098pmid: N/A

The Laboratory Medicine staff would like to extend a warm thank you to our 2019 ad hoc reviewers. We appreciate your time and dedication to the journal. April Abbott Gyorgy Abel Bahattin Adam Adeyemi Adesina Ahmad Akbari Sameer Al Diffalha Loai Aljerf Mohamed Alsammak Harold Alvarez Ashraf Aminorroaya Muhammad Amjad Denise Anamani Emmanuel Andres Ana Araujo Sophie Arbefeville Johan Arendt Tony Bakke Kristina Behan Sylva Bem Mary Berg Johannes Berkhof Gaetano Bernardi Parul Bhargava Jay Bock Geza Bodor N. M. Bulanov Eileen Burd Thierry Burnouf Zheng Cao Vani Chandrashekar Dong Chen Sindhu Cherian Mikael Christiansen Betty Chung Robin Collingwood Cristoforo Comi Steven Cotten Jesse Cox Genevieve Crane Ann Crowley Michael Cruise Steven Dallas Jaime Davila Kristin Deeb Gaoyan Deng Zaian Deng Gregory Denomme Zeinab Deris Zayeri Sridevi Devaraj Slavica Dodig Andrew Don-Wauchope Steven Drexler Walter Dzik Nagwa Mostafa El-Sayed Ahmet Emre Eskazan Emre Eskazan Kevin Fisher Michael Gannett Manjula Garapati Ravinder Garg Uttam Garg Jonathan Genzen Keihan Ghatreh Samani Richard V. Goering Cheryl Goss Dina Greene David Grenache Amy Groszbach Ron Haas Robert Handin Brian Harrington Jane Hata Habib Haybar Jeanne Hendrickson Jonathan Heras Matthew Hiemenz Daniel Holmes Mina Hur Ishwarlal Jialal Yan-Fang Jiang Lisa Johnson Paul Johnson Kanchan Kantekure Walter E. Kaufmann Adil Khan Moon Keun Kim Vijaya Knight Scott Koepsell Piotr Korczynski Matthew Krasowski Andras Lacko Seied Amir Latifi Veeravan Lekskulchai Jun Li J Liang Randie Little Sanam Loghavi Rami Mahfouz Masumeh Maleki Michal Masarik Adam McShane Yara Michelacci Linda Miller Ranjana Minz Lorena Mosso Pawel Mroz Caitlin Murphy Alagarraju Muthukumar Nicholas Nacca Stanley Naides Megan Nakashima Christopher Naugler Dan Navolan Robert Nerenz Davod Ng Josiah Ochieng Nikolaos Papadontonakis Lauren Parsons Morgan Pence Jess Peterson Marie Pezzlo Michael Phelan Jogenananda Pramanik Wei Qin Xiaoyu Qu Peter Ridefelt Roger Riley Jason Rosenbaum J. Rosendahl Sam Sadigh Alec Saitman Toshio Saito Max Salfinger Nikil Sangle Natasha Savage Audrey Schuetz Michela Seghezzi Salima Shaikh Meenu Sharma Ken Shirabe Venktesh Shirure Damian Skrypnik James Snyder Melissa Snyder Ewa Stepien Takaaki Sugihara Harold Sullivan Rei Suzuki Seyithan Taysı Karl Theil Perumal Thiagarajan Hakan Turkon K. Vengadakrishnan Maria Vergara-Luri Mrigender Virk Catherine Wakeman Jason Wang Min-Jin Wang Yao Wang Jun Wei Ying-Hao Wen Lars Westblade Janet Williamson Maria Alice Willrich Bryan Wilson Wojciech Wolyniec Ka-Leung Wong Brittany Young Martina Zaninotto Nicole Zantek Habil Zare Linsheng Zhang Ying Zhao © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)

Levinson, Stanley, S

doi: 10.1093/labmed/lmz032pmid: 31147695

Abstract Background The National Cholesterol Education Program (NCEP) released guidelines for treating cholesterol in 1988, 1994, and 2002. After a hiatus, the guidelines were released again in 2013, 2016, 2017, and 2018. Methods In this article, I review these guidelines, factors that affected their release, how they evolved, and why recommended treatment targets are reasonable. Also, to aid reader understanding, I briefly discuss biochemical mechanisms and the pathophysiology of beta-lipoproteins, focusing on the importance on non–high-density cholesterol (non-HDLC) in assessing risk and as a target for treatment. The concepts discussed are important to laboratory clinicians because those workers inscribe target values on the reports and may consult with medical staff members. Conclusions The newest recommendations, released in 2018, are an extension of the 2017 guidelines that defined non-HDLC as equivalent to low-density lipoprotein cholesterol (LDLC). For the reasons discussed herein, non-HDLC has advantages over LDLC. Laboratories reporting cholesterol results should include non-HDLC values and cutoffs in their reports. cholesterol, apo B, non-HDL cholesterol, recommendations, LDL cholesterol, metabolic pathways In 2013, the American College of Cardiology (ACC) and the American Heart Association (AHA) released new guidelines from an expert group1 that recommended that therapy for lowering low-density lipoprotein cholesterol (LDLC) be focused on the intensity of drug treatment, rather than on a targeted concentration (target value), as previous expert groups had recommended. In 2016, an ACC Expert Consensus Committee2 released new guidelines that restored target values and introduced non–high-density lipoprotein cholesterol (non-HDLC) as an equivalent target to LDLC in patients with diabetes mellitus and those with elevated triglycerides. In 2017, the American College of Cardiology Task Force on Expert Consensus Committee released still-newer guidelines on the role of nonstatin therapies for preventing coronary disease.3 These guidelines, which were an update of the 2016 ACC guidelines,2 extended the use of non-HLDC as a target for all risk groups. In this review, I discuss briefly how these recommendations evolved, how treatment targets reasonably meet the needs for reducing coronary disease, the biochemical mechanisms that support the recommendations, and why the specific target values selected are reasonable. To help readers understand dyslipidemias treatments, I also briefly discuss the pathophysiology of beta-lipoproteins, the relationship of those lipoproteins to atherosclerotic disease, the biochemical sites at which treatments act, and the growing importance of non-HDLC as a marker and target. These concepts are important to laboratory clinicians because those workers inscribe target values on the reports and may have to consult with medical staff members regarding the rationale for and use of these values. The National Cholesterol Education Program (NCEP) and the Development of its Guidelines The idea that cholesterol was a cause of coronary disease has been supported by a wealth of evidence from experimental animal models, epidemiological studies, genetic studies, and strongly suggestive human clinical trials. However, through the years, for various reasons, this idea was rejected by many scientists.4 An article published by Anitschkow and Chalatow5 in 1913 proposed a central role of hypercholesterolemia in atherogenesis. Yet, only in 2017 did a consensus statement from the European Atherosclerosis Society note that LDLC was not only a biomarker but a definitive cause of coronary disease. This statement was based on evidence from inherited disorders, prospective epidemiological studies, Mendelian randomization studies, and randomized control trials (RCTs).6 Anitschkow was a careful experimentalist.4 He described lipid droplets, cholesterol accumulation, and white blood cell accumulation in the artery tissue, as well as conversion of the fatty streak to fibrous plaque. One reason that the findings of Antischow were not taken seriously was because he worked with rabbits, which have low-density lipoprotein (LDL) metabolism similar to that of humans, whereas later investigators worked with rodents, which have different LDL metabolism compared with humans. Also, the prevalent view of atherosclerosis was generally accepted to be that it accompanies aging, and there was a rigid preconceived notion that only aging and not cholesterol was responsible (for a brief discussion of the work of Antischow, see reference4). Even today, some investigators7 doubt the cholesterol hypothesis and claim that most, if not all, evidence implicating cholesterol as a cause of atherosclerosis is faulty. The first guidelines recommending treatments for lowering cholesterol, called the Adult Treatment Panel (ATP), were released by the NCEP in 1988.8 These defined target values for LDLC range from less than 130 mg per dL to 160 mg per dL or less, according to estimated coronary risk. The many events in the history of cholesterol are described by Steinberg in a series of reviews.9–12 The discovery of a defective gene in familial hypercholesterolemia and the identification of the LDL receptor in the 1970s by Goldstein and Brown13–15 were among many milestones in the history of cholesterol and were major finding in its understanding. However, the development of the first ATP guidelines was probably dependent on 2 other milestones. The first such milestone is the Coronary Primary Prevention Trial (CPPT).16 This trial, conceived in the early 1970s and completed in the early 1980s, was a double-blinded RCT that enrolled 3806 men who were followed up for an average of 7.4 years. These men had to consume packets of sandy cholestyramine—a bile-acid sequestrant that lowers LDLC—or a similar gritty placebo 3 times per day. Although the compliance was poor overall, causing the lowering of cholesterol to be much less than was expected, the treated group showed a statically significant 19% reduction in coronary events. Thus, it was apparent that heart disease could be reduced by lowering cholesterol. However, there was no simple way to lower it until Akira Endo identified a substance in mold that could inhibit cholesterol synthesis—the second milestone. Week after week for 2 years, Endo and his associates assayed more than 6000 substances to finally find a substance called compactin that inhibited cholesterol synthesis at the HMG-CoA reductase step—this was the first statin.12 In 1978, Endo, along with Goldstein, Brown, and colleagues,17 published an article showing the large effect of statins on cells. At the time, there was great concern that intensive cholesterol lowering could lead to cancer. Despite this, the drug company Merck & Co, Inc.12 went on to identify and support clinical trials for another statin—lovastatin—that was to become the first commercially available statin. Thus, by 1988, when the ATP I was released, it seemed clear that lowering LDLC could reduce coronary disease and that taking statins were an effective, innocuous way to lower LDLC. The ATP I guidelines were followed by ATP II and ATP III in 1994 and 2002. These guidelines affirmed the approach of ATP I and set a new LDLC goal of 100 mg per dL or less as optimal and the target for the highest risk groups.18,19 It designated persons with diabetes (mellitus) as among the highest-risk group, identified persons with multiple risk factors for more-intense treatment, and introduced the idea that persons with metabolic syndrome should be considered for intensified therapeutic lifestyle changes. The 2002 guidelines,19 which were endorsed by the AHA and the American Diabetes Association,20 indicated that for patients with triglycerides between 200 mg per dL and 500 mg per dL, non-HDLC could be a secondary target, whereas for patients with triglyceride levels greater than 500 mg per dL, triglycerides should be lowered and then LDLC should be treated until the patient reaches the goal value, with non-HDLC as a secondary target. Likewise, the guidelines from the European Atherosclerosis Society21,22 indicated that non-HDLC may be substituted for LDLC in assessing risk in patients with elevated triglycerides, especially when associated with diabetes mellitus, kidney disease, or metabolic syndrome. Replacement of the NCEP with Consensus Committees in 2013 In 2013, the ACC and AHA released new guidelines from an expert group1; these guidelines replace the ATP. The ATP IV Committee transitioned to joining the members