Get 20M+ Full-Text Papers For Less Than $1.50/day. Start a 14-Day Trial for You or Your Team.

Learn More →

Phosphorylation of a member of the MBF1 transcriptional co‐activator family, StMBF1, is stimulated in potato cell suspensions upon fungal elicitor challenge

Phosphorylation of a member of the MBF1 transcriptional co‐activator family, StMBF1, is... Abstract StMBF1 (Solanum tuberosum multiprotein bridging factor 1) is a plant member of the MBF1 family of transcriptional co‐activators. Previously, it has been described as being up‐regulated at the transcrip tional level by fungal and abiotic stress. To understand whether StMBF1 is also regulated at the post‐translational level, in vitro as well as in vivo phosphorylation assays were performed. StMBF1 is phosphorylated under both experimental conditions and [32P] incorporation into StMBF1 increases after treatment of potato cells with hyphal cell wall components (HWC) derived from Phytophthora infestans. The StMBF1‐phosphorylating activity is strongly inhibited by the calcium‐chelator EGTA and partially inhibited by calmodulin antagonists. Using bacterial purified StMBF1 as a substrate, a 57 kDa calcium‐dependent protein kinase (p57) that is able to phosphorylate StMBF1 was detected. The StMBF1 kinase activity of p57 was higher in elicited than in non‐treated cells. The role of the elicitor‐dependent phosphorylation of StMBF1 is discussed. Key words: Calcium‐dependent protein kinase, cell suspensions, elicitor, multiprotein bridging factor 1, protein phosphorylation, Phytophthora infestans, Solanum tuberosum, transcriptional co‐activator. Received 13 June 2002; Accepted 24 September 2002 Introduction Higher plants have developed several elaborate mechanisms to ward off pathogen attack. Whereas some of these defence mechanisms already exist and provide physical and chemical barriers to hinder pathogen infection, others are induced after recognition of specific signal molecules called elicitors (Kombrink and Somssich, 1995; Somssich and Hahlbrock, 1998; Blumwald et al., 1998). These last responses involve a network of signal transduction and the rapid activation of gene expression (Yang et al., 1997). Protein kinases and phosphatases have an important role in plant signalling mechanisms. Evidence supporting the involvement of protein phosphorylation in defence mechanisms was provided by an analysis of changes in the phosphoprotein profiles upon the application of elicitors to cell‐suspension cultures (Dietrich et al., 1990; Felix et al., 1991; Viard et al., 1994). Later, several reports demonstrated the activation of protein kinases with characteristics of animal MAPK (mitogen‐activated protein kinase) in plant signalling pathways that lead to the activation of the defence response (Hirt, 1997; Ligterink et al., 1997; Zhang et al., 1998). In addition to protein phosphorylation, an increase in cytosolic calcium concentration has been observed in plant cells immediately after elicitation, suggesting that calcium also plays a pivotal role in the regulation of inducible‐defence responses (Dietrich et al., 1990; Xing et al., 1996). On the other hand, changes in calcium concentration can affect the activity of protein kinases directly or indirectly. In plants, the majority of calcium‐stimulated protein kinase activity is performed by members of the calcium‐dependent protein kinases (CDPKs) family (Roberts and Harmon, 1992). In the cell nucleus, terminal biochemical signals lead to the transcriptional activation of a variety of pathogen‐responsive genes (Rushton and Somssich, 1998). Activation and deactivation of transcription factors is an additional level at which protein phosphorylation plays an important role (Sessa and Martin, 2000). Several reports have shown that the DNA‐binding activities of various transcription factors involved in the activation of defence‐related genes are regulated by phosphorylation events (Després et al., 1995; Sessa et al., 1995; Dröge‐Laser et al., 1997). Co‐adaptors or co‐activators are a new class of transcription factors, capable of connecting general and gene‐specific transcription factors, allowing transcriptional activation to proceed (Roeder, 1991; Li et al., 1994; Guarente, 1995). MBF1 proteins have been identified as bridging molecules that fall under the category of transcriptional co‐activators (Takemaru et al. 1997, 1998; Kabe et al., 1999). Godoy et al. (2001) reported the cloning and expression analysis of a plant member of the MBF1 transcriptional co‐activator family, named StMBF1 (Solanum tubersoum multiprotein bridging factor 1). In mammalian and plant systems, the activity of some transcription machinery components is often regulated by phosphorylation/dephosphorylation events (Hill and Tresiman, 1995; Schwechheimer and Bevan, 1998). However, this type of post‐translational modification has not been associated with any member of the MBF1 family. This report presents the first evidence of phosphorylation of an MBF1 protein. It also shows that the level of phosphorylation of StMBF1 is enhanced in potato cell suspensions after being challenged with Phytophthora infestans elicitors. Characterization of StMBF1‐phosphorylating kinase activity indicates that a 57 kDa protein kinase acting in a calcium‐dependent manner, participates in the phosphorylation of StMBF1 protein. Materials and methods Biological material Phytophthora infestans race 0, obtained from INTA Balcarce, Argentina, was grown as described previously (Laxalt et al., 1996). The mycelia were harvested by filtration and washed with sterile distilled water. Hyphal‐wall components (HWC) were prepared according to Ayers et al. (1976). Cell suspension cultures of Solanum tuberosum L. cv. Spunta, established from calli, were maintained in liquid Murashige and Skoog’s medium containing 3 mg l–1 NAA, 0.2 mg l–1 kinetin and 30 g l–1 sucrose (Murashige and Skoog, 1962). The cultures were grown in a rotary shaker (120 rpm) at 25 °C in the dark for 12 d. The viability of the cell suspensions was determined by Evans blue staining. For elicitation, the cells were treated with 1 mg ml–1 of HWC. After the treatment, the cells were harvested by centrifugation, frozen in liquid nitrogen and stored at –80 °C until analysis. Isolation of protein extract To prepare cytosolic extracts, cells were homogenized in a mortar with liquid nitrogen and suspended in 1 vol. of extraction buffer (50 mM TRIS‐HCl pH 8.0, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 5 mM NaF, 1 mM Na3VO4, 20 mM β‐glycerol phosphate, 0.5 µg ml–1 pepstatin, and 0.5 µg ml–1 aprotinin). After centrifugation at 16 000 g, supernatants were transferred into clean tubes and stored at –20 °C. Plasmid construction and purification of StMBF1 recombinant proteins To produce Schistosoma japonicum gluthatione‐S‐transferase (GST)‐StMBF1 fusion protein and its deletion derivatives in Escherichia coli, different regions of StMBF1 were amplified by PCR using StMBF1 cDNA cloned in pBC SK+ (Stratagene) as a template. The following primer combinations were used: P1 (5′‐CCAGGATCCATGAGTGGAATATCGCAAGAC‐3′) and P2 (5′‐CCAGGAATTCTTTCTTTCCTCGAAGTTTCG‐3′) for the complete ORF of StMBF1, P3 (5′‐CCAGGGATCCATCGAAA CCGTTAAGAAGTC‐3′) and P2 for StMBF1 Δ1–38, P1 and P4 (5′‐CCAGGAATTCAATTGCCTTTCCCGACTCG‐3′) for StMBF1 Δ118–139, or P4 and P5 (5′‐CCAGGGATCCTTGTCTCATG AAAAGGTACC‐3′) for StMBF1 Δ1–70/Δ118–139. The PCR primers were designed to incorporate a BamHI site in the 5′ end and an EcoRI site at the 3′ end of the PCR product. The amplified DNA fragments were cloned into the BamHI and EcoRI sites of pGEX‐4T‐3 (Amersham Pharmacia Biotech). The resulting constructs were verified by sequencing. E. coli BL21 (DE3) cells bearing the pGEX‐StMBF1 constructs were grown at 37 °C overnight with shaking (170 rpm) in 2× YT medium (16 g l–1 tryptone, 10 g l–1 yeast extract, and 5 g l–1 NaCl) with 0.1 mg ml–1 ampicillin. The culture was diluted 100 times in fresh medium and the cells were grown under the same conditions until an Abs600=0.8 was reached. Expression of the fusion protein was induced by addition of 0.4 mM isopropyl‐1‐thio‐β‐d galactopyranoside (IPTG) followed by additional incubation at 25 °C for 3 h. The cells were harvested by centrifugation at 5000 g for 10 min and suspended in 0.5 vols of PBS (25 mM sodium phosphate buffer pH 7.2, 150 mM NaCl) containing 1 mM EDTA and 1 mM PMSF. After treatment with one freeze/thaw cycle and sonication, the lysates were clarified by centrifugation at 15 000 g for 15 min at 4 °C. GST fusion protein purification and thrombin digestion were performed according to the manufacturer’s instructions (Amersham Pharmacia Biotech). Antibody production Polyclonal antibodies against StMBF1 were raised according to Harlow and Lane (1988). The preimmune serum was collected 1 week before the first inoculation. The titre and specificity of the antiserum were tested against E. coli‐purified StMBF1 protein by Western blot analysis. Western blot analysis Ten µg of whole extracts from potato cell suspensions were separated in 15% (w/v) SDS‐PAGE and blotted onto nitrocellulose membranes. Blots were incubated overnight at room temperature with anti‐StMBF1 serum or the corresponding pre‐immune serum at a dilution of 1:5000 and developed using enhanced chemiluminescence detection system (ECL) according to the manufacturer’s procedure (Amersham Pharmacia Biotech). In vitro phosphorylation of recombinant StMBF1 Two µg of StMBF1or its truncated forms were incubated with 10 µg of potato cell extracts in 30 µl of kinase buffer (20 mM TRIS‐HCl pH 8.0, 10 mM MgCl2 and 10 mM β‐mercaptoethanol) supplemented with 5 µM ATP and 5 µCi (6000 Ci mmol–1, 150 mCi ml–1) of [γ‐32P] ATP. Reactions were incubated at 30 °C for 5 min. To stop the reaction, sample buffer (Laemmli, 1970) was added and the samples were boiled for 5 min. The proteins were subjected to SDS‐PAGE and stained with Coomassie Brillant Blue R 250 (Sigma). The gels were dried and analysed by autoradiography. For experiments with inhibitors, potato cell extracts were preincubated for 15 min with the following compounds: 5 mM EGTA, 500 µM chlorpromazine (CPZ), 200 µM trifluoperazine (TFP), 200 nM staurosporine, 100 µM 5,6‐dichloro‐1‐(β‐d‐ribofuranosyl) (DRB), 20 µg µl–1 heparin, and 1% (v/v) DMSO. To start the reaction, recombinant StMBF1 and [γ‐32P] ATP were added. DRB was purchased from ICN and all other inhibitors from Sigma Chemical Co. In vivo phosphorylation of StMBF1 Potato cell suspensions (1 ml) were incubated with 0.3 mCi ml–1 [32P] sodium phosphate (285.5 Ci mg–1, 5 mCi ml–1) for 2 h at room temperature and then elicited with 1 mg ml–1 HWC for 30 min. The cells were harvested by centrifugation at 1000 g, suspended in 500 µl of extraction buffer (50 mM TRIS‐HCl, pH 8.0, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 5 mM NaF, 1 mM Na3VO4, 20 mM β‐glycerol phosphate, 0.5% (w/v) SDS, 0.5 µg ml–1 pepstatin, and 0.5 µg ml–1 aprotinin) and boiled for 5 min. Then, the cells were homogenized in a mortar and the extract clarified by centrifugation at 16 000 g for 30 min at 4 °C. One hundred µl of the supernatants (200 µg of protein) were diluted 5‐fold with buffer A (12.5 mM sodium phosphate pH 7.2, 2 mM EDTA, 1.25% (v/v) Nonidet P‐40, 1.5% (w/v) sodium deoxycholate, 0.2 mM Na3VO4, 50 mM NaF, and 0.5 µg ml–1 aprotinin) and incubated overnight at 4 °C with anti‐StMBF1 serum or the corresponding preimmune serum (diluted 1:50). Forty µl of protein A‐sepharose (Sigma) were added and the