Nanoscale

Ding, Xiaobo; Wen, Xin; Kawata, Yuto; Liu, Yang; Shi, Guozheng; Ghazi, Refka ben; Sun, Xiang; Zhu, Yujie; Wu, Hao; Gao, Haotian; Shen, Qing; Liu, Zeke; Ma, Wanli

doi: 10.1039/d3nr05951kpmid: 38369889

Lead sulfide colloidal quantum dots (PbS CQDs) show great potential in next-generation photovoltaics. However, their high specific surface area and complex surface crystallography lead to a high surface trap density, which normally requires more than one type of capping ion or ligand to achieve effective surface passivation. In this study, we performed in situ mixed halogen passivation (MHP) during the direct synthesis of semiconducting PbS CQD inks by using different lead halogens. The different halogens can bind with the surface of the CQD throughout the nucleation/growth process, resulting in optimal surface configuration. As a result, the MHP CQD exhibited superior surface passivation compared to the conventionally iodine-capped CQDs. Finally, we achieved a substantial improvement in efficiency from 10.64% to 12.58% after the MHP treatment. Our work demonstrates the advantages of exploring efficient passivation in the directly synthesized CQD inks.

Foroutan Kalourazi, Ali; Nazemi, Seyed Amirabbas; Unniram Parambil, Ajmal Roshan; Muñoz-Tafalla, Ruben; Vidal, Paula; Shahangian, S. Shirin; Guallar, Victor; Ferrer, Manuel; Shahgaldian, Patrick

doi: 10.1039/d3nr06044fpmid: 38349359

We report a method of enzyme stabilisation exploiting the artificial protein chaperone properties of β-cyclodextrin (β-CD) covalently embedded in an ultrathin organosilica layer. Putative interaction points of this artificial chaperone system with the surface of the selected enzyme were studied in silico using a protein energy landscape exploration simulation algorithm. We show that this enzyme shielding method allows for drastic enhancement of enzyme stability under thermal and chemical stress conditions, along with broadening the optimal temperature range of the biocatalyst. The presence of the β-CD macrocycle within the protective layer supports protein refolding after treatment with a surfactant.

Zhou, Tingwei; Kuang, Anlong

doi: 10.1039/d3nr06132apmid: 38358028

The construction of superalkali halide perovskites has attracted attention for the development of new photovoltaic materials, but stable superalkalis have not been found until now. Herein, to construct new three-dimensional superalkali halide perovskites with a MI3 frame (M = Sn and Pb), a new Li(H2O)3+ superalkali cation is designed and selected based on low vertical ionization potential, suitable tolerance factor, small ionic radius and large dissociation energy. High-throughput first-principles calculations show that superalkalis with lower vertical ionization potentials exhibit stronger interactions with the MI3 frame. The normal and cubic Li(H2O)3MI3 perovskites and cubic Li(H2O)4PbI3 perovskites have direct band gaps, s–p and p–p electron transitions, effective carrier masses of less than 0.45me and exciton binding energies of less than 291 meV. Moreover, the cubic Li(H2O)3PbI3 perovskite with a direct band gap of 1.40 eV can in theory show a power conversion efficiency of 33.49%. These results strongly suggest that superalkali cations with large dissociation energy can be used to develop stable superalkali perovskites for photovoltaic applications.

Travagliante, Gabriele; Gaeta, Massimiliano; Gangemi, Chiara M. A.; Alaimo, Salvatore; Ferro, Alfredo; Purrello, Roberto; D'Urso, Alessandro

doi: 10.1039/d3nr05504cpmid: 38305723

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(ii) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

Lesniewska, Nicolas; Duval, Jérôme F. L.; Caillet, Céline; Razafitianamaharavo, Angelina; Pinheiro, José P.; Bihannic, Isabelle; Gley, Renaud; Le Cordier, Hélène; Vyas, Varun; Pagnout, Christophe; Sohm, Bénédicte; Beaussart, Audrey