of the ATP IV expert group, who were working on, but had not yet completed, ATP IV. The term coronary heart disease, used in the ATP guidelines, was replaced with the term atherosclerotic cardiovascular disease (ASCVD). The Committee defined 4 treatment groups, as shown in Table 1. These guidelines were based largely on evidence obtained from RCTs. The guidelines did not speculate on evidence from other types of trials. The Expert Panel was unable to find evidence from RCTs that lowering of LDLC or non-HDLC concentrations to target values reduces risk of ASCVD, as had been suggested in the ATP reports.1 Nor did the panel find sufficient evidence from RCTs that drugs other than statins should be used to reduce risk. Therefore, the 2013 Committee focused on the intensity of statin treatment, as shown in Table 1 and Table 2. Table 1. Intensity of  Treatment for the 4 Studied Groupsa Group . Treatment Type(s) and Intensity . Adults aged ≥21 y with clinical ASCVD For patients aged ≤75 years, high intensity, or moderate intensity if high intensity is intolerable For patients aged >75 y, moderate to high intensity Adults aged ≥21 years with LDLC ≥190 mg/dL (familial hypercholesterolemia) High-intensity statin to achieve >50% reduction in LDLC May consider nonstatin for further reduction Screening of close relatives Adults aged 40–75 years without ASCVD who have diabetes mellitus and LDLC of 70–190 mg/dL Moderate intensity High intensity if ≥7.5% 10-y risk Adults without ASCVD or diabetes mellitus, with >7.5% 10-y risk Estimate with pooled cohort Equation; moderate- to high-intensity statin Group . Treatment Type(s) and Intensity . Adults aged ≥21 y with clinical ASCVD For patients aged ≤75 years, high intensity, or moderate intensity if high intensity is intolerable For patients aged >75 y, moderate to high intensity Adults aged ≥21 years with LDLC ≥190 mg/dL (familial hypercholesterolemia) High-intensity statin to achieve >50% reduction in LDLC May consider nonstatin for further reduction Screening of close relatives Adults aged 40–75 years without ASCVD who have diabetes mellitus and LDLC of 70–190 mg/dL Moderate intensity High intensity if ≥7.5% 10-y risk Adults without ASCVD or diabetes mellitus, with >7.5% 10-y risk Estimate with pooled cohort Equation; moderate- to high-intensity statin ASCVD, atherosclerotic cardiovascular disease; LDLC, low-density lipoprotein cholesterol.aAdapted from Lloyd -Jones DM et al2. Open in new tab Table 1. Intensity of  Treatment for the 4 Studied Groupsa Group . Treatment Type(s) and Intensity . Adults aged ≥21 y with clinical ASCVD For patients aged ≤75 years, high intensity, or moderate intensity if high intensity is intolerable For patients aged >75 y, moderate to high intensity Adults aged ≥21 years with LDLC ≥190 mg/dL (familial hypercholesterolemia) High-intensity statin to achieve >50% reduction in LDLC May consider nonstatin for further reduction Screening of close relatives Adults aged 40–75 years without ASCVD who have diabetes mellitus and LDLC of 70–190 mg/dL Moderate intensity High intensity if ≥7.5% 10-y risk Adults without ASCVD or diabetes mellitus, with >7.5% 10-y risk Estimate with pooled cohort Equation; moderate- to high-intensity statin Group . Treatment Type(s) and Intensity . Adults aged ≥21 y with clinical ASCVD For patients aged ≤75 years, high intensity, or moderate intensity if high intensity is intolerable For patients aged >75 y, moderate to high intensity Adults aged ≥21 years with LDLC ≥190 mg/dL (familial hypercholesterolemia) High-intensity statin to achieve >50% reduction in LDLC May consider nonstatin for further reduction Screening of close relatives Adults aged 40–75 years without ASCVD who have diabetes mellitus and LDLC of 70–190 mg/dL Moderate intensity High intensity if ≥7.5% 10-y risk Adults without ASCVD or diabetes mellitus, with >7.5% 10-y risk Estimate with pooled cohort Equation; moderate- to high-intensity statin ASCVD, atherosclerotic cardiovascular disease; LDLC, low-density lipoprotein cholesterol.aAdapted from Lloyd -Jones DM et al2. Open in new tab Table 2. Statin Intensity and Average Percentage Lowering of LDLC by Various Statinsa High-Intensity Statin Therapy . Moderate-Intensity Statin Therapy . Low-Intensity Statin Therapy . Daily dose lowers LDLC by ≥50%, on average Daily dose lowers LDLC by 30%–50% on average Daily dose lowers LDLC by <30%, on average Atorvastatin, 40–80 mg Atorvastatin, 10–20 mg Lovastatin, 10–20 mg Rosuvastatin, 20–40 mg Fluvastatin, 20 mg Fluvastatin, 40 mg 2× day Fluvastatin XL, 80 mg Pitavastatin, 1 mg Lovastatin, 40 mg Pravastatin, 10–20 mg Pitavastatin, 2–4 mg Simvastatin, 10 mg Pravastatin, 40–80 mg Rosuvastatin, 5–10 mg Simvastatin, 20–40 mg High-Intensity Statin Therapy . Moderate-Intensity Statin Therapy . Low-Intensity Statin Therapy . Daily dose lowers LDLC by ≥50%, on average Daily dose lowers LDLC by 30%–50% on average Daily dose lowers LDLC by <30%, on average Atorvastatin, 40–80 mg Atorvastatin, 10–20 mg Lovastatin, 10–20 mg Rosuvastatin, 20–40 mg Fluvastatin, 20 mg Fluvastatin, 40 mg 2× day Fluvastatin XL, 80 mg Pitavastatin, 1 mg Lovastatin, 40 mg Pravastatin, 10–20 mg Pitavastatin, 2–4 mg Simvastatin, 10 mg Pravastatin, 40–80 mg Rosuvastatin, 5–10 mg Simvastatin, 20–40 mg LDLC, low-density lipoprotein cholesterol.aAdapted from Stone NJ et al.1 Open in new tab Table 2. Statin Intensity and Average Percentage Lowering of LDLC by Various Statinsa High-Intensity Statin Therapy . Moderate-Intensity Statin Therapy . Low-Intensity Statin Therapy . Daily dose lowers LDLC by ≥50%, on average Daily dose lowers LDLC by 30%–50% on average Daily dose lowers LDLC by <30%, on average Atorvastatin, 40–80 mg Atorvastatin, 10–20 mg Lovastatin, 10–20 mg Rosuvastatin, 20–40 mg Fluvastatin, 20 mg Fluvastatin, 40 mg 2× day Fluvastatin XL, 80 mg Pitavastatin, 1 mg Lovastatin, 40 mg Pravastatin, 10–20 mg Pitavastatin, 2–4 mg Simvastatin, 10 mg Pravastatin, 40–80 mg Rosuvastatin, 5–10 mg Simvastatin, 20–40 mg High-Intensity Statin Therapy . Moderate-Intensity Statin Therapy . Low-Intensity Statin Therapy . Daily dose lowers LDLC by ≥50%, on average Daily dose lowers LDLC by 30%–50% on average Daily dose lowers LDLC by <30%, on average Atorvastatin, 40–80 mg Atorvastatin, 10–20 mg Lovastatin, 10–20 mg Rosuvastatin, 20–40 mg Fluvastatin, 20 mg Fluvastatin, 40 mg 2× day Fluvastatin XL, 80 mg Pitavastatin, 1 mg Lovastatin, 40 mg Pravastatin, 10–20 mg Pitavastatin, 2–4 mg Simvastatin, 10 mg Pravastatin, 40–80 mg Rosuvastatin, 5–10 mg Simvastatin, 20–40 mg LDLC, low-density lipoprotein cholesterol.aAdapted from Stone NJ et al.1 Open in new tab The committee also developed a risk calculator (Omnibus Risk Estimator) that is available at http://tools.acc.org/ascvd-risk-estimator-plus/#!/calculate/therapy or can be downloaded as an MS Excel (Microsoft Corporation) program at https://professional.heart.org /professional/index.jsp under the heading ASCV risk calculator. This calculator provides the 10-year risk for persons aged 20 to 79 years and the lifetime risk for persons aged 40 to 59 years, compared with optimal risk. The characteristics entered into the calculator are sex; age; race; total cholesterol; HDLC; and systolic blood pressure, on treatment for high blood pressure, diabetes mellitus, and smoking. Although the ATP Panels relied largely on the Framingham Study 10-year risk scores, the Omnibus estimator is based on multivariate equations that were developed from 9 longstanding population-based cohort studies funded by the National Heart Lung and Blood Institute. The study participants included apparently healthy white, African American, and Hispanic women and men, aged 40 to 79 years.23 The Return to Target Values and the Introduction of Non-HDLC as a Primary Target In 2016, new guidelines were released2 by an ACC Expert Consensus Committee; these guidelines were further revised in 2017.3 The guidelines maintained the 4-treatment groups and the Omnibus Risk Estimator but reintroduced target values, as shown in Table 3. Moreover, the 2016 Committee indicated that non-HDLC was an equivalent target value to LDLC for select groups—namely, those with elevated triglycerides and those with diabetes mellitus. As shown in Table 3, the 2017 Committee defined non-HDLC as equivalent to LDLC for all groups. Table 3. Patient Risk Groups and Targets Concentrationsa Risk Groups . Target . Additional Drug Treatment to Consider to Reach Target After Statin . Patients aged 40–75 years without clinical ASCVD and without diabetes mellitus, with baseline LDLC 70–189 mg/dL, and with 10-y risk >7.5% for primary prevention 30%–49% reduction while taking statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) Bile-acid sequestrant (second) Stable clinical ASCVD with no comorbidities on statins for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100) Ezetimibe (first) PCSK9 inhibitor (second) Clinical ASCVD with comorbidities on statins For secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) PCK9 inhibitor (second) Clinical ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) Without ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia ≥50% reduction on statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) or bile acid sequestrant or PCSK9 inhibitor (second). Patients aged 40–75 without clinical ASCVD, with diabetes mellitus, and with baseline LDLC 70–189 mg/dL for primary prevention ≥50% reduction while taking statin (may consider LDLC <100 mg/dL or may consider non-HDLC <130 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) Risk Groups . Target . Additional Drug Treatment to Consider to Reach Target After Statin . Patients aged 40–75 years without clinical ASCVD and without diabetes mellitus, with baseline LDLC 70–189 mg/dL, and with 10-y risk >7.5% for primary prevention 30%–49% reduction while taking statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) Bile-acid sequestrant (second) Stable clinical ASCVD with no comorbidities on statins for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100) Ezetimibe (first) PCSK9 inhibitor (second) Clinical ASCVD with comorbidities on statins For secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) PCK9 inhibitor (second) Clinical ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) Without ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia ≥50% reduction on statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) or bile acid sequestrant or PCSK9 inhibitor (second). Patients aged 40–75 without clinical ASCVD, with diabetes mellitus, and with baseline LDLC 70–189 mg/dL for primary prevention ≥50% reduction while taking statin (may consider LDLC <100 mg/dL or may consider non-HDLC <130 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) ASCVD, atherosclerotic cardiovascular disease; LDLC, low-density lipoprotein cholesterol; PCSK9, proprotein convertase subtilisin/kexin type 9.aAdapted from Levinson SS.32 Open in new tab Table 3. Patient Risk Groups and Targets Concentrationsa Risk Groups . Target . Additional Drug Treatment to Consider to Reach Target After Statin . Patients aged 40–75 years without clinical ASCVD and without diabetes mellitus, with baseline LDLC 70–189 mg/dL, and with 10-y risk >7.5% for primary prevention 30%–49% reduction while taking statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) Bile-acid