mixture was further incubated for 2 h. The immunocomplexes were collected by centrifugation and washed sequentially with the following solutions: 1 ml of buffer B (10 mM TRIS‐HCl pH 7.4, 0.1% (w/v) SDS, 1% (w/v) sodium dexycholate, and 1% (v/v) Triton X‐100), 1 ml of buffer C (buffer B supplemented with 150 mM NaCl), again 1 ml of buffer B and finally 1 ml of TBS (10 mM TRIS‐HCl pH 7.4 and 150 mM NaCl). The immunocomplexes were resuspended in 40 µl of sample buffer, boiled for 5 min and analysed by SDS‐PAGE in 15% (w/v) polyacrylamide gel and autoradiography. In‐gel kinase assay Purified StMBF1 (0.1 mg ml–1) was included into the polymerization mixture of resolving 12% (w/v) polyacrylamide gels. Thirty µg of potato cells proteins were loaded in each lane of the gel. After electrophoresis, the gel was washed twice with buffer A (50 mM TRIS‐HCl pH 7.5, and 5 mM β‐mercaptoethanol) containing 20% (v/v) isopropyl alcohol, and then re‐equilibrated in buffer A at room temperature for 1 h. Proteins were denatured in 6 M guanidine hydrochloride in buffer A for 1 h. To renature proteins, the gel was incubated in buffer A containing 0.04% (v/v) Tween‐20 at 4 °C overnight with several changes. Then, the gel was incubated in kinase assay buffer (40 mM HEPES pH 7.5, 2 mM DTT, 20 mM MgCl2, 1 mM CaCl2) for 30 min. The phosphorylation reaction was performed in 10 ml of the kinase assay buffer containing 50 µM ATP and 100 µCi (6000 Ci mmol–1, 150 mCi ml–1) [γ32‐P] ATP at room temperature for 2 h. The gel was extensively washed with 5% (w/v) TCA and 1% (w/v) sodium pyrophosphate until non‐reacted radioactivity was removed. The gel was then dried and the signal detected by autoradiography. Protein determination Protein concentration was determined according to Bradford (1976), using BSA as a standard. Statistic analysis Autoradiograms were scanned on a Genius colour–page HR5 scanner and densitometric analyses were performed with the TN‐image Analysis Software 2.13 version. Data handling and statistic analysis were performed using Graph Pad Incorporated Software, version 2.0. Results In vitro and in vivo phosphorylation of StMBF1 are stimulated in potato cell suspensions by P. infestans elicitors The complete StMBF1 cDNA sequence is available in the GenBank database under the accession No. AAF81108 (Godoy et al., 2001). To identify conserved motifs in the amino acid sequence of StMBF1, a standard search against the PROSITE databases was performed. Several motifs probably involved in signalling were detected in StMBF1: four protein kinase C (PKC) phosphorylation sites (TVK, aa 41–43; SNR aa 49–51; TRK, aa 61–63; SGK, aa 114–116), two casein kinase II (CKII) phosphorylation sites (SGAE, aa 35–38; SKLE, aa 125–128), a cAMP‐and‐cGMP‐dependent protein kinase phosphorylation site (KKLT, aa 91–94), an N‐glycosylation site (NLSH, aa 70–73), and an N‐myristoylation site (GSNRAA, aa 48–53). Since some components of the transcriptional machinery are frequently modified by phosphorylation, an initial analysis to discover whether StMBF1 could be phosphorylated in vitro by potato protein extracts was performed. In order to test this, bacterial purified StMBF1 was used as an exogenous substrate in the presence of [γ‐32P] ATP and protein extracts from potato cell suspensions. As shown in Fig. 1A, lane 3, a band of 16 kDa, which corresponds to the appropriated electrophoretic mobility of StMBF1, was phosphorylated by potato cell extracts. By contrast, no signal was detected in that region when potato extracts were incubated without StMBF1 (Fig. 1A, lane 2). In addition, no 32P incorporation into StMBF1 was observed when the protein was incubated in the absence of potato extracts, indicating that StMBF1 is not autophosphorylated (Fig. 1A, lane 1). When potato extracts were incubated alone or with StMBF1 (Fig. 1A, lanes 2, 3), labelled proteins corresponding to approximately 35 and 45 kDa were observed. These bands might correspond to endogenous potato proteins that became phosphorylated under the experimental conditions. To investigate the possible post‐translational regulation of StMBF1 by phosphorylation in response to fungal elicitors, an in vitro phosphorylation assay was performed using StMBF1 protein and cytosolic potato proteins. These extracts were obtained from potato cells after challenging them with HWC derived from P. infestans as the elicitor source. An increase in the incorporation of radioactivity from [γ‐32P] ATP into StMBF1 was detected when it was incubated with the extracts elicited during 30 min with HWC (Fig. 1B, upper panel and Fig. 1C). Such increase was steady, maintained up to 60 min and then, at 120 min, decreased to the initial values (data not shown). Since no differences in the mass of StMBF1 used in each reaction were observed by Coomassie Blue staining (Fig. 1B, lower panel), the increase in the level of phosphorylation of StMBF1 after elicitor treatment is likely to reflect changes in some StMBF1‐phosphorylating kinase activity/ies present in cell extracts. To confirm whether StMBF1 was phosphorylated in potato cells, in vivo labelling was performed. Cell cultures were incubated with [32P] phosphate, homogenized and immunoprecipitated using anti‐StMBF1 or the corresponding preimmune serum. After the resolution of protein complexes by SDS‐PAGE, a polypeptide of approximately 16 kDa, which corresponded to the electrophoretic mobility of StMBF1, was detected by autoradiography (Fig. 2A, lanes 3, 4). By contrast, this polypeptide was not observed when preimmune serum was used, confirming the specificity of the immunoprecipitation (Fig. 2A, lanes 1, 2). When elicited cells were used, an increase by approximately 1.5‐fold in the incorporation of [32P] into immunoprecipitated StMBF1 compared with non‐treated cells was observed in two independent experiments. The autoradiographs were scanned and average densitometric values were 1.075±0.075 and 1.59±0.09 (in arbitrary units) for control and HCW‐treated cells, respectively (Fig. 2A, lanes 3, 4). Since Western blot analysis revealed no differences in StMBF1 protein levels between control and elicited potato cells (Fig. 2B), the higher incorporation of [32P] into StMBF1 detected in HWC‐treated cells might derive from the activation of some kinase activity/ies. Characterization of the StMBF1 phosphorylating activity In order to characterize the kinase activity/ies responsible for StMBF1 phosphorylation, in vitro phosphorylation assays were performed in the presence of different protein kinase inhibitors. Staurosporine is a general inhibitor of serine/threonine kinases. This compound was used at a concentration of 200 nM and partially inhibited (40% of inhibition) the incorporation of [32P] into StMBF1 (Fig. 3A, lane 5, B). At higher concentrations of staurosporine (2 µM) a similar inhibition effect was detected (data not shown). The effect of 500 µM DRB and 20 µg µl–1 heparin, both inhibitors of the casein kinase II (CKII) family, was also examined. Neither of them significantly modified the incorporation of [32P] into StMBF1 (Fig. 3A, lanes 6, 8, B) indicating that this protein kinase family might not be involved in StMBF1 phosphorylation. When the reaction was performed in the presence of 5 mM EGTA, [32P] incorporation into StMBF1 was inhibited by 90% (Fig. 3A, lane 2, B), showing that the kinase activity involved in StMBF1 phosphorylation required the presence of calcium in the medium. CDPK activity is strongly inhibited by the presence of the Ca2+‐chelator EGTA. Although calmodulin is not required for its activity, calmodulin antagonists inhibit CDPK family in a dose–response manner (Sopory and Munshi, 1998). Thus, the effect of two calmodulin antagonists, CPZ and TFP, on the StMBF1‐phosphorylating kinase activity was analysed. TFP and CPZ reduced the incorporation of [32P] into StMBF1 by approximately 40% and 30%, respectively (Fig. 3A, lanes 3, 4, B). These results revealed that StMBF1‐phosphorylating kinase activity was partially inhibited by calmodulin antagonists at the concentrations used in this assay. The molecular properties of the StMBF1‐phosphorylating activities were further characterized by an in‐gel kinase assay. For this purpose, purified StMBF1 was included in the matrix of an SDS‐PAGE gel. Extracts from control and elicited cells were separated in this gel, and the proteins were then renatured. Finally, the gel was incubated in a [γ‐32P] ATP‐containing buffer, washed and analysed by autoradiography. As shown in Fig. 4, a kinase activity band corresponding to an electrophoretic mobility of 57 kDa was detected. This protein was named p57. At the times analysed, the activity was higher in elicited than in non‐treated cells. By contrast, when StMBF1 was omitted in the SDS‐PAGE matrix, no detectable signal was observed (data not shown). This indicated that the 57 kDa activity band was derived from StMBF1 phosphorylation and not from autophosphorylation activity. When the reaction was performed in the presence of 1 mM CaCl2, p57 activity was detected (Fig. 4). However, when the assay was carried out in the absence of calcium, no StMBF1 kinase activity was observed (data not shown). This result agrees with that observed in Fig. 3 and supports the hypothesis that StMBF1 kinase activity is calcium‐dependent. StMBF1 is phosphorylated in the central region of the molecule To locate approximately which region of StMBF1 is phosphorylated by potato cell extracts, a small set of deleted proteins were tested. Various truncated polypeptides encompassing different regions of StMBF1 were expressed in E. coli and purified. In vitro phosphorylation assays were carried out in the presence of potato extracts, as described above. The deletion of 38 or 70 N‐terminal amino acids had no effect on [32P] incorporation into StMBF1 (Fig. 5, lanes 2, 4). The deletion of the 21 C‐terminal amino acids (aa 118–139) did not affect the phosphorylation of StMBF1 either (Fig. 5, lanes 3, 4). These results indicated that StMBF1 phosphorylation occurs in the central 71–118 amino acid region of the protein. It is important to point out that, according to the colorimetric assay, equal amount of purified proteins were loaded in each lane of several independent gels. However, as it is shown in Fig. 5B, the Coomassie Blue pattern did not reveal an equal amount of protein. Since, Coomassie Blue dye recognizes amino groups of basic amino acids, the sensitivity of each protein could be different and, consequently, they were differentially stained. In addition, for the N‐terminal deleted protein, StMBF1 Δ1–38 a wide and clear band was detected in several experiments (Fig. 5B, lane 2, asterisk). Discussion As far as is known, little has been reported about the role of plant coactivators during pathogen defence responses. Interestingly, two putative Arabidopsis transcriptional coactivators, KIWI and KELP, are believed to participate in gene activation during defence response and plant development (Cormack et al., 1998). Recently, Matsushita et al. (2002) reported that a member of the MBF1 transcriptional coactivator familiy, designed MIP24, interacts with the tomato mosaic virus movement protein (MP), raising the possibility that viral MPs could modulate host gene expression. The expression of StMBF1 during wounding and infection of potato tubers with F. eumartii has previously been characterized (Godoy et al., 2001). The putative phosphorylation sites found in the amino acid sequence of StMBF1 led us to investigate whether the