doi: 10.1039/d3nr04740gpmid: 38265106

Given the growing scientific and industrial interests in green microalgae, a comprehensive understanding of the forces controlling the colloidal stability of these bioparticles and their interactions with surrounding aqueous microenvironment is required. Accordingly, we addressed here the electrostatic and hydrophobic surface properties of Chlorella vulgaris from the population down to the individual cell levels. We first investigated the organisation of the electrical double layer at microalgae surfaces on the basis of electrophoresis measurements. Interpretation of the results beyond zeta-potential framework underlined the need to account for both the hydrodynamic softness of the algae cells and the heterogeneity of their interface formed with the outer electrolyte solution. We further explored the nature of the structural charge carriers at microalgae interfaces through potentiometric proton titrations. Extraction of the electrostatic descriptors of interest from such data was obscured by cell physiology processes and dependence thereof on prevailing measurement conditions, which includes light, temperature and medium salinity. As an alternative, cell electrostatics was successfully evaluated at the cellular level upon mapping the molecular interactions at stake between (positively and negatively) charged atomic force microscopy tips and algal surface via chemical force microscopy. A thorough comparison between charge-dependent tip-to-algae surface adhesion and hydrophobicity level of microalgae surface evidenced that the contribution of electrostatics to the overall interaction pattern is largest, and that the electrostatic/hydrophobic balance can be largely modulated by pH. Overall, the combination of multiscale physicochemical approaches allowed a drawing of some of the key biosurface properties that govern microalgae cell–cell and cell–surface interactions.

Qi, Yan; Kan, Yihong; Li, Zhenghua

doi: 10.1039/d3nr05437cpmid: 38369887

Despite rapid advances in magnetic domain imaging techniques, high-resolution imaging of 3D magnetic field components remains a great challenge. Magnetic force microscopy has been utilized to observe the 1D magnetic field component from the sample surface; however, the 1D stray-field component lacks sufficient conditions to clarify the nature of nanomagnetism. Herein, we propose a method for the detection of 3D stray-field components by using a Fe3O4-nanoparticle sensor. We employed this Fe3O4-nanoparticle sensor to detect nanoscale magnetic domains, domain walls, and magnetic vortices (resolution ∼5 nm), and our findings demonstrate its potential in imaging both out-of-plane and in-plane magnetic-field components. Our technique overcomes the limitations of 3D stray-field detection and high-resolution imaging and provides the possibility of observing both out-of-plane and in-plane magnetic field components with a 5 nm resolution, thereby paving the way for the development of future spin-based devices.

Chen, Du; Anantharaman, Surendra B.; Wu, Jinyuan; Qiu, Diana Y.; Jariwala, Deep; Guo, Peijun

doi: 10.1039/d3nr05799bpmid: 38390639

Atomically thin two-dimensional transition-metal dichalcogenides (2D-TMDs) have emerged as semiconductors for next-generation nanoelectronics. As 2D-TMD-based devices typically utilize metals as the contacts, it is crucial to understand the properties of the 2D-TMD/metal interface, including the characteristics of the Schottky barriers formed at the semiconductor-metal junction. Conventional methods for investigating the Schottky barrier height (SBH) at these interfaces predominantly rely on contact-based electrical measurements with complex gating structures. In this study, we introduce an all-optical approach for non-contact measurement of the SBH, utilizing high-quality WS2/Au heterostructures as a model system. Our approach employs a below-bandgap pump to excite hot carriers from the gold into WS2 with varying thicknesses. By monitoring the resultant carrier density changes within the WS2 layers with a broadband probe, we traced the dynamics and magnitude of charge transfer across the interface. A systematic sweep of the pump wavelength enables us to determine the SBH values and unveil an inverse relationship between the SBH and the thickness of the WS2 layers. First-principles calculations reveal the correlation between the probability of injection and the density of states near the conduction band minimum of WS2. The versatile optical methodology for probing TMD/metal interfaces can shed light on the intricate charge transfer characteristics within various 2D heterostructures, facilitating the development of more efficient and scalable nano-electronic and optoelectronic technologies.

Gahlot, Kushagra; Meijer, Julius; Protesescu, Loredana

doi: 10.1039/d3nr06075fpmid: 38385551

Metal halide perovskite nanostructures, characterized by their ionic nature, present a compelling avenue for the tunability of dimensions and band gaps through facile compositional transformations involving both cationic and anionic exchange reactions. While post-synthetic ion-exchange processes have been extensively explored in Pb-halide perovskite nanocrystals, the inherent instability of Sn2+ has limited the exploration of such processes in Sn-halide perovskite nanostructures. In this study, we present a straightforward cation exchange process wherein 2D [R–NH3]2SnX4 Ruddlesden–Popper (RP) nanostructures with n = 1 transition to 3D ASnX3 nanocrystals at room temperature with the addition of A-cation oleate. In addition, anion exchange processes have been demonstrated for both 2D [R–NH3]2SnX4 RP nanostructures and 3D nanocrystals, showcasing transitions between iodide and bromide counterparts. Furthermore, we have fabricated a thin film of 2D [R–NH3]2SnX4 RP nanostructures for cation exchange, wherein A-cation diffusion through a liquid–solid interface facilitates the transformation into a 3D ASnX3 crystal. This investigation underscores the versatility of ion exchange processes in engineering the composition of Sn-halide perovskite nanostructures and, consequently, modulating their optical properties.