sequestrant (second) Stable clinical ASCVD with no comorbidities on statins for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100) Ezetimibe (first) PCSK9 inhibitor (second) Clinical ASCVD with comorbidities on statins For secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) PCK9 inhibitor (second) Clinical ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) Without ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia ≥50% reduction on statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) or bile acid sequestrant or PCSK9 inhibitor (second). Patients aged 40–75 without clinical ASCVD, with diabetes mellitus, and with baseline LDLC 70–189 mg/dL for primary prevention ≥50% reduction while taking statin (may consider LDLC <100 mg/dL or may consider non-HDLC <130 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) Risk Groups . Target . Additional Drug Treatment to Consider to Reach Target After Statin . Patients aged 40–75 years without clinical ASCVD and without diabetes mellitus, with baseline LDLC 70–189 mg/dL, and with 10-y risk >7.5% for primary prevention 30%–49% reduction while taking statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) Bile-acid sequestrant (second) Stable clinical ASCVD with no comorbidities on statins for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100) Ezetimibe (first) PCSK9 inhibitor (second) Clinical ASCVD with comorbidities on statins For secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) PCK9 inhibitor (second) Clinical ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia for secondary prevention ≥50% reduction while taking statin (may consider LDLC <70 mg/dL or non-HDLC <100 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) Without ASCVD with LDLC ≥190 mg/dL due to familial hypercholesterolemia ≥50% reduction on statin (may consider LDLC <100 mg/dL or non-HDLC <130 mg/dL) Ezetimibe (first) or bile acid sequestrant or PCSK9 inhibitor (second). Patients aged 40–75 without clinical ASCVD, with diabetes mellitus, and with baseline LDLC 70–189 mg/dL for primary prevention ≥50% reduction while taking statin (may consider LDLC <100 mg/dL or may consider non-HDLC <130 mg/dL) Ezetimibe (first) or bile-acid sequestrant or PCSK9 inhibitor (second) ASCVD, atherosclerotic cardiovascular disease; LDLC, low-density lipoprotein cholesterol; PCSK9, proprotein convertase subtilisin/kexin type 9.aAdapted from Levinson SS.32 Open in new tab The Beta-Lipoprotein Metabolic Pathways and Dyslipidemias When lipids are ingested, they are converted to chylomicrons in the intestine, and the chylomicrons are transported via the lymphatics and blood to the liver, where the lipids are removed.24 During transportation, some chylomicrons are broken down into remnant lipoproteins by lipoprotein lipase (LPL), releasing fatty acids for tissue metabolism. This is a rapid process that takes 2 to 3 hours. Much of the lipid is then transferred to the beta-lipoproteins by incorporation into very-low-density protein (VLDL). The major beta-lipoprotein metabolic pathways have been known for many years.24 Knowledge of these pathways is helpful in understanding where drugs act and which target values might be best for which dyslipidemias. A simple illustration of the pathways is shown in Figure 1. Apolipoprotein B-100 (apo B) is the major structural protein in beta-lipoproteins and is needed for VLDL synthesis.25 VLDLs are synthesized in the liver and released in to the bloodstream. VLDLs are triglyceride-rich and, like chylomicrons, are broken down by LPL to form intermediate-density lipoprotein (IDL) remnants that have approximately equal amounts of cholesterol and triglycerides. These remnants are removed from the bloodstream by receptors that bind apolipoprotein E (apo E)26 or are converted to LDL by hepatic lipase (HL). LDLs have little or no apo E and are rich in cholesterol. LDL particles containing apo B are removed from the bloodstream by the LDL receptor via endocytosis.26 Figure 1 Open in new tabDownload slide Beta-lipoprotein pathways. HL indicates hepatic lipase; LPL, lipoprotein lipase; sdLDL, small dense lipoprotein lipase; and R, reaction. Major apolipoproteins (apo) contained in each type lipoprotein particle are indicated in block below the type of particle. Figure 1 Open in new tabDownload slide Beta-lipoprotein pathways. HL indicates hepatic lipase; LPL, lipoprotein lipase; sdLDL, small dense lipoprotein lipase; and R, reaction. Major apolipoproteins (apo) contained in each type lipoprotein particle are indicated in block below the type of particle. Normally, the removal of LDL particles is the rate-limiting step. The conversion from VLDL to LDL takes 5 to 7 hours, so that generally after a meal, the lipids in chylomicrons have been transferred to LDL in fewer than 10 hours. Thus, an overnight fast is usually appropriate when seeking a fasting specimen in which VLDL-triglyceride is minimal and LDLC is at its steady-state concentration. Various dyslipidemias can be explained by alterations of the pathway (Figure 1). These include: Deficiency of LPL: Hypertriglyceridemia may occur if there is a deficiency of LPL or abnormalities in apolipoprotein C2 or C3 (apo C) that inhibit LPL (reaction 1 [R1] in Figure 1). In such a case, VLDL cannot progress to IDL or LDL, and LDLC is usually very low. The triglyceride level usually rises beyond 500 mg per dL. Dysbetalipoproteinemia: This is a rare familial dyslipidemia in which a person inherits 2 apo E2 genes. In this case, the process cannot progress to form LDL (reaction 2 [R2] in Figure 1), and cholesterol and triglycerides are elevated, from approximately 300 mg per dL to approximately 500 mg per dL. This process is called dysbetalipoproteinemia, type III hyperlipidemia, or broad beta-hyperlipidemia because on electrophoresis, the IDL migrates in a wide (broad) band between the places where the VLDL and LDL should normally migrate. In this case, the process again cannot progress to LDL, and LDLC is usually low. Hypercholesterolemia: LDLC may be elevated because the LDL receptor may be slow in removing LDL or reduced in number (reaction 3 [R3] in Figure 1), as in familial hypercholesterolemia, so that LDLC may become elevated higher than 160 mg per dL or even 190 mg per dL. Combined hyperlipidemia (also known as the atherogenic phenotype): This is a type of dyslipidemia in which there is a net overproduction of VLDL. In this case, no specific step is inhibited, so neither cholesterol nor triglyceride levels get extremely high but triglycerides may be moderately increased, in the range of approximately 200 mg per dL to 400 mg per dL. LDLC may or may not be elevated; the HDLC is moderately decreased. The reason the LDLC may not be increased is because in this type of lipidemia, much LDL is synthesized as small dense LDL (sdLDL; Figure 1).27 sdLDL contains more protein relative to cholesterol, so that although the LDLC may not appear to be elevated, there are nevertheless more LDL particles and there is more apo B. Mechanism of ASCVD Lindgren et al28 first separated lipoprotein particles using analytical ultracentrifugation. These investigators found that the most buoyant lipoproteins were the chylomicrons, which float to the top during ultracentrifugation and the most-dense HDL, which sinks to the bottom, with the beta-lipoproteins floating in between. Although there are now other ways to separate lipoproteins, classification by density remains the preferred method and seems to have functional importance.24 Substantial evidence10,29 indicates that LDL infiltrates the artery wall, where it is modified and rapidly taken up by macrophages that become lipid-laden foam cells—apparently, the first event in a sequence that leads to atherosclerotic plaque. Thus, high concentrations of LDL cause more penetration. Besides, smaller lipoproteins, such as sdLDL, and remnant particles, such as chylomicron remnants and IDL, are considered especially atherogenic because it is thought that they can more easily penetrate the artery wall.10,27,30 Measurement of LDLC LDLC is usually measure by calculation, most commonly using the Friedwald equation (LDLC = Total C – HDLC – triglyceride/5; all in mg/dL).31,32 This measurement is generally made on fasting specimens because triglyceride levels greater than 400 mg per dL may cause unacceptable clinical alterations. Triglyceride-rich VLDL and chylomicrons contain a different ratio of cholesterol to triglycerides than LDL, so that as the chylomicron triglycerides increase, the division by 5 becomes increasingly inaccurate. After a meal, chylomicrons may be substantially increased. Generally, when the triglycerides level is greater than 400 mg per dL, direct LDL (dLDL) measurement is recommended. Otherwise, calculated LDLC (cLDLC) is preferred because it comes with the routine lipid profile and is as accurate31,32 for at least 2 reasons. First, different dLDLC commercial methods use different chemicals to inhibit the reaction of cholesterol in beta-lipoproteins other than LDL, so it is unclear that these methods all yield similar results. Second, because of overlap of fractions, separation of beta-lipoproteins from one another by chemical inhibition is very difficult, so that one might not only expect variability between methods but also from lot to lot.32 Besides, some of these methods measure the potentially atherogenic lipoprotein Lp(a) but others do not. Lp(a) is always included in the cLDLC concentration. Lp(a) is not affected by the standard cholesterol treatment drugs, namely, statins and ezetimibe. Very high levels of Lp(a) may be atherogenic. Therefore, in a patient with a family history of ASCVD, if a very high cLDLC level is identified that is hardly lowered by these standard drugs, it may be worthwhile to measure the Lp(a). Apo B and Non-HDLC Apo B is usually measured by immunological techniques.33 As seen in Figure 1, apo B is found in all species of beta-lipoproteins. Moreover, there is 1 molecule of apo B in each particle. As such, much evidence indicates it is the best lipoprotein marker for ASCVD.19 Besides, unlike cLDLC, its measurement is not altered by elevated triglycerides, so that randomly collected specimens are acceptable. Generally, apo B targets are approximately 30 mg per dL less than LDLC targets. Thus, an LDLC level of 160 mg per dL would be equivalent to apo B levels of approximately 130 mg per dL. Non-HDLC is also a calculated value (nonHDLC = Total C – HDLC) but it is a simpler, lesser variable and more accurate calculation than LDLC.32 It is a measure of all of the cholesterol in the beta-lipoproteins and thus, like apo B, it is a measure of all particles. Studies have shown non-HDLC correlates better with apo B than LDLC,34,35 and evidence19 indicates it is a better marker for ASCVD than LDLC. According to receiver operating characteristic (ROC) curve analysis, non-HDLC, in conjunction with traditional risk factors, provides the same coronary risk information as apo B more than 97% of the time36 and, like apo B, non-HDLC is unaffected by elevated triglyceride levels. With the epidemic of obesity that is occurring worldwide, combined hyperlipidemia has become the most common type of dyslipidemia. Patients with combined hyperlipidemia tend to have borderline low HDLC and moderately elevated triglyceride levels and sdLDL so