protein is actually phosphorylated in potato cells. In vitro phosphorylation assays revealed that StMBF1 is phosphorylated by potato cell extracts. In addition, immunoprecipitation of StMBF1 showed in vivo [32P] incorporation, indicating that StMBF1 is a phosphoprotein. Treatment of potato cell suspensions with elicitors derived from P. infestans caused a reproducible increase of the radioactivity incorporated into StMBF1, as was revealed by both in vitro and in vivo phosphorylation assays (Figs 1B, 2B). A shift in the electrophoretic mobility of the induced phosphorylated StMBF1 protein was not observed, so it is suggested that the higher level of the phosphorylation signal is due to an increase in the amount of phosphorylated StMBF1 protein. However, taking into account that several putative phosphorylation sites are present in the StMBF1 sequence it is also possible that such increase was due to new phosphorylated sites. Dröge‐Laser et al. (1997) reported changes in the phosphorylation of G/HBF‐1in elicited cells by in vivo and in vitro assays, but there was no shift in the electrophoretic mobility. Unfortunately, the limited resolution of the gel was not sufficient to resolve phosphorylated proteins with very subtle changes in their molecular masses. All this evidence indicates that StMBF1 phosphorylation is positively regulated in potato cells in response to fungal elicitors and it might reflect changes in the activities of protein kinases and phosphatases within potato cells. In‐gel kinase assays using StMBF1 as the substrate allowed the identification of a 57 kDa polypeptide (p57), which was able to phosphorylate StMBF1 in the presence of calcium (Fig. 4). The activity of p57 was higher in elicited cells than in non‐treated cells, supporting the idea that StMBF1‐phosphorylating kinase activity is stimulated by elicitors. The StMBF1 phosphorylating activity detected at 0 time (Fig. 4) was not rigorously correlated with phosphorylation levels detected at this time by in vitro and in vivo assays (Figs 1B, 2A). However, it must be considered that only protein kinases that re‐nature after SDS‐PAGE remain active, and thus are detected by in‐gel kinase assays. In order to characterize the kinase activity/ies responsible for StMBF1 phosphorylation, different specific inhibitors were used in in vitro assays (Fig. 3). StMBF1 phosphorylation was strongly inhibited by the calcium‐chelator EGTA and partially inhibited by two calmodulin antagonists, CPZ and TFP. Since these calmodulin antagonist were used in the range of previously reported concentrations (Romeis et al., 2000; Chico et al., 2002) and considering that total protein extracts were used in the assays, it is possible that the partial inhibition reflects that more than one kinase acting in a calcium‐dependent manner, participate in StMBF1 phosphorylation. In addition, it has been reported (Polya and Micucci, 1985) that TFP variously inhibit plant CDPKs and, moreover, some of them are partially inhibited, even at high concentrations (400 µM to 1 mM) of TFP. The general serine/threonine kinase inhibitor staurosporine also partially inhibited phosphorylation of StMBF1. Interestingly, protein kinases showing different sensitivity to staurosporine in response to elicitors in potato cells have been reported (Katou et al., 1999). In conclusion, the results presented in Fig. 3 suggest that StMBF1 might be phosphorylated by a serine/threonine kinase that requires calcium for its activity, but other kinase/s may also be involved in StMBF1 phosphorylation. In mammals, PKC and calmodulin‐dependent protein kinase (CaMK) have been extensively characterized as calcium‐modulated (Sopory and Munshi, 1998). It has been postulated that the role of PKC in mammals might be fulfilled in plants by CDPKs (Roberts and Harmon, 1992). CDPKs have molecular masses that range between 52 kDa and 90 kDa, and a very conserved structure (Harmon et al., 2000). They are activated by micromolar concentrations of calcium and do not require calmodulin for their activation (Sopory and Munshi, 1998). CDPK isoforms were found in various subcellular locations including the cytosol, nucleus and plasma membrane (Roberts and Harmon, 1992; Schaller et al., 1992). In several species, it has been observed that CDPK activities are usually up‐regulated under stress conditions such as cold and wounding (Li and Komatsu, 2000; Chico et al., 2002). In addition, the participation of CDPKs in plant defence responses has been suggested (Rudd and Franklin‐Tong, 2001). Romeis et al. (2000) reported the activation of a CDPK in transgenic Cf9 tobacco cell cultures elicited with Avr9. In addition, the transcriptional activation of a maize CDPK in response to fungal elicitors has also been observed (Murillo et al., 2001). On the other hand, the specific substrates of this kinase family have been poorly characterized. Recently, it was reported that a two‐component pseudo‐response regulator, CPS1, is phosphorylated by a CDPK from Mesembryanthemum crystallinum (McCDPK1). Co‐transformation experiments showed that CPS1 and McCDPK1 co‐localized to the nuclei of NaCl‐stressed plants (Patharkar and Cushman, 2000). Several characteristics observed for StMBF1‐phosphorylating kinase activity suggest that a member that belongs to the superfamily of serine/threonine CDPKs might be implicated in StMBF1 phosphorylation. First, the kinase activity showed a strong inhibition by EGTA and a partial inhibition by calmodulin antagonists (Fig. 3). Second, the polypeptide (p57) detected by the in‐gel kinase assay, was able to phosphorylate StMBF1 only in the presence of calcium (Fig. 4). Third, the molecular mass (57 kDa) of StMBF1‐phosphorylating activity matches the range of molecular mass described for the CDPK family. Using deleted proteins it was possible to identify that phosphorylation occurs in the central region (aa 71–117) of StMBF1 (Fig. 5). Within this region, there are several serine and threonine residues that might be phosphorylated. This evidence supports the hypothesis that StMBF1 might be a substrate for a serine/threonine protein kinase in potato cells. Further experiments have to be performed to identify the residues that are modified by phosphorylation. In mammalian systems, as well as in plants, it is well documented that phosphorylation might control the activity of gene‐specific transcription factors by modulation of their cellular distribution or changes in protein–protein or DNA–protein interactions in which they are involved (Hill and Tresiman, 1995; Schwechheimer and Bevan, 1998). By contrast, no evidence of such regulation has been reported for members of the MBF1 co‐activator family. Interest is now focused on how phosphorylation affects the activity of StMBF1. It is possible to speculate that phosphorylation might induce changes in the subcellular distribution (between the cytosol and nucleus) of StMBF1 or affect its interaction with other components of the transcriptional machinery. Simultaneously, further investigations might also reveal the identity of the kinase responsible for StMBF1 phosphorylation. Acknowledgements We thank Dr MT Tellez‐Iñon for the help with the phosphorylation assays. The autohors thank Dr Liliana Busconi and Dr Verónica Beligni for their critical comments. This research was supported by grants from the IFS, Sweden (C2124), UNMDP, CONICET, ANPCyT, and Fundación Antorchas, Argentina. GRD is a member of CIC. CC is a member of CONICET, MEZ is a fellow of the same Institution. View largeDownload slide Fig. 1. In vitro phosphorylation of the E. coli‐purified StMBF1. (A) Two µg of E. coli‐purified StMBF1 were incubated alone (lane 1) or with 10 µg of potato cell extracts (lane 3) in the presence of [γ‐32P] ATP for 5 min at 30 °C. In lane 2, potato cell extracts were incubated alone. The arrow indicates the position of StMBF1. (B) Two µg of E. coli‐purified StMBF1 were incubated with 10 µg of extract from potato cells non‐treated and treated with HWC for 5, 10, 20, and 30 min as described in (A). After separation in 15% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. (C) The histogram represents the average of three independent densitometry measurements of different potato cells preparations. Error bars represent the SD. View largeDownload slide Fig. 1. In vitro phosphorylation of the E. coli‐purified StMBF1. (A) Two µg of E. coli‐purified StMBF1 were incubated alone (lane 1) or with 10 µg of potato cell extracts (lane 3) in the presence of [γ‐32P] ATP for 5 min at 30 °C. In lane 2, potato cell extracts were incubated alone. The arrow indicates the position of StMBF1. (B) Two µg of E. coli‐purified StMBF1 were incubated with 10 µg of extract from potato cells non‐treated and treated with HWC for 5, 10, 20, and 30 min as described in (A). After separation in 15% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. (C) The histogram represents the average of three independent densitometry measurements of different potato cells preparations. Error bars represent the SD. View largeDownload slide Fig. 2. (A) StMBF1 in vivo phosphorylation. Potato cell suspensions were incubated in the presence of [32P] sodium phosphate for 2 h and then treated (lanes 2, 4) or not (lanes 1, 3) with HWC for 30 min. Cells were homogenized and immunoprecipitated with anti‐StMBF1 serum or the corresponding preimmune serum. Immunoprecipitates were analysed by 15% (w/v) SDS‐PAGE and autoradiography. (B) Western blot analysis of StMBF1 in potato cells. Ten µg of proteins from potato cell suspensions non‐treated (lanes 1, 3) or treated with HWC for 30 min (lanes 2, 4) were separated in 15% (w/v) SDS‐PAGE, transferred onto nitrocellulose and incubated with polyclonal antibodies against StMBF1 or the corresponding preimmune serum. The blots were developed as described in Materials and methods. Similar results were obtained in at least two independent experiments. View largeDownload slide Fig. 2. (A) StMBF1 in vivo phosphorylation. Potato cell suspensions were incubated in the presence of [32P] sodium phosphate for 2 h and then treated (lanes 2, 4) or not (lanes 1, 3) with HWC for 30 min. Cells were homogenized and immunoprecipitated with anti‐StMBF1 serum or the corresponding preimmune serum. Immunoprecipitates were analysed by 15% (w/v) SDS‐PAGE and autoradiography. (B) Western blot analysis of StMBF1 in potato cells. Ten µg of proteins from potato cell suspensions non‐treated (lanes 1, 3) or treated with HWC for 30 min (lanes 2, 4) were separated in 15% (w/v) SDS‐PAGE, transferred onto nitrocellulose and incubated with polyclonal antibodies against StMBF1 or the corresponding preimmune serum. The blots were developed as described in Materials and methods. Similar results were obtained in at least two independent experiments. View largeDownload slide Fig. 3. Inhibition of StMBF1‐phosphorylating kinase activity. (A) Ten µg of extract from cells treated for 30 min with HWC were preincubated for 15 min in the presence of inhibitors as indicated. After an additional incubation with 2 µg of StMBF1 in the presence of [γ‐32P] ATP for 5 min at 30 °C, the samples were subjected to 15% (w/v) SDS‐PAGE and analysed by Coomassie Blue staining and autoradiography. (B) Densitometry quantification was performed. Error bars represent the SD. The effect of EGTA, staurosporine, DRB, and heparin was tested in six independent experiments and CPZ and TFP in two different experiments. View largeDownload slide Fig. 3. Inhibition of StMBF1‐phosphorylating kinase