Dutta, Soumi; Misra, Ashok; Bose, Suryasarathi

doi: 10.1039/d3nr06115apmid: 38376225

Microplastic (MP) pollution pervades global ecosystems, originating from improper plastic disposal and fragmentation due to factors like hydrolysis and biodegradation. These minute particles, less than 5 mm in size, have become omnipresent, impacting terrestrial, freshwater, and marine environments worldwide. Their ubiquity poses severe threats to marine life by causing physical harm and potentially transferring toxins through the food chain. Addressing this environmental crisis necessitates a sustainable strategy. Our proposed solution involves a highly efficient copper substitute polyoxometalate (Cu-POM) nanocluster infused triple interpenetrating polymer network (IPN) hydrogel, comprising chitosan (CS), polyvinyl alcohol (PVA), and polyaniline (PANI) (referred to as pGel@IPN) for mitigating MP contamination from water. This 3D IPN architecture, incorporating nanoclusters, also enhances the hydrogel's photodegradation capabilities. Our scalable approach offers a sustainable strategy to combat MPs in water bodies, as demostrated by the adsorption behaviors on the hydrogel matrix under varying conditions, simulating real-world scenarios. Evaluations of physicochemical properties, mechanical strength, and thermal behavior underscore the hydrogel's robustness and stability. Detecting minute MP particles remains challenging, prompting us to label MPs with Nile red for fluorescence microscopic analysis of their concentration and adsorption on the hydrogel. The catalytic properties of POM within the hydrogel facilitate UV-induced MP degradation, highlighting a sustainable solution. Our detailed kinetics and isotherm studies revealed pseudo-first-order and Langmuir models as fitting descriptors for MP adsorption, exhibiting a high maximum adsorption capacity (Qm). Notably, pGel@IPN achieved ∼95% and ∼93% removal efficiencies for polyvinyl chloride (PVC) and polypropylene (PP) MPs at pH ∼ 6.5, respectively, also demonstrating reusability for up to 5 cycles. Post-end-of-life, the spent adsorbent was efficiently upcycled into carbon nanomaterials, effectively removing the heavy metal Cr(vi), exemplifying circular economy principles. Our prepared hydrogel emerges as a potent solution for MP removal from water, promising effective mitigation of the emerging pollutants of MPs while ensuring sustainable environmental practices.

Gobbo, Marina; Caligiuri, Isabella; Giannetti, Micaela; Litti, Lucio; Mazzuca, Claudia; Rizzolio, Flavio; Palleschi, Antonio; Meneghetti, Moreno

doi: 10.1039/d4nr00172apmid: 38375540

The immune checkpoint programmed death ligand 1 (PD-L1) protein is expressed by tumor cells and it suppresses the killer activity of CD8+ T-lymphocyte cells binding to the programmed death 1 (PD-1) protein of these immune cells. Binding to either PD-L1 or PD1 is used for avoiding the inactivation of CD8+ T-lymphocyte cells. We report, for the first time, Au plasmonic nanostructures with surface-enhanced Raman scattering (SERS) properties (SERS nanostructures) and functionalized with an engineered peptide (CLP002: Trp-His-Arg-Ser-Tyr-Tyr-Thr-Trp-Asn-Leu-Asn-Thr), which targets PD-L1. Molecular dynamics calculations are used to describe the interaction of the targeting peptide with PD-L1 in the region where the interaction with PD-1 occurs, showing also the poor targeting activity of a peptide with the same amino acids, but a scrambled sequence. The results are confirmed experimentally since a very good targeting activity is observed against the MDA-MB-231 breast adenocarcinoma cancer cell line, which overexpresses PD-L1. A good activity is observed, in particular, for SERS nanostructures where the CLP002-engineered peptide is linked to the nanostructure surface with a short charged amino acid sequence and a long PEG chain. The results show that the functionalized SERS nanostructures show very good targeting of the immune checkpoint PD-L1.