that, although the LDLC may not appear elevated, there are more LDL particles and approximately a 3-fold increase in ASCVD risk.30 Many patients with metabolic syndrome express this phenotype, in which the overall coronary risk may be multiplied as a result of hypertension and insulin resistance. apo B and non-HDLC are invariably increased in these persons and are better markers of risk than LDLC. Mechanisms by Which Recommended Lipid-Lowering Drugs Act Mechanisms by which the various lipid-lowering agents act help medical professionals to understand how to best reach target values. Statins, bile-acid sequestrants, and ezetimibe all act by reducing intracellular cholesterol levels. Those levels are controlled by the sterol regulatory element-binding proteins (SREBPs),37 which are transcription factors that bind to the sterol regulatory element DNA sequence TCACNCCAC. As shown in Figure 1, when intracellular cholesterol is low, the SREBP acts to upregulate the LDL receptor. As a result, more receptor is synthesized and more blood cholesterol is transported into the cell, lowering blood cholesterol. Statins inhibit the 3-Hydroxy 3-methylglutarate coenzyme A (HMG-CoA) reductase step in cholesterol synthesis. This process lowers intracellular cholesterol and upregulates the LDL receptor. Statins are powerful lipid-lowering drugs because they are competitive inhibitors of HMG-CoA reductase, with synthesis inversely proportional to statin dose. Statins are more powerful agents for reducing blood cholesterol (Table 2) than ezetimibe (lower LDLC by 15%–20% or bile-acid sequestrants [lower LDLC by 15%–30%]), as is apparent from their mechanism of action. Ezetimibe selectively inhibits intestinal cholesterol uptake, reducing intracellular cholesterol.38 Ezetimibe and its active glucuronide metabolite circulate interhepatically and therefore, there is very little systemic exposure. Ezetimibe added to a moderate-intensity statin (40 mg of simvastatin; IMPROVE IT-Trial)39 demonstrated a 6.4% statistically significant reduction (P = .02) in ASCVD events. Simvastatin lowered LDLC to 69.5 mg per dL, and 10 mg of ezetimibe further lowered LDLC to 53.7 mg per dL. Nevertheless, a 6.4% reduction was considered too modest, and the Endocrinologic and Metabolic Drugs Advisory Committee of the U.S. Food and Drug Administration (FDA) voted against recommending approval of ezetimibe as an add-on to a statin. Still, patients in that study who were at particularly high risk of recurrent ASCVD events showed a substantial risk reduction (relative risk [RR] reduction, 19%)40 which is why the most recent guidelines recommend ezetimibe as the first primary second-line therapy after first-line statins (Table 3).3,40 Bile-acid sequestrants are a group of ion-exchange resins that bind bile acids in the intestine, thereby disrupting the enterohepatic circulation of bile acids. Because cholesterol is the precursor of bile acids, liver cells synthesize more bile acids, reducing intracellular cholesterol stores. Bile-acid sequestrants are generally recommended as a second-line treatment after ezetimibe (Table 3). It has been known for some time that besides acting on the LDL receptor, SREBPs act to upregulate protease proprotein convertase subtilisin/kexin type 9 (PCSK9).37 The protease initiates a process whereby the LDL receptor is degraded (Figure 1). Thus, when low concentrations of intracellular cholesterol cause an increase in the LDL receptor, PCSK9 tries to counteract the effect. More recently, antibodies that inhibit PCSK9 have been developed. These antibodies are named evolocumab and alirocumab; they are subcutaneously injected41 and reduce LDLC levels approximately 50% beyond those yielded by standard statin therapy. These agents were shown to statistically significantly reduce ASCVD beyond that yielded by a statin by approximately 12% to 15% (RR, 0.85–0.92) and reduce death from any cause (RR, 0.85)42 over a medium duration of 2.8 years. These agents were approved by the FDA.2 The combination of a statin and a PCSK9 inhibitor is a powerful tool for reducing blood LDLC because the statin directly inhibits the intracellular cholesterol that increases the LDL receptor and the PCSK9 inhibitor reduces the counteraction that degrades the receptor. Moreover, data from these studies have made it even clearer that the lower the cholesterol, the lower the risk of ASCVD—the lower the better. Because of expense and possible poor compliance in some patient conditions, these agents are recommended as third-line agents except for familial hypercholesterolemia, in which they may be used as second-line agents (Table 3). Risk-assessment studies are derived from primary populations with a normal incidence of ASCVD, with the possible exception of the CPPT. However, most, if not all, treatment studies have been conducted as secondary prevention studies with high-risk populations, such as patients with type 2 diabetes mellitus, those who have known ASCVD, or those with familial hypercholesterolemia. Moreover, in secondary prevention trials, many subjects have multiple comorbidities, so they are apt to die from factors other than ASCVD, which causes cholesterol lowering to appear to be less effective than it really is. Therefore, although it is clear that the lower the LDLC the better, the exact effect of cholesterol-lowering treatments on persons without ASCVD in the general population remains unclear. Also, from the results of secondary prevention studies, it is clear that the higher the baseline LDLC concentration, the greater the relative effect, so that those with LDLC concentrations less than 70 mg per dL will derive less risk reduction from a 50% lowering than those with cholesterol levels of 160 mg per dL and higher. Thus, it seems reasonable to define less than 70 mg per dL as a target value for the highest-risk groups and less than 100 mg per dL for those at risk but who do not have ASCVD. Moreover, although PCSK9 inhibitors can reduce LDLC to much lower levels, the added effect on risk reduction is a modest 0.08% to 0.15% (1.08-fold–1.15-fold). PCSK9 inhibitors are very expensive. Also, many patients undergoing secondary prevention have numerous comorbidities and are already taking many other drugs. Thus, adding a PCSK9 inhibitor would mean the introduction of another drug that is to be taken by injection, with only modest risk reduction. As such, it seems that compliance would be poor. Therefore, it is reasonable to use these inhibitors as third-line drugs for these patients. However, in familiar hypercholesterolemia, in which LDLC is greater than 160 mg per dL, the risk of ASCVD is approximately 5- to 10-fold. Here, there is an expected large risk reduction by reducing LDLC. So, PCSK9 inhibitors are reasonable additives to statins because these patients may have no other comorbidities but a long life expectancy, during which one could reasonably expect good compliance. One area of weakness in the recent guidelines relates to persons with characteristics of metabolic syndrome. Body mass index (BMI), weight circumference, triglyceride levels, and glucose level are all not included in the Omibus Risk Estimator. Patients with metabolic syndrome and low LDLC may not be identified as being at higher risk, especially those at a young age, because age is by far the most sensitive variable in the risk score. Nevertheless, elevated non-HDLC levels in these patients will usually be recognized as high total cholesterol in the risk calculation. Besides, many will have low HDLC levels and hypertension, so that their lifetime risk will be very elevated compared with the optimal risk. Lifetime risk can be used as a sign to encourage lifestyle changes or even to initiate statin treatment. Discussion Non-HDLC has the advantage that it correlates most strongly with apo B, does not require fasting and, like apo B, identifies persons whose LDLC may be close to desirable levels but who are at increased risk because they exhibit sdLDL and remnant lipoproteins. This has become the most common type of lipidemia as obesity has become more rampant. Moreover, unlike apo B, it is derived from the routine lipid profile at no extra cost. One problem with using non-HDLC as a primary risk-assessment instrument is that most previous studies used LDLC as the eligibility criteria, which means if the studies are reexamined and non-HDLC is substituted for LDLC, the result would be statistically suspect because it would become a retrospective indicator. I believe that the 2017 committee3 should be commended for recommending non-HDLC as being equivalent to LDLC as a target because most clinical-outcome studies have targeted LDLC. In coming to this conclusion, the Committee considered more than RCT results but all of the evidence. This appraisal seems to have been confirmed by the results of recent studies in which PCSK9 inhibitor trials use LDLC and non-HDLC as thresholds for eligibility despite LDLC being below the eligibility cutoff, creating a prospective view.43–45 Also, non-HDLC has been shown45,46 to have a more robust relationship with ASCVD death (and all-cause mortality) than LDLC. When triglycerides are elevated and the calculated cLDLC values are suspect, they can be compared against the non-HDLC values to assess accuracy, with the knowledge that there should be a 30 mg per dL difference between the 2 values. Concurrently, it is important to recognize that patients with metabolic syndrome and elevated triglycerides may exhibit borderline LDLC, but their non-HDLC may be elevated because they have increased numbers of sdLDL and remnants. According to the guidelines (Table 3), many of these patients can experience a 50% or greater drop in LDLC/non-HDLC. If the cLDLC and non-HDLC values are in disagreement, laboratory professionals should be able to consult with one another to determine how non-HDLC may be telling or, in rare instances, suggest measurement of dLDLC or apo B. In November of 2018, the AHA and ACC released updated guidelines,40 and concurrently, a document on risk-assessment tools to guide medical professionals in primary prevention.47 A major focus of the risk-assessment article47 was the addition of coronary-artery calcium measurement (CAC) in persons who might be at borderline risk but only if it is thought CAC measurement can provide sufficient information to modify the decision. As previously, these guidelines pointed out that the main protein embedded in LDL and VLDL is apo B and like non-HDLC, apo B is a stronger indicator of atherogenicity than LDLC by itself.40 The guidelines stated that in most cases, nonfasting specimens were sufficient for routine measurement of LDLC by calculation, which was a departure from previous guidelines, but if there was reason to suspect triglyceride interference, direct LDLC or apo B should be considered. However, these guidelines seemed to focus on LDLC, seemingly placing non-HDLC in a more subservient position. Nevertheless, these guidelines were described as an extension of the 2017 guidelines, with the goal of making the guidelines “shorter and enhancing user friendliness.” Therefore, the guidelines did not appear to change the target values from those defined in Table 3. For this reason, clinical laboratories should include non-HDLC values and cutoffs in their reports. Abbreviations Abbreviations ACC American College of Cardiology; AHA American Heart Association; LDLC low-density lipoprotein cholesterol; non-HDLC non–high-density lipoprotein cholesterol; NCEP National Cholesterol Education Program; RCTs randomized control trials; LDL low-density lipoprotein; ATP Adult Treatment Panel; CPPT Coronary Primary Prevention Trial; ASCVD atherosclerotic cardiovascular disease; LPL lipoprotein lipase; VLDL very-low-density lipoprotein; apo B apolipoprotein B-100; IDL , intermediate-density lipoprotein; apo E apolipoprotein E; HL hepatic lipase; apo C apolipoprotein C; R1 reaction 1; R2 reaction 2; R3 reaction 3; sdLDL small dense low-density lipoprotein; dLDL direct LDL; cLDLC calculated low-density lipoprotein cholesterol; ROC receiver operating characteristic; SREBPs sterol regulatory element-binding proteins; HMG-CoA 3-Hydroxy 3-methylglutarate coenzyme A; FDA U.S. Food and Drug Administration; RR , relative risk; PCSK9 proprotein convertase subtilisin/kexin type 9; BMI , body mass index; CAC coronary-artery calcium measurement; ASCVD atherosclerotic cardiovascular disease. References 1. Stone NJ , Robinson JG , Lichtenstein AH , et al. ; American College of Cardiology/American Heart Association Task Force on Practice Guidelines . 