activity. (A) Ten µg of extract from cells treated for 30 min with HWC were preincubated for 15 min in the presence of inhibitors as indicated. After an additional incubation with 2 µg of StMBF1 in the presence of [γ‐32P] ATP for 5 min at 30 °C, the samples were subjected to 15% (w/v) SDS‐PAGE and analysed by Coomassie Blue staining and autoradiography. (B) Densitometry quantification was performed. Error bars represent the SD. The effect of EGTA, staurosporine, DRB, and heparin was tested in six independent experiments and CPZ and TFP in two different experiments. View largeDownload slide Fig. 4. Analysis of StMBF1‐phosphorylating activity. Purified StMBF1 was included in the polymerization mixture of 12% (w/v) SDS‐PAGE gels. Thirty µg of protein extract from non‐treated potato cells (lane 1) or treated with HWC for 10, 20 and 30 min (lanes 2, 3 and 4, respectively) were separated in the gel. After performing a re‐naturing procedure, the gel was incubated with a [γ‐32P] ATP‐containing buffer, washed and dried. The signal was detected by autoradiography. The arrow indicates the band corresponding to the 57 kDa protein (p57). View largeDownload slide Fig. 4. Analysis of StMBF1‐phosphorylating activity. Purified StMBF1 was included in the polymerization mixture of 12% (w/v) SDS‐PAGE gels. Thirty µg of protein extract from non‐treated potato cells (lane 1) or treated with HWC for 10, 20 and 30 min (lanes 2, 3 and 4, respectively) were separated in the gel. After performing a re‐naturing procedure, the gel was incubated with a [γ‐32P] ATP‐containing buffer, washed and dried. The signal was detected by autoradiography. The arrow indicates the band corresponding to the 57 kDa protein (p57). View largeDownload slide Fig. 5. Analysis of the region of StMBF1 phosphorylation. (A) Schematic representation of wild‐type and truncated StMBF1. (B) In vitro phosphorylation assays were conducted using E. coli‐purified wild type (lane 1) and truncated StMBF1: Δ1–38 (lane 2), StMBF1 Δ118–139 (lane 3) and StMBF1 Δ1–70/Δ118–139 (lane 3). Two µg of each protein were incubated with 10 µg of potato cell extracts in the presence of [γ‐32P] ATP for 5 min at 30 °C. After their separation in 18% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. Asterisks indicate the position of wild‐type and truncated StMBF1 proteins. Similar results were obtained in four independent experiments. View largeDownload slide Fig. 5. Analysis of the region of StMBF1 phosphorylation. (A) Schematic representation of wild‐type and truncated StMBF1. (B) In vitro phosphorylation assays were conducted using E. coli‐purified wild type (lane 1) and truncated StMBF1: Δ1–38 (lane 2), StMBF1 Δ118–139 (lane 3) and StMBF1 Δ1–70/Δ118–139 (lane 3). Two µg of each protein were incubated with 10 µg of potato cell extracts in the presence of [γ‐32P] ATP for 5 min at 30 °C. After their separation in 18% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. Asterisks indicate the position of wild‐type and truncated StMBF1 proteins. Similar results were obtained in four independent experiments. References AyersA, Ebel J, Valent B, Amersheim P. 1976. Host–pathogen interactions. Fractionation and biological activity of an elicitor isolated from the mycelial walls of Phytophthora megasperma var. sojae. Plant Physiology  57, 760–765. Google Scholar BradfordM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry  72, 248–254. Google Scholar BlumwaldE, Aharon G, Lam B. 1998. Early signal transduction pathways in plant–pathogen interactions. Trends in Plant Science  3, 342–346. Google Scholar ChicoJM, Raíces M, Tellez‐Iñón MT, Ulloa RM. 2002. A calcium‐dependent protein kinase is systemically induced upon wounding in tomato plants. Plant Physiology  128, 256–270. Google Scholar CormackRS, Hahlbrock K, Somssich IE. 1998. Isolation of a putative plant transcriptional coactivator using a modified two‐hybrid system incorporating a GFP reporter gene. The Plant Journal  14, 685–692. Google Scholar DesprésC, Subramaniam R, Matton D, Brisson N. 1995. The activation of the potato PR‐10a gene requires phosphorylation of the nuclear factor PBF‐1. The Plant Cell  7, 589–598. Google Scholar DietrichA, Mayers J, Hahlbrock K. 1990. Fungal elicitor triggers rapid, transient and specific protein phosphorylation in parsley cell suspension cultures. Journal of Biological Chemistry  265, 6360–6368. Google Scholar Dröge‐LaserW, Kaiser A, Linsday W, Halkier B, Loake G, Doerner P, Dixon R, Lamb C. 1997. Rapid stimulation of a soybean protein serine kinase which phosphorylates a novel bZIP DNA‐binding protein, G/HBF‐1, during the induction of early transcription‐dependent defences. EMBO Journal  16, 726–738. Google Scholar FelixG, Grosskopf DG, Regenass M, Boller T. 1991. Rapid changes of protein phosphorylation are involved in transduction of elicitor signal in plant cells. Proceedings of the National Academy of Sciences, USA  88, 8831–8834. Google Scholar GuarenteL. 1995. Transcriptional coactivators in yeast and beyond. Trends in Biochemical Science   20, 517–521. Google Scholar GodoyAV, Zanetti ME, San Segundo B, Casalongué C. 2001. Identification of a putative Solanum tuberosum transcriptional coactivator up‐regulated in potato tubers by Fusarium solani f. sp. eumartii infection and wounding. Physiologia Plantarum  112, 217–222. Google Scholar HarlowE, Lane D. 1988. Antibodies. A laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Google Scholar HarmonA, Gribskov M, Harper J. 2000. CDPKs—a kinase for every Ca2+ signal? Trends in Plant Science  5, 154–159. Google Scholar HillCS, Tresiman R. 1995. Transcriptional regulation by extracellular signals: mechanisms and specificity. Cell  80, 199–211. Google Scholar HirtH. 1997. Multiple roles of MAP kinases in plant signal transduction. Trends in Plant Science  2, 11–15. Google Scholar KabeY, Goto M, Shina D, Imai T, Wada T, Morohashi K‐I, Shirakawa M, Hirose S, HandaH. 1999. The role of human MBF1 as a transcriptional coactivator. Journal of Biological Chemistry  274, 34196–34202. Google Scholar KatouS, Senda K, Yoshioka H, Doke N, Kawakita K. 1999. A 51 kDa protein kinase of potato activated with hyphal wall components from Phytophthora infestans. Plant Cell Physiology  40, 825–831. Google Scholar KombrinkE, Somssich IE. 1995. Defence response of plant to pathogen. Advances in Botanical Research  21, 1–34. Google Scholar LaemmliU. 1970. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature  227, 680–685. Google Scholar LaxaltA, Cassia R, Sanllorenti P, Madrid E, Andreu A, Daleo G, Conde R, Lamattina L. 1996. Accumulation of cytosolic glyceraldehyde‐3‐phosphate dehydrogenase RNA under biological stress conditions and elicitor treatments in potato. Plant Molecular Biology  30, 961–972. Google Scholar LiFQ, Ueda H and Hirose S. 1994. Mediators of activation of fushi tarazu gene transcription by BmFTZ‐F1. Molecular and Cellular Biology  14, 3013–3021. Google Scholar LiWG, Komatsu S. 2000. Cold‐induced calcium‐dependent protein kinase(s) in rice (Oryza sativa L.) seedling stem tissue. Theoretical Applied Genetic   101, 355–363. Google Scholar LigterinkW, Kroj T, zur Nieden U, Hirt H, Scheel D. 1997. Receptor‐mediated activation of MAP kinase in pathogen defence in plants. Science  276, 2054–2057. Google Scholar MatsushitaY, Miyakawa O, Deguchi M, Nishiguchi M, Nyunoya H. 2002. Cloning of a tobacco cDNA coding for a putative transcriptional coactivator MBF1 that interacts with the tomato mosaic virus movement protein. Journal of Experimental Botany  53, 1531–1532. Google Scholar MurashigeT, Skoog F. 1962. A revised medium for rapid growth and bioassays with tobacco tissues cultures. Physiologia Plantarum  15, 473–497. Google Scholar MurilloI, Jaeck E, Cordero MJ, San Segundo B. 2001. Transcriptional activation of a maize calcium‐dependent protein kinase gene in respose to fungal elicitors and infection. Plant Molecular Biology  45, 145–158. Google Scholar PatharkarOR, Cushman JC. 2000. A stress‐induced calcium‐dependent protein kinase from Mesembryanthemum crystallinum phosphorylates a two‐component pseudo‐response regulator. The Plant Journal  24, 679–691. Google Scholar PolyaGM, Micucci V. 1985. Interaction of wheat germ Ca2+‐dependent protein kinases with calmodulin antagonists and polyamines. Plant Physiology  79, 968–972. Google Scholar RobertsMR, Harmon AC. 1992. Calcium‐modulated proteins: targets of intracellular calcium signals in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology  43, 375–414. Google Scholar RoederRG. 1991. The complexities of eukaryotic transcription initiation: regulation of preinitiation complex assembly. Trends in Biochemical Science   16, 402–408. Google Scholar RomeisT, Piedras P, Jones JDG. 2000. Resistance gene‐dependent activation of a calcium‐dependent protein kinase in the plant defence response. The Plant Cell  12, 803–815. Google Scholar RuddJJ, Franklin‐Tong VE. 2001. Unravelling response‐specificity in Ca2+ signalling pathways in plant cells. New Phytologist  151, 7–33. Google Scholar RushtonJ, Somssich E. 1998. Transcriptional control of plant genes responsive to pathogens. Current Opinion in Plant Biology  1, 311–315. Google Scholar SchallerEG, Harmon AC, Sussman MR. 1992. Characterization of a calcium and lipid‐dependent protein kinase associated with the plasma membrane of oat. Biochemistry  31, 1721–1727. Google Scholar SchwechheimerC, Bevan M. 1998. The regulation of transcription factor activity in plants. Trends in Plant Science  3, 378–383. Google Scholar SessaG, Martin G. 2000. Protein kinases in the plant defence response. Advances in Botanical Research  32, 379–404. Google Scholar SessaG, Meller Y, Fluhr R. 1995. A GCC element and G‐box motif participate in ethylene induced expression of the PRB‐1b gene. Plant Molecular Biology  28, 145–153. Google Scholar SomssichIE, Hahlbrock K. 1998. Pathogen defence in plants: a paradigm of biological complex. Trends in Plants Science  3, 86–90. Google Scholar SoporyS, Munshi M. 1998. Protein kinases and phosphatases and their role in cellular signalling in plants. Critical Reviews in Plant Sciences  17, 245–318. Google Scholar TakemaruK, Harashima S, Ueda H, Hirose S. 1997. Multiprotein bridging factor 1 (MBF1) is an evolutionarily conserved transcriptional coactivator that connects a regulatory factor and TATA element‐binding protein. Proceedings of the National Academy of Sciences, USA  94, 7251–7256. Google Scholar TakemaruK, Harashima S, Ueda H, Hirose S. 1998. Yeast coactivator MBF1 mediates GCN4‐dependent transcriptional activation. Molecular and Cellular Biology  18, 4971–4976. Google Scholar ViardMP, Martin F, Pugin A, Ricci P, Blein JP. 1994. Protein phsophrylation is induced in tobacco cells by the elicitor criptogein. Plant Physiology  104, 1245–1249. Google Scholar YangY, Shah J, Klessig D. 1997. Signal perception and transduction in plant defence responses. Genes and Development  11, 1621–1639. Google Scholar XingT, Higgins VJ, Blumwald E. 1996. Regulation of plant defence response to fungal pathogen: two types of protein kinases in the reversible phosphorylation of the host plasma membrane H+‐ATPase. The Plant Cell  8, 555–564. Google Scholar ZhangS, Du H, Klessig DF. 1998. Activation of tobacco SIP kinase by both a cell wall‐derived carbohydrate and a purified proteinaceos elicitins from Phytophthora spp. The Plant Cell  10, 435–449. Google Scholar http://www.deepdyve.com/assets/images/DeepDyve-Logo-lg.png Journal of Experimental Botany Oxford University Press

Phosphorylation of a member of the MBF1 transcriptional co‐activator family, StMBF1, is stimulated in potato cell suspensions upon fungal elicitor challenge

Download PDF
10 pages

Loading next page...
 
/lp/oxford-university-press/phosphorylation-of-a-member-of-the-mbf1-transcriptional-co-activator-eOOnTkHuN8

References (51)

Publisher
Oxford University Press
ISSN
0022-0957
eISSN
1460-2431
DOI
10.1093/jxb/erg061
Publisher site
See Article on Publisher Site

Abstract

Abstract StMBF1 (Solanum tuberosum multiprotein bridging factor 1) is a plant member of the MBF1 family of transcriptional co‐activators. Previously, it has been described as being up‐regulated at the transcrip tional level by fungal and abiotic stress. To understand whether StMBF1 is also regulated at the post‐translational level, in vitro as well as in vivo phosphorylation assays were performed. StMBF1 is phosphorylated under both experimental conditions and [32P] incorporation into StMBF1 increases after treatment of potato cells with hyphal cell wall components (HWC) derived from Phytophthora infestans. The StMBF1‐phosphorylating activity is strongly inhibited by the calcium‐chelator EGTA and partially inhibited by calmodulin antagonists. Using bacterial purified StMBF1 as a substrate, a 57 kDa calcium‐dependent protein kinase (p57) that is able to phosphorylate StMBF1 was detected. The StMBF1 kinase activity of p57 was higher in elicited than in non‐treated cells. The role of the elicitor‐dependent phosphorylation of StMBF1 is discussed. Key words: Calcium‐dependent protein kinase, cell suspensions, elicitor, multiprotein bridging factor 1, protein phosphorylation, Phytophthora infestans, Solanum tuberosum, transcriptional co‐activator. Received 13 June 2002; Accepted 24 September 2002 Introduction Higher plants have developed several elaborate mechanisms to ward off pathogen attack. Whereas some of these defence mechanisms already exist and provide physical and chemical barriers to hinder pathogen infection, others are induced after recognition of specific signal molecules called elicitors (Kombrink and Somssich, 1995; Somssich and Hahlbrock, 1998; Blumwald et al., 1998). These last responses involve a network of signal transduction and the rapid activation of gene expression (Yang et al., 1997). Protein kinases and phosphatases have an important role in plant signalling mechanisms. Evidence supporting the involvement of protein phosphorylation in defence mechanisms was provided by an analysis of changes in the phosphoprotein profiles upon the application of elicitors to cell‐suspension cultures (Dietrich et al., 1990; Felix et al., 1991; Viard et al., 1994). Later, several reports demonstrated the activation of protein kinases with characteristics of animal MAPK (mitogen‐activated protein kinase) in plant signalling pathways that lead to the activation of the defence response (Hirt, 1997; Ligterink et al., 1997; Zhang et al., 1998). In addition to protein phosphorylation, an increase in cytosolic calcium concentration has been observed in plant cells immediately after elicitation, suggesting that calcium also plays a pivotal role in the regulation of inducible‐defence responses (Dietrich et al., 1990; Xing et al., 1996). On the other hand, changes in calcium concentration can affect the activity of protein kinases directly or indirectly. In plants, the majority of calcium‐stimulated protein kinase activity is performed by members of the calcium‐dependent protein kinases (CDPKs) family (Roberts and Harmon, 1992). In the cell nucleus, terminal biochemical signals lead to the transcriptional activation of a variety of pathogen‐responsive genes (Rushton and Somssich, 1998). Activation and deactivation of transcription factors is an additional level at which protein phosphorylation plays an important role (Sessa and Martin, 2000). Several reports have shown that the DNA‐binding activities of various transcription factors involved in the activation of defence‐related genes are regulated by phosphorylation events (Després et al., 1995; Sessa et al., 1995; Dröge‐Laser et al., 1997). Co‐adaptors or co‐activators are a new class of transcription factors, capable of connecting general and gene‐specific transcription factors, allowing transcriptional activation to proceed (Roeder, 1991; Li et al., 1994; Guarente, 1995). MBF1 proteins have been identified as bridging molecules that fall under the category of transcriptional co‐activators (Takemaru et al. 1997, 1998; Kabe et al., 1999). Godoy et al. (2001) reported the cloning and expression analysis of a plant member of the MBF1 transcriptional co‐activator family, named StMBF1 (Solanum tubersoum multiprotein bridging factor 1). In mammalian and plant systems, the activity of some transcription machinery components is often regulated by phosphorylation/dephosphorylation events (Hill and Tresiman, 1995; Schwechheimer and Bevan, 1998). However, this type of post‐translational modification has not been associated with any member of the MBF1 family. This report presents the first evidence of phosphorylation of an MBF1 protein. It also shows that the level of phosphorylation of StMBF1 is enhanced in potato cell suspensions after being challenged with Phytophthora infestans elicitors. Characterization of StMBF1‐phosphorylating kinase activity indicates that a 57 kDa protein kinase acting in a calcium‐dependent manner, participates in the phosphorylation of StMBF1 protein. Materials and methods Biological material Phytophthora infestans race 0, obtained from INTA Balcarce, Argentina, was grown as described previously (Laxalt et al., 1996). The mycelia were harvested by filtration and washed with sterile distilled water. Hyphal‐wall components (HWC) were prepared according to Ayers et al. (1976). Cell suspension cultures of Solanum tuberosum L. cv. Spunta, established from calli, were maintained in liquid Murashige and Skoog’s medium containing 3 mg l–1 NAA, 0.2 mg l–1 kinetin and 30 g l–1 sucrose (Murashige and Skoog, 1962). The cultures were grown in a rotary shaker (120 rpm) at 25 °C in the dark for 12 d. The viability of the cell suspensions was determined by Evans blue staining. For elicitation, the cells were treated with 1 mg ml–1 of HWC. After the treatment, the cells were harvested by centrifugation, frozen in liquid nitrogen and stored at –80 °C until analysis. Isolation of protein extract To prepare cytosolic extracts, cells were homogenized in a mortar with liquid nitrogen and suspended in 1 vol. of extraction buffer (50 mM TRIS‐HCl pH 8.0, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 5 mM NaF, 1 mM Na3VO4, 20 mM β‐glycerol phosphate, 0.5 µg ml–1 pepstatin, and 0.5 µg ml–1 aprotinin). After centrifugation at 16 000 g, supernatants were transferred into clean tubes and stored at –20 °C. Plasmid construction and purification of StMBF1 recombinant proteins To produce Schistosoma japonicum gluthatione‐S‐transferase (GST)‐StMBF1 fusion protein and its deletion derivatives in Escherichia coli, different regions of StMBF1 were amplified by PCR using StMBF1 cDNA cloned in pBC SK+ (Stratagene) as a template. The following primer combinations were used: P1 (5′‐CCAGGATCCATGAGTGGAATATCGCAAGAC‐3′) and P2 (5′‐CCAGGAATTCTTTCTTTCCTCGAAGTTTCG‐3′) for the complete ORF of StMBF1, P3 (5′‐CCAGGGATCCATCGAAA CCGTTAAGAAGTC‐3′) and P2 for StMBF1 Δ1–38, P1 and P4 (5′‐CCAGGAATTCAATTGCCTTTCCCGACTCG‐3′) for StMBF1 Δ118–139, or P4 and P5 (5′‐CCAGGGATCCTTGTCTCATG AAAAGGTACC‐3′) for StMBF1 Δ1–70/Δ118–139. The PCR primers were designed to incorporate a BamHI site in the 5′ end and an EcoRI site at the 3′ end of the PCR product. The amplified DNA fragments were cloned into the BamHI and EcoRI sites of pGEX‐4T‐3 (Amersham Pharmacia Biotech). The resulting constructs were verified by sequencing. E. coli BL21 (DE3) cells bearing the pGEX‐StMBF1 constructs were grown at 37 °C overnight with shaking (170 rpm) in 2× YT medium (16 g l–1 tryptone, 10 g l–1 yeast extract, and 5 g l–1 NaCl) with 0.1 mg ml–1 ampicillin. The culture was diluted 100 times in fresh medium and the cells were grown under the same conditions until an Abs600=0.8 was reached. Expression of the fusion protein was induced by addition of 0.4 mM isopropyl‐1‐thio‐β‐d galactopyranoside (IPTG) followed by additional incubation at 25 °C for 3 h. The cells were harvested by centrifugation at 5000 g for 10 min and suspended in 0.5 vols of PBS (25 mM sodium phosphate buffer pH 7.2, 150 mM NaCl) containing 1 mM EDTA and 1 mM PMSF. After treatment with one freeze/thaw cycle and sonication, the lysates were clarified by centrifugation at 15 000 g for 15 min at 4 °C. GST fusion protein purification and thrombin digestion were performed according to the manufacturer’s instructions (Amersham Pharmacia Biotech). Antibody production Polyclonal antibodies against StMBF1 were raised according to Harlow and Lane (1988). The preimmune serum was collected 1 week before the first inoculation. The titre and specificity of the antiserum were tested against E. coli‐purified StMBF1 protein by Western blot analysis. Western blot analysis Ten µg of whole extracts from potato cell suspensions were separated in 15% (w/v) SDS‐PAGE and blotted onto nitrocellulose membranes. Blots were incubated overnight at room temperature with anti‐StMBF1 serum or the corresponding pre‐immune serum at a dilution of 1:5000 and developed using enhanced chemiluminescence detection system (ECL) according to the manufacturer’s procedure (Amersham Pharmacia Biotech). In vitro phosphorylation of recombinant StMBF1 Two µg of StMBF1or its truncated forms were incubated with 10 µg of potato cell extracts in 30 µl of kinase buffer (20 mM TRIS‐HCl pH 8.0, 10 mM MgCl2 and 10 mM β‐mercaptoethanol) supplemented with 5 µM ATP and 5 µCi (6000 Ci mmol–1, 150 mCi ml–1) of [γ‐32P] ATP. Reactions were incubated at 30 °C for 5 min. To stop the reaction, sample buffer (Laemmli, 1970) was added and the samples were boiled for 5 min. The proteins were subjected to SDS‐PAGE and stained with Coomassie Brillant Blue R 250 (Sigma). The gels were dried and analysed by autoradiography. For experiments with inhibitors, potato cell extracts were preincubated for 15 min with the following compounds: 5 mM EGTA, 500 µM chlorpromazine (CPZ), 200 µM trifluoperazine (TFP), 200 nM staurosporine, 100 µM 5,6‐dichloro‐1‐(β‐d‐ribofuranosyl) (DRB), 20 µg µl–1 heparin, and 1% (v/v) DMSO. To start the reaction, recombinant StMBF1 and [γ‐32P] ATP were added. DRB was purchased from ICN and all other inhibitors from Sigma Chemical Co. In vivo phosphorylation of StMBF1 Potato cell suspensions (1 ml) were incubated with 0.3 mCi ml–1 [32P] sodium phosphate (285.5 Ci mg–1, 5 mCi ml–1) for 2 h at room temperature and then elicited with 1 mg ml–1 HWC for 30 min. The cells were harvested by centrifugation at 1000 g, suspended in 500 µl of extraction buffer (50 mM TRIS‐HCl, pH 8.0, 0.1 mM EDTA, 0.1 mM EGTA, 2 mM DTT, 5 mM NaF, 1 mM Na3VO4, 20 mM β‐glycerol phosphate, 0.5% (w/v) SDS, 0.5 µg ml–1 pepstatin, and 0.5 µg ml–1 aprotinin) and boiled for 5 min. Then, the cells were homogenized in a mortar and the extract clarified by centrifugation at 16 000 g for 30 min at 4 °C. One hundred µl of the supernatants (200 µg of protein) were diluted 5‐fold with buffer A (12.5 mM sodium phosphate pH 7.2, 2 mM EDTA, 1.25% (v/v) Nonidet P‐40, 1.5% (w/v) sodium deoxycholate, 0.2 mM Na3VO4, 50 mM NaF, and 0.5 µg ml–1 aprotinin) and incubated overnight at 4 °C with anti‐StMBF1 serum or the corresponding preimmune serum (diluted 1:50). Forty µl