2013 ACC/AHA guideline on the treatment of blood cholesterol to reduce atherosclerotic cardiovascular risk in adults: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines . Circulation. 2014 ; 129 ( 25 Suppl 2 ): S1 – 45 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Lloyd-Jones DM , Morris PB , Ballantyne CM , et al. 2016 ACC expert consensus decision pathway on the role of non-statin therapies for LDL-cholesterol lowering in the management of atherosclerotic cardiovascular disease risk: a report of the American College of Cardiology Task Force on Clinical Expert Consensus Documents . J Am Coll Cardiol. 2016 ; 68 ( 1 ): 92 – 125 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Lloyd-Jones DM , Morris PB , Ballantyne CM , et al. 2017 Focused Update Of The 2016 ACC expert consensus decision pathway on the role of non-statin therapies for LDL-cholesterol lowering in the management of atherosclerotic cardiovascular disease risk: a report of the American College of Cardiology Task Force on Expert Consensus Decision Pathways . J Am Coll Cardiol. 2017 ; 70 ( 14 ): 1785 – 1822 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Steinberg D . In celebration of the 100th anniversary of the lipid hypothesis of atherosclerosis . J Lipid Res. 2013 ; 54 ( 11 ): 2946 – 2949 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Anitschkow NN, Chalatow, S. Ueber experimentalle cholesterinsteatose und ihre bbedeutung fur die entstehung einiger patholischer prozesse. Zentralbl Allg Pathol. 1913;24:1–9. 6. Ference BA , Ginsberg HN , Graham I , et al. Low-density lipoproteins cause atherosclerotic cardiovascular disease. 1. Evidence from genetic, epidemiologic, and clinical studies. A consensus statement from the European Atherosclerosis Society Consensus Panel . Eur Heart J. 2017 ; 38 ( 32 ): 2459 – 2472 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Okuyama H , Hamazaki T , Hama R , et al. A critical review of the consensus statement from the European Atherosclerosis Society Consensus Panel 2017 . Pharmacology. 2018 ; 101 ( 3-4 ): 184 – 218 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Goodman DS , Hulley SB , Clark LT . Report of the National Cholesterol Education Program expert panel on detection, evaluation, and treatment of high blood cholesterol in adults. The expert panel . Arch Intern Med. 1988 ; 148 ( 1 ): 36 – 69 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Steinberg D . Thematic review series: the pathogenesis of atherosclerosis. An interpretive history of the cholesterol controversy: part I . J Lipid Res. 2004 ; 45 ( 9 ): 1583 – 1593 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Steinberg D . Thematic review series: the pathogenesis of atherosclerosis. An interpretive history of the cholesterol controversy, part III: mechanistically defining the role of hyperlipidemia . J Lipid Res. 2005 ; 46 ( 10 ): 2037 – 2051 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Steinberg D . Thematic review series: the pathogenesis of atherosclerosis. An interpretive history of the cholesterol controversy: part II: the early evidence linking hypercholesterolemia to coronary disease in humans . J Lipid Res. 2005 ; 46 ( 2 ): 179 – 190 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Steinberg D . Thematic review series: the pathogenesis of atherosclerosis. An interpretive history of the cholesterol controversy, part V: the discovery of the statins and the end of the controversy . J Lipid Res. 2006 ; 47 ( 7 ): 1339 – 1351 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Goldstein JL , Brown MS . Familial hypercholesterolemia: identification of a defect in the regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity associated with overproduction of cholesterol . Proc Natl Acad Sci U S A. 1973 ; 70 ( 10 ): 2804 – 2808 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Brown MS , Goldstein JL . Familial hypercholesterolemia: defective binding of lipoproteins to cultured fibroblasts associated with impaired regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity . Proc Natl Acad Sci U S A. 1974 ; 71 ( 3 ): 788 – 792 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Goldstein JL , Brown MS . The low-density lipoprotein pathway and its relation to atherosclerosis . Annu Rev Biochem. 1977 ; 46 : 897 – 930 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Steinberg D . The pathogenesis of atherosclerosis. An interpretive history of the cholesterol controversy, part IV: the 1984 coronary primary prevention trial ends it–almost . J Lipid Res. 2006 ; 47 ( 1 ): 1 – 14 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Brown MS , Faust JR , Goldstein JL , Kaneko I , Endo A . Induction of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity in human fibroblasts incubated with compactin (ML-236B), a competitive inhibitor of the reductase . J Biol Chem. 1978 ; 253 ( 4 ): 1121 – 1128 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 18. [No authors listed] . National Cholesterol Education Program. Second report of the expert panel on detection, evaluation, and treatment of high blood cholesterol in adults (Adult Treatment Panel II) . Circulation. 1994 ; 89 ( 3 ): 1333 – 1445 . Crossref Search ADS PubMed WorldCat 19. [No authors listed] . Third Report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel III) final report . Circulation. 2002 ; 106 ( 25 ): 3143 – 3421 . Crossref Search ADS PubMed WorldCat 20. Buse JB , Ginsberg HN , Bakris GL , et al. American Heart Association; American Diabetes Association . Primary prevention of cardiovascular diseases in people with diabetes mellitus: a scientific statement from the American Heart Association and the American Diabetes Association . Circulation. 2007 ; 115 ( 1 ): 114 – 126 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Catapano AL , Reiner Z , De Backer G , et al. ; European Society of Cardiology (ESC); European Atherosclerosis Society (EAS) . ESC/EAS Guidelines for the management of dyslipidaemias. The Task Force for the Management of Dyslipidaemias of the European Society of Cardiology (ESC) and the European Atherosclerosis Society (EAS) . Atherosclerosis. 2011 ; 217 ( 1 ): 3 – 46 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Piepoli MF , Hoes AW , Agewall S , et al. ; ESC Scientific Document Group . 2016 European Guidelines on cardiovascular disease prevention in clinical practice: The Sixth Joint Task Force of the European Society of Cardiology and Other Societies on Cardiovascular Disease Prevention in Clinical Practice (constituted by representatives of 10 societies and by invited experts) developed with the special contribution of the European Association for Cardiovascular Prevention & Rehabilitation (EACPR) . Eur Heart J. 2016 ; 37 ( 29 ): 2315 – 2381 . Google Scholar Crossref Search ADS PubMed WorldCat 23. Goff DC Jr, Lloyd-Jones DM, et al. Evidence Report. Assessing Cardiovascular Risk Systematic Evidence Review From the Risk Assessment Work Group, 2013. https://www.nhlbi.nih.gov/sites/default/files/media/docs/risk-assessment.pdf. 24. Feingold KR , Grunfeld C . Introduction to lipids and lipoproteins . Endotext. [Internet] 2018 . https://www.ncbi.nlm.nih.gov/books/NBK305896/. Accesssed May 1, 2019. 25. Krauss RM . Hold the antioxidants and improve plasma lipids? J Clin Invest. 2004 ; 113 ( 9 ): 1253 – 1255 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Blasiole DA , Oler AT , Attie AD . Regulation of ApoB secretion by the low density lipoprotein receptor requires exit from the endoplasmic reticulum and interaction with ApoE or ApoB . J Biol Chem. 2008 ; 283 ( 17 ): 11374 – 11381 . Google Scholar Crossref Search ADS PubMed WorldCat 27. Krauss RM . Atherogenicity of triglyceride-rich lipoproteins . Am J Cardiol. 1998 ; 81 ( 4A ): 13B – 17B . Google Scholar Crossref Search ADS PubMed WorldCat 28. Lindgren FT , Elliott HA , Gofman JW . The ultracentrifugal characterization and isolation of human blood lipids and lipoproteins, with applications to the study of atherosclerosis . J Phys Colloid Chem. 1951 ; 55 ( 1 ): 80 – 93 . Google Scholar Crossref Search ADS PubMed WorldCat 29. Levinson SS . Inflammatory and long-term risk markers . Clin Lab Med. 2006 ; 26 ( 3 ): 553 – 70 . Google Scholar Crossref Search ADS PubMed WorldCat 30. Austin MA , Breslow JL , Hennekens CH , Buring JE , Willett WC , Krauss RM . Low-density lipoprotein subclass patterns and risk of myocardial infarction . JAMA. 1988 ; 260 ( 13 ): 1917 – 1921 . Google Scholar Crossref Search ADS PubMed WorldCat 31. Abudu N , Levinson SS . Calculated low-density lipoprotein cholesterol remains a viable and important test for screening and targeting therapy . Clin Chem Lab Med. 2007 ; 45 ( 10 ): 1319 – 1325 . Google Scholar Crossref Search ADS PubMed WorldCat 32. Levinson SS . Critical review of 2016 ACC guidelines on therapies for cholesterol lowering with reference to laboratory testing . Clin Chim Acta. 2019 ; 489 : 189 – 195 . Google Scholar Crossref Search ADS PubMed WorldCat 33. Levinson SS , Wagner SG . Measurement of apolipoprotein B-containing lipoproteins for routine clinical laboratory use in cardiovascular disease . Arch Pathol Lab Med. 1992 ; 116 ( 12 ): 1350 – 1354 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 34. Levinson SS , Wagner SG . Immunonephelometric/turbidimetric apolipoprotein B assays for the clinical laboratory . Clin Chim Acta. 1993 ; 223 ( 1-2 ): 31 – 42 . Google Scholar Crossref Search ADS PubMed WorldCat 35. Grundy SM . Low-density lipoprotein, non-high-density lipoprotein, and apolipoprotein B as targets of lipid-lowering therapy . Circulation. 2002 ; 106 ( 20 ): 2526 – 2529 . Google Scholar Crossref Search ADS PubMed WorldCat 36. Levinson SS . Comparison of apolipoprotein B and non–high-density lipoprotein cholesterol for identifying coronary artery disease risk based on receiver operating curve analysis . Am J Clin Pathol. 2007 ; 127 ( 3 ): 449 – 455 . Google Scholar Crossref Search ADS PubMed WorldCat 37. Tall AR . Protease variants, LDL, and coronary heart disease . N Engl J Med. 2006 ; 354 ( 12 ): 1310 – 1312 . Google Scholar Crossref Search ADS PubMed WorldCat 38. Bays H . Ezetimibe . Expert Opin Investig Drugs. 