of protein A‐sepharose (Sigma) were added and the mixture was further incubated for 2 h. The immunocomplexes were collected by centrifugation and washed sequentially with the following solutions: 1 ml of buffer B (10 mM TRIS‐HCl pH 7.4, 0.1% (w/v) SDS, 1% (w/v) sodium dexycholate, and 1% (v/v) Triton X‐100), 1 ml of buffer C (buffer B supplemented with 150 mM NaCl), again 1 ml of buffer B and finally 1 ml of TBS (10 mM TRIS‐HCl pH 7.4 and 150 mM NaCl). The immunocomplexes were resuspended in 40 µl of sample buffer, boiled for 5 min and analysed by SDS‐PAGE in 15% (w/v) polyacrylamide gel and autoradiography. In‐gel kinase assay Purified StMBF1 (0.1 mg ml–1) was included into the polymerization mixture of resolving 12% (w/v) polyacrylamide gels. Thirty µg of potato cells proteins were loaded in each lane of the gel. After electrophoresis, the gel was washed twice with buffer A (50 mM TRIS‐HCl pH 7.5, and 5 mM β‐mercaptoethanol) containing 20% (v/v) isopropyl alcohol, and then re‐equilibrated in buffer A at room temperature for 1 h. Proteins were denatured in 6 M guanidine hydrochloride in buffer A for 1 h. To renature proteins, the gel was incubated in buffer A containing 0.04% (v/v) Tween‐20 at 4 °C overnight with several changes. Then, the gel was incubated in kinase assay buffer (40 mM HEPES pH 7.5, 2 mM DTT, 20 mM MgCl2, 1 mM CaCl2) for 30 min. The phosphorylation reaction was performed in 10 ml of the kinase assay buffer containing 50 µM ATP and 100 µCi (6000 Ci mmol–1, 150 mCi ml–1) [γ32‐P] ATP at room temperature for 2 h. The gel was extensively washed with 5% (w/v) TCA and 1% (w/v) sodium pyrophosphate until non‐reacted radioactivity was removed. The gel was then dried and the signal detected by autoradiography. Protein determination Protein concentration was determined according to Bradford (1976), using BSA as a standard. Statistic analysis Autoradiograms were scanned on a Genius colour–page HR5 scanner and densitometric analyses were performed with the TN‐image Analysis Software 2.13 version. Data handling and statistic analysis were performed using Graph Pad Incorporated Software, version 2.0. Results In vitro and in vivo phosphorylation of StMBF1 are stimulated in potato cell suspensions by P. infestans elicitors The complete StMBF1 cDNA sequence is available in the GenBank database under the accession No. AAF81108 (Godoy et al., 2001). To identify conserved motifs in the amino acid sequence of StMBF1, a standard search against the PROSITE databases was performed. Several motifs probably involved in signalling were detected in StMBF1: four protein kinase C (PKC) phosphorylation sites (TVK, aa 41–43; SNR aa 49–51; TRK, aa 61–63; SGK, aa 114–116), two casein kinase II (CKII) phosphorylation sites (SGAE, aa 35–38; SKLE, aa 125–128), a cAMP‐and‐cGMP‐dependent protein kinase phosphorylation site (KKLT, aa 91–94), an N‐glycosylation site (NLSH, aa 70–73), and an N‐myristoylation site (GSNRAA, aa 48–53). Since some components of the transcriptional machinery are frequently modified by phosphorylation, an initial analysis to discover whether StMBF1 could be phosphorylated in vitro by potato protein extracts was performed. In order to test this, bacterial purified StMBF1 was used as an exogenous substrate in the presence of [γ‐32P] ATP and protein extracts from potato cell suspensions. As shown in Fig. 1A, lane 3, a band of 16 kDa, which corresponds to the appropriated electrophoretic mobility of StMBF1, was phosphorylated by potato cell extracts. By contrast, no signal was detected in that region when potato extracts were incubated without StMBF1 (Fig. 1A, lane 2). In addition, no 32P incorporation into StMBF1 was observed when the protein was incubated in the absence of potato extracts, indicating that StMBF1 is not autophosphorylated (Fig. 1A, lane 1). When potato extracts were incubated alone or with StMBF1 (Fig. 1A, lanes 2, 3), labelled proteins corresponding to approximately 35 and 45 kDa were observed. These bands might correspond to endogenous potato proteins that became phosphorylated under the experimental conditions. To investigate the possible post‐translational regulation of StMBF1 by phosphorylation in response to fungal elicitors, an in vitro phosphorylation assay was performed using StMBF1 protein and cytosolic potato proteins. These extracts were obtained from potato cells after challenging them with HWC derived from P. infestans as the elicitor source. An increase in the incorporation of radioactivity from [γ‐32P] ATP into StMBF1 was detected when it was incubated with the extracts elicited during 30 min with HWC (Fig. 1B, upper panel and Fig. 1C). Such increase was steady, maintained up to 60 min and then, at 120 min, decreased to the initial values (data not shown). Since no differences in the mass of StMBF1 used in each reaction were observed by Coomassie Blue staining (Fig. 1B, lower panel), the increase in the level of phosphorylation of StMBF1 after elicitor treatment is likely to reflect changes in some StMBF1‐phosphorylating kinase activity/ies present in cell extracts. To confirm whether StMBF1 was phosphorylated in potato cells, in vivo labelling was performed. Cell cultures were incubated with [32P] phosphate, homogenized and immunoprecipitated using anti‐StMBF1 or the corresponding preimmune serum. After the resolution of protein complexes by SDS‐PAGE, a polypeptide of approximately 16 kDa, which corresponded to the electrophoretic mobility of StMBF1, was detected by autoradiography (Fig. 2A, lanes 3, 4). By contrast, this polypeptide was not observed when preimmune serum was used, confirming the specificity of the immunoprecipitation (Fig. 2A, lanes 1, 2). When elicited cells were used, an increase by approximately 1.5‐fold in the incorporation of [32P] into immunoprecipitated StMBF1 compared with non‐treated cells was observed in two independent experiments. The autoradiographs were scanned and average densitometric values were 1.075±0.075 and 1.59±0.09 (in arbitrary units) for control and HCW‐treated cells, respectively (Fig. 2A, lanes 3, 4). Since Western blot analysis revealed no differences in StMBF1 protein levels between control and elicited potato cells (Fig. 2B), the higher incorporation of [32P] into StMBF1 detected in HWC‐treated cells might derive from the activation of some kinase activity/ies. Characterization of the StMBF1 phosphorylating activity In order to characterize the kinase activity/ies responsible for StMBF1 phosphorylation, in vitro phosphorylation assays were performed in the presence of different protein kinase inhibitors. Staurosporine is a general inhibitor of serine/threonine kinases. This compound was used at a concentration of 200 nM and partially inhibited (40% of inhibition) the incorporation of [32P] into StMBF1 (Fig. 3A, lane 5, B). At higher concentrations of staurosporine (2 µM) a similar inhibition effect was detected (data not shown). The effect of 500 µM DRB and 20 µg µl–1 heparin, both inhibitors of the casein kinase II (CKII) family, was also examined. Neither of them significantly modified the incorporation of [32P] into StMBF1 (Fig. 3A, lanes 6, 8, B) indicating that this protein kinase family might not be involved in StMBF1 phosphorylation. When the reaction was performed in the presence of 5 mM EGTA, [32P] incorporation into StMBF1 was inhibited by 90% (Fig. 3A, lane 2, B), showing that the kinase activity involved in StMBF1 phosphorylation required the presence of calcium in the medium. CDPK activity is strongly inhibited by the presence of the Ca2+‐chelator EGTA. Although calmodulin is not required for its activity, calmodulin antagonists inhibit CDPK family in a dose–response manner (Sopory and Munshi, 1998). Thus, the effect of two calmodulin antagonists, CPZ and TFP, on the StMBF1‐phosphorylating kinase activity was analysed. TFP and CPZ reduced the incorporation of [32P] into StMBF1 by approximately 40% and 30%, respectively (Fig. 3A, lanes 3, 4, B). These results revealed that StMBF1‐phosphorylating kinase activity was partially inhibited by calmodulin antagonists at the concentrations used in this assay. The molecular properties of the StMBF1‐phosphorylating activities were further characterized by an in‐gel kinase assay. For this purpose, purified StMBF1 was included in the matrix of an SDS‐PAGE gel. Extracts from control and elicited cells were separated in this gel, and the proteins were then renatured. Finally, the gel was incubated in a [γ‐32P] ATP‐containing buffer, washed and analysed by autoradiography. As shown in Fig. 4, a kinase activity band corresponding to an electrophoretic mobility of 57 kDa was detected. This protein was named p57. At the times analysed, the activity was higher in elicited than in non‐treated cells. By contrast, when StMBF1 was omitted in the SDS‐PAGE matrix, no detectable signal was observed (data not shown). This indicated that the 57 kDa activity band was derived from StMBF1 phosphorylation and not from autophosphorylation activity. When the reaction was performed in the presence of 1 mM CaCl2, p57 activity was detected (Fig. 4). However, when the assay was carried out in the absence of calcium, no StMBF1 kinase activity was observed (data not shown). This result agrees with that observed in Fig. 3 and supports the hypothesis that StMBF1 kinase activity is calcium‐dependent. StMBF1 is phosphorylated in the central region of the molecule To locate approximately which region of StMBF1 is phosphorylated by potato cell extracts, a small set of deleted proteins were tested. Various truncated polypeptides encompassing different regions of StMBF1 were expressed in E. coli and purified. In vitro phosphorylation assays were carried out in the presence of potato extracts, as described above. The deletion of 38 or 70 N‐terminal amino acids had no effect on [32P] incorporation into StMBF1 (Fig. 5, lanes 2, 4). The deletion of the 21 C‐terminal amino acids (aa 118–139) did not affect the phosphorylation of StMBF1 either (Fig. 5, lanes 3, 4). These results indicated that StMBF1 phosphorylation occurs in the central 71–118 amino acid region of the protein. It is important to point out that, according to the colorimetric assay, equal amount of purified proteins were loaded in each lane of several independent gels. However, as it is shown in Fig. 5B, the Coomassie Blue pattern did not reveal an equal amount of protein. Since, Coomassie Blue dye recognizes amino groups of basic amino acids, the sensitivity of each protein could be different and, consequently, they were differentially stained. In addition, for the N‐terminal deleted protein, StMBF1 Δ1–38 a wide and clear band was detected in several experiments (Fig. 5B, lane 2, asterisk). Discussion As far as is known, little has been reported about the role of plant coactivators during pathogen defence responses. Interestingly, two putative Arabidopsis transcriptional coactivators, KIWI and KELP, are believed to participate in gene activation during defence response and plant development (Cormack et al., 1998). Recently, Matsushita et al. (2002) reported that a member of the MBF1 transcriptional coactivator familiy, designed MIP24, interacts with the tomato mosaic virus movement protein (MP), raising the possibility that viral MPs could modulate host gene expression. The expression of StMBF1 during wounding and infection of potato tubers with F. eumartii has previously been characterized (Godoy et al., 2001). The putative phosphorylation sites found in the amino acid sequence of StMBF1 led us to investigate whether the protein is actually phosphorylated in potato cells. In vitro phosphorylation assays revealed that StMBF1 is phosphorylated by potato cell extracts. In addition, immunoprecipitation of StMBF1 showed in vivo [32P] incorporation, indicating that StMBF1 is a phosphoprotein. Treatment of potato cell suspensions with elicitors derived from P. infestans caused a reproducible increase of the radioactivity incorporated into StMBF1, as was revealed by both in vitro and in vivo phosphorylation assays (Figs 1B, 2B). A shift in the electrophoretic mobility of the induced phosphorylated StMBF1 protein was not observed, so it is suggested that the higher level of the phosphorylation signal is due to an increase in the amount of phosphorylated StMBF1 protein. However, taking into account that several putative phosphorylation sites are present in the StMBF1 sequence it is also possible that such increase was due to new phosphorylated sites. Dröge‐Laser et al. (1997) reported changes in the phosphorylation of G/HBF‐1in elicited cells by in vivo and in vitro assays, but there was no shift in the electrophoretic mobility. Unfortunately, the limited resolution of the gel was not sufficient to resolve phosphorylated proteins with very subtle changes in their molecular masses. All this evidence indicates that StMBF1 phosphorylation is positively regulated in potato cells in response to fungal elicitors and it might reflect changes in the activities of protein kinases and phosphatases within potato cells. In‐gel kinase assays using StMBF1 as the substrate allowed the identification of a 57 kDa polypeptide (p57), which was able to phosphorylate StMBF1 in the presence of calcium (Fig. 4). The activity of p57 was higher in elicited cells than in non‐treated cells, supporting the idea that StMBF1‐phosphorylating kinase activity is stimulated by elicitors. The StMBF1 phosphorylating activity detected at 0 time (Fig. 4) was not rigorously correlated with phosphorylation levels detected at this time by in vitro and in vivo assays (Figs 1B, 2A). However, it must be considered that only protein kinases that re‐nature after SDS‐PAGE remain active, and thus are detected by in‐gel kinase assays. In order to characterize the kinase activity/ies responsible for StMBF1 phosphorylation, different specific inhibitors were used in in vitro assays (Fig. 3). StMBF1 phosphorylation was strongly inhibited by the calcium‐chelator EGTA and partially inhibited by two calmodulin antagonists, CPZ and TFP. Since these calmodulin antagonist were used in the range of previously reported concentrations (Romeis et al., 2000; Chico et al., 2002) and considering that total protein extracts were used in the assays, it is possible that the partial inhibition reflects that more than one kinase acting in a calcium‐dependent manner, participate in StMBF1 phosphorylation. In addition, it has been reported (Polya and Micucci, 1985) that TFP variously inhibit plant CDPKs and, moreover, some of them are partially inhibited, even at high concentrations (400 µM to 1 mM) of TFP. The general serine/threonine kinase inhibitor staurosporine also partially inhibited phosphorylation of StMBF1. Interestingly, protein kinases showing different sensitivity to staurosporine in response to elicitors in potato cells have been reported (Katou et al., 1999). In conclusion, the results presented in Fig. 3 suggest that StMBF1 might be phosphorylated by a serine/threonine kinase that requires calcium for its activity, but other kinase/s may also be involved in StMBF1 phosphorylation. In mammals, PKC and calmodulin‐dependent protein kinase (CaMK) have been extensively characterized as calcium‐modulated (Sopory and Munshi, 1998). It has been postulated that the role of PKC in mammals might be fulfilled in plants by CDPKs (Roberts and Harmon, 1992). CDPKs have molecular masses that range between 52 kDa and 90 kDa, and a very conserved structure (Harmon et al., 2000). They are activated by micromolar concentrations of calcium and do not require calmodulin for their activation (Sopory and Munshi, 1998). CDPK isoforms were found in various subcellular locations including the cytosol, nucleus and plasma membrane (Roberts and Harmon, 1992; Schaller et al., 1992). In several species, it has been observed that CDPK activities are usually up‐regulated under stress conditions such as cold and wounding (Li and Komatsu, 2000; Chico et al., 2002). In addition, the participation of CDPKs in plant defence responses has been suggested (Rudd and Franklin‐Tong, 2001). Romeis et al. (2000) reported the activation of a CDPK in transgenic Cf9 tobacco cell cultures elicited with Avr9. In addition, the transcriptional activation of a maize CDPK in response to fungal elicitors has also been observed (Murillo et al., 2001). On the other hand, the specific substrates of this kinase family have been poorly characterized. Recently, it was reported that a two‐component pseudo‐response regulator, CPS1, is phosphorylated by a CDPK from Mesembryanthemum crystallinum (McCDPK1). Co‐transformation experiments showed that CPS1 and McCDPK1 co‐localized to the nuclei of NaCl‐stressed plants (Patharkar and Cushman, 2000). Several characteristics observed for StMBF1‐phosphorylating kinase activity suggest that a member that belongs to the superfamily of serine/threonine CDPKs might be implicated in StMBF1 phosphorylation. First, the kinase activity showed a strong inhibition by EGTA and a partial inhibition by calmodulin antagonists (Fig. 3). Second, the polypeptide (p57) detected by the in‐gel kinase assay, was able to phosphorylate StMBF1 only in the presence of calcium (Fig. 4). Third, the molecular mass (57 kDa) of StMBF1‐phosphorylating activity matches the range of molecular mass described for the CDPK family. Using deleted proteins it was possible to identify that phosphorylation occurs in the central region (aa 71–117) of StMBF1 (Fig. 5). Within this region, there are several serine and threonine residues that might be phosphorylated. This evidence supports the hypothesis that StMBF1 might be a substrate for a serine/threonine protein kinase in potato cells. Further experiments have to be performed to identify the residues that are modified by phosphorylation. In mammalian systems, as well as in plants, it is well documented that phosphorylation might control the activity of gene‐specific transcription factors by modulation of their cellular distribution or changes in protein–protein or DNA–protein interactions in which they are involved (Hill and Tresiman, 1995; Schwechheimer and Bevan, 1998). By contrast, no evidence of such regulation has been reported for members of the MBF1 co‐activator family. Interest is now focused on how phosphorylation affects the activity of StMBF1. It is possible to speculate that phosphorylation might induce changes in the subcellular distribution (between the cytosol and nucleus) of StMBF1 or affect its interaction with other components of the transcriptional machinery. Simultaneously, further investigations might also reveal the identity of the kinase responsible for StMBF1 phosphorylation. Acknowledgements We thank Dr MT Tellez‐Iñon for the help with the phosphorylation assays. The autohors thank Dr Liliana Busconi and Dr Verónica Beligni for their critical comments. This research was supported by grants from the IFS, Sweden (C2124), UNMDP, CONICET, ANPCyT, and Fundación Antorchas, Argentina. GRD is a member of CIC. CC is a member of CONICET, MEZ is a fellow of the same Institution. View largeDownload slide Fig. 1. In vitro phosphorylation of the E. coli‐purified StMBF1. (A) Two µg of E. coli‐purified StMBF1 were incubated alone (lane 1) or with 10 µg of potato cell extracts (lane 3) in the presence of [γ‐32P] ATP for 5 min at 30 °C. In lane 2, potato cell extracts were incubated alone. The arrow indicates the position of StMBF1. (B) Two µg of E. coli‐purified StMBF1 were incubated with 10 µg of extract from potato cells non‐treated and treated with HWC for 5, 10, 20, and 30 min as described in (A). After separation in 15% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. (C) The histogram represents the average of three independent densitometry measurements of different potato cells preparations. Error bars represent the SD. View largeDownload slide Fig. 1. In vitro phosphorylation of the E. coli‐purified StMBF1. (A) Two µg of E. coli‐purified StMBF1 were incubated alone (lane 1) or with 10 µg of potato cell extracts (lane 3) in the presence of [γ‐32P] ATP for 5 min at 30 °C. In lane 2, potato cell extracts were incubated alone. The arrow indicates the position of StMBF1. (B) Two µg of E. coli‐purified StMBF1 were incubated with 10 µg of extract from potato cells non‐treated and treated with HWC for 5, 10, 20, and 30 min as described in (A). After separation in 15% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. (C) The histogram represents the average of three independent densitometry measurements of different potato cells preparations. Error bars represent the SD. View largeDownload slide Fig. 2. (A) StMBF1 in vivo phosphorylation. Potato cell suspensions were incubated in the presence of [32P] sodium phosphate for 2 h and then treated (lanes 2, 4) or not (lanes 1, 3) with HWC for 30 min. Cells were homogenized and immunoprecipitated with anti‐StMBF1 serum or the corresponding preimmune serum. Immunoprecipitates were analysed by 15% (w/v) SDS‐PAGE and autoradiography. (B) Western blot analysis of StMBF1 in potato cells. Ten µg of proteins from potato cell suspensions non‐treated (lanes 1, 3) or treated with HWC for 30 min (lanes 2, 4) were separated in 15% (w/v) SDS‐PAGE, transferred onto nitrocellulose and incubated with polyclonal antibodies against StMBF1 or the corresponding preimmune serum. The blots were developed as described in Materials and methods. Similar results were obtained in at least two independent experiments. View largeDownload slide Fig. 2. (A) StMBF1 in vivo phosphorylation. Potato cell suspensions were incubated in the presence of [32P] sodium phosphate for 2 h and then treated (lanes 2, 4) or not (lanes 1, 3) with HWC for 30 min. Cells were homogenized and immunoprecipitated with anti‐StMBF1 serum or the corresponding preimmune serum. Immunoprecipitates were analysed by 15% (w/v) SDS‐PAGE and autoradiography. (B) Western blot analysis of StMBF1 in potato cells. Ten µg of proteins from potato cell suspensions non‐treated (lanes 1, 3) or treated with HWC for 30 min (lanes 2, 4) were separated in 15% (w/v) SDS‐PAGE, transferred onto nitrocellulose and incubated with polyclonal antibodies against StMBF1 or the corresponding preimmune serum. The blots were developed as described in Materials and methods. Similar results were obtained in at least two independent experiments. View largeDownload slide Fig. 3. Inhibition of StMBF1‐phosphorylating kinase activity. (A) Ten µg of extract from cells treated for 30 min with HWC were preincubated for 15 min in the presence of inhibitors as indicated. After an additional incubation with 2 µg of StMBF1 in the presence of [γ‐32P] ATP for 5 min at 30 °C, the samples were subjected to 15% (w/v) SDS‐PAGE and analysed by Coomassie Blue staining and autoradiography. (B) Densitometry quantification was performed. Error bars represent the SD. The effect of EGTA, staurosporine, DRB, and heparin was tested in six independent experiments and CPZ and TFP in two different experiments. View largeDownload slide Fig. 3. Inhibition of StMBF1‐phosphorylating kinase activity. (A) Ten µg of extract