2002 ; 11 ( 11 ): 1587 – 1604 . Google Scholar Crossref Search ADS PubMed WorldCat 39. Cannon CP , Blazing MA , Giugliano RP , et al. ; for the IMPROVE-IT Investigators . Ezetimibe added to statin therapy after acute coronary syndromes . N Engl J Med. 2015 ; 372 ( 25 ): 2387 – 2397 . Google Scholar Crossref Search ADS PubMed WorldCat 40. Grundy SM , Stone NJ , Bailey AL , et al. 2018 ACC/AHA/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the Management of Blood Cholesterol . J Am Coll Cardiol. 2018 ; doi: 10.1016/j.jacc.2018.11.003 . OpenURL Placeholder Text WorldCat Crossref 41. Sullivan D , Olsson AG , Scott R , et al. Effect of a monoclonal antibody to PCSK9 on low-density lipoprotein cholesterol levels in statin-intolerant patients: the GAUSS randomized trial . JAMA. 2012 ; 308 ( 23 ): 2497 – 2506 . Google Scholar Crossref Search ADS PubMed WorldCat 42. Sabatine MS , Giugliano RP , Wiviott SD , et al. ; Open-Label Study of Long-Term Evaluation against LDL Cholesterol (OSLER) Investigators . Efficacy and safety of evolocumab in reducing lipids and cardiovascular events . N Engl J Med. 2015 ; 372 ( 16 ): 1500 – 1509 . Google Scholar Crossref Search ADS PubMed WorldCat 43. Ridker PM , Revkin J , Amarenco P , et al. ; for the SPIRE Cardiovascular Outcome Investigators . Cardiovascular efficacy and safety of bococizumab in high-risk patients . N Engl J Med. 2017 ; 376 ( 16 ): 1527 – 1539 . Google Scholar Crossref Search ADS PubMed WorldCat 44. Sabatine MS , Giugliano RP , Keech AC , et al. ; FOURIER Steering Committee and Investigators . Evolocumab and clinical outcomes in patients with cardiovascular disease . N Engl J Med. 2017 ; 376 ( 18 ): 1713 – 1722 . Google Scholar Crossref Search ADS PubMed WorldCat 45. Virani SS , Ballantyne CM . Low-density lipoprotein cholesterol: is 160 the new 190? Circulation. 2018 ; 138 ( 21 ): 2326 – 2329 . Google Scholar Crossref Search ADS PubMed WorldCat 46. Abdullah SM , Defina LF , Leonard D , et al. Long-term association of low-density lipoprotein cholesterol with cardiovascular mortality in individuals at low 10-year risk of atherosclerotic cardiovascular disease . Circulation. 2018 ; 138 ( 21 ): 2315 – 2325 . Google Scholar Crossref Search ADS PubMed WorldCat 47. Lloyd-Jones DM , Braun LT , Ndumele CE , et al. Use of risk assessment tools to guide decision-making in the primary prevention of atherosclerotic cardiovascular disease: a special report from the American Heart Association and American College of Cardiology . J Am Coll Cardiol. 2018 . In press. OpenURL Placeholder Text WorldCat Published by Oxford University Press on behalf of American Society for Clinical Pathology 2019. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Janac, Jelena, M;Zeljkovic,, Aleksandra;Jelic-Ivanovic, Zorana, D;Dimitrijevic-Sreckovic, Vesna, S;Vekic,, Jelena;Miljkovic, Milica, M;Stefanovic,, Aleksandra;Kotur-Stevuljevic, Jelena, M;Ivanisevic, Jasmina, M;Spasojevic-Kalimanovska, Vesna, V

Tang,, Junming;Jiang,, Yan;Ge,, Zhijun;Wu,, Haifeng;Chen,, Huajun;Dai,, Ji;Gu,, Yinjie;Mao,, Xuhua;Lu,, Junjie

doi: 10.1093/labmed/lmz025pmid: 31245815

Abstract Objective To determine whether the performance of a new quantum dots–based point-of-care test (POCT) devices is qualified for procalcitonin testing. Methods Finger-prick and venous blood specimens from 153 patients were measured with a quantum dots–based POCT device; the results were compared with those from the reference method. Results The quantum dots–based POCT device correlated well with the reference method in measuring plasma, venous whole blood, and finger-prick blood. No significant bias was observed (−0.08 ng/mL). At 0.5 ng per mL cutoff value, the concordances were 96.6%, 94.6%, and 90.5% for plasma, venous whole blood, and finger-prick blood, respectively. And at 2 ng per mL cutoff value, the concordances were 98.0%, 96.6%, and 95.3%, respectively. Conclusions The quantum dots–based POCT device measured procalcitonin with multiple specimen types, high sensitivity, wide detection range, and short turnaround time. It would allow a more widespread use of procalcitonin and help lessen the burden of overcrowding in healthcare facilities in China. point-of-care testing, procalcitonin, finger-prick blood, immunochromatographic assay, quantum dots, sepsis Early diagnosis and treatment of severe bacterial infection–induced sepsis is the most effective strategy to improve health outcomes for patients.1-4 Etiologic diagnosis requires identification of pathogenic microorganisms from blood or secretion, which usually takes several days. Procalcitonin measurement, is increasingly being used for diagnosing and for guiding the initiation and termination of antibacterial therapy.5,6 The results of several clinical trials have uncovered a marked reduction of antibacterial drug use without compromising health outcomes for patients.7-9 Moreover, because procalcitonin is a specific bacterial-infection biomarker, it could help in differentiating bacterial and viral infections,10 as well as distinguishing between sepsis and systemic inflammatory response syndrome (SIRS) of noninfectious origin in patients with critical illness.11 Sepsis is unlikely when the procalcitonin value is lower than 0.5 ng per mL. Levels between 0.5 and 2 ng per mL imply SIRS, levels ranging from 2 to 10 ng per mL are suggestive of sepsis, and levels higher than 10 ng per mL indicate septic shock.12 For emergency department and outpatient clinics, quick diagnosis of bacterial infection or sepsis is critical for the early initiation of antibacterial therapy. For this purpose, POCT devices with short turnaround times that are easy to use fit well with those needs.13 Quantum dots is the most potential type of fluorescent probe for developing high-performance POCT devices—it has broad ultraviolet absorption, narrow fluorescent-emission spectra, high quantum-yield fluorescence, and excellent stability against photobleaching.14 Application of quantum dots has already been proved to greatly improve performance in lateral-flow immunoassay technology,15 especially detection sensitivity.16 In this study, a new quantum dots–based POCT device was evaluated, which measures the concentration of procalcitonin in plasma, venous whole blood, and finger-prick blood, with high sensitivity. The accuracy of this device in measuring procalcitonin in plasma, venous whole blood, and finger-prick blood was compared with the reference method (Roche ELECSYS B·R·A·H·M·S procalcitonin assay [F. Hoffman-La Roche Ltd]); the concordance of the new device with the reference method at 0.5 ng per mL and 2 ng per mL cutoff values was also analyzed. Materials and Methods Characteristics of Quantum Dots–Based POCT Device The quantum dots–based POCT device is a lateral-flow immunochromatographic sandwich assay using quantum dots as tracer material, which has the typical constitution of an immunochromatographic test strip. The antibody pair used in the strip was developed by Nanjing Vazyme Medical Co., Ltd; the epitope of those antibodies was similar to that of BRAHMS procalcitonin antibodies. The assay requires 80 μL of whole blood, plasma, or serum as specimen material and 15 minutes of reaction time. All types of specimens are directly dispensed into a specimen well on the strip without dilution. Then, the specimen moves towards the end of the strip due to capillary effect. When the liquid passes through the conjugate pad, the antiprocalcitonin monoclonal antibody–sensitized quantum dots are dissolved by the liquid and bind with the procalcitonin protein in the specimen. Next, the procalcitonin-antibody–quantum-dots complex moves with the liquid towards the test line and control line, which are subsequently captured by another antiprocalcitonin monoclonal antibody immobilized on the test line. Finally, the extrasensitized quantum dots that do not bind to procalcitonin protein are captured by recombinant procalcitonin protein immobilized on the control line. The fluorescence signals of test line and control line were recorded by a customized fluorescence immunoanalyzer, and the concentration of procalcitonin in the specimen is calculated according to the ratio of signal intensity on the test line and control line. Each lot of strips was precalibrated, and the calibration curve was stored on a memory card. The calibration was a 7-point calibration, ranging from 0.03 to 45.00 ng per mL. Before measurement, the calibration curve was transferred into the fluorescence immunoanalyzer. This assay was cleared by the China Food and Drug Administration. We purchased all test strips and the fluorescence immunoanalyzer used in this study from Nanjing Vazyme Medical Co, Ltd. Patients and Specimen Processing A total of 153 patients admitted to the intensive care unit (ICU) of Yixing People’s Hospital from October 9, 2017 through March 22, 2018 were enrolled into this study. We took 250 μL of finger-prick blood and approximately 5 mL of venous ethylenediaminetetraacetic acid (EDTA)–collected whole blood (taken from the routine blood withdrawal) from each patient enrolled. We rejected five sets of specimens because the finger-prick specimen clotted before testing. We tested the finger-prick blood and venous EDTA-collected whole blood specimens using quantum dots–based procalcitonin assay immediately after blood withdrawal. The remaining specimen volume of venous EDTA-collected blood was centrifuged; the resulting plasma was analyzed using the Roche ELECSYS B·R·A·H·M·S procalcitonin assay. We completed collection and measurement of all specimens from the same patient within 2 hours. The remaining plasma specimens were stored at −20°C for the performance evaluation of quantum dots–based procalcitonin assay. This study was in accord with the Helsinki Declaration of 1975 and was approved by the Institutional Review Board of Yixing People’s Hospital. Performance Evaluation We evaluated the precision of the quantum dots–based procalcitonin assay according to the Clinical & Laboratory Standards (CLSI) guideline EP05-A3. Mixed plasma specimens at a low concentration of 0.52 ng per mL and a high concentration of 10.16 ng per mL were aliquoted into 2 batches, respectively, and stored at −20°C. The intraassay coefficient of variance (CV) was calculated by measuring 20 replicates of each mixed specimen. Each batch was tested once in the morning and once in the afternoon for 10 consecutive days, to assess the interassay CV. The lower limit of quantification (LoQ) of the quantum dots–based procalcitonin assay was evaluated by measuring 3 mixed plasma specimens with procalcitonin concentration (0.02 ng/mL, 0.05 ng/mL, and 0.10 ng/mL) close to the claimed limit of detection of 0.02 ng per mL with 20 replicates. Statistics Comparison of the quantum dots–based procalcitonin assay and the Roche ELECSYS B·R·A·H·M·S procalcitonin assay was performed using Passing-Bablok regression analysis and Bland-Altman difference plotting. We assessed the clinical concordance between different assays over 2 clinically relevant procalcitonin cutoff values (0.5 ng/mL and 2 ng/mL) by calculating the к coefficient. We performed data analysis using Medcalc software, version 15.8 (MedCalc Software bvba). Results For the evaluation of LoQ (Table 1), measuring the specimen with 0.02 ng per mL of procalcitonin resulted in a CV of 25.0%. The CVs of specimens with PCT concentration of 0.05 ng per mL and 0.10 ng per mL were both less than 20%; thus, the LoQ of the quantum dots–based procalcitonin assay was set as 0.05 ng per mL. For the evaluation of precision, the inter- and intraassay CVs are shown in Table 2. Replicate measurements showed the intraassay CVs were 7.4% and 5.3% for low and high procalcitonin concentration-specimens, respectively. The interassay CVs for low- and high-procalcitonin concentration specimens were 9.5% and 7.6%, respectively (slightly higher than the intraassay CVs). Table 1. Determination of the Lower Limit of Quantification Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . . Mean (SD) (ng/mL) . CV (%) . 0.02 0.02 (0.005) 25.0 0.05 0.05 (0.009) 18.0 0.10 0.09 (0.012) 13.3 Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . . Mean (SD) (ng/mL) . CV (%) . 0.02 0.02 (0.005) 25.0 0.05 0.05 (0.009) 18.0 0.10 0.09 (0.012) 13.3 CV, coefficient of variance. Open in new tab Table 1. Determination of the Lower Limit of Quantification Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . . Mean (SD) (ng/mL) . CV (%) . 0.02 0.02 (0.005) 25.0 0.05 0.05 (0.009) 18.0 0.10 0.09 (0.012) 13.3 Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . . Mean (SD) (ng/mL) . CV (%) . 0.02 0.02 (0.005) 25.0 0.05 0.05 (0.009) 18.0 0.10 0.09 (0.012) 13.3 CV, coefficient of variance. Open in new tab Table 2. Intra- and Interassay CVs of Quantum Dots–Based PCT Assay Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . Interassay CV (n = 10) . . . Mean (SD) (ng/mL) . CV (%) . Mean (SD) (ng/mL) . CV (%) . 0.52 0.49 (0.036) 7.4% 0.55 (0.052) 9.5% 10.16 10.53 (0.558) 5.3% 10.67 (0.811) 7.6% Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . Interassay CV (n = 10) . . . Mean (SD) (ng/mL) . CV (%) . Mean (SD) (ng/mL) . CV (%) . 0.52 0.49 (0.036) 7.4% 0.55 (0.052) 9.5% 10.16 10.53 (0.558) 5.3% 10.67 (0.811) 7.6% Open in new tab Table 2. Intra- and Interassay CVs of Quantum Dots–Based PCT Assay Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . Interassay CV (n = 10) . . . Mean (SD) (ng/mL) . CV (%) . Mean (SD) (ng/mL) . CV (%) . 0.52 0.49 (0.036) 7.4% 0.55 (0.052) 9.5% 10.16 10.53 (0.558) 5.3% 10.67 (0.811) 7.6% Procalcitonin Concentration (ng/mL) . Intraassay CV (n = 20) . . Interassay CV (n = 10) . . . Mean (SD) (ng/mL) . CV (%) . Mean (SD) (ng/mL) . CV (%) . 0.52 0.49 (0.036) 7.4% 0.55 (0.052) 9.5% 10.16 10.53 (0.558) 5.3% 10.67 (0.811) 7.6% Open in new tab The results of quantum dots–based PCT assay and the Roche ELECSYS B·R·A·H·M·S procalcitonin assay were compared using plasma specimens (n = 148). Passing-Bablok regression analysis yielded the regression equation y (Vazyme) = −0.028 + 0.985 × (on the Roche ELECSYS B R A H M S instrument) (Figure 1A). Bland-Altman analysis showed good agreement, with a mean bias of −0.08 ng per mL (95% confidence interval [CI], 0.34–0.30) and 95% limits of agreement from –1.25 ng per mL (1.42 to −1.08) to 1.10 ng per mL (0.93–1.26) (Figure 1B). These results indicated that the quantum dots–based procalcitonin assay has excellent consistency with Roche ELECSYS B·R·A·H·M·S procalcitonin assay in a broad range of procalcitonin concentration. Next, the agreement between results obtained by quantum dots–based procalcitonin assay using finger-prick or venous whole blood and the Roche ELECSYS B·R·A·H·M·S procalcitonin assay was estimated. Passing-Bablok regression analysis yielded the regression equation y (venous whole blood) = 0.025 + 1.009 × (Roche instrument value) and Bland-Altman analysis yielded the equation y (finger-prick) = 0.052 + 0.948 × (Roche instrument value) (Figure 2A and B). Figure 1 Open in new tabDownload slide Method comparison between the quantum dots–based procalcitonin assay and the Roche ELECSYS B·R·A·H·M·S procalcitonin assay (F. Hoffman-La Roche Ltd). A, Passing-Bablok regression analysis with 95% confidence interval (CI) of procalcitonin measurements performed with 2 assays (n = 148). The 95% CI of slope and intercept of the regression line were 0.93 to 1.09 and −0.05 to 0.02, respectively. B, Bland-Altman analysis of quantum dots–based procalcitonin assay and Roche ELECSYSTM B·R·A·H·M·STM procalcitonin assay (n = 148). Mean bias and 1.96-fold SD indicative of its 95% limits of agreement were shown with straight line and dashed line, respectively. Figure 1 Open in new tabDownload slide Method comparison between the quantum dots–based procalcitonin assay and the Roche ELECSYS B·R·A·H·M·S procalcitonin assay (F. Hoffman-La Roche Ltd). A, Passing-Bablok regression analysis with 95% confidence interval (CI) of procalcitonin measurements performed with 2 assays (n = 148). The 95% CI of slope and intercept of the regression line were 0.93 to 1.09 and −0.05 to 0.02, respectively. B, Bland-Altman analysis of quantum dots–based procalcitonin assay and Roche ELECSYSTM B·R·A·H·M·STM procalcitonin assay (n = 148). Mean bias and 1.96-fold SD indicative of its 95% limits of agreement were shown with straight line and dashed line, respectively. Figure 2 Open in new tabDownload slide Agreement between finger-prick whole blood procalcitonin and venous whole blood procalcitonin values on quantum dots–based procalcitonin assay vs the Roche ELECSYS B·R·A·H·M·S procalcitonin assay (F. Hoffman-La Roche Ltd). Bland-Altman analysis of finger-prick (A) and whole-blood (B) procalcitonin in specimens with procalcitonin concentration <50 ng/mL (n = 119). Mean bias and 1.96-fold SD indicative of its 95% limits of agreement were shown with straight line and dashed line, respectively. Figure 2 Open in new tabDownload slide Agreement between finger-prick whole blood procalcitonin and venous whole blood procalcitonin values on quantum dots–based procalcitonin assay vs the Roche ELECSYS B·R·A·H·M·S procalcitonin assay (F. Hoffman-La Roche Ltd). Bland-Altman analysis of finger-prick (A) and whole-blood (B) procalcitonin in specimens with procalcitonin concentration <50 ng/mL (n = 119). Mean bias and 1.96-fold SD indicative of its 95% limits of agreement were shown with straight line and dashed line, respectively. The quantum dots–based procalcitonin assay again showed good correlation with the Roche ELECSYS B·R·A·H·M·S procalcitonin assay when testing finger-prick and venous whole blood specimens in a broad procalcitonin concentration range. However, we note that the results are more disperse when comparing finger-prick specimens measured by quantum dots–based procalcitonin assay and Roche ELECSYS B·R·A·H·M·S procalcitonin assay. The concordance between quantum dots–based procalcitonin assay and the Roche ELECSYS B·R·A·H·M·S procalcitonin assay at clinically relevant procalcitonin cutoffs (0.5 ng/mL and 2 ng/mL) was calculated. As listed in Table 3, for the cutoff value of 0.5 ng per mL, quantum dots–based procalcitonin assay showed 96.6%, 94.6%, and 90.5% concordances when measuring plasma, venous whole blood, and finger-prick blood specimens, respectively. The concordance was better at the cutoff value of 2 ng per mL: quantum dots–based procalcitonin assay showed 98.0%, 96.6%, and 95.3% concordances measuring plasma, venous whole blood, and finger-prick blood specimens, respectively. For finger-prick specimens, the sensitivity and specificity at a cutoff value of 0.5 ng per mL were 91.6% (95% CI, 84.2%–95.8%) and 87.8% (73.0%–95.4%); at 2 ng per mL, those values were 94.4% (85.5%–98.2%) and 96.1% (88.3%–99.0%). Therefore, the quantum dots–based procalcitonin assay has excellent diagnostic performance at a 2 ng per mL cutoff value. Table 3. Concordance of Quantum Dots–Based Procalcitonin Assay with Reference Method Analyte . Cutoff Value . . . . . . . 0.5 ng/mL . . . 2 ng/mL . . . . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Plasma 97.2 95.1 96.6 97.2 98.7 98.0 Venous whole blood 95.3 92.7 94.6 95.8 97.4 96.6 Finger-prick blood 91.6 87.8 90.5 94.4 96.1 95.3 Analyte . Cutoff Value . . . . . . . 0.5 ng/mL . . . 2 ng/mL . . . . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Plasma 97.2 95.1 96.6 97.2 98.7 98.0 Venous whole blood 95.3 92.7 94.6 95.8 97.4 96.6 Finger-prick blood 91.6 87.8 90.5 94.4 96.1 95.3 Sens., sensitivity; CI, confidential interval; Spec., specificity; Conc, concordance. Open in new tab Table 3. Concordance of Quantum Dots–Based Procalcitonin Assay with Reference Method Analyte . Cutoff Value . . . . . . . 0.5 ng/mL . . . 2 ng/mL . . . . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Plasma 97.2 95.1 96.6 97.2 98.7 98.0 Venous whole blood 95.3 92.7 94.6 95.8 97.4 96.6 Finger-prick blood 91.6 87.8 90.5 94.4 96.1 95.3 Analyte . Cutoff Value . . . . . . . 0.5 ng/mL . . . 2 ng/mL . . . . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Sens, % (95% CI) . Spec, % (95% CI) . Conc, % . Plasma 97.2 95.1 96.6 97.2 98.7 98.0 Venous whole blood 95.3 92.7 94.6 95.8 97.4 96.6 Finger-prick blood 91.6 87.8 90.5 94.4 96.1 95.3 Sens., sensitivity; CI, confidential interval; Spec., specificity; Conc, concordance. Open in new tab Discussion Benefitting from the features of quantum dots,17 the new POCT device we tested has high sensitivity (LoQ, 0.05 ng/mL), a broad measurable range (as high as 50 ng/mL), and short detection time (typically less than 20 minutes turnaround time). It also correlates well with the reference method without a clinically significant bias when testing plasma, whole blood, and finger-prick specimens. According to our experience, outpatients with bacterial infections and patients treated in the emergency department or ICU exhibited a broad distribution of procalcitonin value. Thus, the high sensitivity and the broad measurable range are valuable for clinicians. Our findings showed that across a wide measurable range of 0.05 ng per mL to 50 ng per mL, the concordance of quantum dots–based procalcitonin assay with the reference method was reassuring when testing venous plasma and whole blood specimens. Bland-Altman plotting showed neglecting bias when comparing venous quantum dots–based procalcitonin assay measurements and reference method measurements. For quick analysis, venous whole blood or finger-prick blood measurements also exhibited good correlation. Further, our data revealed high concordance at 0.5 ng per mL cutoff value (>90% for all specimen types) and 2 ng per mL cutoff value (>95% for all specimen types). Thus, based on these findings, we considered that quantum dots–based procalcitonin assay would lead to the same decision for antibacterial drug use and disease-severity assessment, compared with the reference method. Procalcitonin is synthesized by the CALC-I gene in healthy subjects and patients with inflammation. Translation of CALC-I messenger RNA (mRNA) results in preprocalcitonin with 141 amino acids; then, the signal peptide is removed, and the remaining fragment is called procalcitonin.18 In healthy subjects, procalcitonin is mainly produced in thyroid C cells and further cleaved into 3 fragments, namely N-termal region, calcitonin, and katacalcin with different biological functions. In patients with inflammation, procalcitonin is produced in various organs and tissues, including the liver, kidney, aorta, body fat, ovaries, bladder, and adrenal glands, and released into the circulation.19 Thus, concentration of procalcitonin in healthy subjects is extremely low (usually <0.05 ng/mL) and increases enormously during sepsis (as high as 200 ng/mL or more), which makes procalcitonin a sensitive and specific biomarker for systemic inflammation. However, in patients with medullary-thyroid carcinoma, procalcitonin is also secreted by thyroid C cells, and the concentration of procalcitonin in blood reaches 12.9 ng per mL.20 However, due to the fact that inflammatory-induced procalcitonin and cancer-induced procalcitonin are alike in nature, no devices could distinguish those procalcitonin proteins with different origins. POCT devices of procalcitonin measurement had been reported in several studies,21-25 including quantitative and semiquantitative assays. Three studies reported laboratory-developed tests to quantitatively measure procalcitonin in serum, plasma, or whole blood specimens but with narrow measurable range23 or with poor concordance with reference methods.24,25 A commercial semiquantitative assay, the ABSOGEN Procalcitonin assay (Bumyoungbio, Inc), had good consistency with the Roche ELECSYS B·R·A·H·M·S procalcitonin assay; however, it could not report absolute concentration of procalcitonin, which restricted its application.22 The B·R·A·H·M·S procalcitonin direct assay was the most accurate POCT assay reported but it still had a limited measurable range (as high as 10 ng/mL).21 Further, the B·R·A·H·M·S procalcitonin direct assay requires 20 minutes of incubation time, which means the turnaround time would be as high as 25 minutes or longer. In contrast to these study findings, a quantum dots–based POCT device with a small and easy-to-handle specimen volume (80 μL), high sensitivity, broad measuring range (0.05–40.0 ng/mL), and a fast time to result (15 minutes after specimen dropping) was evaluated. This device allowed a less than 20-minute turnaround time, which exceeds that of most available procalcitonin-measurement methods with similar technical performance. These features fulfill the requirements of procalcitonin measurement in various departments, including emergency, pediatrics, ICU, and respiratory, and would significantly shorten the diagnosis-to-treatment interval time. Quantum dots have been widely used in POCT devices to improve sensitivity.26-28 Yang et al28 reported that application of quantum dots increased the sensitivity by 10-fold, compared with colloidal gold, in testing for anti-TP47 polyclonal antibody. However, this device is laboratory developed and has cumbersome manual steps. It requires the user to mix specimen material with sensitized quantum dots manually in the tube and place the strip into the mixture to complete the test. Further, the result was read by naked eyes, which removed the advantage of quantum dots as being of fluorescence material and semiquantitative. Thus, the convenience and sensitivity of such devices still need to be promoted. For the quantum dots–based test, a fluorescence immunoanalyzer would give more accurate quantitative result with simpler operation. In conclusion, the quantum dots–based POCT device has high sensitivity and precision with a wide measurable range, compared with other POCT devices for procalcitonin measurement for which studies have been published. The quantum dots–based POCT device could be suitable in the clinical management of patients with bacterial infection and may also help increase outpatient effectiveness and lessen the burden of hospital overcrowding, which is a tremendous problem in China. Abbreviations Abbreviations SIRS systemic inflammatory response syndrome ICU intensive care unit EDTA ethylenediaminetetraacetic acid CLSI Clinical and Laboratory Standards CV coefficient of variance LoQ limit of quantification CI confidence interval mRNA messenger RNA Sens. sensitivity Spec. specificity Conc concordance References 1. Kumar A , Roberts D , Wood KE , et al. Duration of hypotension before initiation of effective antimicrobial therapy is the critical determinant of survival in human septic shock . Crit Care Med. 2006 ; 34 ( 6 ): 1589 – 1596 . Google Scholar Crossref Search ADS PubMed WorldCat 2. Parrillo JE , Parker MM , Natanson C , et al. Septic shock in humans. Advances in the understanding of pathogenesis, cardiovascular dysfunction, and therapy . Ann Intern Med. 1990 ; 113 ( 3 ): 227 – 242 . Google Scholar Crossref Search ADS PubMed WorldCat 3. Rivers E , Nguyen B , Havstad S , et al. ; Early Goal-Directed Therapy Collaborative Group . Early goal-directed therapy in the treatment of severe sepsis and septic shock . N Engl J Med. 2001 ; 345 ( 19 ): 1368 – 1377 . Google Scholar Crossref Search ADS PubMed WorldCat 4. Warren HS . Strategies for the treatment of sepsis . N Engl J Med. 1997 ; 336 ( 13 ): 952 – 953 . Google Scholar Crossref Search ADS PubMed WorldCat 5. Schuetz P , Maurer P , Punjabi V , Desai A , Amin DN , Gluck E . Procalcitonin decrease over 72 hours in US critical care units predicts fatal outcome in sepsis patients . Crit Care. 2013 ; 17 ( 3 ): R115 . Google Scholar Crossref Search ADS PubMed WorldCat 6. Schuetz P , Wolbers M , Christ-Crain M , et al. ; ProHOSP Study Group . Prohormones for prediction of adverse medical outcome in community-acquired pneumonia and lower respiratory tract infections . Crit Care. 2010 ; 14 ( 3 ): R106 . Google Scholar Crossref Search ADS PubMed WorldCat 7. Dusemund F , Bucher B , Meyer S , et al. ; ProREAL Study Team . Influence of procalcitonin on decision to start antibiotic treatment in patients with a lower respiratory tract infection: insight from the observational multicentric ProREAL surveillance . Eur J Clin Microbiol Infect Dis. 2013 ; 32 ( 1 ): 51 – 60 . Google Scholar Crossref Search ADS PubMed WorldCat 8. Schuetz P , Briel M , Christ-Crain M , et al. Procalcitonin to guide initiation and duration of antibiotic treatment in acute respiratory infections: an individual patient data meta-analysis . Clin Infect Dis. 2012 ; 55 ( 5 ): 651 – 662 . Google Scholar Crossref Search ADS PubMed WorldCat 9. Schuetz P , Christ-Crain M , Thomann R , et al. ; ProHOSP Study Group . Effect of procalcitonin-based guidelines vs standard guidelines on antibiotic use in lower respiratory tract infections: the ProHOSP randomized controlled trial . JAMA. 2009 ; 302 ( 10 ): 1059 – 1066 . Google Scholar Crossref Search ADS PubMed WorldCat 10. Schuetz P , Christ-Crain M , Müller B . Biomarkers to improve diagnostic and prognostic accuracy in systemic infections . Curr Opin Crit Care. 2007 ; 13 ( 5 ): 578 – 585 . Google Scholar Crossref Search ADS PubMed WorldCat 11. Wacker C , Prkno A , Brunkhorst FM , Schlattmann P . Procalcitonin as a diagnostic marker for sepsis: a systematic review and meta-analysis . Lancet Infect Dis. 2013 ; 13 ( 5 ): 426 – 435 . Google Scholar Crossref Search ADS PubMed WorldCat 12. Schneider HG , Lam QT . Procalcitonin for the clinical laboratory: a review . Pathology. 2007 ; 39 ( 4 ): 383 – 390 . Google Scholar Crossref Search ADS PubMed WorldCat 13. Rooney KD , Schilling UM . Point-of-care testing in the overcrowded emergency department–can it make a difference? Crit Care. 2014 ; 18 ( 6 ): 692 . Google Scholar Crossref Search ADS PubMed WorldCat 14. Margraf JT , Ruland A , Sgobba V , Guldi DM , Clark T . Quantum-dot-sensitized solar cells: understanding linker molecules through theory and experiment . Langmuir. 2013 ; 29 ( 7 ): 2434 – 2438 . Google Scholar Crossref Search ADS PubMed WorldCat 15. Banerjee R , Jaiswal A . Recent advances in nanoparticle-based lateral flow immunoassay as a point-of-care diagnostic tool for infectious agents and diseases . Analyst. 2018 ; 143 ( 9 ): 1970 – 1996 . Google Scholar Crossref Search ADS PubMed WorldCat 16. Shen J , Zhou Y , Fu F , et al. Immunochromatographic assay for quantitative and sensitive detection of hepatitis B virus surface antigen using highly luminescent quantum dot-beads . Talanta. 2015 ; 142 : 145 – 149 . Google Scholar Crossref Search ADS PubMed WorldCat 17. Pisanic TR 2nd , Zhang Y , Wang TH . Quantum dots in diagnostics and detection: principles and paradigms . Analyst. 2014 ; 139 ( 12 ): 2968 – 2981 . Google Scholar Crossref Search ADS PubMed WorldCat 18. Meisner M . Pathobiochemistry and clinical use of procalcitonin . Clin Chim Acta. 2002 ; 323 ( 1-2 ): 17 – 29 . Google Scholar Crossref Search ADS PubMed WorldCat 19. Morgenthaler NG , Struck J , Chancerelle Y , et al. Production of procalcitonin (PCT) in non-thyroidal tissue after LPS injection . Horm Metab Res. 2003 ; 35 ( 5 ): 290 – 295 . Google Scholar Crossref Search ADS PubMed WorldCat 20. Giovanella L , Imperiali M , Piccardo A , et al. Procalcitonin measurement to screen medullary thyroid carcinoma: a prospective evaluation in a series of 2705 patients with thyroid nodules . Eur J Clin Invest. 2018 ; 48 ( 6 ): e12934 . Google Scholar Crossref Search ADS PubMed WorldCat 21. Kutz A , Hausfater P , Oppert M , et al. Comparison between B·R·A·H·M·S PCT direct, a new sensitive point-of-care testing device for rapid quantification of procalcitonin in emergency department patients and established reference methods - a prospective multinational trial . Clin Chem Lab Med. 2016 ; 54 ( 4 ): 577 – 584 . Google Scholar Crossref Search ADS PubMed WorldCat 22. Kwon HJ , Lee J , Park HI , Han K . Evaluation of a novel point-of-care test kit, ABSOGENTM PCT, in semi-quantitative measurement of procalcitonin in whole blood . J Clin Lab Anal. 2017 ; 31 ( 6 ): e22111 . Google Scholar Crossref Search ADS WorldCat 23. Rascher D , Geerlof A , Kremmer E , et al. Total internal reflection (TIRF)-based quantification of procalcitonin for sepsis diagnosis–a point-of-care testing application . Biosens Bioelectron. 2014 ; 59 : 251 – 258 . Google Scholar Crossref Search ADS PubMed WorldCat 24. Shao X-Y , Wang C-R , Xie C-M , Wang X-G , Liang R-L , Xu W-W . Rapid and sensitive lateral flow immunoassay method for procalcitonin (PCT) based on time-resolved immunochromatography . Sensors (Basel) . 2017 ; 17 ( 3 ): 480 . Google Scholar Crossref Search ADS WorldCat 25. Wang H , Wang H , Chen S , et al. Development of a fluorescent immnunochromatographic assay for the procalcitonin detection of clinical patients in China . Clin Chim Acta. 2015 ; 444 : 37 – 42 . Google Scholar Crossref Search ADS PubMed WorldCat 26. Cheng X , Pu X , Jun P , Zhu X , Zhu D , Chen M . Rapid and quantitative detection of C-reactive protein using quantum dots and immunochromatographic test strips . Int J Nanomedicine. 2014 ; 9 : 5619 – 5626 . Google Scholar PubMed OpenURL Placeholder Text WorldCat 27. Ge S , Ge L , Yan M , Song X , Yu J , Liu S . A disposable immunosensor device for point-of-care test of tumor marker based on copper-mediated amplification . Biosens Bioelectron. 2013 ; 43 : 425 – 431 . Google Scholar Crossref Search ADS PubMed WorldCat 28. Yang H , Li D , He R , et al. A novel quantum dots–based point of care test for syphilis . Nanoscale Res Lett. 2010 ; 5 ( 5 ): 875 – 881 . Google Scholar Crossref Search ADS PubMed WorldCat Author notes These authors contributed equally to this article. © American Society for Clinical Pathology 2019. All rights reserved. For permissions, please e-mail: [email protected] This article is published and distributed under the terms of the Oxford University Press, Standard Journals Publication Model (https://academic.oup.com/journals/pages/open_access/funder_policies/chorus/standard_publication_model)