from cells treated for 30 min with HWC were preincubated for 15 min in the presence of inhibitors as indicated. After an additional incubation with 2 µg of StMBF1 in the presence of [γ‐32P] ATP for 5 min at 30 °C, the samples were subjected to 15% (w/v) SDS‐PAGE and analysed by Coomassie Blue staining and autoradiography. (B) Densitometry quantification was performed. Error bars represent the SD. The effect of EGTA, staurosporine, DRB, and heparin was tested in six independent experiments and CPZ and TFP in two different experiments. View largeDownload slide Fig. 4. Analysis of StMBF1‐phosphorylating activity. Purified StMBF1 was included in the polymerization mixture of 12% (w/v) SDS‐PAGE gels. Thirty µg of protein extract from non‐treated potato cells (lane 1) or treated with HWC for 10, 20 and 30 min (lanes 2, 3 and 4, respectively) were separated in the gel. After performing a re‐naturing procedure, the gel was incubated with a [γ‐32P] ATP‐containing buffer, washed and dried. The signal was detected by autoradiography. The arrow indicates the band corresponding to the 57 kDa protein (p57). View largeDownload slide Fig. 4. Analysis of StMBF1‐phosphorylating activity. Purified StMBF1 was included in the polymerization mixture of 12% (w/v) SDS‐PAGE gels. Thirty µg of protein extract from non‐treated potato cells (lane 1) or treated with HWC for 10, 20 and 30 min (lanes 2, 3 and 4, respectively) were separated in the gel. After performing a re‐naturing procedure, the gel was incubated with a [γ‐32P] ATP‐containing buffer, washed and dried. The signal was detected by autoradiography. The arrow indicates the band corresponding to the 57 kDa protein (p57). View largeDownload slide Fig. 5. Analysis of the region of StMBF1 phosphorylation. (A) Schematic representation of wild‐type and truncated StMBF1. (B) In vitro phosphorylation assays were conducted using E. coli‐purified wild type (lane 1) and truncated StMBF1: Δ1–38 (lane 2), StMBF1 Δ118–139 (lane 3) and StMBF1 Δ1–70/Δ118–139 (lane 3). Two µg of each protein were incubated with 10 µg of potato cell extracts in the presence of [γ‐32P] ATP for 5 min at 30 °C. After their separation in 18% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. Asterisks indicate the position of wild‐type and truncated StMBF1 proteins. Similar results were obtained in four independent experiments. View largeDownload slide Fig. 5. Analysis of the region of StMBF1 phosphorylation. (A) Schematic representation of wild‐type and truncated StMBF1. (B) In vitro phosphorylation assays were conducted using E. coli‐purified wild type (lane 1) and truncated StMBF1: Δ1–38 (lane 2), StMBF1 Δ118–139 (lane 3) and StMBF1 Δ1–70/Δ118–139 (lane 3). Two µg of each protein were incubated with 10 µg of potato cell extracts in the presence of [γ‐32P] ATP for 5 min at 30 °C. After their separation in 18% (w/v) SDS‐PAGE, the proteins were analysed by Coomassie Blue staining and autoradiography. Asterisks indicate the position of wild‐type and truncated StMBF1 proteins. Similar results were obtained in four independent experiments. References AyersA, Ebel J, Valent B, Amersheim P. 1976. Host–pathogen interactions. Fractionation and biological activity of an elicitor isolated from the mycelial walls of Phytophthora megasperma var. sojae. Plant Physiology  57, 760–765. Google Scholar BradfordM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Analytical Biochemistry  72, 248–254. Google Scholar BlumwaldE, Aharon G, Lam B. 1998. Early signal transduction pathways in plant–pathogen interactions. Trends in Plant Science  3, 342–346. Google Scholar ChicoJM, Raíces M, Tellez‐Iñón MT, Ulloa RM. 2002. A calcium‐dependent protein kinase is systemically induced upon wounding in tomato plants. Plant Physiology  128, 256–270. Google Scholar CormackRS, Hahlbrock K, Somssich IE. 1998. Isolation of a putative plant transcriptional coactivator using a modified two‐hybrid system incorporating a GFP reporter gene. The Plant Journal  14, 685–692. Google Scholar DesprésC, Subramaniam R, Matton D, Brisson N. 1995. The activation of the potato PR‐10a gene requires phosphorylation of the nuclear factor PBF‐1. The Plant Cell  7, 589–598. Google Scholar DietrichA, Mayers J, Hahlbrock K. 1990. Fungal elicitor triggers rapid, transient and specific protein phosphorylation in parsley cell suspension cultures. Journal of Biological Chemistry  265, 6360–6368. Google Scholar Dröge‐LaserW, Kaiser A, Linsday W, Halkier B, Loake G, Doerner P, Dixon R, Lamb C. 1997. Rapid stimulation of a soybean protein serine kinase which phosphorylates a novel bZIP DNA‐binding protein, G/HBF‐1, during the induction of early transcription‐dependent defences. EMBO Journal  16, 726–738. Google Scholar FelixG, Grosskopf DG, Regenass M, Boller T. 1991. Rapid changes of protein phosphorylation are involved in transduction of elicitor signal in plant cells. Proceedings of the National Academy of Sciences, USA  88, 8831–8834. Google Scholar GuarenteL. 1995. Transcriptional coactivators in yeast and beyond. Trends in Biochemical Science   20, 517–521. Google Scholar GodoyAV, Zanetti ME, San Segundo B, Casalongué C. 2001. Identification of a putative Solanum tuberosum transcriptional coactivator up‐regulated in potato tubers by Fusarium solani f. sp. eumartii infection and wounding. Physiologia Plantarum  112, 217–222. Google Scholar HarlowE, Lane D. 1988. Antibodies. A laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Google Scholar HarmonA, Gribskov M, Harper J. 2000. CDPKs—a kinase for every Ca2+ signal? Trends in Plant Science  5, 154–159. Google Scholar HillCS, Tresiman R. 1995. Transcriptional regulation by extracellular signals: mechanisms and specificity. Cell  80, 199–211. Google Scholar HirtH. 1997. Multiple roles of MAP kinases in plant signal transduction. Trends in Plant Science  2, 11–15. Google Scholar KabeY, Goto M, Shina D, Imai T, Wada T, Morohashi K‐I, Shirakawa M, Hirose S, HandaH. 1999. The role of human MBF1 as a transcriptional coactivator. Journal of Biological Chemistry  274, 34196–34202. Google Scholar KatouS, Senda K, Yoshioka H, Doke N, Kawakita K. 1999. A 51 kDa protein kinase of potato activated with hyphal wall components from Phytophthora infestans. Plant Cell Physiology  40, 825–831. Google Scholar KombrinkE, Somssich IE. 1995. Defence response of plant to pathogen. Advances in Botanical Research  21, 1–34. Google Scholar LaemmliU. 1970. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature  227, 680–685. Google Scholar LaxaltA, Cassia R, Sanllorenti P, Madrid E, Andreu A, Daleo G, Conde R, Lamattina L. 1996. Accumulation of cytosolic glyceraldehyde‐3‐phosphate dehydrogenase RNA under biological stress conditions and elicitor treatments in potato. Plant Molecular Biology  30, 961–972. Google Scholar LiFQ, Ueda H and Hirose S. 1994. Mediators of activation of fushi tarazu gene transcription by BmFTZ‐F1. Molecular and Cellular Biology  14, 3013–3021. Google Scholar LiWG, Komatsu S. 2000. Cold‐induced calcium‐dependent protein kinase(s) in rice (Oryza sativa L.) seedling stem tissue. Theoretical Applied Genetic   101, 355–363. Google Scholar LigterinkW, Kroj T, zur Nieden U, Hirt H, Scheel D. 1997. Receptor‐mediated activation of MAP kinase in pathogen defence in plants. Science  276, 2054–2057. Google Scholar MatsushitaY, Miyakawa O, Deguchi M, Nishiguchi M, Nyunoya H. 2002. Cloning of a tobacco cDNA coding for a putative transcriptional coactivator MBF1 that interacts with the tomato mosaic virus movement protein. Journal of Experimental Botany  53, 1531–1532. Google Scholar MurashigeT, Skoog F. 1962. A revised medium for rapid growth and bioassays with tobacco tissues cultures. Physiologia Plantarum  15, 473–497. Google Scholar MurilloI, Jaeck E, Cordero MJ, San Segundo B. 2001. Transcriptional activation of a maize calcium‐dependent protein kinase gene in respose to fungal elicitors and infection. Plant Molecular Biology  45, 145–158. Google Scholar PatharkarOR, Cushman JC. 2000. A stress‐induced calcium‐dependent protein kinase from Mesembryanthemum crystallinum phosphorylates a two‐component pseudo‐response regulator. The Plant Journal  24, 679–691. Google Scholar PolyaGM, Micucci V. 1985. Interaction of wheat germ Ca2+‐dependent protein kinases with calmodulin antagonists and polyamines. Plant Physiology  79, 968–972. Google Scholar RobertsMR, Harmon AC. 1992. Calcium‐modulated proteins: targets of intracellular calcium signals in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology  43, 375–414. Google Scholar RoederRG. 1991. The complexities of eukaryotic transcription initiation: regulation of preinitiation complex assembly. Trends in Biochemical Science   16, 402–408. Google Scholar RomeisT, Piedras P, Jones JDG. 2000. Resistance gene‐dependent activation of a calcium‐dependent protein kinase in the plant defence response. The Plant Cell  12, 803–815. Google Scholar RuddJJ, Franklin‐Tong VE. 2001. Unravelling response‐specificity in Ca2+ signalling pathways in plant cells. New Phytologist  151, 7–33. Google Scholar RushtonJ, Somssich E. 1998. Transcriptional control of plant genes responsive to pathogens. Current Opinion in Plant Biology  1, 311–315. Google Scholar SchallerEG, Harmon AC, Sussman MR. 1992. Characterization of a calcium and lipid‐dependent protein kinase associated with the plasma membrane of oat. Biochemistry  31, 1721–1727. Google Scholar SchwechheimerC, Bevan M. 1998. The regulation of transcription factor activity in plants. Trends in Plant Science  3, 378–383. Google Scholar SessaG, Martin G. 2000. Protein kinases in the plant defence response. Advances in Botanical Research  32, 379–404. Google Scholar SessaG, Meller Y, Fluhr R. 1995. A GCC element and G‐box motif participate in ethylene induced expression of the PRB‐1b gene. Plant Molecular Biology  28, 145–153. Google Scholar SomssichIE, Hahlbrock K. 1998. Pathogen defence in plants: a paradigm of biological complex. Trends in Plants Science  3, 86–90. Google Scholar SoporyS, Munshi M. 1998. Protein kinases and phosphatases and their role in cellular signalling in plants. Critical Reviews in Plant Sciences  17, 245–318. Google Scholar TakemaruK, Harashima S, Ueda H, Hirose S. 1997. Multiprotein bridging factor 1 (MBF1) is an evolutionarily conserved transcriptional coactivator that connects a regulatory factor and TATA element‐binding protein. Proceedings of the National Academy of Sciences, USA  94, 7251–7256. Google Scholar TakemaruK, Harashima S, Ueda H, Hirose S. 1998. Yeast coactivator MBF1 mediates GCN4‐dependent transcriptional activation. Molecular and Cellular Biology  18, 4971–4976. Google Scholar ViardMP, Martin F, Pugin A, Ricci P, Blein JP. 1994. Protein phsophrylation is induced in tobacco cells by the elicitor criptogein. Plant Physiology  104, 1245–1249. Google Scholar YangY, Shah J, Klessig D. 1997. Signal perception and transduction in plant defence responses. Genes and Development  11, 1621–1639. Google Scholar XingT, Higgins VJ, Blumwald E. 1996. Regulation of plant defence response to fungal pathogen: two types of protein kinases in the reversible phosphorylation of the host plasma membrane H+‐ATPase. The Plant Cell  8, 555–564. Google Scholar ZhangS, Du H, Klessig DF. 1998. Activation of tobacco SIP kinase by both a cell wall‐derived carbohydrate and a purified proteinaceos elicitins from Phytophthora spp. The Plant Cell  10, 435–449. Google Scholar

Journal

Journal of Experimental Botany – Oxford University Press

Published: Feb 1, 2003

There are no references for this article.